| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 274, Issue 27, 18942-18946, July 2, 1999
, andFrom The Rockefeller University, New York, New York 10021
 |
ABSTRACT |
|---|
 TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
|
|---|
Both vancomycin- and teicoplanin-resistant
laboratory mutants of Staphylococcus aureus produce
peptidoglycans of altered composition in which the proportion of highly
cross-linked muropeptide species is drastically reduced with a parallel
increase in the representation of muropeptide monomers and
dimers (Sieradzki, K., and Tomasz, A. (1997) J. Bacteriol. 179, 2557-2566; and Sieradzki, K., and Tomasz, A. (1998) Microb. Drug Resist. 4, 159-168). We now report that the distorted peptidoglycan composition is related to defects in
penicillin-binding protein 4 (PBP4); no PBP4 was detectable by the
fluorographic assay in membrane preparations from the mutants, and
comparison of the sequence of pbp4 amplified from the
mutants indicated disruption of the gene by two types of abnormalities, a 17-amino acid long duplication starting at position 305 of the pbp4 gene was detected in the vancomycin-resistant mutant,
and a stop codon was found to be introduced into the pbp4
KTG motif at position 261 in the mutant selected for teicoplanin
resistance. Additional common patterns of disturbances in the
peptidoglycan metabolism of the mutants are indicated by the increased
sensitivity of mutant cell walls to the M1 muramidase and decreased
sensitivity to lysostaphin, which is a reversal of the susceptibility
pattern of the parental cell walls. Furthermore, the results of high
performance liquid chromatography analysis of lysostaphin digests of
peptidoglycan suggest an increase in the average chain length of the
glycan strands in the peptidoglycan of the glycopeptide-resistant
mutants. The increased molar proportion of muropeptide monomers in the cell wall of the glycopeptide-resistant mutants should provide binding
sites for the "capture" of vancomycin and teicoplanin molecules,
which may be part of the mechanism of glycopeptide resistance in
S. aureus.
Interest in the mode of action of glycopeptide antibiotics was
rekindled by the emergence of glycopeptide resistance among enterococci
(1) and, more recently, by reports on the appearance of clinical
isolates of Staphylococcus aureus with reduced
susceptibility to teicoplanin and vancomycin (2-5). Vancomycin has
been the antibiotic of choice in the therapy of infections by
methicillin-resistant strains of S. aureus, and it has
become the last effective antibiotic left against multidrug-resistant
strains of S. aureus.
In an attempt to obtain some insights into the mechanism of
staphylococcal glycopeptide resistance, we isolated laboratory step
mutants using either vancomycin (6) or teicoplanin (7) as the primary
selective agent. Despite several differences in the properties of
mutants selected by vancomycin as compared with those selected by
teicoplanin, both types of highly glycopeptide-resistant mutants showed
decreased cross-linking of muropeptides and several other properties,
suggesting extensive perturbation of cell wall metabolism. In this
communication we use a combination of biochemical and genetic
techniques to further explore the mechanism that has led to the
striking changes in cell wall structure and metabolism of these mutants.
Bacterial Strains and Growth Conditions--
The parental strain
for both of the independently isolated glycopeptide-resistant mutants
was the methicillin-resistant S. aureus strain COL (8).
Mutant VM was isolated by serial selection with vancomycin (6) and
mutant TNM by selection for bacteria capable of growing on tryptic soy
agar containing increasing concentrations of teicoplanin (final
concentration, 100 µg/ml) (7). A third mutant, TM, was derived from
mutant VM as a spontaneous, single step teicoplanin-resistant
derivative, capable of growing on agar containing 800 µg/ml
teicoplanin (6). The methicillin-susceptible strain RN450 (9) was also
used in some of the experiments. The antibiotic susceptibility profiles
of these strains are shown in Table I.
All strains were grown in tryptic soy broth (Difco, Detroit, MI) at
37 °C with aeration. For each experiment, overnight cultures were
diluted 10,000-fold into prewarmed tryptic soy broth and growth was
followed by monitoring optical density (620 nm, using an LKB
Spectrophotometer, Amersham Pharmacia Biotech, Sweden) and by plating
on tryptic soy agar to determine viable titers of the cultures.
Antibiotic resistance levels were determined by plating diluted
cultures on tryptic soy agar for population analysis, as described
previously (10).
