|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 274, Issue 27, 19109-19114, July 2, 1999
From the Laboratoire de Biochimie, Unité Mixte de Recherche
No. 7654, CNRS-Ecole Polytechnique,
91128 Palaiseau Cedex, France
The yihZ gene of Escherichia
coli is shown to produce a deacylase activity capable of
recycling misaminoacylated D-Tyr-tRNATyr. The
reaction is specific and, under optimal in vitro
conditions, proceeds at a rate of 6 s D-Amino acids are usually prevented from being
incorporated into proteins because aminoacyl-tRNA synthetases are
specific of L-amino acids (1-4). However, it was observed
early on that Escherichia coli and Bacillus
subtilis tyrosyl-tRNA synthetases can transfer
D-tyrosine to tRNATyr (5, 6). The same extent
of tRNATyr aminoacylation could be reached with the
L- and the D-enantiomers of the amino acid.
Some time later, extracts of E. coli, yeast, rabbit
reticulocytes, or rat liver were reported to contain an enzyme activity
capable of accelerating the hydrolysis of the ester linkage of
D-Tyr-tRNA in the production of free tRNA and D-tyrosine (7). Partially purified E. coli
deacylase could be shown to be distinct from tyrosyl-tRNA synthetase
(7) or peptidyl-tRNA hydrolase (8). It also cleaves
D-Phe-tRNAPhe and Gly-tRNAGly,
although more slowly than D-Tyr-tRNATyr.
L-Aminoacyl-tRNAs (L-Ile-tRNAIle,
L-Phe-tRNAPhe, and
L-Tyr-tRNATyr) are left intact. These findings
suggested that, although tRNATyr might be misaminoacylated
with D-tyrosine in vivo, misincorporation of
this D-amino acid into proteins was prevented by the
detected deacylase. Such a mechanism possibly helps living cells to
counterreact against the toxicity of D-amino acids found in
diet or produced by endogenous metabolism. It may also be a relic of
primitive forms of life when selection between D- and
L- amino acid isomers began.
In the present report, we describe the isolation and
overexpression of yihZ, the gene encoding the E. coli D-Tyr-tRNATyr deacylase. The
catalytic constants of the D-Tyr-tRNATyr
deacylase reaction are measured. Disruption of the deacylase gene did
not modify the generation time of the bacterium under standard
laboratory conditions. Nevertheless, a significant decrease in the
growth rate of yihZ null mutants could be obtained if
minimal medium was supplemented with D-tyrosine. Orthologs
of the E. coli deacylase gene occur in the genetic materials
of many cells including those of mammals and higher plants.
D-[methylene-3H]Tyrosine
(211 GBq/mmol) was custom-prepared by Amersham Pharmacia Biotech;
L-[14C]tyrosine was from NEN Life Science
Products; and unlabeled D-tyrosine was from Sigma. Sephadex
DEAE-A50 and Q-Sepharose were from Amersham Pharmacia Biotech.
Hydroxylapatite was from Bio-Rad and Trisacryl GF05 from IBF.
Preparation of Aminoacylated tRNATyr--
E.
coli tRNATyr2 was overexpressed in strain JM101TR from
a synthetic gene built according to a published procedure (9). The resulting bulk tRNA accepted 320 pmol of L-tyrosine per
A260 unit.
D-[3H]Tyr-tRNATyr was directly
prepared from the above tRNA extract. The reaction mixture (500 µl)
contained 20 mM Tris-HCl (pH 7.8), 7 mM
MgCl2, 2 mM ATP, 3.5 µM
D-[3H]tyrosine (18.5 GBq/mmol), 0.1 mM EDTA, 7.5 µM tRNATyr, and 1.2 µM purified E. coli tyrosyl-tRNA synthetase.
Reactions conditions (10 min, 28 °C) ensured a nearly complete
esterification of the D-amino acid to the tRNA. Note that
because of the occurrence of contaminating L-tyrosine (2%)
inside the D-[3H]tyrosine sample, the
reaction was performed with a concentration of tRNATyr in
excess over that of D-tyrosine. Under this condition and
provided the D-amino acid is fully incorporated in
tRNATyr, the proportion of
L-Tyr-tRNATyr (the favored product of
tyrosyl-tRNA synthetase) in the prepared D-Tyr-tRNATyr sample cannot exceed 2%. The
reaction was quenched by 500 µl of 600 mM sodium acetate
(pH 5.0) plus 500 µl of phenol saturated with a 100 mM
sodium acetate solution (pH 5.0). The solution was vigorously shaken
and centrifuged for 15 min at 15,000 × g. The interphase and the phenol phase were re-extracted with 250 µl of 300 mM sodium acetate (pH 5.0) and centrifuged as above. The two aqueous phases were pooled, precipitated with ethanol, and centrifuged (15 min at 15,000 × g). The pellet was
resuspended in 100 µl of 20 mM sodium acetate (pH 5.0)
containing 100 mM KCl and 0.1 mM EDTA. Finally,
the sample was chromatographed on a Trisacryl GF05 column (0.25 × 16 cm) equilibrated in the same solution. Resulting
D-Tyr-tRNATyr (100 pmol of D-amino
acid incorporated per A260 unit of tRNA) was
stored frozen at
L-[14C]Tyr-tRNATyr (80 pmol per
A260 unit) was prepared by the same procedure,
except that esterification was performed with 2 µM
L-[14C]tyrosine (18.4 GBq/mmol) and 0.5 µM tyrosyl-tRNA synthetase.
