|
J Biol Chem, Vol. 274, Issue 27, 18957-18964, July 2, 1999
CD44, a Cell Surface Chondroitin Sulfate Proteoglycan,
Mediates Binding of Interferon- and Some of Its Biological
Effects on Human Vascular Smooth Muscle Cells*
Eva
Hurt-Camejo ,
Birgitta
Rosengren,
Peter
Sartipy,
Karin
Elfsberg,
Germán
Camejo§, and
Lennart
Svensson§
From the Wallenberg Laboratory for Cardiovascular Research,
Göteborg University, Göteborg 413 45, Sweden and
§ Astra Hässle, Mölndal S-431 83, Sweden
 |
ABSTRACT |
Several cytokines and growth factors act on cells
after their association with the glycosaminoglycan (GAG) moiety of cell surface proteoglycans (PGs). Interferon- (IFN- ) binds to GAG; however, the relevance of this interaction for the biological activity
of IFN- on human cells remains to be established. Human arterial
smooth muscle cells (HASMC), the main cells synthesizing PG in the
vascular wall, respond markedly to IFN- . We found that treatment of
HASMC with chondroitinase ABC, an enzyme that degrades chondroitin
sulfate GAG, reduced IFN- binding by more than 50%. This treatment
increased the affinity of 125I-IFN- for cells from
a Kd value of about 93 nM to a Kd value of about 33 nM. However, the
total binding was reduced from 9.3 ± 0.77 pmol/µg to 3.0 ± 0.23 pmol/mg (n = 4). Interestingly, pretreatment
with chondroitinase ABC reduced significantly the cellular response
toward IFN- . The interaction of IFN- with chondroitin sulfate GAG
was confirmed by affinity chromatography of isolated cell-associated
35S-, 3H-labeled PG on a column with
immobilized IFN- . The cell-associated PG that binds to IFN- was a
chondroitin sulfate PG (CSPG). This CSPG had a core protein of
approximately 110 kDa that was recognized by anti-CD44 antibodies on
Western blots. High molecular weight complexes between IFN- and
chondroitin 6-sulfate were observed in gel exclusion chromatography.
Additions of chondroitin 6-sulfate to cultured HASMC antagonized the
antiproliferative effect and expression of major histocompatibility
complex II antigens induced by IFN- . These results indicate that
IFN- binds with low affinity to the chondroitin sulfate GAG moiety
of the cell surface CSPG receptor CD44. This interaction may increase
the local concentration of IFN- at the cell surface, thus
facilitating its binding to high affinity receptors and modulating the
ability of IFN- to signal a cellular response.
 |
INTRODUCTION |
IFN- 1 is a
glycoprotein produced by activated T-lymphocytes and is released during
the immune response and in inflammatory conditions (1, 2). IFN-
elicits antiviral, antiproliferative, and immunomodulatory activities
in different cells (3-5). IFN- causes its pleiotropic effects
partially through interaction with a specific plasma membrane receptor
(6, 7). In addition, the biologically active IFN- -receptor complex
requires the species-matched interaction of the complex with at least
one additional accessory factor that conveys different cellular
responses (8, 9). However, the structural basis of these interactions
is not completely understood.
Proteoglycans (PGs) are ubiquitous components of cell membranes. They
consist of a core protein to which one or more glycosaminoglycan (GAG)
chains are covalently attached. GAGs are linear, sulfate-substituted carbohydrates. The main GAG types in PG are as follows: chondroitin sulfate, dermatan sulfate, heparan sulfate, keratan sulfate, and heparin. This last one is restricted to mast cell granules (10-12). Because of the high sulfate and carboxyl group content in their GAG
moieties, PGs are the most negatively charged polymers in living
tissues. This property allows them to interact with proteins with
clusters of positively charged amino acids (13, 14). Thus, apart from
being structural elements for extracellular matrix and basement
membrane assembly, PGs/GAGs also serve as cell surface receptors for a
wide range of proteins, including growth factors, enzymes, cytokines,
chemokines, lipoproteins, and viruses (11, 12, 15-22).
Human recombinant IFN- is a 146-amino acid polypeptide where three
positive charged clusters of basic amino acids are localized in the
carboxyl terminus: 1) SNKKKRDDF, residues
87-96, total charge +2; 2)
AKTGKRKRS, residues 127-135, total
charge +5; and 3) LFRGRRAS, residues
138-145, total charge +3. These sequences do not correspond completely to the consensus GAG binding sequences reported for other proteins (13). However, experimental data indicate that these regions may
provide IFN- with the capacity to interact with negative charged GAG
(18, 23). Crystallographic analysis of human IFN- indicates that
these sequences of basic amino acids are exposed on the surface of the
protein (24, 25). Furthermore, these sequences are similar to the
nuclear localization signal, a consensus of basic amino acids required
for efficient transport of proteins, including IFN- , from the
cytosol to the nucleus (26). Our previous experiments with synthetic
peptides suggested that the cluster of basic amino acid residues
127-135 (AKTGKRKRS) of human
IFN- is involved in the binding with chondroitin-sulfate PGs
from the extracellular matrix of human arterial smooth muscle cells
(HASMC) (18). In addition, results have shown that IFN- immobilized
in CSPG generates a higher response than soluble IFN- from HASMC in
culture. Sadir et al. (27) recently showed that this basic
cluster of amino acids was involved both in heparin and
IFN- -receptor recognition. Furthermore, results from studies with
site-directed mutagenesis and controlled proteolysis suggest that part
of this region (residues 131-135, KRKRS) is critical for
receptor binding and biological activity (28-31). Together, these
results indicate that the basic clusters in IFN- carboxyl-terminal structure are important for the biological activity of IFN- .
Arterial smooth muscle cells in culture respond markedly to IFN- by
expressing class II MHC such as HLA-DR (32). These genes are
up-regulated by smooth muscle cells in experimentally injured arteries
and human atherosclerotic plaques, probably induced by secretion of
IFN- by a subset of T-cells present in the arterial wall (33).
IFN- is present in human atherosclerotic plaque (34). This cytokine
is also a potent inhibitor of both cell proliferation and collagen
synthesis in HASMC (35, 36). Based on these in vitro
effects, Libby et al. (37) suggested that chronic activation
of these cells by IFN- might contribute to mechanic instability of
atherosclerotic plaques. Such a hypothesis is supported by results from
double knockout mice lacking the IFN- receptor and apoE that develop
much less atherosclerosis than the apoE single knockout mice do (38).
Taken together, these results imply that IFN- signaling may promote
atherogenesis and plaque disruption. Therefore, inhibition of IFN-
signaling in arterial cells may be a possible therapy against acute
coronary syndromes. This hypothesis, however, requires more knowledge
about mechanisms involved in signaling the presence of IFN- in human cells. The interaction between IFN- and GAG has been reported previously (18, 39). However, characterization of the interaction and
its relevance for the biological activity of IFN- on human cells is
not completely understood. In the present study, we explored whether
cell surface GAG in HASMC may have a function in binding IFN- and if
this interaction may modulate the ability of IFN- to induce a
biological response.
 |
EXPERIMENTAL PROCEDURES |
Materials--
Hepes, Triton X-100, N-ethylmaleimide,
-amino caproic acid, benzamidine HCl, phenylmethylsulfonyl fluoride,
heparan sulfate (7,500 kDa), cetylpyridinium bromide, and
ethylaminohexanoic acid were purchased from Sigma. Chondroitin
6-sulfate (C6S) (40-80 kDa), protease-free chondroitinase ABC (EC
4.2.2.4), and heparitinase I (EC 4.2.2.8) were purchased from Seikagaku
Kogyo Co. (Tokyo, Japan). Molecular weight standards for exclusion
chromatography, cyanogen bromide-activated Sepharose, Hi-Trap Q, and
Superose 6 PC 3.2/3.0 columns were bought from Amersham Pharmacia
Biotech. Collagen-I was purchased from Collaborative Biomedical
Products, Becton Dickinson, Labware (Bedford, MA). Cell culture media,
antibiotics, nonessential amino acids, fetal calf serum (FCS),
Dulbecco's phosphate-buffered saline (DPBS) with and without calcium
and magnesium, and culture vessels were purchased from Life
Technologies, Inc. Cell culture-tested BSA and trypsin-EDTA were
purchased from Sigma. Na2[35S]SO4
(25-40 Ci/mg), L-[4,5-3H]leucine (120-190
mCi/mmol), unlabeled recombinant human IFN- (10 units/ng),
recombinant human 125I-IFN- (1000 Ci/mmol,
Mr 17,000; 10 units/ng), and hyperfilms for
autoradiography were from Amersham Pharmacia Biotech. Liquid scintillation mixture, Ready Safe, for aqueous samples was from Beckman
Instruments Inc. Monoclonal mouse anti-human HLA-DR, CR3/43, negative
control mouse IgG1, biotinylated rabbit anti-mouse immunoglobulins, normal rabbit serum, and ABComplex/AP for determination of HLA-DR expression in human cells were purchased from Dako (Dakopatts AB,
Sweden). Mitochondrial activity kit (XTT) and BrdU ELISA kit for
nonradioactive quantification of cell activation and proliferation, respectively, were purchased from Roche Molecular Biochemicals (Bromma,
Sweden). Salts, buffer substances, and detergents used in this work
were of analytical grade and were purchased from Merck (Darmstadt,
Germany) and Bio-Rad.