High Performance Liquid Chromatography
(HPLC)1 Analysis of
Peptidoglycan--
Cell wall peptidoglycan was prepared and enzymatic
cell wall hydrolysates were analyzed with reversed-phase HPLC as
described previously (11), except that the alkaline phosphatase step
was omitted. Peptidoglycan prepared from the parental strain and from the three resistant mutants was analyzed after digestion with three
different types of enzymes. In the first type of enzymatic hydrolysis,
digestion by the M1 muramidase was used. In the second type of
digestion, M1 was replaced by lysostaphin, and in the third type of
digestion lysostaphin treatment was followed by a second digestion with
the M1 muramidase.
Susceptibility of Cell Walls to Enzymatic Digestion in
Vitro--
Purified cell walls were suspended in appropriate buffer
(for lysostaphin, 50 mM Tris-Cl, pH 7.5; for muramidase, 25 mM phosphate buffer, pH 5.5) to initial
A620 = 1.0. Lysis was measured as a decrease in
A620 during incubation of the wall samples at
37 °C.
Membrane Purification and Analysis of Penicillin-binding Proteins
(PBPs)--
Membranes were prepared from cells grown to the late
exponential stage in the following way: harvested cells were washed
once in 50 mM Tris, 150 mM NaCl, 5 mM MgCl2 buffer, pH 7.5, resuspended in the
same buffer supplemented with phenylmethylsulfonyl fluoride (0.5 mM) and Sequencing of pbp4--
DNA fragments including the
pbp4 gene and its promoter region (2,076 base pairs) were
amplified by PCR from chromosomal DNAs isolated from the parental
strain COL and its mutants VM, TM and TNM. GeneAmp PCR reagent kit
(Perkin Elmer) was used with 20 pmol of primers ATAAGACCCACTGGCCATGATAG
and CTGGGGACAAAAAGAAGACGATG. The following conditions were used for
amplification: 94 °C for 2 min; 30 cycles of 94 °C for 30 s,
53 °C for 30 s, and 72 °C for 3 min; and one final extension
step of 72 °C for 5 min. The PCR product was purified with Wizard
PCR Preps (Promega), and DNA sequencing was done at the Rockefeller
University Protein/DNA Technology Center with Taq
fluorescent dye terminator sequencing method by using a PE/ABI 377 automated sequencer.
Evidence for Decreased Peptide Cross-linking and Increased Glycan
Chain Lengths in the Peptidoglycan of Glycopeptide-resistant
Mutants--
Fig. 1 shows the HPLC
elution profiles of muropeptide species generated from the
peptidoglycans of the parental strain COL and its vancomycin-resistant
(VM) and teicoplanin-resistant (TNM) derivatives, and a third mutant,
TM, selected from mutant VM as a highly teicoplanin-resistant
derivative (6). The HPLC profiles in panels A show
muropeptide species obtained after treatment of the peptidoglycans with
the M1 muramidase, an enzyme that breaks glycosidic bonds between the
disaccharide units in the peptidoglycan (14). Drastic reduction in the
proportion of highly cross-linked muropeptide oligomers
(i.e. muropeptide species eluting from the HPLC column with
the retention time of muropeptide 17 and with retention times longer)
is apparent in each one of the mutant cell walls (see Fig. 1).
Fig. 2 documents in quantitative
terms the altered cell wall muropeptide composition in the
glycopeptide-resistant mutants.
Panels B in Fig. 1 show HPLC profiles obtained after
hydrolysis of parental and mutant peptidoglycan with lysostaphin, an enzyme that hydrolyzes the oligoglycine cross-bridges in the
peptidoglycan (15, 16). A large increase in the proportion of
muropeptide species eluting with long retention times from the reverse
phase column is apparent in each one of the resistant mutants.
If one assumed that the lysostaphin digestion resulted in a
quantitative breakage of all oligoglycine cross-bridges in the peptidoglycan, then the muropeptide species with the long retention time most likely represented muropeptide monomers attached to glycan
chains of increased length as compared with glycan chains in the
parental peptidoglycan. This interpretation was confirmed by the
results of double digestion shown in panels C of Fig. 1. It
may be seen that a subsequent treatment of the lysostaphin hydrolysates
with the M1 muramidase generated a virtually identical set of
muropeptides from both parental as well as from the mutant peptidoglycans, and these were identified on the basis of their elution
patterns as a group of muropeptide monomers expected to be produced if
the lysostaphin digestion preceding the treatment with M1 was complete
(11). These observations suggest that the radically decreased peptide
cross-linking of the peptidoglycan of the glycopeptide-resistant
mutants was accompanied by increase in the average length of the glycan strands.
