![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 27, 18965-18972, July 2, 1999
§,
, and
From the
Biozentrum, University of Basel,
Klingelbergstrasse 70, CH-4056 Basel, Switzerland and
¶ Department of Medicine, Kantonsspital, CH-6000
Luzern 16, Switzerland
| |
ABSTRACT |
|---|
|
|
|---|
Autosomal dominant neurohypophyseal diabetes
insipidus is caused by mutations in the gene encoding the vasopressin
precursor protein, prepro-vasopressin-neurophysin II. We analyzed the
molecular consequences of a mutation ( Human neurohypophyseal diabetes insipidus is a disease
characterized by a severe disturbance of antidiuresis becauseof the lack of the hypothalamic/neurohypophyseal antidiuretic hormone arginine-vasopressin. Patients produce great amounts of dilute urine and accordingly must drink large volumes of fluid to avoid exsiccosis. Neurohypophyseal diabetes insipidus most often results from
trauma (including brain operations) or infiltrative or metastatic processes that damage the hypothalamus or the neurohypophysis, or it
occurs as a primary idiopathic disorder. More rarely, the disease is
hereditary and generally transmitted in an autosomal dominant manner
(autosomal dominant neurohypophyseal diabetes insipidus, ADNDI) (1,
2).1 Various mutations were identified in the coding
sequence of the prepro-vasopressin-neurophysin II gene (3). As illustrated in Fig.
1A, the precursor protein consists of four main segments (4): 1) a 19-amino acid signal sequence for targeting to the endoplasmic reticulum (ER); 2) the nonapeptide hormone vasopressin; 3)
neurophysin II (NPII) consisting of 93 residues, which serves as the
vasopressin transport protein in the circulation; and 4) a 39-amino
acid glycopeptide of unknown function with a single N-glycosylation site. The signal sequence is cleaved off by
signal peptidase upon translocation of the precursor into the ER lumen. After folding and disulfide bond formation, pro-vasopressin-NPII passes
through the Golgi apparatus into secretory granules where the other
segments are separated by proteolytic removal of the linker residues.
The mutations identified in different kindred of ADNDI are located in
the sequences encoding the NPII moiety, the signal peptide, and in one
case the vasopressin sequence (3, 5-9).
Typically, symptoms of ADNDI develop gradually over a period of months
to years after birth (10-13). Postmortem studies revealed degeneration
of the hypothalamic magnocellular neurons in the nucleus
supraventricularis and paraopticus, which synthesize the vasopressin-NPII precursor (14-19). Based on these findings, it has
been postulated that impaired transport and/or processing of the mutant
precursor may result in its intracellular accumulation, eventually
leading to degeneration of the vasopressinergic neurons and to the
gradual manifestation of clinical symptoms. A recent study provided
evidence for the toxicity of mutant precursors or their degradation
products to cultured neuronal cells (20).
We have investigated the molecular mechanism of an unusual mutation
associated with ADNDI recently identified in a Swiss kindred (21).
Guanosine 227, the third nucleotide of the translation initiation codon
of the vasopressin precursor gene, is deleted on one allele in affected
family members. These heterozygous patients are completely
vasopressin-deficient and show an abnormal appearance of the
neurohypophysis in magnetic resonance imaging. Because loss of
expression of one allele is not a plausible cause for the observed
dominant phenotype, we hypothesized that a second, in-frame ATG present
four codons downstream might serve as an alternative initiation site
generating a mutant precursor with a truncated signal sequence (Fig.
1B, Vm). To test this hypothesis and to analyze
how a signal sequence truncation might affect the fate of the protein,
we transiently transfected mutant or wild-type prepro-vasopressin-NPII
cDNA into COS-7 cells and characterized the effects of the
guanosine 227 deletion on expression, membrane translocation, signal
cleavage, polypeptide folding, and secretion of the precursor. The
protein was found to be synthesized and translocated into the ER.
However, the truncated signal sequence was not cleaved and interfered
specifically with the folding and disulfide bond formation of the
vasopressin nonapeptide portion of the precursor, thus causing the
formation of disulfide aggregates and retention within the ER.
DNA Constructs--
The full-size cDNA of wild-type
prepro-vasopressin-NPII was a gift from Dr. M. Ito (Northwestern
University, Chicago, IL). To construct the full-size cDNA of the
guanosine 227 deletion mutant, Vm, the 5' end of the precursor cDNA
up to the SmaI site was amplified by polymerase chain
reaction using Vent polymerase, the mutagenic primer
CAGGATCCTGACACCATGCTGC (the BamHI site produced by the deletion of guanosine 227 is underlined), and a second primer
corresponding to a sequence in the plasmid vector. The product was
ligated at the SmaI site to the unamplified 3' portion of
the cDNA. The cDNA was confirmed by sequencing. In the process, a separate cDNA clone, Vm
Polymerase chain reaction amplification of the precursor cDNA using
the mutagenic primer CGCAGATCTACCATGCTGCCCGCCAGCTTCCTCGG in
combination with a second primer in the flanking vector sequence was
performed to generate the plasmid pVm(C
Cysteine 6 was mutated to serine by polymerase chain reaction
amplification of the 5' portion of the wild-type precursor cDNA using the mutagenic antisense primer CGGGAGCTCTGTTCTGGAAGTAGCACGC in
combination with a second primer in the flanking vector sequence. Separately the 3' portion was amplified using the primer
CAGGATCCTGACACCATGCTGC and a vector primer. The mutagenic primers
mutated the codon TGC of cysteine 6 to the sequence
AGAGCTC, thus inserting four nucleotides to generate a new
SacI site (22). The cloned polymerase chain reaction
products were ligated at this SacI site. Finally, the four
extra nucleotides were deleted by cutting the DNA with SacI, blunting the 3' protruding ends with T4 DNA polymerase, and ligation, producing the sequence AGC encoding serine. The final cDNAs were confirmed by sequencing.