Cell Culture--
Primary cultures of HASMC from inner media of
human uterine arteries were established using a previously described
explantation technique (40). The cells were harvested by trypsinization
and cultured at a cell density of 5 × 103
cells/cm2 in 6-, 12-, 24-, and 96-well plates for binding
experiments and biological assays of IFN- activity and in
80-cm2 bottles for the isolation of PGs synthesized by the
cells. HASMC were cultured in bottles coated with a film of collagen-I
(41). The cells were allowed to proliferate in Waymouth's medium plus 10% (v/v) FCS, 100 units/ml penicillin, 100 µg/ml streptomycin, 1 mmol/liter sodium pyruvate, 4 mmol/liter glutamine, and nonessential amino acids (growing medium). After 2 days, the medium was removed, and
cells were washed three times with DPBS and then cultured in
Waymouth's medium containing the supplements indicated above but only
0.5% FCS (sera-poor medium) in order to synchronize the cells by
stopping proliferation. After 3 days, the medium was removed, and cells
were washed 3 times with DPBS and cultured in growing medium for 3-4
days until the cells were confluent. The experiments were carried out
with cells between passages 3 and 12. HASMC were tested for mycoplasma
contamination during each passage by using a mycoplasma test kit from
Gen-Probe Inc. Endotoxin levels were regularly tested in cell culture
media and cell culture reagents with Coatest/endotoxin (Chromogenix
AB). Levels detected were 0.01 enzyme units/ml.
Binding Assay--
The ability of 125I-IFN- to
bind to HASMC was measured in binding assays carried out in 12-, 24-, or 96-well plates. The plates were washed three times with ice-cold
DPBS, 0.2% BSA and incubated for 10 min at 4 °C with ice-cold
bicarbonate-free Waymouth's medium, 0.2% BSA. The cells were
incubated with 125I-IFN- (100-1000 cpm/pg) at
concentrations indicated in the figures at 4 °C for 4 h. The
plates were then placed over ice and washed three times with ice-cold
Waymouth's medium, 0.2% BSA and three times with ice-cold DPBS. The
cells were then washed three times with DPBS and then two times with 2 mol/liter NaCl in 20 mmol/liter Hepes (pH 7.4) to induce a maximal
release of 125I-IFN- bound to GAGs (42). These washes
were collected. The cells were next dissolved with 2 × 0.2 mol/liter NaOH, and their protein was measured. The radioactivity
measured in the 2 mol/liter NaCl, pH 7.4, wash represented the fraction
of 125I-IFN- bound extracellularly to sulfated GAGs
through ionic interactions. The radioactivity measured in cells
dissolved with 0.2 mol/liter NaOH represented the fraction of
125I-IFN- bound through nonionic interactions to cell
membrane, probably to the receptor and 125I-IFN-
internalized by the cells. The amount of radioactivity was counted in a
Compugamma counter (LKB, Wallac, Sweden), and aliquots were used for
protein determination (43). The data from binding experiments were
analyzed to determine maximum binding (Bmax) and
apparent dissociation constant (Kd) by nonlinear regression analysis (44) using the program GraphPad PRISM Software, Inc. (San Diego, CA).
Digestion of Cell Surface Glycosaminoglycans with Chondroitinase
ABC/Heparitinase I--
HASMC were treated with chondroitinase ABC
(chABC) and heparitinase I (Hep I) in order to digest cell surface
chondroitin sulfate and heparan sulfate, respectively. Cell media were
removed, and the HASMC were washed three times with DPBS, 0.2% BSA and incubated for 2 h at 37 °C with or without 0.01 unit/ml of the enzymes in DPBS, 0.2% BSA. Cell viability in the DPBS and
glycosidase-treated cells was greater than 90%, as judged by trypan
blue exclusion and cell morphology. Dishes without cells were run in
parallel as control. After incubation, the cells were washed three
times with DPBS, 0.2% BSA. The cells were then incubated with
125I-labeled IFN- to perform binding experiments or with
unlabeled IFN- to study cellular response toward IFN- as
described below. In order to keep cells depleted from pericellular
GAGs, the incubation with IFN- were done in the presence of chABC
and/or Hep I (0.01 U/ml). Control cells were treated and incubated in
similar conditions but without enzyme(s).
Isolation of Cell-associated Proteoglycans--
HASMC (5,000 cells/cm2) were cultured as described above in Waymouth's
medium plus 10% (v/v) FCS (complete medium) for 2 days. After this
period, the medium was changed to sera-poor formulation. After 2 days,
medium was removed, and the cells were washed three times with DPBS and
then cultured in diploid medium (sulfate-free) supplemented with 10%
FCS, penicillin/streptomycin, sodium pyruvate, glutamine, and
nonessential amino acids (diploid medium A). After 1 day, the medium
was removed, and fresh diploid medium A was added plus 33 µCi/ml
[35S]sulfate (40-50 µCi/mol) and 17 µCi/ml
[3H]leucine (120 mCi/mmol). The cells remained in this
medium for 3 days. After this period, the cell culture medium was
harvested. The cells were washed three times with DPBS and then
incubated for 30 min at room temperature with sera-free culture medium
containing 50 µg/ml heparin. This step was included in order to
remove peripheral, extrinsically associated PG (45). Heparin-containing
medium was discarded, and the cells were washed three times with DPBS. Cell-associated proteoglycans were isolated by incubating HASMC with 15 ml of extraction buffer for 30 min with gentle shaking. The extraction
buffer contained 0.15 mol/liter NaCl, 5 mmol/liter MgCl2, 2 mmol/liter EDTA, 0.255 mmol/liter dithiothreitol, 1 mmol/liter phenylmethylsulfonyl fluoride, 1% Triton X-100, 5 mmol/liter
-aminocaproic acid, 5 mmol/liter N-ethylmaleimide, 5 mmol/liter benzamidine HCl, 10 mmol/liter Tris-HCl, pH 7.2. The cell
extracts were then dialyzed against ion exchange chromatography buffer
(8 mol/liter urea, 2 mmol/liter EDTA, 0.5% Triton X-100, and 20 mmol/liter Tris-HCl, pH 7.5, containing protease inhibitors) for 2 days
with two changes per day (Mr 3500 cut-off).
After dialysis, the samples were passed through Hi-trap Q ion exchange
columns equilibrated in binding buffer. After the samples were loaded,
the columns were washed with binding buffer containing 0.25 mol/liter
NaCl to remove glycoproteins. The bound material was finally eluted with a gradient from 0.25 mol/liter to 3 mol/liter NaCl in binding buffer, and the radioactivity in each collected fraction was measured. The fractions rich in 35S-labeled PGs eluted around 1.5 mol/liter NaCl. These PG-containing fractions were pooled, dialyzed
against water, and lyophilized. These samples were used for IFN-
affinity chromatography as described below. GAG composition was
analyzed by agarose gel electrophoresis (46). The 35S-,
3H-labeled PG samples were analyzed by SDS-PAGE in a
4-12% linear gradient gel. The positions of the radioactive bands
were visualized by autoradiography of dried gels.
14C-methylated protein molecular weight standards (Amersham
Pharmacia Biotech) were used to estimate the average sizes of
35S-, 3H-labeled cell PGs.