N-Acetylation of
D-[3H]Tyr-tRNATyr or
L-[14C]Tyr-tRNATyr was performed
as described earlier for the preparation of
diacetyl-lysyl-tRNALys (10).
Purification of D-Tyr-tRNATyr
Deacylase--
D-Tyr-tRNATyr deacylase was
purified from E. coli strain K37 (Table I). All buffers
contained 0.1 mM EDTA and 10 mM
2-mercaptoethanol. Cells were grown at 37 °C in 16 liters of 2× TY
medium and harvested by centrifugation for 35 min at 3,000 × g. The cell pellet was suspended in 20 mM
Tris-HCl (pH 7.8) at a cell density of 0.1 g of wet weight per ml
of buffer. Cells were disrupted by sonication (10 min, 0 °C), and
debris removed by centrifugation (35 min at 3,000 × g). Nucleic acids were precipitated by addition of
streptomycin (30 g/liter) to the supernatant, which was then
centrifuged for 35 min at 3,000 × g. The resulting
supernatant was brought to 50% ammonium sulfate saturation, left to
stand 1 h at 4 °C, and centrifuged (35 min, 3,000 × g). The pellet was discarded, and the supernatant was
brought to 80% ammonium sulfate saturation. After centrifugation for
35 min at 3,000 × g, the protein sample was dissolved
in 250 ml of 20 mM potassium phosphate (pH 8.0) and
dialyzed against 3 liters of the same buffer. The resulting solution
was applied on a column of Sephadex DEAE-A50 (4 × 12 cm),
equilibrated in 20 mM potassium phosphate (pH 8.0). Elution was carried out with a 3-liter linear gradient of 40-350
mM potassium phosphate (pH 8.0) at a flow rate of 100 ml/h.
Fractions containing activity were pooled, dialyzed against a 10 mM potassium phosphate (pH 6.75) buffer, and applied on a
hydroxylapatite column (3 × 13 cm) equilibrated in the same
buffer. Enzyme activity was recovered by using a 2× 500 ml linear
gradient of 10-400 mM potassium phosphate (pH 6.75), at a
flow rate of 50 ml/h. Fractions containing activity were pooled,
dialyzed against a 10 mM potassium phosphate buffer (pH
7.0), and applied on a Q-Sepharose Hi-Load column (3.2 × 10 cm,
from Amersham Pharmacia Biotech) equilibrated in the same buffer. This
column was eluted with a 1.5-liter linear gradient from 10 to 500 mM NaCl in the buffer of the column. One fraction from the
Q-Sepharose chromatography, accounting for 1/3 of the total recovered
activity, was concentrated batchwise on a Sephadex DEAE-A50 column
(0.25 × 4 cm). 100 µl of the recovered sample (600 µl) were
then loaded on a TSK G3000 SW HPLC column (0.75 × 30 cm, from
Tosohaas), which was eluted at a flow rate of 0.5 ml/min with 10 mM potassium phosphate (pH 7.0) containing 150 mM KCl.
N-terminal Sequencing of D-Tyr-tRNATyr
Deacylase--
Aliquots (200 µl) of each active fraction recovered
from the above TSK column were analyzed by
SDS-PAGE1 (11). After
migration, proteins were electrophoretically transferred on a ProBlot
membrane (from Applied Biosystems) and stained with Amido Black. About
10 protein bands were visible on the membrane. One of them, the
intensity of which was correlated with the
D-Tyr-tRNATyr deacylase activity measured in
the fractions, was cut and submitted to 10 cycles of Edman degradation
on an Applied Biosystems 473A Sequencer.
Purification of Tyrosyl-tRNA Synthetase--
E. coli
tyrosyl-tRNA synthetase was overexpressed in strain JM101TR harboring
plasmid pBR322 EcoTyrTS (Table I). Cells were grown
overnight in 1 liter of 2× TY medium containing 100 µg of ampicillin
per ml. Crude extract preparation and removal of nucleic acids by
streptomycin precipitation were performed as described above for the
purification of D-Tyr-tRNATyr deacylase. Then
the sample was brought to 70% ammonium sulfate saturation, left to
stand 1 h at 4 °C, and centrifuged for 20 min at 8,000 × g.
The protein sample was dissolved in 3 ml of 20 mM potassium
phosphate (pH 6.75), dialyzed overnight against 3 liters of the same
buffer, and applied on an 80-ml Q-Sepharose column (2.8 × 13 cm).
The column was eluted with a 1200-ml linear gradient of 100-400
mM KCl in the column buffer (flow rate 120 ml/h). Recovered fractions containing activity were immediately applied on a
hydroxylapatite column (3.8 × 18 cm) equilibrated in 20 mM potassium phosphate (pH 6.75). Tyrosyl-tRNA synthetase
activity was recovered at a flow rate of 100 ml/h by using a 5-liter
linear gradient of potassium phosphate (pH 6.75), from 40 to 200 mM. As judged by SDS-PAGE analysis, tyrosyl-tRNA synthetase
was at least 90% pure at this stage. The enzyme solution was
concentrated 100-fold by a batchwise chromatography on a Sephadex DEAE
column (2 × 3.2 cm) and then dialyzed against 20 mM
Tris-HCl (pH 7.8) containing 60% glycerol and stored at
Purification of the D-Tyr-tRNATyr
Deacylase from Overproducing E. coli Cells--
E. coli
strain JM101TR transformed by plasmid pYtH (Table I) was grown at
37 °C in 2 liters of 2× TY medium containing 200 µg of ampicillin
per ml. When the optical density of the culture reached 0.3 at 650 nm,
1 mM isopropyl-1-thio- Assay of D-Tyr-tRNATyr Deacylase
Activity--
Unless otherwise stated,
D-Tyr-tRNATyr deacylase activity was measured
for 5 min at 28 °C in 100-µl assays containing 50 nM
D-[3H]Tyr-tRNATyr, 20 mM Tris-HCl (pH 7.8), and 0.1 mM EDTA. The
reaction was quenched by the successive addition of 100 µl of 10%
trichloroacetic acid and 20 µl of carrier RNA from yeast (4 mg/ml).