Expression of PBP4 in the Resistant Mutant--
Plasma membrane
preparations isolated from the glycopeptide-resistant mutants were
tested with the fluorographic assay using [3H]penicillin
for the presence of staphylococcal penicillin-binding proteins in the
membrane preparations. No PBP4 could be detected in any one of the
three highly resistant bacterial mutants (Fig. 3).
Alterations in the DNA Sequence of the PBP4 Determinant of
Glycopeptide-resistant Mutants--
The pbp4 gene from the
parental strain COL and from mutants VM, TM, and TNM was amplified and
sequenced. The sequence of the pbp4 gene revealed that
mutants VM and TM both carried a 17-amino acid duplication at position
305 of the parental gene. In the third mutant TNM, the alteration in
the pbp4 gene involved introduction of a stop codon into the
KTG motif at position 261 in the sequence (Fig.
4).
Altered Susceptibility of Mutant Cell Walls to Lysostaphin and
Muramidase Degradation in Vitro--
The decreased peptide
cross-linkage and the apparent increase in the average glycan chain
length in the peptidoglycan of the resistant mutants suggested that
these alterations may have also caused an alteration in the relative
susceptibilities of the mutant cell walls to lysostaphin and the M1
muramidase. This was in fact confirmed. Susceptibility of mutant cell
walls to degradation by the M1 muramidase increased, whereas
susceptibility to lysostaphin decreased, as compared with the
properties of the parental cell wall (Fig.
5). Such a shift in sensitivity would be
consistent with the documented decrease in the peptide cross-linking
and with the proposed increase in the average glycan chain length in
the mutants, because the structural integrity of the mutant cell walls
would depend less on the peptide cross-linking network than on the
glycan chains.
The observations described in this study confirm and extend our
findings reported earlier (6, 7). The drastically reduced level of
peptidoglycan cross-linking, both in the vancomycin-resistant and also
in the independently selected teicoplanin-resistant mutants, strongly
suggests that this change in peptidoglycan composition is related,
directly or indirectly, to the mechanism of antibiotic resistance.
Highly cross-linked muropeptides, representing nearly 60% of all
muropeptide species in the parental strain, were reduced to about 30, 15, and 17% in mutants VM, TM, and TNM, respectively. Results
described in this study strongly suggest that these cell wall
alterations are caused by the disruption of pbp4 in the
mutants, resulting in the inactivation or greatly reduced production of PBP4, as evidenced by the negative results of the fluorographic assay.
PBP4 has been shown to have both transpeptidase and
D,D-carboxypeptidase activities (17), and this protein was postulated to act in vivo as a secondary transpeptidase required for
the extensive cross-linking of peptidoglycan (18). A mutant of S. aureus lacking pbp4 (19) was reported to have a
hypo-cross-linked peptidoglycan layer (18), as well as a slight
increase in susceptibility to Results described in this study indicate that a defect in PBP4 is also
associated with the extensive reduction of peptidoglycan cross-linkage
in glycopeptide-resistant S. aureus. That this abnormality may be related to the mechanism of resistance is suggested by disruption of pbp4 by two distinct modes of inactivation:
the insertion of a 51-nucleotide sequence near the active site in the
mutants with the primary selection for vancomycin resistance; and the
introduction of a stop codon at the KTG motif in the mutant selected
for by teicoplanin.
The drastic reduction in peptidoglycan cross-linking in the resistant
mutants was accompanied by an increased representation of monomeric
muropeptides carrying intact carboxyl-terminal
D-alanyl-D-alanine residues (Fig. 2), which are
known to be the recognition sites for glycopeptide antibiotics (22). It
was also demonstrated earlier that during the growth of cultures of the
glycopeptide-resistant staphylococcal mutants, the bacteria can remove
teicoplanin and vancomycin from the medium, and subsequently the
sequestered antibiotic can be recovered in biologically active form
from the cell walls (6, 7). In the resistant staphylococci, the
antibiotic molecules captured by the monomer-rich peptidoglycan may
sterically block the porous channels in the cell wall through which
incoming drug molecules normally reach sites of cell wall
biosynthesis at the plasma membrane (Fig.