Affinity Chromatography on Sepharose-IFN- Column--
A
Sepharose-IFN- column (5 × 1-cm diameter) was prepared from
IFN- bound to cyanogen bromide-activated Sepharose according to the
manufacturer's procedure. The column was equilibrated in binding
buffer: 5 mmol/liter Hepes, pH 7.4, 20 mmol/liter NaCl, 5 mmol/liter
CaCl2, and 2 mmol/liter MgCl2. A similar column
containing no IFN- and blocked with ethanolamine served as a control
column for unspecific binding. The cell extract containing the
[35S]sulfate- and [3H]leucine-labeled PGs
synthesized by HASMC were equilibrated in binding buffer and passed,
half through the IFN- column and half through the control column.
The columns were washed with 25 ml of the same buffer. Bound material
was eluted with a gradient from 20 mmol/liter to 500 mmol/liter NaCl,
and fractions of 1 ml were collected. The peaks containing the cell PGs
retained by the immobilized IFN- were dialyzed and lyophilized.
Thereafter, the samples were dissolved in 1.5 ml of 20 mmol/liter Tris,
pH 7.5, and divided in three aliquots. One aliquot was treated with chondroitinase ABC (20 units/ml), the second aliquot with heparitinase I (20 units/ml), and the third without enzyme (control). The samples were incubated overnight at 37 °C. The reaction was stopped by rapidly freezing the samples at 20 °C. The aliquots were
equilibrated in binding buffer and passed again through the IFN-
affinity column as described above.
Western Blot Analysis of Cell-associated
Proteoglycans--
Total and cell-associated proteoglycans with
affinity for IFN- were isolated as described above. These
preparations of cell-associated proteoglycans were incubated with or
without 0.10 units/ml chondroitinase ABC overnight at 37 °C. The
samples were mixed with electrophoresis sample buffer and run in a 10%
SDS-PAGE under nonreducing conditions (47). Gel transfer and blotting
was performed as described by Hurt-Camejo et al. (48). Blots
were incubated (1.5 h at room temperature) with monoclonal anti-CD44
(MA-4410, Endogen) diluted 1:1000 or with rabbit antibody LF-51
anti-biglycan (from Dr. Larry Fisher) (49) diluted 1:5000 with PBS-T
(PBS with 0.1% Tween 20 and 5% dry milk). After three washes with
PBS-T (5 min each, room temperature), the blots were incubated
overnight at 4 °C with goat anti-mouse peroxidase-conjugated
antibody (P0447, DAKO) or with swine anti-rabbit peroxidase-conjugated
antibody (P0217, DAKO). These secondary antibodies were diluted
1:25,000 with PBS-T. After washing three times with PBS-T, the blots
were developed with the ECL Plus Western blot detection system from
Amersham Pharmacia Biotech.
RT-PCR--
Total cellular RNA was isolated from HASMC in
culture and from human arterial tissue using the RNeasy Mini Kit from
Qiagen. RT-PCR with 0.1 or 0.5 µg of total RNA was performed with the GeneAmp single reaction tube RNA-PCR kit (Perkin-Elmer). The
oligonucleotides used as PCR primers were CD44E3-FP
(GGGGTGTACATCCTCACATC) and CD44E16-RP (ACTCCAACCTTCTTGACTCC) (50).
These primers represent common exons shared by all C44D isoforms. The
RT-PCR program was as follows: 70 °C for 15 min (reverse
transcription) and 95 °C for 5 min; 35 cycles carried out at
95 °C at 30 s, 60 °C at 1 min; and a final step of 60 °C
for 7 min. RT-PCR products were run in a 0.2% agarose gel and stained
with ethidium bromide.
Evaluation of IFN- /Chondroitin Sulfate Interaction by
Analytical Gel Exclusion Chromatography--
To study the formation of
complexes between chondroitin sulfate and IFN- , we evaluated the
elution behavior of the IFN- in a Superose 6 PC, 3.2/3.0 column in
the presence and absence of chondroitin 6-sulfate GAG in the elution
buffer. The column was operated with an automated SMART system
(Amersham Pharmacia Biotech). Flow was 0.032 ml/min. In control
experiments, the column was equilibrated in PBS, and 20 µl of the
IFN- (17,000 kDa) at 5 µmol/liter, dissolved in the same buffer,
was injected. In other runs, the column and the solution of IFN-
were equilibrated in PBS containing 1 mg/ml C6S (40-80 kDa). The
absorbance of the fractions eluted was followed at 254 nm. The same
column was calibrated with standard proteins indicated in the legend to
Fig. 8.
Competition with Soluble Glycosaminoglycans: Effect on HLA-DR
Antigen Expression and Cell Proliferation--
HASMC were cultured in
96-well plates as described above. Cells were incubated with IFN-
(0, 10, and 1,000 ng/ml) with or without C6S (11 and 110 µg/ml).
After 3-day incubations, the cellular response toward IFN- was
studied by measuring cell surface expression of major
histocompatibility complex II or HLA-DR, cell proliferation by
bromodeoxyuridine incorporation, and mitochondrial dehydrogenase function in cells. HLA-DR expression was measured by an enzyme-linked immunoassay with monoclonal antibody HLA-DR, CR3/43, and mouse IgG1-negative control antibody as described (18). Briefly, the optimal
dilution of the antibodies and ABComplex were determined previously by
checkerboard titration. The absorbance values obtained with the
negative control antibody were subtracted from the absorbance values
obtained with the antibody against HLA-DR. Effects of IFN- on cell
proliferation and mitochondrial activity were measured with BrdU ELISA
and XTT colorimetric kits according to the manufacturer's procedure.
 |
RESULTS |
125I-IFN- Binding to Cell Membrane-associated
Glycosaminoglycans--
The possibility that cell membrane-associated
GAGs in HASMC contributes to the binding of IFN- was addressed by
removal of pericellular GAGs with degradative enzymes that cleave GAGs.
Fig. 1 shows that treatment of HASMC with
chABC reduced drastically the binding of 125I-IFN- .
Treatment with Hep I, an enzyme that hydrolyzes heparan GAG, did not
affect the binding of 125I-IFN- . Fig.
2A shows the binding isotherms
for the fraction of 125I-IFN- that can be dissociated by
raising the concentration of NaCl to 2 mol/liter. It appears that in
HASMC treated with chABC/Hep I the binding isotherm of
125I-IFN- reached saturation at lower concentrations
than in the untreated cells (control). The binding data fitted best a
two-site binding model. This analysis showed that, as a consequence of pericellular GAG removal, the apparent dissociation constant
(Kd) for the binding was decreased from 93 ± 11 nM to 32 ± 5.5 nM (n = 4), and the maximum binding (Bmax) was reduced
from 9.30 ± 0.77 to 3.0 ± 0.23 pmol/µg cell protein
(n = 4). Fig. 2B shows that digestion with
chABC plus Hep I affected much less the amount of
125I-IFN- that remained cell- associated after treatment
with 2 mol/liter NaCl and that was dissolved in 0.2 mol/liter NaOH.
This fraction contains 125I-IFN- bound to cells through
nonionic interaction. This fraction may also contain some
125I-IFN- internalized by the cells despite performing
the binding experiments at 4 °C.

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 1.
Binding of
125I-IFN- in chondroitinase-
and heparitinase I-treated and untreated HASMC. Confluent
HASMC cultured in 24-well plates were treated 2 h with chABC (0.01 unit/ml) or Hep I (0.01 unit/ml) in DPBS containing 0.2% BSA. Control
cells without enzymes were incubated in parallel. The cells were then
incubated with 125I-IFN- (2 ng/ml) in Waymouth's cell
medium containing 10% fetal bovine serum. After a 2-h incubation,
cell-associated radioactivity content and protein were measured. The
values are the average and S.D. of four determinations.
|
|

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 2.
Binding of
125I-IFN- in chondroitinase- and
heparitinase I-treated ( ) and untreated ( ) HASMC. Confluent
HASMC cultured in 96-well plates were treated 2 h with chABC (0.01 unit/ml) plus Hep I (0.01 unit/ml) in DPBS containing 0.2% BSA.