The sample was centrifuged (5 min, 15,000 × g), and
200 µl of the supernatant were mixed with 6 ml of Picofluor
scintillation mixture (from Packard) and counted in a Beckman LS1801
counter. Concentration of D-Tyr-tRNATyr
deacylase was determined using the light-absorption coefficient calculated from the amino acid sequence of the protein (0.571 A280 units·mg
Km and kcat values were
derived from iterative non-linear fits to the theoretical Michaelis
equation to the experimental values, using the Levenberg-Marquardt
algorithm. Confidence limits on the fitted values were obtained by 100 Monte Carlo simulations followed by least squares fitting, using the
experimental standard deviations on individual measurements (12).
Cloning of the yihZ Gene--
The yihZ
gene was amplified by PCR using oligonucleotides DTyrFront
(CCGAATTCCATGATTGCATTAATTCAACGCGTAAC) and DTyrEnd
(CCAGCCAAGCTTTCATACCTGCAACCAGAATGTCACG) and genomic DNA from
strain K37. The amplified DNA fragment (460 bp) was purified using the
Qiagen Plasmid Mini Kit 100, digested by EcoRI and
HindIII, and inserted into the corresponding sites of
plasmid pKK223-3, to finally give plasmid pYtH. The sequence of the
insert was verified by DNA sequencing.
The EcoRI-HindIII fragment of plasmid pYtH
containing the yihZ gene was also subcloned between the
corresponding sites of plasmid pBluescript( Disruption of the yihZ Gene--
Disruption of the
yihZ gene was achieved by the procedure of Hamilton et
al. (13) using plasmid pMAK705, which contains a thermosensitive
replicon and a chloramphenicol resistance gene. A DNA fragment
containing the first 190 bp of the yihZ ORF, the kanamycin
resistance cassette from pUC4K (14), and the last 187 bp of the
yihZ ORF was inserted in pMAK705. E. coli strain K37 was transformed by the resulting plasmid (pKK4). The integration of
pKK4 into the chromosome was selected by plating transformants at
42 °C on LB agar medium containing chloramphenicol. After growth at
30 °C in liquid medium for ~30 generations, cells no longer carrying the plasmid in their chromosome were identified as
chloramphenicol-sensitive colonies at 42 °C. Approximately 60% of
selected cells were also kanamycin-resistant at 42 °C, thus
suggesting that (i) the Cloning of the Gene Encoding E. coli
D-Tyr-tRNATyr Deacylase--
The presence of
D-Tyr-tRNATyr hydrolytic activity in E. coli strain K37 was verified by adding cellular extract to
D- or L-Tyr-tRNATyr (Tris 20 mM (pH 7.8), 28 °C, final concentration of total protein in the assay: 20-200 µg/ml). The rate of deacylation of
D-Tyr-tRNATyr was at least 100-fold faster than
that of L-Tyr-tRNATyr. The activity of the
enzyme responsible for the specific
D-Tyr-tRNATyr hydrolysis was then followed
through chromatographies on Sephadex DEAE-A50, hydroxylapatite,
Q-Sepharose, and TSK 3000. At each step, a single peak of activity was
always recovered. According to the TSK gel filtration, the molecular
mass associated to the native D-Tyr-tRNATyr
deacylase activity could be estimated equal to 35 ± 3 kDa. In this experiment, marker proteins of known Mr
included lysyl-tRNA synthetase (18), truncated methionyl-tRNA
synthetase (19), ovalbumin, carbonic anhydrase, peptidyl-tRNA hydrolase
(20), and egg white lysozyme.
At the last step of the purification, the recovered enzyme was less
than 10% pure, according to SDS-PAGE analysis. However, along the
fractions recovered from the TSK column, the activity varied
proportionally to the intensity on the gel of one protein band having
an apparent mass of 16 ± 2 kDa. After transfer from the gel to a
polyvinylidene difluoride membrane, this protein material was submitted
to 10 cycles of Edman degradation. Its N-terminal sequence, MIALIQRVTR,
designated an open reading frame (ORF), yihZ, at 87.81 min
on the E. coli genetic map. The predicted Mr of the yihZ product (15, 950) was
in agreement with the Mr of the selected protein.
To assess whether the yihZ gene actually encoded the
D-Tyr-tRNATyr deacylase activity in the crude
extract, a DNA fragment encompassing this gene was amplified by PCR and
inserted into the expression vector pKK223-3. Upon transformation by
the resulting plasmid (pYtH), E. coli strain JM101TR
overexpressed one protein with the expected mass of ~16 kDa. In
addition, D-Tyr-tRNATyr deacylase activity in
crude extract was increased 1500-fold as compared with cells
transformed by the control plasmid pKK223-3 (Table
II). We therefore concluded that the
yihZ gene encodes the E. coli
D-Tyr-tRNATyr deacylase and that, upon TSK
chromatography in non-denaturing conditions, this deacylase shows the
mass of a dimer.