Cell Culture, Transfection, and Immunoprecipitation--
COS-7
cells were grown in Eagle's minimal essential medium with 10% fetal
calf serum at 37 °C with 7.5% CO2. The media were supplemented with 2 mM L-glutamine, 100 units/ml penicillin, and 100 µg/ml streptomycin. Transfection of
COS-7 cells using DEAE-dextran and Me2SO was performed
according to Cullen (23) in 6-well plates. Transfected cells were
processed 48 h after transfection. For in vivo
labeling, transfected cells were incubated for 30 min in medium lacking
methionine and labeled for 30 min at 37 °C with 100 µCi/ml
[35S]methionine in starvation medium. Where indicated,
cells were chased in complete medium containing excess methionine.
Lysed cells and media were subjected to immunoprecipitation using a polyclonal rabbit anti-NPII antiserum (ICN) and protein A-Sepharose (Amersham Pharmacia Biotech). For analysis with
endo- In Vitro Translation and Radiosequencing--
The cDNAs of
wild-type and mutant prepro-vasopressin-NPII were subcloned into the
plasmid pGEM3 (Promega), in vitro transcribed with SP6 RNA
polymerase, and translated using rabbit reticulocyte lysate with dog
pancrease microsomes as described (24). Translation products were
labeled with [35S]methionine for fluorography and with
[3H]leucine for sequencing. After translation, the
microsomes were pelleted through a sucrose cushion (24), separated by
SDS gel electrophoresis, and transferred to polyvinylidene difluoride membrane. The region containing the labeled protein was cut out and
subjected to automated Edman degradation using an Applied Biosystems
477A sequencer. The eluants at each cycle were analyzed by
scintillation counting. Inhibition of signal peptidase was accomplished
by addition of
N-methoxysuccinyl-Ala-Ala-Pro-Val-chloromethyl ketone
(Sigma) in Me2SO at a final concentration of 5 mM.2
Membrane Integration, Disulfide Aggregation, and Protease
Sensitivity--
To assess membrane integration of wild-type and
mutant vasopressin precursor, labeled cells were scraped and subjected
to alkaline extraction as described by Gilmore and Blobel (25). Alternatively, cells were extracted with 0.1% saponin in PBS at 4 °C for 20 min (24). Extracted and membrane-associated material was
separately taken up in lysis buffer and subjected to
immunoprecipitation. To analyze disulfide formation, labeled
transfected cells were treated with 100 mM iodoacetamide
for 60 min at 4 °C before lysis and immunoprecipitation. Samples
were split in two aliquots and boiled with SDS sample buffer with or
without 100 mM Immunofluorescence--
For indirect immunofluorescence
staining, cells were grown on 14-mm glass coverslips, fixed with 3%
paraformaldehyde for 20 min at room temperature, washed in PBS, and
quenched with 50 mM NH4Cl in PBS. Cells were
permeabilized with 0.1% Triton X-100 for 10 min. Nonspecific antibody
binding was blocked with PBS containing 1% bovine serum albumin
(PBSB). The fixed cells were incubated with anti-neurophysin II primary
antibody diluted 1:400 in PBSB for 1 h, washed with PBSB, and
incubated with fluorescein isothiocyanate-labeled anti-rabbit
immunoglobulin secondary antibody diluted 1:200 in PBSB for 30 min.
After additional washes with PBSB, PBS, and water, the coverslips were
mounted in Mowiol 4-88 (Hoechst) containing 2.5% 1,4-diazobicyclo-(2,
2, 2)-octane and analyzed using a Zeiss Axiophot microscope. For double
immunofluorescence, the fixed cells were incubated simultaneously with
anti-neurophysin II and a mouse monoclonal anti-p63 antibody (26)
followed by incubation with fluorescein isothiocyanate-labeled
anti-rabbit immunoglobulin and then Cy3-labeled rabbit anti-mouse
immunoglobulin antibodies.
Deletion of Guanosine 227 Results in a Truncated Signal Sequence
That Is Functional but Not Cleaved--
Deletion of guanosine 227 in
the prepro-vasopressin-NPII gene of the Swiss ADNDI kindred eliminates
the original translation initiation codon. Expression of a mutant
protein would depend upon initiation at an alternative in-frame ATG.
There are only two internal ATG sequences in the entire
prepro-vasopressin-NPII cDNA, encoding Met14 (the
second codon of NPII) and Met
To test whether translation of the mutant cDNA initiates at one of
the downstream ATGs and whether insertion into the ER occurs, wild-type
and mutant cDNAs were transiently expressed in transfected COS-7
cells, labeled with [35S]methionine for 30 min, and
immunoprecipitated with an antiserum against the NPII portion of the
precursor protein (Fig. 2A).
As expected, the wild-type vasopressin precursor was synthesized as a
major species of ~22 kDa (Fig. 2A, lane 1).
Sensitivity to digestion with Endo H showed it to be glycosylated and
thus translocated into the ER lumen (lane 3). Often, a small
amount of a ~19-kDa species was also produced (lane 1).