Control cells, without enzyme, were incubated in parallel. Cells were
incubated at 4 °C with increasing concentrations of
125I-IFN- in Waymouth's cell medium containing 10%
fetal bovine serum. 125I-IFN- bound to the cells was
released by washing the cells twice with 2 mol/liter NaCl in 20 mmol/liter Hepes, pH 7.4. The radioactivity measured represents the
IFN- bound to cell surface GAGs (A) through ionic
interaction. Cells were then dissolved with 0.2 mol/liter NaOH, and the
radioactivity and protein content were measured. The radioactivity
measured in this last fraction represents extracellular
125I-IFN- bound with high affinity and intracellular
125I-IFN- . The values are the average and S.D. of four
determinations.
|
|
Effect of Cell Surface Glycosaminoglycan Removal on the Cellular
Response toward IFN- --
The results described above indicate that
IFN- binds to cell surface-associated CSPG and that the interaction
contributes to the total binding of IFN- to HASMC. We then explored
if the removal of CSPG could affect the cellular response toward
IFN- . One of the anti-cellular effects ascribed to IFN- is its
ability to inhibit cell proliferation (1). Recombinant IFN- has been reported to inhibit human smooth muscle cell proliferation in vitro in a dose-response manner (35). Therefore, we studied if the
removal of cell surface-associated CSPG could affect the antiproliferative effect of IFN- on HASMC in culture. The
experiments were performed with HASMC preincubated with protease-free
chABC or without enzyme (control cells), as described under
"Experimental Procedures." HASMC control cells and chABC-treated
ones were incubated with IFN- , as indicated in the legend to Fig.
3. HASMC proliferation was measured using
a XTT colorimetric assay for cell proliferation (51). The results,
illustrated in Fig. 3, show that removal of cell surface CS-GAG by
treatment with chABC decreased significantly the antiproliferative
effect of IFN- on HASMC when compared with control cells. These
results indicate that interaction of IFN- with cell surface CSPG
enhances the cellular effect of IFN- on HASMC.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 3.
Contribution of cells surface GAG on the
cellular response toward IFN- . HASMC were
treated with chABC ( ; 0.01 unit/ml) to remove cell surface CS-GAGs.
The cells were incubated for 3 days at 37 °C with IFN- at the
concentrations indicated and in the presence of chABC. Control cells
( ) were treated and incubated under the same conditions but without
chABC. The cellular response toward IFN- in control and treated
cells was compared by measuring the expression of MHC class II antigen
HLA-DR divided by the level of mitochondrial activity (XTT)
measured in cells run in parallel. The bars represent the
mean ± S.D. of eight determinations. ***, p 0.0003; ***, p 0.0016 (n = 8).
|
|
IFN- Affinity Chromatography of Cell-associated
Proteoglycans--
To further characterize the interaction of IFN-
with cell surface PG from HASMC, we used affinity chromatography of
metabolically labeled cell-associated PG on immobilized IFN- . Fig.
4A shows that only one peak of
biolabeled material was obtained. This peak, as expected for PGs,
contained more 35S- than 3H-labeled leucine.
The PG peak retained by IFN- eluted at 150 mmol/liter of NaCl. This
indicates that the interaction of IFN- with GAGs takes place at
physiological ionic strength. In the IFN- column, 80% of the
radioactive PG-rich fraction was bound, whereas only 3% of the
radioactivity was retained in a similar control column. Fractions 5-13
from the NaCl gradient containing the cell-associated PG that was bound
to IFN- were pooled, dialyzed, and lyophilized. This IFN- -bound
PG preparation was divided into three equal parts. One part was treated
with chABC, and another was treated with Hep I; the third was a control
without enzyme, as described under "Experimental Procedures." The
samples were passed again through the Sepharose IFN- affinity
column. It can be observed in Fig. 4B that pretreatment with
chABC, which hydrolyzes chondroitin sulfate GAG, abolished completely
the binding of cell-associated 35S-, 3H-labeled
PGs to the immobilized IFN- . Hep I had no effect in the binding of
cell-associated 35S-, 3H-labeled PGs to
IFN- . These results show that IFN- binds to cell-associated CSPGs
synthesized by HASMC.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 4.
IFN- affinity
chromatography of 35S-sulfate and
[3H]leucine-labeled cell-associated PGs synthesized by
HASMC. A, cell-associated PGs were loaded and eluted
from a column (5 × 1 cm) to which IFN- was covalently attached
to Sepharose and from a control column for unspecific binding.
IFN- -bound PGs were eluted by a linear gradient between 20 and 500 mM NaCl (dotted line). B,
35S-, 3H-labeled PGs eluted from the IFN-
column were pooled, equilibrated in buffer, and divided in three equal
parts that were treated with 1) chABC ( ); 2) Hep I ( ), and 3)
control sample without enzyme ( ). The samples were passed through
the Sepharose-IFN- column and eluted as in (A)
(dotted line). Only [35S]sulfate
counts are shown.
|
|
Characterization of Total and IFN- -bound Cell-associated
Proteoglycans--
SDS-PAGE analysis of cell-associated
35S-, 3H-labeled PGs was used to further
characterize the cell-associated PG expressed by HASMC and to
immunologically probe the chondroitin sulfate PG that binds to IFN- .
Fig. 5 shows the results obtained. The
gels showed three bands of PG with different relative molecular mass: one class size that remains on the top of the separating gel (Fig. 5,
band I, 400 kDa), a second class around 200 kDa (band II), and a
third class of low molecular mass, between ~100 and 46 kDa (band
III). Digestion with chABC and Hep I of the IFN- -bound 35S-, 3H-labeled PGs, prior to SDS-PAGE
analysis, indicated that the macromolecules of band II and III are
chondroitin/dermatan-containing PGs, while those of band I represent
heparan sulfate containing PGs, probably perlecan, since these cells
express this PG (52). Versican (CSPG, 400 kDa) was not detected in
these preparations. These analyses support the results obtained with
affinity chromatography and confirmed that cell-associated PGs contain
mainly CS-GAG with minor amounts of heparan sulfate-GAG.

View larger version (61K):
[in this window]
[in a new window]
|
Fig. 5.
SDS-PAGE analysis of cell-associated
35S-, 3H-labeled PGs. Total
cell-associated 35S-, 3H-labeled PGs before
(control, Ctrl) and after chABC or heparitinase I (HS
I) digestions were run on an SDS-PAGE 4-12% gradient gel under
reducing conditions. The radioactive bands were detected by
autoradiography. I-III indicate the different size classes
of 35S-, 3H-labeled PGs. Molecular mass
standards are shown at the left.
|
|
In an effort to identify the PG that binds to IFN- , we performed
Western blot analysis. Fig. 6 shows
representative Western blots of total preparation of cell-associated PG
(Fig. 6A) and the cell-associated PG eluted from an IFN-
affinity column (Fig. 6B). These membranes were probed with
a monoclonal antibody against CD44 and a polyclonal antibody against
biglycan. Western blot analysis of the total preparation of
cell-associated PG indicated the presence of biglycan and CD44 (Fig.
6A, lanes 1 and 2,
respectively). These were chondroitin sulfate PGs. Western blot
analysis of the cell-associated PG that binds IFN- showed a positive
reaction with antibody against cells surface receptor CD44 (Fig.
6B, lane 1 (control) and
lane 2 (chABC-treated)). However, no
immunoreactivity was observed with anti-biglycan (Fig. 6B,
lane 3) or anti-decorin antibodies (data not
shown). Treatment with chABC increased the reaction with the antibodies
and shifted downward the molecular mass of PGs, from ~250 to 42 kDa
for biglycan and from 150 to 110 kDa for CD44 approximately (Fig.
6B, lane 1 (control) and lane 2 (chABC-treated)). These changes in
molecular weight before and after chABC digestion indicate that the
CS-GAG moiety in biglycan is markedly larger than in CD44. The Western
blot results indicate that in the SDS-PAGE analysis of the total
preparation of cell-associated PG (Fig. 5) the CSPGs in band II contain
biglycan and that band III contains CD44. These results suggest that
HASMC express the majority of their cell-associated PG as CSPG and that
the core protein of CSPG that binds to IFN- is immunologically
related to CD44, a cell surface CSPG receptor.

View larger version (53K):
[in this window]
[in a new window]
|
Fig. 6.