The yihZ gene is the third ORF of a four-gene operon also
including yihX, rbn (or yihY), and
yiiD (21) (Fig. 1). A putative promoter sequence can be recognized 30-63 bp upstream of the
yihX initiator codon. rbn codes for RNase BN, an
enzyme involved in the maturation of the 3'-end of tRNAs (22).
According to sequence comparison using BLAST program (23), the
yihX protein resembles various dehalogenases or epoxide
hydrolases. The yiiD product has no significant homology
with any other protein stored in the data bases.
Catalytic Constants of D-Tyr-tRNATyr
Deacylase--
D-Tyr-tRNATyr deacylase was
purified from strain JM101TR transformed by plasmid pYtH. After
successive chromatographies on Q-Sepharose and hydroxylapatite columns,
the enzyme was recovered homogeneous, as judged by SDS-PAGE analysis.
The initial rate of D-Tyr-tRNATyr hydrolysis,
in a 20 mM Tris-HCl buffer (pH 7.8) containing 0.1 mM EDTA, was increased 3-4-fold upon the addition of
either 50 mM KCl or 10 mM MgCl2
(Table III). Higher concentrations of
these salts inhibited the enzyme, and the simultaneous addition of both MgCl2 and KCl showed no effect. These results suggest that
ionic strength improves the rate of the reaction through the folding of
the tRNA structure. Accordingly, addition of 1 mM
spermidine also stimulated 3-fold the hydrolysis of
D-Tyr-tRNATyr (Table III). However, specific
features in the tRNA nucleotide sequence may also be involved in
substrate recognition, as indicated by the capacity of the
deacylase to hydrolyze D-tyrosyl oligonucleotides (7).
The activity of the deacylase in the presence of 5 mM
MgCl2 was insensitive to the further addition of 0.1 mM various metal ions like CaCl2,
CoCl2, MnCl2, or NiCl2. Only
ZnCl2 showed a slight stimulatory effect (Table III).
The initial rate of hydrolysis by the deacylase was measured at 5 mM MgCl2 as a function of
D-Tyr-tRNATyr concentration. The kinetics were
Michaelian, with a Km value of 1.0 ± 0.15 µM and a maximal rate of 6.0 ± 0.5 s Hydrolysis of D-Tyr-tRNATyr by Tyrosyl-tRNA
Synthetase--
Because several aminoacyl-tRNA synthetases can
hydrolyze aminoacyl-tRNAs (24-26), the AMP-independent deacylation of
D-Tyr-tRNATyr by tyrosyl-tRNA synthetase
deserved attention. Nevertheless, this reaction was so slow that, in
order to measure initial rates of hydrolysis, synthetase concentrations
(0.2-2.5 µM) much higher than the
D-Tyr-tRNATyr substrate concentration (50 nM) had to be used in the assay. Michaelis constants of the
reaction could be estimated, however, by varying the enzyme
concentration in the assay. kcat and
Km values of 1.5 × 10 Specificity of D-Tyr-tRNATyr
Deacylase--
D-Tyr-tRNATyr deacylase and
peptidyl-tRNA hydrolase recognize an ester linkage between the
3'-terminal adenosine of tRNA and the carboxyl group of an amino acid.
Nevertheless, D-Tyr-tRNATyr deacylase does not
hydrolyze L-aminoacyl-tRNAs, on the one hand (7), and
peptidyl-tRNA hydrolase is specific for
N-blocked-L-amino acids, on the other hand (8).
By using D-Tyr-tRNATyr,
L-Tyr-tRNATyr,
N-acetyl-D-Tyr-tRNATyr, or
N-acetyl-L-Tyr-tRNATyr as
substrates, these specificities could be confirmed (Table IV). In particular, N-blocked
D- or L-aminoacylated tRNAs fully resisted the
action of D-Tyr-tRNATyr deacylase (Table
IV).
Notably, strain JM101TR transformed by pYtH did not grow when LB
ampicillin plates contained 1 mM
isopropyl-1-thio- Occurrence of yihZ Orthologs in Various Genomes--
Searches on
the GenBankTM/EMBL data bases using BLAST program (23)
revealed the presence of yihZ orthologs in several
proteobacteria (Hemophilus influenzae, Pseudomonas
aeruginosa, Vibrio cholerae, etc.), in various
Gram-positive bacteria (Streptococcus equisimilis, Staphylococcus aureus, Mycobacterium
tuberculosis, etc.), as well as in Deinococcus radiodurans,
Thermotoga maritima, Aquifex aeolicus, fungi
(Saccharomyces cerevisiae), animals (Caenorhabditis
elegans), and higher plants (Arabidopsis thaliana).
Partial cDNA sequences from expressed sequence tags also indicate
the presence of genes homologous to yihZ in mouse and man.
On the other hand, genes related to yihZ could not be
recognized in the following complete genome sequences:
Helicobacter pylori, Rickettsia prowazekii,
Mycoplasma genitalium, Mycoplasma pneumoniae,
Synechocystis sp. PCC6803, Borrelia burgdorferi,
Treponema pallidum, Chlamydia trachomatis or in any sequenced
archaebacterial genome.