6). In this model the diffusion barrier by the captured antibiotic molecules is assumed to become part of
the mechanism of resistance.
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
Antibiotic susceptibility profiles of Staphylococcus aureus strains
used in the study
-mercaptoethanol (10 mM).
Lysostaphin, DNase, and RNase were added to the final concentration of
100, 20, and 10 µg/ml, respectively, and the suspensions were
incubated on ice for 30 min, followed by sonication for 5 min with 2 min intervals on ice-water batch after each 1 min cycle. Partially
lysed/broken cells were harvested by ultracentrifugation at
110,000 × g for 40 min at 4 °C, washed twice in 50 mM phosphate buffer, pH 7.0, and membranes were solubilized
by 2% Triton X-100. Protein concentrations were determined using the
BCA protein assay kit (Pierce) with bovine serum albumin as a standard.
Membranes (80 µg/sample) were labeled with
[3H]benzylpenicillin NEP salt (87.4 mCi/mg) (Merck) for
10 min at 30 °C. The reaction was stopped by addition of an access
of unlabeled benzylpenicillin. Separation of proteins was carried out
by the technique of Laemmli (12) on 8% acrylamide gels at constant current of 
20 mA until the blue dye reached the bottom of the separation gel. PBPs were visualized by fluorography (13).
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
View larger version (26K):
[in a new window]
Fig. 1.
HPLC elution profiles of muropeptides
isolated from the parental strain COL, vancomycin-resistant mutant VM,
vancomycin- and highly teicoplanin-resistant mutant TM, and
teicoplanin-resistant mutant TNM. Peptidoglycan was purified and
digested with muramidase (A), lysostaphin (B),
and lysostaphin followed by muramidase (C). Separation of
muropeptides was performed as described previously (11).
View larger version (17K):
[in a new window]
Fig. 2.
Muropeptide composition of parental strain
COL and its glycopeptide-resistant mutants VM, TM, and TNM.
Percentages are expressed as the fraction of the total area and were
obtained from HPLC profiles shown in Fig. 1. Muropeptide numbers refer
to the peaks in Fig. 1.
View larger version (53K):
[in a new window]
Fig. 3.
PBP patterns of parental strain COL
(lane 1) and glycopeptide-resistant mutants VM (lane
2), TM (lane 3), and TNM (lane 4).
The purified plasma membranes were incubated with
[3H]benzylpenicillin and were subjected to
SDS-polyacrylamide gel electrophoresis and fluorography, as described
under "Experimental Procedures."
View larger version (39K):
[in a new window]
Fig. 4.
Amino acid sequence alignment of an internal
fragment of PBP4 (amino acids 201-400) of the parental strain COL and
glycopeptide-resistant derivatives VM, TM, and TNM. The KTG
conserved motif of transpeptidase domain is shown in a box.
In the TNM mutant, a point mutation converted the codon coding for
Gly-261 into a stop codon while in VM and TM mutants there was a
duplication of 17 amino acids (underlined).
View larger version (22K):
[in a new window]
Fig. 5.
Cell wall hydrolysis in
vitro. Cell walls prepared from penicillin-sensitive
control strain RN450 from parental strain COL and its
glycopeptide-resistant mutants VM, TM, and TNM were degraded by
lysostaphin (panel A) and muramidase (panel B).
Lysis was measured as a decrease in A620
(OD) during incubation of wall samples.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-lactam antibiotics. Other studies
(20, 21) demonstrated that overproduction or modification of PBP4 leads
to increase in peptidoglycan cross-linking and to increased resistance
to methicillin.
View larger version (55K):
[in a new window]
Fig. 6.
Model for the capture of vancomycin molecules
in the cell wall of glycopeptide-resistant staphylococci.
Glycopeptides are assumed to initiate their antibacterial activity by
attachment to the D-alanyl-D-alanine termini of
cell wall precursors emerging at biosynthetic sites on the bacterial
plasma membrane (23-25). Diffusion of drug molecules to the plasma
membrane is presumed to occur nearly unhindered through the cell wall
of susceptible staphylococci. In contrast, the cell walls of resistant
mutants enriched for the muropeptide monomers may slow down and prevent
access to the cell wall synthetic sites by attachment of the antibiotic
molecules to the D-alanyl-D-alanine termini of
peptidoglycan monomers. The captured antibiotic molecules may then
become part of the mechanism of resistance through the steric hindrance
they pose to the penetration of free glycopeptide molecules.
CW, cell wall; CM, ; PG,
peptidoglycan.
Although the correlation between the structural abnormality of peptidoglycan and glycopeptide resistance is striking, genetic and biochemical experiments clearly indicate that this cell wall abnormality alone cannot be fully responsible for the mechanism of resistance (6). For instance, whereas cell walls purified from glycopeptide-resistant mutants have clearly increased (2-4-fold) drug binding capacities over that of the cell walls of the parental strain, this increase in binding capacity is much less than what would be expected for the disproportionately large increase in glycopeptide minimal inhibitory concentration value (6,7). Alterations in the secondary structure of the cell walls and/or changes in other cell surface polymers may also accompany acquisition of glycopeptide resistance (6, 7). Glycopeptide-resistant laboratory mutants carry multistep mutations and show extensive and diverse abnormalities in cell wall metabolism, and the relationship of these to the mechanism of antibiotic resistance remains to be elucidated. One of these unexplained anomalies is the decrease in the methicillin resistance level of mutant VM (6). The mechanism of this observation is not known. However, a similar inverse relationship between the methicillin and vancomycin resistance level was also detected in a set of clinical isolates of methicillin-resistant S. aureus strain with reduced vancomycin susceptibilities (26).
Another abnormality of wall metabolism was detected by in
vitro testing of the susceptibility of mutant cell walls to
degradation by lysostaphin and by the M1 muramidase, as described in
this study. The tests showed that there was a reversal in the relative sensitivities of the cell walls to these enzymes as compared with the
susceptibility of the parental cell walls. Cell walls from the mutants
had an increased sensitivity to the M1 muramidase and a decreased
sensitivity to lysostaphin, suggesting that the structural integrity of
the mutant cell walls has become more dependent on the glycan strands
as compared with the peptide cross-linking. The activity responsible
for such a structural change is unknown. Nevertheless, this observation
is consistent with the results of the experiments illustrated in
panels B and C of Fig. 1, which we interpret as
an apparent increase in the average glycan chain length in the
peptidoglycan of the resistant mutants, perhaps "compensating" for
the decrease in peptide cross-linkage.
| |
FOOTNOTES |
|---|
* Partial support for these investigations was received from the Irene Diamond Fund.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Supported by a grant from PRAXIS XXI/BD/9079/96.
§ To whom correspondence should be addressed: The Rockefeller University, 1230 York Ave., New York, NY 10021. Tel.: 212-327-8278; Fax: 212-327-8688.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: HPLC. high performance liquid chromatography, PBP, penicillin-binding protein; PCR, polymerase chain reaction.
| |
REFERENCES |
|---|
|
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
|
|---|
This article has been cited by other articles:
|
|
 |
|
  D. S. Burgess and R. P. Rapp Bugs versus drugs: Addressing the pharmacist's challenge Am. J. Health Syst. Pharm., May 1, 2008; 65(9_Supplement_2): S4 - S15. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Zhou, A. Antignac, S. W. Wu, and A. Tomasz Penicillin-Binding Proteins and Cell Wall Composition in -Lactam-Sensitive and -Resistant Strains of Staphylococcus sciuri J. Bacteriol., January 15, 2008; 190(2): 508 - 514. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. McCallum, A. K. C. Brassinga, C. D. Sifri, and B. Berger-Bachi Functional Characterization of TcaA: Minimal Requirement for Teicoplanin Susceptibility and Role in Caenorhabditis elegans Virulence Antimicrob. Agents Chemother., November 1, 2007; 51(11): 3836 - 3843. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. M. Pereira, S. R. Filipe, A. Tomasz, and M. G. Pinho Fluorescence Ratio Imaging Microscopy Shows Decreased Access of Vancomycin to Cell Wall Synthetic Sites in Vancomycin-Resistant Staphylococcus aureus Antimicrob. Agents Chemother., October 1, 2007; 51(10): 3627 - 3633. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Meehl, S. Herbert, F. Gotz, and A. Cheung Interaction of the GraRS Two-Component System with the VraFG ABC Transporter To Support Vancomycin-Intermediate Resistance in Staphylococcus aureus Antimicrob. Agents Chemother., August 1, 2007; 51(8): 2679 - 2689. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. D. Stapleton, S. Shah, K. Ehlert, Y. Hara, and P. W. Taylor The beta-lactam-resistance modifier (-)-epicatechin gallate alters the architecture of the cell wall of Staphylococcus aureus Microbiology, July 1, 2007; 153(7): 2093 - 2103. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Valera, A. G. Vigo, S. Alonso, L. Barbolla, M. S. Crespo, and N. Fernandez Peptidoglycan and mannose-based molecular patterns trigger the arachidonic acid cascade in human polymorphonuclear leukocytes J. Leukoc. Biol., April 1, 2007; 81(4): 925 - 933. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. L. Nelson, K. C. Rice, S. R. Slater, P. M. Fox, G. L. Archer, K. W. Bayles, P. D. Fey, B. N. Kreiswirth, and G. A. Somerville Vancomycin-Intermediate Staphylococcus aureus Strains Have Impaired Acetate Catabolism: Implications for Polysaccharide Intercellular Adhesin Synthesis and Autolysis Antimicrob. Agents Chemother., February 1, 2007; 51(2): 616 - 622. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Gardete, H. de Lencastre, and A. Tomasz A link in transcription between the native pbpB and the acquired mecA gene in a strain of Staphylococcus aureus. Microbiology, September 1, 2006; 152(Pt 9): 2549 - 2558. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. McCallum, H. Karauzum, R. Getzmann, M. Bischoff, P. Majcherczyk, B. Berger-Bachi, and R. Landmann In Vivo Survival of Teicoplanin-Resistant Staphylococcus aureus and Fitness Cost of Teicoplanin Resistance. Antimicrob. Agents Chemother., July 1, 2006; 50(7): 2352 - 2360. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Cui, A. Iwamoto, J.-Q. Lian, H.-m. Neoh, T. Maruyama, Y. Horikawa, and K. Hiramatsu Novel Mechanism of Antibiotic Resistance Originating in Vancomycin-Intermediate Staphylococcus aureus Antimicrob. Agents Chemother., February 1, 2006; 50(2): 428 - 438. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Cui, J.-Q. Lian, H.-m. Neoh, E. Reyes, and K. Hiramatsu DNA Microarray-Based Identification of Genes Associated with Glycopeptide Resistance in Staphylococcus aureus Antimicrob. Agents Chemother., August 1, 2005; 49(8): 3404 - 3413. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Wootton, P. M. Bennett, A. P. MacGowan, and T. R. Walsh Strain-Specific Expression Levels of pbp4 Exist in Isolates of Glycopeptide-Intermediate Staphylococcus aureus (GISA) and Heterogeneous GISA Antimicrob. Agents Chemother., August 1, 2005; 49(8): 3598 - 3599. [Full Text] [PDF]
|
|
|
|
|
|
T. A. Leski and A. Tomasz Role of Penicillin-Binding Protein 2 (PBP2) in the Antibiotic Susceptibility and Cell Wall Cross-Linking of Staphylococcus aureus: Evidence for the Cooperative Functioning of PBP2, PBP4, and PBP2A J. Bacteriol., March 1, 2005; 187(5): 1815 - 1824. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Nishi, H. Komatsuzawa, T. Fujiwara, N. McCallum, and M. Sugai Reduced Content of Lysyl-Phosphatidylglycerol in the Cytoplasmic Membrane Affects Susceptibility to Moenomycin, as Well as Vancomycin, Gentamicin, and Antimicrobial Peptides, in Staphylococcus aureus Antimicrob. Agents Chemother., December 1, 2004; 48(12): 4800 - 4807. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. L. Koehl, A. Muthaiyan, R. K. Jayaswal, K. Ehlert, H. Labischinski, and B. J. Wilkinson Cell Wall Composition and Decreased Autolytic Activity and Lysostaphin Susceptibility of Glycopeptide-Intermediate Staphylococcus aureus Antimicrob. Agents Chemother., October 1, 2004; 48(10): 3749 - 3757. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Gardete, A. M. Ludovice, R. G. Sobral, S. R. Filipe, H. de Lencastre, and A. Tomasz Role of murE in the Expression of {beta}-Lactam Antibiotic Resistance in Staphylococcus aureus J. Bacteriol., March 15, 2004; 186(6): 1705 - 1713. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Muthaiyan, R. K. Jayaswal, and B. J. Wilkinson Intact mutS in Laboratory-Derived and Clinical Glycopeptide-Intermediate Staphylococcus aureus Strains Antimicrob. Agents Chemother., February 1, 2004; 48(2): 623 - 625. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Sieradzki and A. Tomasz Alterations of Cell Wall Structure and Metabolism Accompany Reduced Susceptibility to Vancomycin in an Isogenic Series of Clinical Isolates of Staphylococcus aureus J. Bacteriol., December 15, 2003; 185(24): 7103 - 7110. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. M. Weigel, D. B. Clewell, S. R. Gill, N. C. Clark, L. K. McDougal, S. E. Flannagan, J. F. Kolonay, J. Shetty, G. E. Killgore, and F. C. Tenover Genetic Analysis of a High-Level Vancomycin-Resistant Isolate of Staphylococcus aureus Science, November 28, 2003; 302(5650): 1569 - 1571. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Mongodin, J. Finan, M. W. Climo, A. Rosato, S. Gill, and G. L. Archer Microarray Transcription Analysis of Clinical Staphylococcus aureus Isolates Resistant to Vancomycin J. Bacteriol., August 1, 2003; 185(15): 4638 - 4643. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Sieradzki, T. Leski, J. Dick, L. Borio, and A. Tomasz Evolution of a Vancomycin-Intermediate Staphylococcus aureus Strain In Vivo: Multiple Changes in the Antibiotic Resistance Phenotypes of a Single Lineage of Methicillin-Resistant S. aureus under the Impact of Antibiotics Administered for Chemotherapy J. Clin. Microbiol., April 1, 2003; 41(4): 1687 - 1693. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Boyle-Vavra, S. Yin, M. Challapalli, and R. S. Daum Transcriptional Induction of the Penicillin-Binding Protein 2 Gene in Staphylococcus aureus by Cell Wall-Active Antibiotics Oxacillin and Vancomycin Antimicrob. Agents Chemother., March 1, 2003; 47(3): 1028 - 1036. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Reipert, K. Ehlert, T. Kast, and G. Bierbaum Morphological and Genetic Differences in Two Isogenic Staphylococcus aureus Strains with Decreased Susceptibilities to Vancomycin Antimicrob. Agents Chemother., February 1, 2003; 47(2): 568 - 576. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Couto, S. W. Wu, A. Tomasz, and H. de Lencastre Development of Methicillin Resistance in Clinical Isolates of Staphylococcus sciuri by Transcriptional Activation of the mecA Homologue Native to the Species J. Bacteriol., January 15, 2003; 185(2): 645 - 653. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Cui, X. Ma, K. Sato, K. Okuma, F. C. Tenover, E. M. Mamizuka, C. G. Gemmell, M.-N. Kim, M.-C. Ploy, N. El Solh, et al. Cell Wall Thickening Is a Common Feature of Vancomycin Resistance in Staphylococcus aureus J. Clin. Microbiol., January 1, 2003; 41(1): 5 - 14. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Schaaff, A. Reipert, and G. Bierbaum An Elevated Mutation Frequency Favors Development of Vancomycin Resistance in Staphylococcus aureus Antimicrob. Agents Chemother., November 1, 2002; 46(11): 3540 - 3548. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. M. MacKenzie, P. Greig, D. Morrison, G. Edwards, and I. M. Gould Identification and characterization of teicoplanin-intermediate Staphylococcus aureus blood culture isolates in NE Scotland J. Antimicrob. Chemother., November 1, 2002; 50(5): 689 - 697. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Srinivasan, J. D. Dick, and T. M. Perl Vancomycin Resistance in Staphylococci Clin. Microbiol. Rev., July 1, 2002; 15(3): 430 - 438. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Komatsuzawa, K. Ohta, S. Yamada, K. Ehlert, H. Labischinski, J. Kajimura, T. Fujiwara, and M. Sugai Increased Glycan Chain Length Distribution and Decreased Susceptibility to Moenomycin in a Vancomycin-Resistant Staphylococcus aureus Mutant Antimicrob. Agents Chemother., January 1, 2002; 46(1): 75 - 81. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. E. Finan, G. L. Archer, M. J. Pucci, and M. W. Climo Role of Penicillin-Binding Protein 4 in Expression of Vancomycin Resistance among Clinical Isolates of Oxacillin-Resistant Staphylococcus aureus Antimicrob. Agents Chemother., November 1, 2001; 45(11): 3070 - 3075. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
|