Western blot analysis of total and
IFN- -bound cell-associated 35S-,
3H-labeled PGs using anti-CD44 monoclonal and anti-biglycan
polyclonal antibodies. A, total preparation of
cell-associated 35S-, 3H-labeled PG was
separated in a 10% SDS-PAGE under nonreducing conditions. After
transferring, blots were incubated with anti-CD44 (1) or
anti-biglycan (2) antibodies. B, cell-associated
35S-, 3H-labeled PGs eluted from an IFN-
affinity column were incubated with or without chABC and separated as
in A. B, lane 1 (intact PG)
and lane 2 (chABC-treated PG) were incubated with
anti-CD44 antibody; lane 3 (chABC-treated PG) was
incubated with anti-biglycan antibody. Molecular mass standards are
indicated at the right.
|
|
Analysis of CD44 RNA Transcript in Human Arterial Smooth Muscle
Cells--
RT-PCR was carried out to investigate the presence of RNA
transcript encoding CD44 in HASMC. RT-PCR was performed on RNA isolated from HASMC culture in the presence of 10% fetal bovine serum
(proliferative condition) and in sera-free medium (nonproliferative
condition). Total RNA isolated from human arterial tissue was also
analyzed. The primers used are located in the common exons E3 (forward
primer) and E16 (reverse primer) shared by all CD44 isoform genes. Fig. 7 shows analysis of the RT-PCR products
from total RNA from HASMC and human arterial tissue. The agarose gels
showed a single size DNA band of approximately 453 base pairs, the
predicted size for this CD44 product. No differences in the levels of
CD44 mRNA were observed between proliferative and nonproliferative
HASMC. These RT-PCR results corroborate the results obtained with
Western blot analysis indicating the expression of CD44, a cell surface
receptor, by HASMC.

View larger version (51K):
[in this window]
[in a new window]
|
Fig. 7.
Expression of CD44 mRNA in HASMC in
culture and human arterial tissue. Total RNA was isolated from
HASMC in different culture conditions representing proliferative and
nonproliferative (quiescent) cells. RT-PCR products from 0.1 µg of
total RNA were run on a 2% agarose gel and stained with ethidium
bromide. HASMC was cultured as follows: 2 days in 10% FCS (lane
1); 3 days in 0.5% FCS (sera-poor medium) (lane 2); 3 days in 10% FCS (lane 3); 1 day in 0% FCS (sera-free
medium) (lane 4); 3 days in 0% FCS (lane 5); 5 days in 0% FCS (lane 6); 7 days in 0% FCS (lane
7); human arterial tissue (lane 8); negative control
(lane 9); positive control pAW109 106 copies
(lane 10). Molecular mass standards (St) are
shown on the right.
|
|
Analytical Gel Exclusion Chromatography--
The interaction
between IFN- and chondroitin sulfate moiety of CSPG was further
studied by evaluating the oligomerization of IFN- by chondroitin
sulfate GAG at physiological salt concentration in a gel exclusion
chromatography column equilibrated with or without C6S. The elution
profiles of IFN- in the presence and absence of C6S indicate that at
physiological pH and ionic strength the protein forms associations with
a broad range of molecular sizes. The data in Fig.
8 show that in the conditions used and without C6S the pure human recombinant IFN- elutes in the molecular weight range between 14 and 43 kDa. This peak contains both IFN- monomers and dimmers with a molecular mass of 17 and 34 kDa,
respectively. When equilibrated with C6S, two main protein components
were observed: one peak in the molecular mass range between 63 and 280 kDa and a larger top in the molecular mass range between 232 and 440 kDa. This exclusion chromatography profile indicates the formation of
higher states of oligomerization between the IFN- and C6S in
solution.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 8.
Analytical gel exclusion chromatography of
IFN- with C6S. The elution behavior of
IFN- was evaluated in a Superose 6 PC, 3.2/3.0 column in the absence
( ) or presence ( ) of C6S in the elution buffer. In the experiment
with C6S, the column and the IFN- were equilibrated in PBS
containing 1 mg/ml C6S ( ). The column was calibrated with standard
proteins ( ): thyroglobulin (669 kDa), apoferritin (440 kDa),
catalase (232 kDa), aldolase (155 kDa), BSA (67 kDa), ovalbumin (43 kDa), chymotrypsinogen (25 kDa), and ribonuclease (14 kDa).
|
|
Antagonizing Effect of Soluble Chondroitin 6-Sulfate to the
Cellular Responses toward IFN- --
The results described showed
that CS-GAG contributes to the total binding of IFN- to cell surface
PG in HASMC and that C6S is able to form complexes with IFN- at
physiological salt concentrations. The next question was if this
interaction could modulate the biological activity of IFN- . We
studied if soluble C6S added to HASMC in culture could modify the cell
expression of class II MHC HLA-DR induced by IFN- . Induction of
class II MHC HLA-DR antigens is a unique biological property of
IFN- . This cytokine can also inhibit serum- or growth factor-induced
proliferation of vascular smooth muscle cells; therefore, we chose as
markers of cellular response toward IFN- the HLA-DR expression and
cell proliferation. The addition of C6S to the cell culture medium
together with IFN- antagonized the antiproliferative effect of
IFN- , inducing an increase in the incorporation of bromodeoxyuridine
by the cells (Fig. 9A).
Furthermore, soluble C6S antagonized the expression of HLA-DR cell
surface antigens by the cells (Fig. 9B). The effects were
directly related to the molar ratio between C6S and IFN- . These
results indicate that the extracellular addition of C6S glycosaminoglycans inhibits the biological effects of IFN- on HASMC.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 9.
Antagonizing effect of C6S on the cellular
responses toward IFN- . HASMC cultured in
two 96-well dishes were incubated with 0, 10, and 1,000 ng/ml IFN-
in the absence or presence of 10 or 100 µg/ml C6S in cell culture
medium with 10% FCS. After 4 days in culture, one dish was used to
determine cell proliferation (A) by measuring
bromodeoxyuridine incorporation, and expression of HLA-DR
(B). The values represent means ± S.D. of eight
determinations.
|
|
 |
DISCUSSION |
The results presented in this work indicate that human
recombinant IFN- binds to cell surface CSPG in HASMC and that the interaction has functional consequences. The removal of the HASMC cell
surface CS-GAG moiety of the PGs by treatment with chABC decreased by
more than 50% the total binding of IFN- to HASMC. Analysis of the
binding data for the fraction probably associated by ionic bonds
indicates the existence of two binding components for IFN- in HASMC:
a low affinity component with an apparent Kd about
equal 93 nM and a component with higher affinity that was
unmasked after CS-GAG digestion with an apparent Kd about equal to 33 nM. The low affinity binding, due to the
CS-GAG, provided the cells with a larger total binding. Similar
interpretation was given to results from analogous experiments
performed to study the binding of basic fibroblast growth factor and
low density lipoproteins to pericellular GAG in fibroblasts (20, 42). These studies reported that basic fibroblast growth factor and low
density lipoproteins also showed low affinity sites and high affinity
sites that were unmasked after removal of the pericellular GAG by
treatment with chABC. Interestingly, the affinity constants of these
three different proteins, basic fibroblast growth factor, low density
lipoproteins, and IFN- , for the low affinity GAG sites were in the
nanomolar range: 2 nM for basic fibroblast growth factor,
31 nM for low density lipoproteins, and 93 nM
for IFN- . The changes in affinity and maximal binding values, after
removal of CS-GAG, are probably due to an increase in the exposure of less abundant, high affinity-specific IFN- receptors in the cell surface or to the elimination of abundant high capacity, low affinity cell surface components, the CS-GAG. Although our experiments do not
allow us to select between these alternatives, they indicate that cell
surface CS-GAG contribute significantly to the total binding of IFN-
in HASMC. These results agree with previous reports describing the
presence of two different molecular forms of human IFN- receptors in
human cells: one with a Kd of about 10 10 M (high affinity binding) and another
with a Kd of 10 9 to 10 8
M (low affinity binding) (53, 54). Furthermore, antibodies that block the binding of IFN- to the high affinity receptor do not
inhibit the binding of IFN- to the low affinity receptor. The low
affinity receptor thus seems to be a different molecular structure
(55).