The case of B. subtilis is special. In this organism, a DNA
fragment encodes a protein sequence clearly homologous to that of the
yihZ product. However, the lack of initiation codon renders the translation of this putative protein unlikely, in agreement with
the earlier observation that D-Tyr-tRNATyr
deacylase activity could not be detected in a B. subtilis
crude extract (7). One possible reason is that the homolog of
yihZ in B. subtilis is not functional.
Inactivation of the Chromosomal yihZ Gene--
To assess the
importance of D-Tyr-tRNATyr deacylase in cell
function, the yihZ gene of E. coli strain K37 was
inactivated (Table I). For this purpose, a kanamycin resistance
cassette was placed inside the chromosomal yihZ gene of
strain K37, whereas a wild-type copy of the gene was retained on a
plasmid bearing a thermosensitive replicon. The resulting strain grew
at 42 °C, a non-permissive temperature for plasmid replication. As a
consequence, the thermosensitive plasmid carrying the wild-type copy of
the yihZ gene was spontaneously lost at this temperature.
The resulting
Upon inactivation of the yihZ gene, the
D-Tyr-tRNATyr deacylase activity in crude
extracts of the strain K37
The generation times of the strains K37
To confirm that the inhibition of growth by D-tyrosine
resulted from the yihZ gene disruption, strain
K37
Transport of D-tyrosine in E. coli by the
general aromatic amino acid permease is inhibited by the addition of
either L-tryptophan or L-tyrosine (27). In
agreement with an involvement of this permease in the uptake of
D-tyrosine, we observed that supplementation of the M9
medium with 0.2 mM L-tyrosine or 1 mM L-tryptophan fully suppressed the negative
effect exerted by 2.4 mM D-tyrosine on the
growth of the strain K37 D-Amino Acid Dehydrogenase Protects Against the
D-Tyrosine Toxicity--
Neurospora crassa
mutants with decreased D-amino acid oxidase activity have
been reported to be more sensitive to the toxicity of
D-tyrosine than their parental strains (28). Consequently, we also studied the effect of the disruption of the yihZ
gene in an E. coli strain with reduced D-amino
acid dehydrogenase activity (EC989). The dadA
In the absence of external D-tyrosine, the generation times
of strains EC989 (dadA), EC989d
(dadA+), EC989
In Table V, the two couples of strains K37/K37 The D-Tyr-tRNATyr deacylase characterized
in this study displays the specificity and the rate parameters expected
for an efficient recycling of D-Tyr-tRNATyr
into free tRNATyr and, therefore, for defending the cell
against misincorporation of D-tyrosine into proteins.
Accordingly, in the absence of functional yihZ gene,
D-tyrosine becomes toxic for the bacterium even though all
steps of the elongation pathway in translation, from tRNA aminoacylation to peptide bond synthesis, are believed to favor the
L-isomers of amino acids (29). This toxicity of
D-tyrosine is improved by the concomitant inactivation of
the gene of D-amino acid dehydrogenase. Deamination by the
latter enzyme enables D-tyrosine to be recycled into
4-hydroxyphenylpyruvate, a precursor of L-tyrosine. Consequently, the absence of this enzyme activity stabilizes
intracellular D-tyrosine and exerts a synergistic effect on
the yihZ phenotype.
To transport D-tyrosine inside E. coli cells,
the general aromatic amino acid permease encoded by the aroP
gene is necessary (27). In S. cerevisiae, the uptake of
D-tyrosine is sustained by the general amino acid permease
encoded by the gap gene. L-Amino acid starvation
and, depending on the yeast strain, deprivation of ammonium ions are
necessary to promote D-tyrosine transport and, as a
consequence, toxicity of this amino acid (30).
In the case of B. subtilis, toxicity of
D-tyrosine is exacerbated by the lack of functional
D-Tyr-tRNATyr deacylase gene. Such a toxicity
was indeed observed in strains which efficiently transport this
D-amino acid (31). Incorporation of D-tyrosine
into proteins could be established (32). In addition, D-tyrosine impairs L-tyrosine biosynthesis
through the inhibition of prephenate dehydrogenase (32).
Several D-amino acids like D-methionine,
D-phenylalanine, and D-tryptophan are described
to be toxic for E. coli. In this case, the toxicity is
believed to ensue from incorporation of the D-amino acids
in cell walls (33, 34) rather than from formation of
D-aminoacyl-tRNAs. However, if such misaminoacylated tRNAs
occur in vivo, they are possibly recycled by specific
hydrolases. Indeed, earlier in vitro studies indicated that
the specificity of D-Tyr-tRNATyr deacylase was
broad enough to ensure the recognition of
D-Phe-tRNAPhe or Gly-tRNAGly (7).
In this context, our preliminary results (not shown) suggest that the
growth of strain K37 Gene organization in E. coli suggests that the
yihZ gene can be expressed together with the yihX
cistron. The product of the latter resembles a detoxification protein.
Association of other detoxifying functions with that of the deacylase
makes sense for the homeostasis of the bacterium. One other cistron,
close to yihZ, is yihY or rbn. It
produces an RNase involved in the maturation of functional tRNA
molecules. Therefore, one can imagine that, in response to some
starvation conditions involving the sequestration of tRNAs under the
form of esters of D-amino acids, for instance, the cell
must respond by both accelerating the onset of new tRNA molecules and
recycling the D-Tyr-misesterified tRNAs. As a benefit of
this adaptation, the cell would escape the risk of incorporation of
D-amino acids in nascent proteins.