Its insensitivity to Endo H digestion and the electrophoretic mobility,
which was identical to that of the deglycosylated major product,
suggested it to be an unglycosylated form of the precursor protein. The
mutant cDNA with the guanosine 227 deletion was also efficiently
expressed (Vm, lanes 2 and 4). The
major product, however, migrated with an increased apparent molecular
mass of ~23 kDa that was reduced to ~20 kDa by deglycosylation.
Glycosylation indicates that even in the absence of the original
initiator codon a mutant protein with a functional signal sequence was
translated. Similar to the wild-type protein, a minor fraction was
produced in unglycosylated form. Because there is no other ATG upstream
of the coding sequence, initiation must have occurred at codon 5 of the
segment encoding the signal sequence. The increased molecular mass
suggested that the signal was not cleaved.
To experimentally determine the N-terminal sequence of Vm, its cDNA
was translated in vitro using rabbit reticulocyte lysate and
dog pancreas microsomes in the presence of radioactive amino acids for
subsequent detection after Edman degradation. The mutant precursor
labeled with [35S]methionine was efficiently glycosylated
in the presence of microsomes (Fig.
3A, lanes 1 and
2). As expected, it migrated slightly more slowly than the
wild-type precursor (lane 4) but with the same mobility as
the wild-type precursor translated in the presence of a signal
peptidase inhibitor (lane 3). For sequencing, Vm was synthesized with
[3H]leucine, and the glycosylated products were subjected
to automated Edman degradation. [3H]Leucine was released
in cycle 2 and in cycles 7-10 (Fig. 3B). Within the entire
prepro-vasopressin-NPII sequence, this pattern corresponds only with
the sequence starting with Met The Mutant Precursor Is Efficiently Retained in the ER--
To
analyze their secretion properties, wild-type and mutant
prepro-vasopressin-NPII precursors were expressed in COS-7 cells, pulse-labeled for 30 min with [35S]methionine, chased for
up to 4 h, and then immunoprecipitated from the medium and from
the lysed cells (Fig. 4). The wild-type precursor was rapidly secreted into the medium with a half-time of less
than 1 h (lanes 1-8). Because COS cells lack a
regulated secretory pathway and the corresponding processing proteases, pro-vasopressin-NPII was secreted intact. The secreted protein was
resistant to Endo H digestion (lanes 9 and 10),
indicative of conversion of the N-linked glycan from high
mannose to complex type in the Golgi apparatus. In contrast, the mutant
precursor was almost completely retained inside the cells in an Endo
H-sensitive form (lanes 13-26). Localization of the mutant
protein by indirect immunofluorescence showed strong staining with the
typical reticular pattern of the ER extending through the entire cell
(Fig. 5A). Double
immunofluorescence staining for the ER resident protein p63 (Fig.
5D) (29) and for mutant vasopressin precursor (Fig. 5C) produced identical patterns in expressing cells. For
comparison, the weak staining pattern of cells expressing the wild-type
protein reflects the steady state distribution of the precursor in the secretory pathway, i.e. the network of the ER and a
perinuclear spot typical of the Golgi apparatus (Fig.
5B).
An uncleaved, hydrophobic signal peptide could cause ER retention by
anchoring the protein in the ER membrane. Membrane integration was
tested by alkaline extraction (Fig. 2B). Microsomes of
labeled cells were incubated at pH 11.5 to disrupt organelles and
release peripherally associated and soluble proteins. As expected,
wild-type vasopressin precursor was recovered in the soluble extract
(lanes 1 and 2), whereas subunit H1 of the
asialoglycoprotein receptor, a control integral membrane protein, was
pelleted with the membranes (lanes 5 and 6). The
mutant vasopressin precursor was as almost as efficiently extracted as
the wild-type protein (lanes 3 and 4), suggesting
that it was not anchored in the bilayer of the ER.
The Uncleaved Signal Causes Disulfide Aggregation but Does Not
Prevent NPII Folding--
The uncleaved hydrophobic signal peptide
might cause ER retention by interfering with correct folding and
disulfide bonding of the precursor. Pro-vasopressin-NPII contains eight
intramolecular disulfide bridges. Formation of disulfide bonds is often
reflected in the electrophoretic mobility of a protein under reducing
versus nonreducing conditions. To address this, transfected
COS cells were metabolically labeled and then incubated at 4 °C with
iodoacetamide to alkylate free sulfhydryl groups to prevent post-lysis
oxidation. Vasopressin precursor was immunoprecipitated and split into
two samples that were boiled in SDS sample buffer with or without mercaptoethanol. Upon gel electrophoresis, the wild-type precursor migrated slightly faster in its nonreduced, more compact folded state
than after reduction of the disulfide bonds (Fig.
6, lanes 1 and 3).
In contrast, the nonreduced mutant precursor was hardly detectable at
the corresponding position in the gel but appeared as aggregates that
migrated more slowly or did not enter the gel at all (lane 4). Such
aggregates are typically observed for misfolded proteins (28).
To more directly assess the folding state of the protein, wild-type and
mutant precursors were subjected to a protease sensitivity assay.
Labeled protein was immunoprecipitated using anti-NPII antiserum and
protein A-Sepharose and was incubated with increasing concentrations of
trypsin. The Sepharose beads were washed, and bound material was
analyzed by gel electrophoresis and fluorography (Fig.
7). From the wild-type precursor
(lanes 1-5), a fragment of ~12 kDa (fragment 3) was
generated that was completely resistant to trypsin at up to 5000 µg/ml. Its size corresponds to that of the NPII domain, indicating
that the flanking segments (vasopressin and glycopeptide) were cleaved
off at the connecting peptides normally hydrolyzed by processing
enzymes in secretory granules. Intermediates of ~21 and ~13 kDa
(fragments 1 and 2) were weakly detectable at the lowest trypsin
concentration (lane 2). Their sizes suggest that these
intermediates correspond to NPII-glycopeptide and vasopressin-NPII
fragments, respectively. This was confirmed by performing the same
experiment using an antiserum directed against the vasopressin
nonapeptide (data not shown). Only the full-size precursor and the
13-kDa intermediate (fragment 2) were recovered, indicating that they
contain the vasopressin sequence.
Upon incubation of the mutant precursor with trypsin (Fig. 7,
lanes 6-10), the 12-kDa NPII fragment was generated as
well, although it was slightly less resistant to the highest protease concentrations. Intermediate fragments of ~21 kDa (fragment 1) lacking the uncleaved signal and vasopressin, and of ~14 kDa
(fragment 2*) lacking the glycopeptide portion were also produced. The
latter intermediate was the only one to be recovered using
anti-vasopressin antibody (not shown), supporting the notion that it
consists of the uncleaved signal, vasopressin, and NPII. It is more
abundant than the corresponding fragment of the wild-type precursor
(even considering that it contains an additional methionine in the
signal sequence). The uncleaved signal thus appears to affect the
accessibility of the peptide connecting vasopressin to NPII. Most
importantly, it did not interfere with the folding of NPII itself.
In contrast, the precursor Vm The Uncleaved Signal Interferes with Disulfide Formation in
Vasopressin--
In the wild-type pro-vasopressin-NPII, all cysteines
are engaged in disulfide bonds, seven in NPII and one in vasopressin. The mutant precursor, however, contains an additional cysteine, Cys
The first residue of vasopressin, Cys1, forms a disulfide
bridge with Cys6. It is conceivable that lack of signal
cleavage in Vm and Vm(C
The guanosine 227 deletion in Vm thus acts indirectly. By eliminating
the normal translation initiation site, it induces translation of a
truncated signal sequence that, because it cannot be cleaved, prevents
the correct folding and oxidation of vasopressin. This is ultimately
sufficient to cause aggregation and ER retention.
In this study, we have analyzed the mechanism by which a mutation
in the translation initiation codon of prepro-vasopressin-NPII causes
ADNDI in a Swiss kindred. The mutant precursor was expressed and
glycosylated, indicating that translation initiated at an alternative
ATG codon and produced a functional signal for ER targeting and
translocation (Fig. 2). The only possible initiation site is codon It is not clear by which mechanism signal peptidase cleavage was
affected. The available algorithms to predict signal cleavage sites
(30, 31), which are based on statistical evaluation of known sequences,
yield the same result for the wild-type and the mutant sequence. The
main criteria are the residues close to the cleavage site (particularly
residues The uncleaved mutant vasopressin precursor was efficiently retained in
the ER in a high mannose glycosylated form (Figs. 4 and 5) and could be
recovered largely in disulfide-linked aggregates (Fig. 6) typical of
unfolded or misfolded proteins (28). All the cysteines in the precursor
are normally involved in intramolecular disulfide bonds, except for one
in the signal sequence. However, folding of the NPII domain, which
contains 7 of the 8 disulfide bonds in the precursor, was not
significantly affected by the uncleaved signal, because the NPII domain
was found to be almost as resistant to trypsin digestion as in the
wild-type protein (Fig. 7). Based on the positions of the N and the C
termini of NPII in the crystal structure (35), the small, C-terminal
glycopeptide domain is not in contact with the signal vasopressin
segments and is thus unlikely to be disturbed during folding. In
addition, it does not contain any cysteines and thus cannot be
responsible for disulfide aggregation. Hence, retention and aggregation
is caused by the uncleaved signal and/or by misfolded vasopressin. Cys The crystal structures of bovine NPII complexed with a dipeptide analog
of vasopressin (35) and of the closely homologous bovine neurophysin
I-oxytocin complex (36) have been determined. They show that the
In the prepro-vasopressin-NPII precursor sequence, close to 30 different mutations causing ADNDI have been identified (3, 5-9).
Besides the mutation studied here, three localized to the signal
sequence. Ala The gradual development of the dominant phenotype of ADNDI and
postmortem studies suggest that the disease is caused by the degeneration of the hypothalamic cells producing mutant hormone precursor. In a recent study, reduced viability of neuro2A
neuroblastoma cell lines expressing different vasopressin precursor
mutants (a signal cleavage site mutant and several NPII mutants) was
observed (20), indicating that the retained precursor (or its
degradation products) has a cytotoxic effect. ER retention, first shown
for the glycine 17-to-valine mutation of NPII (40), and the resulting cytotoxicity might be a common feature of many, if not all,
prepro-vasopressin-NPII mutations. This is reminiscent of
G227) recently identified in a
Swiss kindred that destroys the translation initiation codon. In COS-7 cells transfected with the mutant cDNA, translation was found to
initiate at an alternative ATG, producing a truncated signal sequence
that was functional for targeting and translocation but was not cleaved
by signal peptidase. The mutant precursor was completely retained
within the endoplasmic reticulum. The uncleaved signal did not affect
folding of the neurophysin portion of the precursor, as determined by
its protease resistance. However, formation of disulfide-linked
aggregates indicated that it interfered with the formation of the
disulfide bond in vasopressin, most likely by blocking its insertion
into the hormone binding site of neurophysin. Preventing disulfide
formation in the vasopressin nonapeptide by mutation of cysteine 6 to
serine was shown to be sufficient to cause aggregation and retention.
These results indicate that the
G227 mutation induces translation of
a truncated signal sequence that cannot be cleaved but prevents correct
folding and oxidation of vasopressin, thereby causing precursor
aggregation and retention in the endoplasmic reticulum.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
, was identified with an additional, accidental mutation, deletion of codons 28-36 of pro-vasopressin-NPII (residues 16-24 of NPII).
11S), which encodes the
vasopressin precursor with a truncated signal sequence and with
Cys
11 of the signal peptide mutated to serine.
-N-acetylglucosaminidase H (Endo H; Roche Molecular
Biochemicals), immunoprecipitates were boiled for 2 min in 50 µl of
50 mM sodium citrate, pH 6, 1% SDS. Aliquots were
incubated with 1 milliunit of Endo H for 2 h at 37 °C. Finally,
samples were boiled in SDS sample buffer and analyzed by
SDS-polyacrylamide gel electrophoresis. Gels were fixed, soaked in 1 M sodium salicylate containing 1% glycerol, dried, and
fluorographed on Kodak BioMax MR films. For quantification,
fluorographs were densitometrically scanned.
-mercaptoethanol before SDS gel
electrophoresis and fluorography. To assess the folding state of
wild-type and mutant vasopressin precursor, labeled protein was
immunoprecipitated with rabbit anti-NPII or anti-vasopressin antiserum
(ICN), and protein A-Sepharose. The immunoprecipitates were incubated
for 10 min at 4 °C with 0-5 mg/ml trypsin. The protease was then
stopped by the addition of 10 mM phenylmethylsulfonyl fluoride, the resin was washed, and the bound protein was analyzed by
SDS gel electrophoresis and fluorography.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
15 (the fifth codon of the
signal sequence; Fig. 1B).
Translation initiation at Met14 would generate a cytosolic
polypeptide, whereas a protein beginning with Met
15 would
still contain most of the signal peptide truncated by four residues
(Fig. 1B). The wild-type signal sequence is unusual in that
it contains a negatively charged aspartate and no positively charged
residues in its N-domain (27, 28). In comparison, the truncated signal
appears rather more typical, because the negative residue is
deleted.

View larger version (12K):
[in a new window]
Fig. 1.
Sequence of wild-type and mutant
prepro-vasopressin-NPII. A, the general organization of
the precursor protein is schematically shown with the disulfide-linked
cysteines connected by lines and the site for
N-glycosylation indicated with a diamond. The protein
segments produced by proteolytic cleavage of the precursor are
visualized by different shades of gray; the linker sequences
are cross-hatched. B, the N-terminal sequence of
the wild-type protein (V) and of the predicted mutant
precursor protein (Vm) is shown.

View larger version (46K):
[in a new window]
Fig. 2.
The mutant signal is functional for ER
targeting and translocation but does not anchor the protein in the
membrane. A, COS-7 cells were transfected with
wild-type (V) or mutant (Vm)
prepro-vasopressin-NPII cDNA, labeled for 30 min with
[35S]methionine, lysed, and subjected to
immunoprecipitation using an antiserum against NPII. Immunoprecipitates
were incubated with or without Endo H and analyzed by SDS gel
electrophoresis and fluorography. The positions of marker proteins are
indicated with their molecular masses in kDa. (Expression of the mutant
cDNA reproducibly yielded better incorporation of radioactivity
into immunoprecipitable protein, probably because of the additional
methionine remaining with the uncleaved signal.) B, alkaline
extraction. Microsomes of labeled COS-7 cells were incubated at pH 11.5 and centrifuged through a sucrose cushion. Vasopressin precursor was
then separately immunoprecipitated from the membrane pellet
(P) and the supernatant (S) and analyzed by gel
electrophoresis. As a control for a membrane-anchored protein, subunit
H1 of the asialoglycoprotein receptor was expressed and analyzed in
parallel.
15, which has leucines at
positions 2, 7, 9, and 10 from the N terminus (positions
14,
9,
7, and
6 of the precursor protein). This confirms that translation
initiated at Met
15 and that the truncated signal was not
cleaved.

View larger version (28K):
[in a new window]
Fig. 3.
Radiosequencing of translocated mutant
vasopressin precursor. A, mutant vasopressin precursor
(Vm) was translated in vitro with
[35S]methionine in the absence (
) or presence of
microsomes (M) and compared with the wild-type protein
translocated into microsomes in the presence (M+I) or
absence of signal peptidase inhibitor (as described under
"Experimental Procedures"). The fluorograph of an SDS gel is shown.
B, mutant precursor translated in vitro in the
presence of [3H]leucine and inserted into microsomes was
subjected to automated Edman degradation. Radioactivity released at
each cycle is plotted. The only compatible precursor sequence,
corresponding to residues
15 to
2 of the precursor, is shown
below.

View larger version (51K):
[in a new window]
Fig. 4.
Retention of mutant vasopressin precursor in
transfected COS-7 cells. Wild-type (V) and mutant
(Vm) prepro-vasopressin-NPII were expressed in transfected
COS-7 cells. The cells were labeled for 30 min with
[35S]methionine and chased for 0-4 h as indicated. The
collected medium (M) and the lysed cells (C) were
subjected to immunoprecipitation using anti-NPII antiserum.
Immunoprecipitates were analyzed by electrophoresis on SDS-Tricine gels
and fluorography. Some of the samples were incubated without (
) or
with (+) Endo H before analysis. The graph shows the
densitometric quantitation of the pulse-chase experiments shown above,
normalized to the total at each time point.

View larger version (123K):
[in a new window]
Fig. 5.
Immunofluorescence localization of retained
mutant vasopressin precursor. Transfected COS-7 cells were fixed
and subjected to indirect immunofluorescence microscopy as described
under "Experimental Procedures." The wild-type precursor
(B) yielded staining of the secretory pathway,
i.e. ER and Golgi, whereas mutant prepro-vasopressin-NPII
(A) produced exclusively a strong reticular staining typical
of the ER. (Identical exposure times were used for panels A
and B.) Co-immunofluorescence staining for mutant
prepro-vasopressin-NPII (C) and the ER marker p63
(D) yielded identical patterns. Bar, 20 µm.

View larger version (53K):
[in a new window]
Fig. 6.
Disulfide bond formation in wild-type and
mutant vasopressin precursor. COS-7 cells were transfected with
wild-type (V) or mutant (Vm)
prepro-vasopressin-NPII cDNA, labeled for 30 min with
[35S]methionine, and treated with iodoacetamide to
alkylate free SH groups. After immunoprecipitation with anti-NPII,
aliquots were boiled in SDS sample buffer with or without reducing
agent and analyzed by gel electrophoresis. The asterisks
indicate the disulfide aggregates of the mutant precursor.

View larger version (53K):
[in a new window]
Fig. 7.
Protease resistance of wild-type and mutant
vasopressin precursors. Wild-type (V) or mutant
prepro-vasopressin-NPII (Vm or Vm
) were
expressed in transfected COS-7 cells, labeled for 30 min with
[35S]methionine, and immunoprecipitated with anti-NPII
antiserum. The immunoprecipitates were incubated at 4 °C for 10 min
with 0-5000 µg/ml trypsin as indicated and analyzed by SDS gel
electrophoresis. The arrows with numbers point
out fragments generated by proteolysis as follows (see text):
1, NPII-glycopeptide; 2, vasopressin-NPII;
2*, signal vasopressin-NPII; 3, NPII. An
open circle indicates nonglycosylated precursor
protein.
, a cloning artifact of Vm with an
additional small deletion of codons 28-36 of pro-vasopressin-NPII (residues 16-24 of NPII), did not generate specific trypsin-resistant fragments (Fig. 7, lanes 11-15). Vm
thus serves as a
control showing that protease resistance depends on NPII folding.
11, in the uncleaved signal peptide (Fig.
1B). To test whether this cysteine is responsible for the
formation of disulfide aggregates and retention, we constructed the
mutant Vm(C
11S), in which Cys
11 in the truncated signal
sequence of Vm was mutated to serine. As shown in Fig.
8, mutation of this cysteine did not
significantly affect the properties of the protein. It was synthesized
by COS cells as a 23-kDa glycosylated, Endo H-sensitive protein (Fig. 8A, lanes 1 and 2), indicating that
the truncated signal without cysteine was functional and uncleaved. The
majority of the protein was retained in an Endo H-sensitive form within
the cell (lanes 5-8). After 2 h of chase, ~7% was
recovered from the medium as Endo H-resistant protein, which is
slightly more than for Vm. Trypsin resistance of the 12-kDa NPII
fragment indicates correct folding of NPII (Fig. 8B). Most
notably, elimination of Cys
11 did not prevent most of the
protein from forming disulfide-linked aggregates (Fig. 8C),
indicating that covalent aggregation is not, or not solely, caused by
Cys
11. The extraordinary protease resistance of the NPII
portion in Vm and Vm(C
11S) argues that its seven disulfide bonds were
correctly formed. Thus, the disulfide bond in the vasopressin segment
may not be correctly formed in the mutant precursors and cause
aggregation.

View larger version (52K):
[in a new window]
Fig. 8.
Analysis of the mutant precursor
Vm(C
11S). Expression, secretion, and Endo H sensitivity
(A) were analyzed as in Figs. 2 and 3, trypsin sensitivity
(B) was analyzed as in Fig. 7, and disulfide aggregation
(C) was analyzed as in Fig. 6. C
,
cells without Endo H digestion; C+, cells with
Endo H digestion; M
, medium without Endo H
digestion; M+, medium with Endo H digestion;
red., reduced; non-red., nonreduced.
11S) interferes with the formation of this
disulfide bond, leaving its thiol groups potentially available for
oxidation to form covalent aggregates. To test whether unpaired
cysteines of vasopressin might cause ER retention, we constructed the
mutant V(C6S). Cys6 was mutated to serine in the context of
the wild-type precursor sequence, leaving Cys1 without its
normal disulfide partner, even if the signal is removed. Upon
expression in COS cells, V(C6S) showed an electrophoretic mobility of
22 kDa like the wild-type precursor (Fig.
9A, lanes 1 and
2), indicative of signal cleavage. Nevertheless, it was not
secreted from the cells and remained sensitive to Endo H digestion (lanes 6-9). The mutation did not interfere with folding of
NPII, because the trypsin-resistant NPII fragment of ~12 kDa was
generated in the protease sensitivity assay (Fig. 9B).
However, V(C6S) was also found largely as aggregates when analyzed
under nonreducing conditions (Fig. 9C). These results
indicate that failure to form the disulfide bond in vasopressin is
sufficient to cause aggregation and ER retention of the precursor
protein.

View larger version (57K):
[in a new window]
Fig. 9.
Analysis of the mutant precursor V(C6S).
Expression, secretion, and Endo H sensitivity (A) were
analyzed as in Figs. 2 and 3, trypsin sensitivity (B) was
analyzed as in Fig. 7, and disulfide aggregation (C) was
analyzed as in Fig. 6. C
, cells without Endo H digestion;
C+, cells with Endo H digestion; M
, medium
without Endo H digestion; M+, medium with Endo H digestion;
red., reduced; non-red., nonreduced.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
15
generating a signal sequence truncated by four residues. This shortened
signal is in better agreement with the typical characteristics of ER
targeting signals, because an unusual N-terminal negative charge,
Asp
17, is deleted. The immediate consequence of the
truncation was the complete loss of signal cleavage, which is evident
from a molecular mass increase of ~2 kDa.
1 and
3, which preferentially have small and uncharged
side chains) and the vicinity to the apolar segment of the signal.
These features are not affected by the mutation. However, it is
conceivable that the mutant signal is positioned differently within the
translocation machinery, because the hydrophilic N-terminal segment
with Asp
17 is lacking. As a result, accessibility of the
cleavage site for signal peptidase might be reduced. Nilsson et
al. (32) previously reported evidence for a subtle position effect
on signal cleavage depending on the length of the hydrophobic signal
domain. An effect of the N-terminal hydrophilic segment on signal
cleavage has been observed for major histocompatibility complex class
II invariant chain and the asialoglycoprotein receptor H1. Both
proteins are type II membrane proteins with uncleaved signal anchor
sequences. Deletion of the N-terminal hydrophilic portions resulted in
partial signal cleavage at cryptic sites that normally are not
accessible to signal peptidase (33, 34). How alterations in the
N-terminal domain of a signal sequence can affect the situation of the
signal in the insertion process is not clear, even more so because it is not known precisely in what environment the signal is situated at
the time of cleavage (i.e. inside the translocation pore or within the lipid bilayer).
11 of the signal sequence is not solely responsible,
because its mutation to serine did not eliminate aggregation and did
not allow secretion (Fig. 8). Our results therefore suggest that the
disulfide bond in vasopressin is not formed in the uncleaved mutant
protein, leaving the free thiols available for incorrect intermolecular disulfide formation. Consistent with this model, we found that preventing disulfide formation in vasopressin by mutating one of
its two cysteines is sufficient to cause ER retention and
aggregation, even if the signal is removed correctly (Fig. 9).
-amino group of the hormone is hidden in the binding pocket, forming
three hydrogen bonds and a salt bridge, and that the disulfide bond of
the hormone is facing into the binding site. Binding of the N-terminal
vasopressin segment of pro-vasopressin-NPII into the hormone binding
site may be essential to stabilize the intramolecular disulfide bond
between Cys1 and Cys6 by protecting it from
further disulfide isomerization. If the signal sequence is not removed,
this is impossible, and the signal and vasopressin will remain exposed.
The observation that the NPII domain of the wild-type precursor is
somewhat more stable at high trypsin concentrations than that of the
mutants Vm or V(C6S) (Figs. 7 and 9B) may reflect
stabilization of NPII when the correctly oxidized hormone is bound to
its binding site. A stabilizing effect of the ligand on NPII has
previously been documented in in vitro folding studies
(37).
1 was mutated to threonine in six kindred
(3, 8, 13, 38, 39), representing the most frequent ADNDI mutation known
so far. In addition, substitution of Ala
1 by valine (3,
9) and of Ser
3 by phenylalanine (3) have been identified.
These signal mutations involve the residues that are most critical for
signal peptidase activity. Reduced signal cleavage was experimentally
demonstrated in vitro for the alanine-to-threonine mutation
(38). These cleavage site mutants are very likely to cause ER retention
by the same mechanism as the guanosine 227 deletion mutant analyzed in
this study. There is only one known case of ADNDI with a mutation in vasopressin itself (Tyr2 to His) (6). Because
Tyr2 is essential for vasopressin binding to NPII,
Cys1 and Cys6 of the mutant protein are likely
to remain exposed to the ER lumen, with the same consequences as
observed for the signal mutant analyzed here. All other mutations were
distributed throughout the NPII sequence and include missense,
deletion, and nonsense mutations that most likely cause ER retention by
disturbing the correct folding of the NPII domain.
1-antitrypsin deficiency, which causes liver cirrhosis
in susceptible individuals. Mutant antitrypsin was found in hepatocytes
in characteristic insoluble inclusions that were associated with
hepatocellular damage (41). Several mutant proteins, including the
relatively frequent Z variant, were shown to be retained in the ER in a
misfolded form producing large noncovalent homopolymers of a specific
structure (loop-sheet polymerization) (42, 43). In contrast to this
mechanism, mutant vasopressin precursors were not found in inclusions
but rather evenly distributed throughout the ER (Fig. 4 and Ref. 20).
The disulfide aggregates appear to be heterogeneous, suggesting that disulfide linkage occurs to other still unfolded proteins in the ER
rather than by oxidative homooligomerization. In addition, the
mutations that cause ADNDI are quite different. For example, truncation
of the C-terminal third of NPII is very likely to cause gross
misfolding of the rest of the precursor, whereas lack of signal
cleavage in the guanosine 227 deletion mutant did not impede NPII
folding (Fig. 7). Elucidating the mechanism of cytotoxicity by retained
vasopressin precursors is the main challenge in understanding the
molecular pathogenesis of ADNDI and may provide important insights into
the mechanisms underlying neurodegenerative diseases.
| |
ACKNOWLEDGEMENTS |
|---|
We thank C. Bieri, A. Renold, and Drs. M. Böni-Schnetzler, M. Ito, H. P. Hauri, J. J. Legros, and M. B. Vallotton for reagents and support, the group of Dr. G. Schatz, K. Rösch, T. Mini, and Dr. P. Jenö for assistance with in vitro translation and protein sequencing, A. Renold for immunofluorescence, and Drs. V. Laird, L. Vogel, P. Kopp, and R. Yu for critically reading the manuscript.
| |
FOOTNOTES |
|---|
* This work was supported by Grant 31-43483.95 from the Swiss National Science Foundation.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ These authors contributed equally to this work.
To whom correspondence should be addressed. Tel.:
41-61-2672164; Fax: 41-61-2672149; E-mail:
spiess{at}ubaclu.unibas.ch.
2 M. Nusier and M. O. Lively, personal communication.
| |
ABBREVIATIONS |
|---|
The abbreviations used are:
ADNDI, autosomal
dominant neurohypophyseal diabetes insipidus;
NP, neurophysin;
ER, endoplasmic reticulum;
Endo H, endo-
-N-acetylglucosaminidase H;
PBS, phosphate-buffered
saline;
Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. Zillig, A. Wurm, F. J. Grehn, P. Russell, and E. R. Tamm Overexpression and Properties of Wild-Type and Tyr437His Mutated Myocilin in the Eyes of Transgenic Mice Invest. Ophthalmol. Vis. Sci., January 1, 2005; 46(1): 223 - 234. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Christensen, C. Siggaard, T. J. Corydon, G. L. Robertson, N. Gregersen, L. Bolund, and S. Rittig Differential Cellular Handling of Defective Arginine Vasopressin (AVP) Prohormones in Cells Expressing Mutations of the AVP Gene Associated with Autosomal Dominant and Recessive Familial Neurohypophyseal Diabetes Insipidus J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4521 - 4531. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Bonapace, A. Waheed, G. N. Shah, and W. S. Sly Chemical chaperones protect from effects of apoptosis-inducing mutation in carbonic anhydrase IV identified in retinitis pigmentosa 17 PNAS, August 17, 2004; 101(33): 12300 - 12305. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Liu and D. Vollrath Reversal of mutant myocilin non-secretion and cell killing: implications for glaucoma Hum. Mol. Genet., June 1, 2004; 13(11): 1193 - 1204. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Friberg, M. Spiess, and J. Rutishauser Degradation of Wild-type Vasopressin Precursor and Pathogenic Mutants by the Proteasome J. Biol. Chem., May 7, 2004; 279(19): 19441 - 19447. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Beuret, H. Stettler, A. Renold, J. Rutishauser, and M. Spiess Expression of Regulated Secretory Proteins Is Sufficient to Generate Granule-like Structures in Constitutively Secreting Cells J. Biol. Chem., May 7, 2004; 279(19): 20242 - 20249. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Rebello, R. Ramesar, A. Vorster, L. Roberts, L. Ehrenreich, E. Oppon, D. Gama, S. Bardien, J. Greenberg, G. Bonapace, et al. Apoptosis-inducing signal sequence mutation in carbonic anhydrase IV identified in patients with the RP17 form of retinitis pigmentosa PNAS, April 27, 2004; 101(17): 6617 - 6622. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. T. Wahlstrom, M. J. Fowler, W. E. Nicholson, and W. J. Kovacs A Novel Mutation in the Preprovasopressin Gene Identified in a Kindred with Autosomal Dominant Neurohypophyseal Diabetes Insipidus J. Clin. Endocrinol. Metab., April 1, 2004; 89(4): 1963 - 1968. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Ozisik, G. Mantovani, J. C. Achermann, L. Persani, A. Spada, J. Weiss, P. Beck-Peccoz, and J. L. Jameson An Alternate Translation Initiation Site Circumvents an Amino-Terminal DAX1 Nonsense Mutation Leading to a Mild Form of X-Linked Adrenal Hypoplasia Congenita J. Clin. Endocrinol. Metab., January 1, 2003; 88(1): 417 - 423. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Anjos, A. Nguyen, H. Ounissi-Benkalha, M.-C. Tessier, and C. Polychronakos A Common Autoimmunity Predisposing Signal Peptide Variant of the Cytotoxic T-lymphocyte Antigen 4 Results in Inefficient Glycosylation of the Susceptibility Allele J. Biol. Chem., November 22, 2002; 277(48): 46478 - 46486. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Rittig, C. Siggaard, M. Ozata, I. Yetkin, N. Gregersen, E. B. Pedersen, and G. L. Robertson Autosomal Dominant Neurohypophyseal Diabetes Insipidus due to Substitution of Histidine for Tyrosine2 in the Vasopressin Moiety of the Hormone Precursor J. Clin. Endocrinol. Metab., July 1, 2002; 87(7): 3351 - 3355. [Abstract] |