Experiments performed with GAG-degrading enzymes and affinity
chromatography indicate that chondroitin sulfate is the main GAG
through which IFN- binds to cell surface PGs in HASMC. Chondroitin sulfate appeared to be also the main type of GAG synthesized by HASMC.
The degradation of CS-containing PGs completely abolished the binding
to IFN- . These results also showed that the binding of IFN- to
cell CSPG was reversible at near physiological concentrations of NaCl,
between 150 and 200 mmol/liter NaCl. This reversibility may contribute
to modulate the action of the cytokine in response to changes in concentration.
HASMC in culture expressed CSPG as the predominant cell-associated
proteoglycan, and the core protein of the CSPG that binds to IFN-
was immunologically related to CD44. Western blot analysis showed one
band of immunoreactivity at ~150 to <200 kDa in undigested cell-associated PG and CSPG isolated by affinity chromatography on
IFN- columns. Digestion of GAGs lowers the molecular mass to ~110
kDa. This data suggests that the cell-associated PG that binds IFN-
is a CD44-related CSPG. A similar CD44-related CSPG is expressed in
activated endothelial cells and melanoma cells. CD44-related CSPG
mediates migration of these cells and invasion into matrix (19, 45,
56). CD44 is a transmembrane glycoprotein with extracellular, membrane,
and cytoplasmic domains. CD44 appears to mediate cell-cell and
cell-matrix interactions (57), and it also has multiple proinflammatory
functions (58). In addition, CD44 is the receptor for hyaluronate and
mediates T-lymphocyte homing. Ligand binding to CD44 promotes T-cell
activation and interleukin-2 release and, on monocytes, induces
cytokine release (59). The CD44 gene contains 19 exons, 12 of which may
be alternatively spliced, leading to the existence of multiple isoforms
of CD44 (60). The diversity of CD44 isoforms is further amplified by the presence of different GAG attachment sites on its extracellular domain. These GAG attachment sites appear to contribute to the multiple
functions of CD44 isoforms (61). For example, CD44 decorated with HS,
but not CS, were reported to interact with growth factors (50), and
CD44 in the form of a CSPG mediates migration (57) and binding to
collagen type I (45). We believe that our observations show for the
first time that HASMC express the cell surface receptor CD44-related
CSPG and that this is involved in the cell surface binding of
IFN- .
The removal of cell surface CS-GAG decreased the antiproliferative
effect of IFN- on HASMC. Furthermore, competition experiments showed
that purified C6S added extracellularly antagonized the antiproliferative effect of IFN- and the induction of class II MHC
molecules. These results suggest that the interaction with CS-GAG
modulates the ability of IFN- or the IFN- ·IFN- receptor complex to generate a biological response. The results from affinity chromatography experiments showing the binding of IFN- to CSPGs isolated from cells as well as the exclusion chromatography results showing the formation of high molecular weight complexes at
physiological salt concentrations between IFN- and soluble C6S
support this interpretation. According to Schlessinger and
collaborators, the primary function of these low affinity GAG receptors
on cell surfaces is to reduce the dimensionality of ligand diffusion
from three-dimensional volume of the extracellular space to two
dimensions (62). As a consequence, the probability of IFN-
interaction with the high affinity receptor will be enhanced. Since
most surface receptors diffuse in the cell membrane, lateral mobility
will allow encounters between high density low affinity CS-GAG
receptors and unoccupied, less abundant high affinity IFN-
receptors, thus transmitting signals. This interpretation is supported
by data from kinetic analysis with surface plasmon resonance showing a
high dissociation constant rate of the interaction between IFN- and
C6S (data not shown). This result suggests that a high dissociation
from low affinity CS-GAG may lead to complex formation with high
affinity receptors for IFN- . This is in agreement with the proposal
that extracellular proteoglycans in general serve as a reservoir of cytokines and growth factors (63, 64).
The active form of IFN- is a homodimer consisting of two intertwined
copies (monomers) of a single protein (25). The biologically active
IFN- -receptor complex requires the species-specific interaction of
IFN- with at least one additional accessory factor (65, 66). Studies
with a covalently linked IFN- mutant suggest that each domain of
IFN- may function independently to trigger a biological signal.
Structurally, this corresponds to each domain of IFN- binding one
receptor and one accessory factor (67). The potential interaction of
different combinations of accessory factors with the complex of IFN-
with its receptor has been suggested as a mechanism that modulates its
pleiotropic activities (9, 25). The results from the present work
suggest that the cell surface CSPG identify as CD44 may be added to the
list of possible accessory factors involved in the binding and
regulation of IFN- activity on cells. The competing action of
soluble C6S on the biological effect of IFN- can be interpreted
within the frame of two models. In one model, excess soluble C6S in the
extracellular compartment could displace the IFN- from cell surface
CSPG diminishing the pericellular concentration of IFN- from which
the high affinity receptor, responsible for signal transduction, picks
up the cytokine. In a second model, soluble C6S could antagonize the
potential accessory factor function of the cell surface GAG.
Experiments with human cell lines lacking expression of CD44-related
CSPG and CD44 isoforms with and without GAG attachments may allow for discrimination between these models. Recent findings indicate that
fragments of hyaluronan, a nonsulfated GAG, potentiate the effect of
IFN- on macrophages (68). This may be related to the fact that CD44
is a receptor for hyaluronan. Together with our results, these data
suggest the importance of the interaction of GAGs with IFN- in
mediating its effects on cells.
The interaction of IFN- with GAG may be a mechanism to control the
concentrations of the cytokine in plasma and tissues. Unfortunately,
there are not data on the in vivo concentrations of IFN-
surrounding vascular smooth muscle cells. Hansson et al.
reported the presence of IFN- using immunological methods and RT-PCR
technique (34). However, these data are qualitative. One may speculate
that in microenvironments in the vascular wall the activation and
further proliferation of Th1 lymphocyte cells may lead to an increase
in the local concentration of IFN- . Concentrations of 30-300
pM at places of IFN- production were reported (69, 70).
In vivo, IFN- disappears from the bloodstream with a
half-life of 1.1 min, due to high affinity binding to heparan sulfate
GAGs (71). In the other side, unbound IFN- in solution is cleaved rapidly and inactivated. We found that IFN- binds to matrix
chondroitin sulfate GAG at physiological salt concentrations and that
this interaction protects the cytokine from proteolysis (18).
Therefore, it can be speculated first that IFN- molecules appear to
associate with diverse types of GAG with different kinetics, thus
modulating its interaction with the specific signaling receptor, and
second that due to its interaction with GAG, the local concentration of
active IFN- in tissue may possibly be higher than the concentrations measured in plasma or tissue fluids. IFN- is a potent pleiotropic cytokine acting on different types of cells. The binding to cell surface or cell matrix GAG may be a mechanism that augments the bioavailability of the cytokine at specific local places, thus making
unnecessary increases of the IFN- levels in plasma or tissue fluids
that could compromise the functionality of other cells or tissues.
 |
ACKNOWLEDGEMENTS |
We thank Dr. Larry Fisher, Bone Research
Branch, NIDR, National Institutes of Health (Bethesda, MD), for
providing us with the antibody against biglycan.
 |
FOOTNOTES |
*
This work was supported by grants from the Swedish Medical
Research Council (Project 4531), the Swedish Heart Lung Foundation (Projects 41027, 51014, and 61538), the Sahlgrenska University Hospital
Foundation, the Swedish Society of Medicine (Projects 468.0, 413.0, and
437.0), and Astra Hässle AB, Mölndal, Sweden.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.: 46-31-342-17-33;
Fax: 46-31-82-37-62; E-mail: Eva.Hurt{at}wlab.wall.gu.se.
 |
ABBREVIATIONS |
The abbreviations used are:
IFN- , interferon- ;
PG, proteoglycan;
GAG, glycosaminoglycan;
MHC, major
histocompatibility complex;
HASMC, human arterial smooth muscle cell(s);
C6S, chondroitin 6-sulfate;
DPBS, Dulbecco's
phosphate-buffered saline;
BSA, bovine serum albumin;
FCS, fetal calf
serum;
chABC, chondroitinase ABC;
Hep I, heparitinase I;
PAGE, polymerase chain reaction;
PBS, phosphate-buffered saline;
PCR, polymerase chain reaction;
RT-PCR, reverse transcriptase-PCR;
CSPG, chondroitin sulfate PG;
CS-GAG, chondroitin sulfate GAG.
 |
REFERENCES |
-
Trinchieri, G.,
and Perussia, B.