In the H. influenzae genome, the yihZ cistron is
adjacent to mioC, a gene which in the E. coli
genome context is close to oriC. In A. aeolicus,
yihZ appears to be an isolated gene. However, the idea of a
physiological link between tRNA starvation and the regulation of the
expression of D-Tyr-tRNATyr deacylase is again
suggested by the genome organizations of B. subtilis,
S. equisimilis, and S. aureus. In these bacteria,
the yihZ ortholog is systematically located immediately
downstream from the rel gene on the chromosome. As already
noted above, however, the functionality of the deacylase gene in the
B. subtilis genome is questionable.
D-Tyr-tRNATyr deacylase appears to be
widespread in the living world. Possibly, the description of more
genomes from more organisms will bring additional indications on the
physiological responses involving the mobilization and function of this
deacylase activity.
We thank Jacques d'Alayer and
Marilyne Davi for determining the N-terminal sequence of the
D-Tyr-tRNATyr deacylase, Hugues Bedouelle for
the gift of plasmid pBR322 EcoTyrTS, and Antoine Danchin for
providing us with strains FB8 and FB8r.
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The abbreviations used are:
PAGE, polyacrylamide
gel electrophoresis;
ORF, open reading frame;
PCR, polymerase chain
reaction;
bp, base pair.
Functional Characterization of the
D-Tyr-tRNATyr Deacylase from Escherichia
coli*
,
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
1 with a
Km value for the substrate equal to 1 µM. Cell growth is sensitive to interruption of the
yihZ gene if D-tyrosine is added to minimal
culture medium. Toxicity of exogenous D-tyrosine is
exacerbated if, in addition to the disruption of yihZ, the gene of D-amino acid dehydrogenase (dadA) is
also inactivated. Orthologs of the yihZ gene occur in many,
but not all, bacteria. In support of the idea of a general role of the
D-Tyr-tRNATyr deacylase function in the
detoxification of cells, similar genes can be recognized in
Saccharomyces cerevisiae, Caenorhabditis elegans, Arabidopsis thaliana, mouse, and man.
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
20 °C.
20 °C.
-D-galactopyranoside was added, and growth was continued overnight. Conditions for crude
extract preparation, removal of nucleic acids, and ammonium sulfate
precipitation were the same as those used for the purification of the
deacylase from the strain K37. Further chromatographies on Q-Sepharose
and hydroxylapatite columns were similar to those of tyrosyl-tRNA
synthetase purification. However, in the case of the deacylase (i) all
buffers were supplemented with 0.1 mM EDTA and 10 mM 2-mercaptoethanol, (ii) NaCl rather than KCl was used in
the elution buffer of the Q-Sepharose column, and (iii) the potassium
phosphate linear gradient for the elution of the hydroxylapatite column
was from 10 to 400 mM. Recovered deacylase was concentrated
by an ammonium sulfate precipitation (80% saturation). After
centrifugation at 10,000 × g for 30 min, the pellet
was dialyzed against a 20 mM Tris-HCl buffer (pH 7.8)
containing 60% glycerol, 0.1 mM EDTA and 10 mM
2-mercaptoethanol, and stored at 20 °C.
1·ml).
)KS (pBS). The resulting
plasmid, designated pBSKSyihZ, harbored the yihZ gene in the
opposite orientation to the lacZ promoter.
yihZ::kan mutation carried by pKK4 was now located on the chromosome and (ii) the
yihZ gene was not essential to the growth of E. coli. After subsequent growth at 42 °C, the loss of the
thermosensitive plasmid was verified by ensuring that the cells had
become chloramphenicol-sensitive at 30 °C. One of the resulting
clones was named K37TyrH and was used in further studies. Disruption
of the yihZ gene in this clone was confirmed by PCR
amplification of chromosomal DNA using the above oligonucleotides
DTyrFront and DTyrEnd. The yihZ::kan
mutation could be transferred from strain K37TyrH into strains
EC989, FB8, and FB8r (Table I) by P1
transduction. Resulting strains were named EC989TyrH, FB8TyrH,
and FB8rTyrH, respectively. Strain K37TyrHrecA was further
obtained by P1 transduction of the
recA938::cat mutation from the
strain GW5552 (15). Strains EC989d and EC989dTyrH were constructed
by P1 transduction of the dadA+ allele, from
strain K37 into strain EC989 or EC989TyrH, respectively. In the
latter case, selection of transductants was performed on M9 minimal
plates containing 20 mM L-alanine as carbon
source (16, 17).
Bacterial strains and plasmids
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
D-Tyr-tRNATyr deacylase activity in various E. coli
strains
-D-galactopyranoside was
added when the optical density of the culture reached 0.3 at 650 nm.
Specific deacylase activities were measured in crude extracts obtained
by sonication of cells resuspended at an optical density of 100 at 650 nm. Final protein concentration in the extracts was 5-10 mg/ml.
View larger version (12K):
[in a new window]
Fig. 1.
Map of the E. coli
chromosomal region encompassing yihZ and
structures of plasmids pYtH and pKK4. The organization of the
four-gene yihX-rbn-yihZ-yiiD operon is derived from Plunkett
et al. (21). The direction of transcription is indicated by
an arrow. A putative promoter sequence (P) can be
recognized 30-63 bp upstream of the yihX initiator codon. A
460-bp DNA fragment harboring the yihZ gene was amplified by
PCR and inserted between the EcoRI and HindIII
sites of pKK223-3, to give pYtH. The plasmid pKK4, which was used to
inactivate the chromosomal yihZ gene, was derived from
pMAK705. It harbored the first 190 bp of yihZ, the kanamycin
resistance cassette from pUC4K (14), and the last 187 bp of
yihZ.
Activity of D-Tyr-tRNATyr deacylase under various
ionic conditions
1. Under the same assay conditions, the spontaneous
chemical hydrolysis of D-Tyr-tRNATyr occurred
at a rate of 2.2 × 104 s1. Addition
of uncharged tRNA (KI >20 µM) or of
free D-tyrosine (KI >2 mM)
had no effect on the enzyme activity.
3
s1 and 0.2 µM, respectively, were deduced.
Therefore, although D-Tyr-tRNATyr strongly
interacts with tyrosyl-tRNA synthetase, its rate of deacylation by this
enzyme remains slow, being only 7-fold faster than that of spontaneous
chemical hydrolysis.
Substrate specificities of E. coli D-Tyr-tRNATyr
deacylase and peptidyl-tRNA hydrolase
-D-galactopyranoside, i.e.
under conditions of full overexpression of yihZ. One
possible interpretation is that an excess of cellular deacylase
inhibits the growth of E. coli through hydrolysis of some
aminoacylated tRNAs. One possible candidate is Gly-tRNAGly,
which was shown in vitro to be sensitive to the action of
the deacylase (7).
yihZ::kan chromosomal mutant strain was named K37TyrH.
TyrH was reduced by at least 10-fold
(Table II). The residual activity is likely to be contributed by the
tyrosyl-tRNA synthetase. Actually, this enzyme, which hydrolyzes
D-Tyr-tRNATyr at a maximal rate of 1.5 × 103 s1, is present at a concentration of
~1 µM in the cell extract. For comparison, using the
catalytic constant of purified deacylase, the concentration of the
yihZ product in the extract of K37 can be calculated on the
order of 30 nM. We therefore conclude that in the E. coli wild-type context, the yihZ gene product is the only protein capable of efficiently deacylating
D-Tyr-tRNATyr.
TyrH (yihZ) and
K37 (yihZ+) were compared. They were identical
in either 2× TY or LB-rich medium and in M9 minimal medium. LB medium
under anaerobic conditions was also investigated, without result. In
contrast, we observed that, if added at 2.4 mM (near from
its limit of solubility) to M9 minimal medium, D-tyrosine
significantly increased the generation time of the yihZ
mutant (92 min instead of 69) but did not change that of the control
yihZ+ strain (Table
V).
Effect of D-tyrosine on the growth of various E. coli
strains
TyrHrecA was transformed with plasmid pBSKSyihZ, which carries
an intact yihZ copy. As expected, addition in
trans of this plasmid abolished the growth inhibition caused
by D-tyrosine (Table V). Control plasmid pBS had no effect.
During exponential growth in M9 medium, an aliquot of the culture
was withdrawn to measure the deacylase activity. In cells
transformed by pBSKSyihZ or pBS, the
D-Tyr-tRNATyr deacylase activity amounted to
440 and 14 units per mg of total protein, respectively. Under the same
growth conditions, the deacylase activity in the strain K37 was equal
to 130 units/ mg.
TyrH (Table V).
yihZ::kan double mutant
(EC989TyrH) was obtained by P1 transduction of the
yihZ::kan mutation from strain
K37TyrH into strain EC989. However, the parental strain EC972
(dadA+) could not be used as a control because
we observed that it was an auxotroph for tryptophan while EC989 was a
prototroph, and the protection exerted by tryptophan against
D-tyrosine transport precluded the comparison of this
couple of strains. Therefore, dadA+ derivatives of EC989 and
EC989TyrH (EC989d and EC989dTyrH, respectively) were constructed
by P1 transduction. In all the yihZ::kan strains, deacylase
activity in crude extracts was lowered by a factor greater than 10-fold
when compared with the corresponding yihZ+
strains. This factor is identical to that measured when comparing K37TyrH and K37 (Table II).
TyrH (dadA
yihZ), and EC989dTyrH (dadA+
yihZ) were the same (80 ± 2 min). In the presence
of 2.4 mM D-tyrosine, the growth of the double
dadA yihZ mutant was markedly slowed (230 min)
as compared with strain EC989 (106 min). In the dadA+ context, the effect of the disruption of
yihZ is much less pronounced (136 versus 90 min).
These measurements, summarized in Table V, therefore indicate that the
toxicity of D-tyrosine is reinforced in the absence of
D-amino acid dehydrogenase activity.