(1985)
Immunol. Today
6,
131-136
-
Romagnani, S.
(1997)
Immunol. Today
18,
263-266[Medline]
[Order article via Infotrieve]
-
Billiau, A.
(1996)
Adv. Immunol.
62,
61-130[Medline]
[Order article via Infotrieve]
-
Farrar, M. A.,
and Schreiber, R. D.
(1993)
Annu. Rev. Immunol.
11,
571-611[CrossRef][Medline]
[Order article via Infotrieve]
-
Dalton, D. K.,
Pitts-Meek, S.,
Keshav, S.,
Figari, I. S.,
Bradley, A.,
and Stewart, T. A.
(1993)
Science
259,
1739-1742[Abstract/Free Full Text]
-
Valente, G.,
Ozmen, L.,
Novelli, F.,
Geuna, M.,
Palestro, G.,
Forni, G.,
and Garotta, G.
(1992)
Eur. J. Immunol.
22,
2403-2412[Medline]
[Order article via Infotrieve]
-
Bach, E. A.,
Aguet, M.,
and Schreiber, R. D.
(1997)
Annu. Rev. Immunol.
15,
563-591[CrossRef][Medline]
[Order article via Infotrieve]
-
Hemmi, S.,
Böhni, R.,
Stark, G.,
Marco, F. D.,
and Aguet, M.
(1994)
Cell
76,
803-810[CrossRef][Medline]
[Order article via Infotrieve]
-
Soh, J.,
Donnelly, R. J.,
Kotenko, S.,
Mariano, T. M.,
Cook, J. R.,
Wang, N.,
Emanuel, S.,
Schwartz, B.,
Miki, T.,
and Pestka, S.
(1994)
Cell
76,
793-802[CrossRef][Medline]
[Order article via Infotrieve]
-
Wight, T. N.,
Heinegård, D. K.,
and Hascall, V. C.
(1991)
in
Cell Biology of Extracellular Matrix
(Hay, E. D., ed)
, pp. 45-78, Plenum Press, New York
-
Iozzo, R. V.,
and Murdoch, A. D.
(1996)
FASEB J.
10,
598-614[Abstract]
-
Williams, K. J.,
and Fuki, I. V.
(1997)
Curr. Opin. Lipidol.
8,
252-261
-
Cardin, A. D.,
and Weintraub, H. J. R.
(1988)
Arteriosclerosis
9,
21-31[Abstract/Free Full Text]
-
Margalit, H.,
Fischer, N.,
and Ben-Sasson, S. A.
(1993)
J. Biol. Chem.
268,
19228-19231[Abstract/Free Full Text]
-
Lustig, F.,
Hoebeke, J.,
Östergren-Lundén, G.,
Velge-Roussel, F.,
Bondjers, G.,
Olsson, U.,
Rüetschi, U.,
and Fager, G.
(1996)
Biochemistry
35,
12077-12085[CrossRef][Medline]
[Order article via Infotrieve]
-
DiGabriele, A. D.,
Lax, I.,
Chen, D. I.,
Svahn, C. M.,
Jaye, M.,
Schlessinger, J.,
and Hendrickson, W. A.
(1998)
Nature
393,
812-817[CrossRef][Medline]
[Order article via Infotrieve]
-
Lookene, A.,
Savonen, R.,
and Olivecrona, G.
(1997)
Biochemistry
36,
5267-5275[CrossRef][Medline]
[Order article via Infotrieve]
-
Hurt-Camejo, E.,
Rosengren, B.,
Camejo, G.,
Sartipy, P.,
Fager, G.,
and Bondjers, G.
(1995)
Arterioscler. Thromb. Vasc. Biol.
15,
1456-1465[Abstract/Free Full Text]
-
Hoogewerf, A. J.,
Kuschert, G. S. V.,
Proudfoot, A. E. I.,
Borlat, F.,
Clark-Lewis, I.,
Power, C. A.,
and Wells, T. N. C.
(1997)
Biochemistry
36,
13570-13578[CrossRef][Medline]
[Order article via Infotrieve]
-
Olsson, U.,
Camejo, G.,
Hurt-Camejo, E.,
Elfsberg, K.,
Wiklund, O.,
and Bondjers, G.
(1997)
Arterioscler. Thromb. Vasc. Biol.
17,
149-155[Abstract/Free Full Text]
-
Batra, R. K.,
Olsen, J. C.,
Hoganson, D. K.,
Caterson, B.,
and Boucher, R. C.
(1997)
J. Biol. Chem.
272,
11736-11743[Abstract/Free Full Text]
-
Yanagishita, M.,
and Hascall, V. C.
(1992)
J. Biol. Chem.
267,
9451-9454[Free Full Text]
-
Lortat-Jacob, H.,
and Grimaud, J.-A.
(1991)
FEBS Lett.
280,
152-154[CrossRef][Medline]
[Order article via Infotrieve]
-
Ealick, S. E.,
Cook, W. J.,
Vijay-Kumar, S.,
Carson, M.,
Nagabhushan, T. L.,
Trotta, P. P.,
and Bugg, C. E.
(1991)
Science
252,
698-702[Abstract/Free Full Text]
-
Walter, M. R.,
Windsor, W. T.,
Nagabhushan, T. L.,
Lundell, D. J.,
Lunn, C. A.,
Zauodny, P. J.,
and Narula, S. K.
(1995)
Nature
376,
230-235[CrossRef][Medline]
[Order article via Infotrieve]
-
Bader, T.,
and Wietzerbin, J.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
11831-11835[Abstract/Free Full Text]
-
Sadir, R.,
Forest, E.,
and Lortat-Jacob, H.
(1998)
J. Biol. Chem.
273,
10919-10925[Abstract/Free Full Text]
-
Döbeli, H.,
Gentz, R.,
Jucker, W.,
Garotta, G.,
Hartmann, D. W.,
and Hochuli, E.
(1988)
J. Biotechnol.
7,
199-216[CrossRef]
-
Seelig, G. F.,
Wijdenes, J.,
Nagabhushan, T. L.,
and Trotta, P. P.
(1988)
Biochemistry
27,
1981-1987[CrossRef][Medline]
[Order article via Infotrieve]
-
Leinikki, P. O.,
Calderon, J.,
Luquette, M. H.,
and Schreiber, R. D.
(1987)
J. Immunol.
139,
3360-3366[Abstract]
-
Lundell, D.,
Lunn, C.,
Dalgarno, D.,
Fossetta, J.,
Greenberg, R.,
Reim, R.,
Grace, M.,
and Narula, S.
(1991)
Protein Eng.
4,
335-341[Abstract/Free Full Text]
-
Hansson, G. K.,
Jonasson, L.,
Holm, J.,
Clowes, M. M.,
and Clowes, A. W.
(1988)
Circ. Res.
63,
712-719[Abstract/Free Full Text]
-
Jonasson, L.,
Holm, J.,
and Hansson, G. K.
(1985)
J. Clin. Invest.
76,
125-131
-
Zhou, X.,
Paulsson, G.,
Stemme, S.,
and Hansson, G. K.
(1998)
J. Clin. Invest.
101,
1717-1725[Medline]
[Order article via Infotrieve]
-
Warner, S. J. C.,
Friedman, G. B.,
and Libby, P.
(1989)
J. Clin. Invest.
83,
1174-1182
-
Amento, E. P.,
Ehsani, N.,
Palmer, H.,
and Libby, P.
(1991)
Arterioscler. Thromb.
11,
1223-1230[Abstract/Free Full Text]
-
Libby, P.
(1995)
Circulation
91,
2844-2850[Free Full Text]
-
Gupta, S.,
Pablo, A. M.,
Jiang, X.-C.,
Wang, N.,
Tall, A. R.,
and Schindler, C.
(1997)
J. Clin. Invest.
99,
2752-2761[Medline]
[Order article via Infotrieve]
-
Lortat-Jacob, H.,
and Grimaud, J.-A.
(1991)
Cell. Mol. Biol.
37,
253-260[Medline]
[Order article via Infotrieve]
-
Fager, G.,
Hansson, G. K.,
Ottosson, P.,
Dahllöf, B.,
and Bondjers, G.
(1988)
Exp. Cell Res.
176,
319-335[CrossRef][Medline]
[Order article via Infotrieve]
-
Thyberg, J.,
Hedin, U.,
and Bottger, B. A.
(1991)
in
Cell Culture Techniques in Heart and Vessel Research
(Piper, H. M., ed)
, pp. 315-333, Springer, Berlin
-
Moscatelli, D.
(1987)
J. Cell. Physiol.
131,
123-130[CrossRef][Medline]
[Order article via Infotrieve]
-
Markwell, M. A. K.,
Hass, S. N.,
Bieber, L. L.,
and Tolbert, N. E.
(1978)
Anal. Biochem.
87,
206-210[CrossRef][Medline]
[Order article via Infotrieve]
-
Epps, D. E.,
Raub, T. J.,
and Kézdy, F. J.
(1995)
Anal. Biochem.
227,
342-350[CrossRef][Medline]
[Order article via Infotrieve]
-
Faassen, A. E.,
Achrager, J. A.,
Klein, D. J.,
Oegema, T. R.,
Couchman, J. R.,
and McCarthy, J. B.
(1992)
J. Cell Biol.
116,
521-531[Abstract/Free Full Text]
-
Camejo, G.,
Hurt-Camejo, E.,
Olsson, U.,
and Bondjers, G.
(1993)
Curr. Opin. Lipidol.
4,
385-391[CrossRef]
-
Schägger, H.,
and Jagow, G. V.
(1987)
Anal. Biochem.
166,
368-379[CrossRef][Medline]
[Order article via Infotrieve]
-
Hurt-Camejo, E.,
Anderssen, S.,
Standal, R.,
Rosengren, B.,
Sartipy, P.,
Stadberg, E.,
and Johansen, B.
(1996)
Arterioscler. Thromb. Vasc. Biol.
17,
300-309[Abstract/Free Full Text]
-
Fisher, L. W.,
Stubbs, J. T. I.,
and Young, M. F.
(1995)
Acta Orthop. Scand. Suppl.
66,
61-65
-
Bennett, K. L.,
Jackson, D. G.,
Simon, C.,
Tanczos, E.,
Peach, R.,
Modrell, B.,
Stamenkovic, I.,
Plowman, G.,
and Aruffo, A.
(1995)
J. Cell Biol.
128,
687-698[Abstract/Free Full Text]
-
Rohem, N. W.,
Rodgers, G. H.,
Hatfield, S. M.,
and Glasebrook, A. L.
(1991)
J. Immunol. Methods
142,
257-265[CrossRef][Medline]
[Order article via Infotrieve]
-
Sartipy, P.,
Bondjers, G.,
and Hurt-Camejo, E.
(1998)
Arterioscler. Thromb. Vasc. Biol.
18,
1934-1941[Abstract/Free Full Text]
-
Aiyer, R. A.,
Serrano, L. E.,
and Jones, P. P.
(1986)
J. Immunol.
136,
3329-3334[Abstract]
-
van Loon, A. P.,
Ozmen, L.,
Fountoulakis, M.,
Kania, M.,
Haiker, M.,
and Garotta, G.
(1991)
J. Leukocyte Biol.
49,
462-473[Abstract]
-
Finbloom, D. S.,
and Wahl, L. A.
(1989)
J. Immunol.
142,
2314-2320[Abstract]
-
Mohamadzadeh, M.,
Degrendele, H.,
Arizpe, H.,
Estess, P.,
and Siegelman, M.
(1998)
J. Clin. Invest.
101,
97-108[Medline]
[Order article via Infotrieve]
-
Henke, C. A.,
Roongta, U.,
Mickelson, D. J.,
Knutson, J. R.,
and McCarthy, J. B.
(1996)
J. Clin. Invest.
97,
2541-2552[Medline]
[Order article via Infotrieve]
-
Haynes, B. F.,
Hale, L. P.,
Patton, K. L.,
Martin, M. E.,
and McCallum, R. M.
(1991)
Arthritis Rheum.
34,
1434-1443[Medline]
[Order article via Infotrieve]
-
Webb, D. S. A.,
Shimuzu, Y.,
Seventer, G. A. V.,
Shaw, S.,
and Gerrard, T. L.
(1990)
Science
249,
1295-1297[Abstract/Free Full Text]
-
Mackay, C. R.,
Terpe, H.-J.,
Stauder, R.,
Martson, W. L.,
Stark, H.,
and Günthert, U.
(1994)
J. Cell Biol.
124,
71-82[Abstract/Free Full Text]
-
Sy, M. S.,
Guo, Y. J.,
and Stamenkovic, I.
(1991)
J. Exp. Med.
174,
859-866[Abstract/Free Full Text]
-
Schlessinger, J.,
Lax, I.,
and Lemmon, M.
(1995)
Cell
83,
357-360[CrossRef][Medline]
[Order article via Infotrieve]
-
Tanaka, Y.,
Adams, D. H.,
and Shaw, S.
(1993)
Immunol. Today
14,
111-115[CrossRef][Medline]
[Order article via Infotrieve]
-
Taipale, J.,
and Keski-Oja, J.
(1997)
FASEB J.
11,
51-59[Abstract]
-
Jung, V.,
Rashidbaigi, A.,
Jones, C.,
Tischfield, J. A.,
Shows, T. B.,
and Pestka, S.
(1987)
Proc. Natl. Acad. Sci. U. S. A.
84,
4151-4155[Abstract/Free Full Text]
-
Soh, J.,
Donnelly, R. J.,
Mariano, T. M.,
Cook, J. R.,
and Schwartz, B.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
8737-8741[Abstract/Free Full Text]
-
Lunn, C. A.,
Davies, L.,
Dalgarno, D.,
Narula, S. K.,
Zavodny, P. J.,
and Lundell, D.
(1992)
J. Biol. Chem.
267,
17920-17924[Abstract/Free Full Text]
-
Horton, M. R.,
McKee, C. M.,
Bao, C.,
Liao, F.,
Farber, J. M.,
Hodge-DuFour, J.,
Puré, E.,
Oliver, B. L.,
Wright, T. M.,
and Noble, P. W.
(1998)
J. Biol. Chem.
273,
35088-35094[Abstract/Free Full Text]
-
Nathan, C.,
and Yoshida, R.
(1988)
in
Inflammation: Basic Principles and Clinical Correlates
(Gallin, J. I.
, Goldstein, I. M.
, and Snyderman, R., eds)
, pp. 229-257, Raven Press, New York
-
Szekanecz, Z.,
Shah, M. R.,
Pearce, W. H.,
and Koch, A. E.
(1994)
Agents Actions
42,
159-162[CrossRef][Medline]
[Order article via Infotrieve]
-
Lortat-Jacob, H.,
Baltzer, F.,
and Grimaud, J. A.
(1996)
J. Biol. Chem.
271,
16139-16143[Abstract/Free Full Text]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
S. P. Murphy, C. Tayade, A. A. Ashkar, K. Hatta, J. Zhang, and B. A. Croy
Interferon Gamma in Successful Pregnancies
Biol Reprod,
May 1, 2009;
80(5):
848 - 859.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.H. Zou, W.C. Foong, T. Cao, B.H. Bay, H.W. Ouyang, and G.W. Yip
Chondroitin Sulfate in Palatal Wound Healing
Journal of Dental Research,
November 1, 2004;
83(11):
880 - 885.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. N. Wight and M. J. Merrilees
Proteoglycans in Atherosclerosis and Restenosis: Key Roles for Versican
Circ. Res.,
May 14, 2004;
94(9):
1158 - 1167.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. M. Wuttge, P. Eriksson, A. Sirsjo, G. K. Hansson, and S. Stemme
Expression of Interleukin-15 in Mouse and Human Atherosclerotic Lesions
Am. J. Pathol.,
August 1, 2001;
159(2):
417 - 423.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
H. Peilot, B. Rosengren, G. Bondjers, and E. Hurt-Camejo
Interferon-gamma Induces Secretory Group IIA Phospholipase A2 in Human Arterial Smooth Muscle Cells. INVOLVEMENT OF CELL DIFFERENTIATION, STAT-3 ACTIVATION, AND MODULATION BY OTHER CYTOKINES
J. Biol. Chem.,
July 21, 2000;
275(30):
22895 - 22904.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|