TyrH and
EC989d/EC989dTyrH show small discrepancies in the amplitudes of the
response to the D-amino acid. The consequence of the
disruption on the growth appeared more pronounced in the EC989d context
(136 versus 90 min) than in the K37 one (92 versus 71 min). Such a variation may reflect the different
genotypes of the strains (Table I). To exclude an interference of the
relA1 mutation with the behavior of the strain EC989d, the
following experiment was designed. The
yihZ::kan mutation was transduced
into the relA+ strain FB8 and into its isogenic
relA1 mutant FB8r. The generation times of the four
resulting strains were measured in the presence or absence of added
D-tyrosine. Values in Table V do not reveal the occurrence
of a relation between the D-amino acid toxicity and the
relA character in a dadA+ context.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
TyrH
(yihZ::kan) exhibits enhanced
sensitivity to the presence of D-tryptophan when compared with K37 (yihZ+). At this stage, we may
hypothesize that D-tryptophan is esterified to
tRNATrp and that it is further released from
D-Trp-tRNATrp by the
D-Tyr-tRNATyr hydrolase. We also noticed that
the toxicity of D-methionine or
D-phenylalanine was not improved upon disruption of
yihZ. We conclude that either these D-amino
acids are not or are weak substrates of the corresponding
aminoacyl-tRNA synthetases, or that, if D-aminoacylated tRNAs occur, they are processed by hydrolases distinct from
D-Tyr-tRNATyr deacylase. In cases where such
deacylases would exist, they will not present any sequence homology
with the E. coli yihZ gene product.
ACKNOWLEDGEMENTS
FOOTNOTES
To whom correspondence should be addressed. Tel.: 33 1 69 33 41 81; Fax: 33 1 69 33 30 13; E-mail:
plateau{at}coli.polytechnique.fr.
ABBREVIATIONS
REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  S. Wydau, G. van der Rest, C. Aubard, P. Plateau, and S. Blanquet Widespread Distribution of Cell Defense against D-Aminoacyl-tRNAs J. Biol. Chem., May 22, 2009; 284(21): 14096 - 14104. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Takaku and M. Nashimoto Escherichia coli tRNase Z can shut down growth probably by removing amino acids from aminoacyl-tRNAs Genes Cells, November 1, 2008; 13(11): 1087 - 1097. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Kemp, B. Bae, J. P. Yu, M. Ghosh, M. Leffak, and S. K. Nair Structure and Function of the c-myc DNA-unwinding Element-binding Protein DUE-B J. Biol. Chem., April 6, 2007; 282(14): 10441 - 10448. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Wydau, M.-L. Ferri-Fioni, S. Blanquet, and P. Plateau GEK1, a gene product of Arabidopsis thaliana involved in ethanol tolerance, is a D-aminoacyl-tRNA deacylase Nucleic Acids Res., February 16, 2007; 35(3): 930 - 938. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Ling, H. Roy, and M. Ibba Mechanism of tRNA-dependent editing in translational quality control PNAS, January 2, 2007; 104(1): 72 - 77. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M.-L. Ferri-Fioni, M. Fromant, A.-P. Bouin, C. Aubard, C. Lazennec, P. Plateau, and S. Blanquet Identification in Archaea of a Novel D-Tyr-tRNATyr Deacylase J. Biol. Chem., September 15, 2006; 281(37): 27575 - 27585. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. J. RIGDEN Archaea recruited D-Tyr-tRNATyr deacylase for editing in Thr-tRNA synthetase RNA, December 1, 2004; 10(12): 1845 - 1851. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Soutourina, J. Soutourina, S. Blanquet, and P. Plateau Formation of D-Tyrosyl-tRNATyr Accounts for the Toxicity of D-Tyrosine toward Escherichia coli J. Biol. Chem., October 8, 2004; 279(41): 42560 - 42565. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Fromant, M.-L. Ferri-Fioni, P. Plateau, and S. Blanquet Peptidyl-tRNA hydrolase from Sulfolobus solfataricus Nucleic Acids Res., June 15, 2003; 31(12): 3227 - 3235. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Lim, A. Tempczyk, N. Bonander, J. Toedt, A. Howard, E. Eisenstein, and O. Herzberg A Catalytic Mechanism for D-Tyr-tRNATyr Deacylase Based on the Crystal Structure of Hemophilus influenzae HI0670 J. Biol. Chem., April 4, 2003; 278(15): 13496 - 13502. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Min, J. T. Pelaschier, D. E. Graham, D. Tumbula-Hansen, and D. Soll Transfer RNA-dependent amino acid biosynthesis: An essential route to asparagine formation PNAS, March 5, 2002; 99(5): 2678 - 2683. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M.-L. Ferri-Fioni, E. Schmitt, J. Soutourina, P. Plateau, Y. Mechulam, and S. Blanquet Structure of Crystalline D-Tyr-tRNATyr Deacylase. A REPRESENTATIVE OF A NEW CLASS OF tRNA-DEPENDENT HYDROLASES J. Biol. Chem., December 7, 2001; 276(50): 47285 - 47290. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Soutourina, S. Blanquet, and P. Plateau D-Tyrosyl-tRNATyr Metabolism in Saccharomyces cerevisiae J. Biol. Chem., April 14, 2000; 275(16): 11626 - 11630. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Ibba and a. D. Söll Quality Control Mechanisms During Translation Science, December 3, 1999; 286(5446): 1893 - 1897. [Abstract] [Full Text]
|
|
|
|
|
|
J. Soutourina, P. Plateau, and S. Blanquet Metabolism of D-Aminoacyl-tRNAs in Escherichia coli and Saccharomyces cerevisiae Cells J. Biol. Chem., October 13, 2000; 275(42): 32535 - 32542. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Soutourina, S. Blanquet, and P. Plateau Role of D-Cysteine Desulfhydrase in the Adaptation of Escherichia coli to D-Cysteine J. Biol. Chem., October 26, 2001; 276(44): 40864 - 40872. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |