| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 274, Issue 27, 19204-19210, July 2, 1999
From the Departments of To evaluate the contribution of the macrophage
low density lipoprotein receptor (LDLR) to atherosclerotic lesion
formation, we performed bone marrow transplantation studies in
different mouse strains. First, LDLR( The development of atherosclerosis involves the recruitment of
monocyte-derived macrophages into the subendothelial space and their
transformation into lipid-laden foam cells (1). Because foam cell
transformation is a consequence of an excessive accumulation of lipid
droplets in the cytoplasm, it has long been hypothesized that
macrophage lipoprotein receptor expression may play a role in this
process. The macrophage expresses several receptors capable of taking
in native or modified lipoproteins, including the low density
lipoprotein receptor (LDLR)1
(2), the LDLR-related protein, and the scavenger receptor (3). The
association between elevated levels of LDL cholesterol and increased
risk of atherosclerosis suggests that the LDLR might mediate the
cholesterol accumulation by macrophage-derived foam cells. However, the
uptake of fresh LDL by macrophages is at least one order of magnitude
lower than that of acetylated LDL, suggesting that scavenger receptor
expression is physiologically more relevant than LDLR expression in
this cell type (4, 5). Observations from studies both in
vivo and in vitro indicate that macrophage and
leukocyte LDLR expression is not required for foam cell formation (4,
6, 7). Leukocytes express little LDLR activity, which is promptly
down-regulated by incubation with LDL (8). Similarly, macrophage
expression of LDLR is limited (2, 9) and easily inhibited by excess
cholesterol, suggesting that the physiologic contribution of the LDLR
to lipoprotein uptake by the macrophage may be limited in the presence
of elevated LDL cholesterol levels (4). Most importantly, individuals
with homozygous familial hypercholesterolemia, who lack functional
LDLR, show accumulation of cholesteryl esters in macrophages (10), a
proof that the LDLR is not necessary for foam cell transformation of
macrophages. However, Tabas and co-workers (11, 12) have reported that J774 cells and mouse peritoneal macrophages bind and internalize unmodified LDL. In addition, the macrophage LDLR has the ability to
take up other atherogenic lipoproteins, such as Murine bone marrow transplantation (BMT) studies have been used to
examine the role of the leukocyte LDLR in lipoprotein metabolism and
atherosclerosis. LDLR deficient ( The goal of the current study was to examine whether the reconstitution
of macrophage LDLR activity in LDLR( Animals--
A colony of C57BL/6J mice is established in our
animal facility. The LDLR( BMT--
A week before and 2 weeks following BMT, 100 mg/liter
neomycin and 10 mg/liter polymyxin B sulfate (both from Sigma) were added to the acidified water. Bone marrow was collected from donor mice
by flushing femurs with RPMI 1640 media containing 2% fetal bovine
serum and 5 units/ml heparin (Sigma). Recipient mice were lethally
irradiated (9 Gy), and 4 h later, 5 × 106 bone
marrow cells in 0.3 ml were transplanted by tail vein injection.
Serum Cholesterol and Triglycerides Analysis--
Nonfasting
mice were anesthetized with methoxyflurane (Mallinckrodt Veterinary,
Inc., Madelein, IL) and blood samples were collected by retro-orbital
venous plexus puncture. Serum cholesterol levels were determined using
Sigma kit 352 adapted for a microtiter plate assay as described (23).
Serum triglyceride levels were determined using Sigma kit 339 on a
microplate reader, and absorbance was read at 540 nm.
Separation of Lipoproteins--
Mouse serum was fractionated on
a Superose 6 column (Amersham Pharmacia Biotech) using an HPLC system
model 600 (Waters, Milford, MA). A 100-µl aliquot of serum was
injected onto the column and separated using a buffer containing 0.15 M NaCl, 0.01 M Na2HPO4, 0.1 mM EDTA (pH 7.5) at a flow rate of 0.5 ml/min. Forty
0.5-ml fractions were collected, and fractions 11-40 were analyzed for cholesterol content. Fractions 13-17 contain VLDL and chylomicrons; fractions 18-24 contain intermediate density lipoproteins (IDL) and
LDL; fractions 25-31 contain high density lipoproteins (HDL), and
fractions 32-40 contain nonlipoprotein-associated serum proteins.
Quantitation of Arterial Lesions--
Mice were sacrificed and
flushed with 30 ml of saline by slow injection through the left cardiac
ventricle. The heart with ascending aorta was embedded in OCT and
snap-frozen in liquid N2. Cryosections of 10-µm thickness
were taken from the region of the proximal aorta starting from the end
of the aortic sinus and for 300 µm distally, according to the
procedure of Paigen et al. (24). Cryosections were stained
with Oil-Red-O and counterstained with hematoxylin. Quantitative
analysis of lipid-stained lesions was performed using an Imaging System
KS 300 (Release 2.0, Kontron Electronik GmbH). Color threshold was used
to delimit the Oil-Red-O stained lesion area, and the lesion area was
determined as mean lesion area per section in square micrometers.
Immunocytochemical Analysis--
Immunocytochemical staining of
tissue samples for LDLR and macrophages was performed on 5-µm thick
serial cryosections from the proximal aortas. Sections were fixed in
acetone and incubated with either rabbit antibodies to bovine LDLR,
which cross-react with mouse LDLR (Rb.455, a gift from Dr. Innerarity,
Gladstone Institute, San Francisco, CA; and Ab638, a gift from Dr.
Herz, University of Texas, Southwestern Medical Center, Dallas, TX) or
with a rat monoclonal antibody to mouse macrophages, MOMA-2 (Accurate
Chemicals, Westbury, NY). Primary antibodies were used at dilutions of
1:250, 1:300 and 1:30, respectively, and incubated overnight at
4 °C. After washing, the sections were treated with goat
biotinylated antibodies to rabbit and rat IgGs (both from PharMingen,
San Diego, CA) and incubated with avidin-biotin complex labeled with
alkaline phosphatase (Vector Laboratories, Inc., Burlingame, CA). The
enzyme activity was visualized with Fast Red TR/naphthol AS-NX
substrate (Sigma). Sections were counterstained with hematoxylin.
Nonimmune rabbit and rat sera were used as negative controls in the
place of primary antibodies. Photomicroscopy was performed on a Zeiss
Axiophot with Plan-Neofluar objectives (Zeiss, Thornwood, NY).
In Situ Hybridization--
A 167-base insert consisting of
nucleotides 2106-2273 of the mouse LDLR cDNA (primers were gift
from Dr. Ishibashi, University of Tokyo, Japan) was cloned into
pBluescript II SK phagemid (Stratagene, La Jolla, CA). Another 59-base
fragment consisting of nucleotides 735-794 of the mouse LDLR gene was
amplified using primers (CAGTGCTCCTCATCTGACTTGTC and
GTGGTAGCAGTGAGTGTATCC), and cloned into pGEM-T vector (Promega, Madison, WI). Antisense and sense riboprobes for LDLR were labeled with
35S-uridine (RNA transcription kit, Stratagene).
Cryosections (5-µm thick) were fixed for 30 min in 4%
paraformaldehyde-phosphate-buffered saline, treated for 15 min with
proteinase K (5 µg/ml), prehybridized for 1 h at 55 °C in a
mixture (0.3 M NaCl, 20 mM Tris, pH 8.0, 5 mM EDTA, 1× Denhardt's solution, 10 mM
dithiothreitol, 10% dextran sulfate, 50% formamide) and, after
addition of the riboprobes, incubated overnight at 55 °C. The
sections were then treated for 30 min with RNase A (20 µg/ml),
washed, coated with autoradiographic emulsion (Kodak NTB-2) and exposed
for 2-3 weeks. After development, the slides were counterstained with
hematoxylin. The sense probe was used in parallel as a negative control.
The role of the macrophage LDLR in foam cell formation and
atherosclerosis was examined in two different murine bone marrow transplantation models, using dietary conditions which differed significantly in ambient levels of plasma lipids and lipoproteins. The
duration of the atherogenic diet in each model was selected to induce
lesions consisting primarily of macrophage-derived foam cells. For a
model of severe hypercholesterolemia, lethally irradiated (9 Gy) male
LDLR( In the LDLR( Consistent with our previous results, examination of serum cholesterol
and triglyceride levels in the C57BL/6 mice transplanted with either
LDLR(+/+) or LDLR(
A Direct Role for the Macrophage Low Density Lipoprotein Receptor
in Atherosclerotic Lesion Formation*
§¶,
,, and**
Medicine, ** Pathology, and
§ Pharmacology, Vanderbilt University Medical Center,
Nashville, Tennessee 37232
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
/) mice were transplanted
with either LDLR(+/+) marrow or LDLR(/) marrow and were challenged
with an atherogenic Western type diet. The diet caused severe
hypercholesterolemia of a similar degree in the two groups, and no
differences in the aortic lesion area were detected. Thus, macrophage
LDLR expression does not influence foam cell lesion formation in the
setting of extreme LDL accumulation. To determine whether macrophage
LDLR expression affects foam cell formation under conditions of
moderate, non-LDL hyperlipidemia, we transplanted C57BL/6 mice with
either LDLR(/) marrow (experimental group) or LDLR(+/+)
marrow (controls). Cholesterol levels were not significantly different
between the two groups at baseline or after 6 weeks on a butterfat
diet, but were 40% higher in the experimental mice after 13 weeks,
mostly due to accumulation of 
-very low density lipoprotein
(-VLDL). Despite the increase in cholesterol levels, mice receiving
LDLR(/) marrow developed 63% smaller lesions than controls,
demonstrating that macrophage LDLR affects the rate of foam cell
formation when the atherogenic stimulus is -VLDL. We conclude that
the macrophage LDLR is responsible for a significant portion of lipid
accumulation in foam cells under conditions of dietary stress.
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
-very low density
lipoprotein (-VLDL) and chylomicron remnants (13-15). In fact,
-VLDL is the only naturally occurring (unmodified) lipoprotein that
induces transformation of macrophages into foam cells (16, 17).
Therefore, macrophage LDLR expression may have a relevant impact in the
metabolism and clearance of -VLDL and may modulate foam cell
formation when the main atherogenic stimulus is the diet-induced remnant.
/) mice have increased plasma LDL
levels and enhanced susceptibility to diet-induced atherosclerosis (18,
19). We and others (20, 21) have shown that reconstitution of wild-type
LDLR expression in the hematopoietic system of LDLR(/) mice
(LDLR(+/+)
LDLR(/)), has no measurable effects on plasma
lipoprotein levels and turnover time. We also demonstrated that
elimination of LDLR expression from the hematopoietic cells C57BL/6
mice has no effect on plasma lipid parameters on a normal chow diet
(20). Based on the qualitative observation that both
LDLR(/)LDLR(/) and LDLR(+/+)LDLR(/) mice
developed extensive atherosclerosis in the aortic valves after 20 weeks
on a diet containing 1.25% cholesterol and 0.5% sodium cholate,
Boisvert et al. (21) have suggested that the leukocyte
LDLR may not play a major role in lesion development. Herijgers
et al. (22) found similar results in
LDLR(/)LDLR(/) and LDLR(+/+)LDLR(/) mice after 20 weeks on a diet containing 1.0% cholesterol. The dietary conditions in
both of these studies induced severe hypercholesterolemia and complex
atherosclerotic lesions. Therefore, a contribution of leukocyte LDLR
expression to foam cell formation might have been obscured under these
conditions of extreme hypercholesterolemia and advanced atherosclerosis.
/) mice or its elimination in
C57BL/6 mice would have an impact on the extent of atherosclerosis in a
setting of less severe hypercholesterolemia and during an early stage
of atherosclerotic lesion formation. Although the macrophage LDLR is
unlikely to play a significant role in the uptake of LDL, it is
possible that its involvement in the endocytosis of -VLDL is
substantial (13-15). To test this hypothesis we set up a series of
experiments directed at analyzing the development of aortic
atherosclerosis in LDLR(/) or C57BL/6 mice reconstituted with
either LDLR(/) or LDLR(+/+) marrow. In LDLR(/) mice, extreme
atherosclerosis developed irrespective of the kind of marrow received,
indicating that, in the presence of massive elevations in LDL levels,
the macrophage LDLR is not a modulator of foam cell formation. However,
C57BL/6 mice that received LDLR(/) marrow had a mean aortic lesion
area that was 70% less compared with mice that received LDLR(+/+)
marrow. This effect was evident despite a 40% higher plasma
cholesterol level in LDLR(/)C57BL/6 mice, which was due to the
accumulation of -VLDL. Thus, our results are compatible with a major
role of macrophage LDLR in the regulation of foam cell transformation when the atherogenic stimulus is -VLDL.
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
/) mice were originally purchased from
Jackson Laboratories (Bar Harbor, ME) and backcrossed into the C57BL/6 background. Recipient LDLR(/) mice were at the 7th backcross, whereas donors for the C57BL/6 study were at the 10th backcross into
C57BL/6. LDLR genotype was determined by polymerase chain reaction as
described previously (20). All mice were maintained in microisolator
cages on a rodent chow diet containing 4.5% fat (PMI 5010, St. Louis,
MO) and acidified water (pH 2.8). Atherogenic diets used included the
Western type diet containing 21% milkfat and 0.15% cholesterol diet
(Teklad, Madison, WI) and the butterfat diet containing 19.5% fat,
1.25% cholesterol and 0.5% cholic acid (ICN, Aurora, OH). Animal care
and experimental procedures were performed in accordance with
institutional guidelines and under approval from the Animal Care
Committee of Vanderbilt University.
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
/) mice were transplanted with either LDLR(+/+) marrow
(experimental group; n = 15) or LDLR(/) marrow
(controls; n = 14). Eight weeks post-BMT, the mice were
challenged with an atherogenic diet containing 21% milkfat and 0.15%
cholesterol diet for 9 weeks. To examine the contribution of the
macrophage LDLR to foam cell formation under conditions of more
moderate hypercholesterolemia, 8-wk-old lethally irradiated (9 Gy)
female C57BL/6 mice were transplanted with either LDLR(/) marrow
(experimental group; n = 11) or LDLR(+/+) marrow
(controls; n = 11). Eight weeks post-BMT the mice were
challenged with an atherogenic diet containing 19.5% butterfat, 1.25%
cholesterol, and 0.5% cholic acid for 13 weeks.
/) mice transplanted with either LDLR(+/+) or
LDLR(/) marrow, there were no significant differences in serum cholesterol or triglyceride levels between the two groups at baseline or after 6 weeks on a chow diet or after 6 or 9 weeks on the
Western-type diet (Table I). We have
previously reported that on a chow diet the lipoprotein profiles in the
LDLR(+/+)LDLR(/) mice and LDLR(/)LDLR(/) mice are
indistinguishable, with HDL as the predominant lipoprotein class and a
significant accumulation of LDL cholesterol (20). After 6 weeks on the
Western-type diet, examination of the distribution of cholesterol among
the serum lipoprotein fractions by size-exclusion chromatography in the
LDLR(/)LDLR(/) mice revealed a massive accumulation of
cholesterol in the VLDL/IDL/LDL range, with a relative decrease in the
HDL cholesterol compared with the lipoprotein profile on a normal chow
diet (Fig. 1A). A similar
pattern was seen in the LDLR(+/+)LDLR(/) mice (data not shown).
Thus, in the LDLR (/) mice, the Western-type diet induced
severe hypercholesterolemia due to an accumulation of both LDL
cholesterol and VLDL/IDL-sized remnant lipoproteins.
Total serum cholesterol and triglyceride levels in male LDLR(/)
mice before and after transplantation with LDLR(+/+) or LDLR(/)
marrow and on the Western-type diet
View larger version (21K):
[in a new window]
Fig. 1.
Lipoprotein distribution in LDLR( /) or
C57BL/6 recipient mice on an atherogenic diet. Lipoprotein
distribution was determined by fast performance liquid chromatography
followed by cholesterol analysis of each fraction. Fractions 13-17
contain VLDL; fractions 18-24 contain IDL/LDL; and fractions 25-31
contain HDL. Fractions 32-40 are the bottom nonlipoprotein-associated
proteins. Panel A shows the average lipoprotein distribution
of LDLR(/)LDLR(/) mice 8 weeks after transplantation
(post-BMT) on a normal chow diet (n = 5), compared with
the profile after 6 weeks on the Western type diet (post-BMT)
(n = 4). Panel B compares the average
lipoprotein distribution of LDLR(+/+)C57BL/6 mice (n = 4) and LDLR(/)C57BL/6 mice (n = 4) after 13 weeks on the atherogenic diet.
/) marrow revealed no significant differences on
a chow diet 8 weeks post-BMT (Table II)
(20). After 6 weeks on the atherogenic diet, no significant differences in serum cholesterol or triglyceride levels existed between the two
groups, although the serum cholesterol levels had doubled from baseline
(Table II). However, after 13 weeks on the butterfat diet, the mean
serum cholesterol level in the LDLR(/)C57BL/6 mice was
significantly higher than in the LDLR(+/+)C57BL/6 mice (Table II).
Examination of the distribution of cholesterol among the serum
lipoprotein fractions by size-exclusion chromatography after 13 weeks
on the atherogenic diet revealed an accumulation of cholesterol in the
VLDL/IDL range with a relative decrease in the HDL cholesterol in both
groups (Fig. 1B). Levels of HDL cholesterol in 8 LDLR(/)C57BL/6 and 7 LDLR(+/+)C57BL/6 mice were 68.6 ± 10.0 and 67.4 ± 9.37 (mg/dl ± S.D.), respectively, (p = 0.820), and the ratio of total cholesterol to HDL
cholesterol was higher in the LDLR(/)C57BL/6 mice than in the
controls (5.01 versus 3.63). Thus, in the C57BL/6 mice, the
butterfat diet induced a moderate hypercholesterolemia due to an
accumulation of remnant lipoproteins.
Total serum cholesterol and triglyceride levels in female C57BL/6 mice
before and after transplantation with LDLR(+/+) or LDLR(/) marrow,
and in the course of butterfat diet
The aortas were collected for quantitative analysis of the extent of
atherosclerosis from the LDLR(/) recipient group after 9 weeks on
the Western-type diet. The mean lesion area in the proximal aorta was
not significantly different in the LDLR(+/+)LDLR(/) mice and
LDLR(/)LDLR(/) mice (42,815 ± 6,358 versus
39,032 ± 8,700 µm2 ± S.E.; p = 0.76) (Fig. 2A). In contrast,
the mean lesion area in the experimental LDLR(/)C57BL/6 mice was
significantly less than in the control LDLR(+/+)C57BL/6 mice
(1,158 ± 260 versus 3,157 ± 823 µm2 ±S.E.; p = 0.031) after 13 weeks on
the butterfat diet (Fig. 2B). Additionally, there was not a
significant correlation between individual serum cholesterol levels and
the extent of lesion area in the experiment using C57BL/6 recipient
mice (r = 0.45; 0 < 0.16).
|
Immunocytochemical studies using a macrophage specific antibody, MOMA2
(25), revealed that the lesions consisted almost exclusively of
macrophage-derived foam cells in both the LDLR(/) and C57BL/6
transplant models (Fig. 3). We have
demonstrated previously (26) that the induction of atherosclerotic
lesions in recipient mice after reconstitution with congenic marrow
results in the development of atherosclerotic lesions containing
macrophage-derived foam cells that are exclusively donor in origin. In
the current study, the LDLR was detected on macrophage-derived foam
cells in both the LDLR(+/+)LDLR(/) mice (Fig. 3, panel
D) and in the LDLR(+/+)C57BL/6 mice (Fig. 3, panel
F), but was strikingly absent in the LDLR(/)LDLR(/)
mice (Fig. 3, panel B) and LDLR(/)C57BL/6 mice (Fig.
3, panel H).
|
In situ hybridization studies were performed to examine the
expression of mouse LDLR mRNA in the atherosclerotic lesions of both the LDLR(/) and C57BL/6 transplant models. In control
experiments, hepatic sections from LDLR(/) mice obtained 4 days
after infection with an adenoviral construct coding for the human LDLR
showed extremely high levels of LDLR expression when hybridized with the 35S-labeled 167-nucleotide mouse LDLR mRNA
antisense riboprobe and no expression above background with the
corresponding sense probe, as described previously (27). Mouse LDLR
mRNA expression was detectable at low levels in hepatic sections
from wild-type C57BL/6 mice, but was absent in hepatic sections from
LDLR(/) mice (data not shown). Hybridization of 5-µm sections
from the proximal aorta of LDLR(+/+)C57BL/6 mice with the
35S-labeled 167-nucleotide mouse LDLR mRNA antisense
riboprobe revealed low level expression of the LDLR in foam cells,
which was absent in sections hybridized with the sense probe (Fig.
4). In contrast, expression of the LDLR
in foam cell lesions of the LDLR(+/+)LDLR(/) mice was not
detectable by this assay (data not shown).
|
| |
DISCUSSION |
|---|
|
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
The current studies provide strong evidence for a direct role of
the macrophage LDLR in foam cell formation and atherogenesis in
vivo. The macrophage LDLR has been implicated in the binding and
internalization of -VLDL and chylomicron remnants by a number of
in vitro studies (13-15). On an atherogenic diet, C57BL/6
mice develop relatively modest hypercholesterolemia due to an
accumulation of -VLDL, providing an attractive model for testing the
hypothesis that the macrophage LDLR influences foam cell formation and
atherogenesis in vivo. Therefore, female C57BL/6 mice were
transplanted with either LDLR(/) marrow or LDLR(+/+) marrow and
challenged with the butterfat diet. As expected, the mice in both
groups developed moderate hypercholesterolemia (Table II). Although
serum cholesterol levels were not significantly different between the
two groups at baseline or after 6 weeks on the butterfat diet, the
serum cholesterol levels were 40% higher in the experimental
LDLR(/)C57BL/6 mice compared with controls after 13 weeks. The
main lipoprotein class accumulating under conditions of dietary stress
is a -VLDL remnant, and the higher cholesterol levels observed in
the experimental mice were due primarily to higher levels of the
-VLDL in this group. However, this significant additional
accumulation of a potentially atherogenic lipoprotein did not have the
expected consequences on the artery wall. In fact, quantitative
analysis of the extent of atherosclerosis in the proximal aorta
revealed that C57BL/6 mice reconstituted with LDLR(/) marrow
developed 63% smaller lesion area than the LDLR(+/+) marrow
recipients. Thus, our results are compatible with a major role of
macrophage LDLR in foam cell formation when the atherogenic stimulus is
-VLDL.
It is noteworthy that no correlation was detected between individual
serum cholesterol levels and the extent of lesion area in the
experiment using C57BL/6 recipient mice, suggesting that the effect of
intervention was not mediated by plasma lipoprotein changes. After 13 weeks on the atherogenic diet, the LDLR(/)C57BL/6 mice had
higher serum total cholesterol levels and a higher total cholesterol to
HDL cholesterol ratio than the control group. Levels of serum
triglycerides did not differ between the two groups, and the
lipoprotein distributions were qualitatively similar as determined by
size-exclusion chromatography. Subtle changes in HDL or apolipoprotein
B composition are unlikely to explain the difference in
atherosclerosis. A 75% decrease in HDL cholesterol due to knockout of
the apoAI gene does not effect the extent of diet-induced
atherosclerosis in 129xC57BL/6 hybrid mice (28). In apoE-deficient mice
expressing only apoB100 or apoB48, serum cholesterol levels predict
lesion area but the differences in apoB containing lipoproteins do not
(29). In the current study, despite the presence of an apparently more
atherogenic lipoprotein profile, the LDLR(/)C57BL/6 mice
developed significantly less atherosclerosis. Therefore, the lack of
macrophage LDLR expression in these mice was apparently protective,
resulting in less foam cell formation.
In the current studies, the role of macrophage LDLR expression in foam
cell formation was examined in LDLR(+/+)LDLR(/) mice and
LDLR(/)LDLR(/) controls under dietary conditions resulting
in less severe hypercholesterolemia than in the studies of
Boisvert et al. (21) and Herijgers et al.
(22). The mice in both groups developed severe hypercholesterolemia due
to accumulation of VLDL, IDL, and LDL cholesterol, but there were no
significant differences in serum cholesterol between the two groups at
baseline or after 6 or 9 weeks on the atherogenic diet. The extent of
atherosclerosis was examined when the lesions had not progressed beyond
fatty streak lesions. Quantitative analysis of the extent of
atherosclerosis demonstrated that there were no differences between the
two groups. Thus, in the presence of extremely high levels of serum
cholesterol, macrophage LDLR expression did not influence the extent of
foam cell lesion formation. Our results extend the findings of Boisvert et al. (21) and Herijgers et al. (22) by showing
that reconstitution of LDLR expression in leukocytes and macrophages of
LDLR(/) mice during the foam cell-rich fatty streak stage of
atherogenesis does not influence the extent of atherosclerosis.
The contribution of leukocyte LDLR expression to foam cell formation
and atherogenesis was examined in two different murine bone marrow
transplantation models, which differed dramatically with respect to the
levels of plasma lipids and lipoproteins. Although the studies in LDLR
deficient mice seem to indicate that the macrophage LDLR does not
influence foam cell formation, a different picture emerges when one
looks at the effect of eliminating macrophage LDLR from C57BL/6 mice on
a high fat diet. In this experimental model of moderate
hypercholesterolemia due predominantly to the accumulation of -VLDL,
macrophage expression of the LDLR does play a physiologic role in foam
cell formation in vivo, as evidenced by the significant
(p = 0.031) 70% reduction in lesion area shown by mice
transplanted with LDLR(/) marrow. Although there is inherent
variation in the diet-induced model of atherosclerosis in C57BL/6 mice,
the result is clearly statistically significant, and the extent of
aortic atherosclerotic lesion area obtained in C57BL/6 mice under
similar dietary conditions has been shown to be highly reproducible
(30). Overall, our results emphasize the importance of genetic
background, dietary conditions, and stage of atherosclerosis in
designing experiments to elucidate the physiologic role of expression
of a gene by the macrophage in atherosclerosis.
We and others (20, 21) have previously reported that plasma lipid and
lipoprotein levels do not differ in LDLR/ mice reconstituted with
LDLR+/+ or LDLR / marrow on a chow diet. Based on these studies, we
concluded that leukocyte LDLR activity does not play a significant role
in the clearance of LDL in plasma. In contrast, Herijgers et
al. (22) reported that 4 weeks post-BMT LDLR(+/+)LDLR(/)
mice have significantly lower levels of total serum cholesterol level
and LDL cholesterol than control LDLR(/)LDLR(/) mice, but
the decrease in LDL was less prominent by 12 weeks post-BMT, suggesting
it was a transient effect (22). Consistent with our current results,
Herijgers et al. (22) did not see any significant differences in total serum cholesterol levels between LDLR(+/+) and
LDLR(/)LDLR(/) mice on a diet containing 1% cholesterol, demonstrating that the leukocyte LDLR does not influence plasma cholesterol levels in the presence of severe hypercholesterolemia. In
addition, we have reported that plasma lipid and lipoprotein levels do
not differ in C57BL/6 mice reconstituted with LDLR+/+ or LDLR /
marrow on a chow diet (20). In C57BL/6 mice on a chow diet, the
majority of cholesterol is found in HDL, making it unlikely that a
contribution of leukocyte LDLR expression to the clearance of LDL from
plasma would be detected. Yet, in the current studies we found that
after 13 weeks on the butterfat diet the serum cholesterol levels were
40% higher in the LDLR(/)C57BL/6 mice than
LDLR(+/+)C57BL/6 mice because of accumulation of -VLDL. van
Berkel and co-workers (31, 32) have shown that Kupffer cells
contribute significantly to the clearance of LDL from plasma in the
rat. Therefore, a lack of Kupffer cell LDLR expression in the
LDLR(/)C57BL/6 may be responsible for the increased level of
serum cholesterol relative to the LDLR(+/+)C57BL/6 mice. These
results suggest that the leukocyte LDLR expression can significantly influence plasma cholesterol levels under conditions of moderate hypercholesterolemia due to an accumulation of -VLDL.
We have previously reported that six weeks after bone marrow
transplantation in LDLR/ recipient mice both the myeloid and lymphoid cells were essentially completely reconstituted by cells of
donor origin (20). In addition, we have previously demonstrated that
bone marrow transplantation results in reconstitution of the arterial
wall with macrophages of donor origin (26). In the current study,
we report that macrophages in the atherosclerotic lesions of
LDLR(+/+)LDLR(/) mice stain positive for the LDLR, a finding
consistent with results reported by Boisvert et al. (21).
These findings indicate that the LDLR is being expressed by
macrophage-derived foam cells even in the setting of extreme hypercholesterolemia with high levels of LDL cholesterol. However, the
results of our in situ hybridization studies indicate that the level of macrophage-derived foam cell LDLR expression in the LDLR(+/+)LDLR(/) mice was down-regulated relative to the level of expression noted in the LDLR(+/+)C57BL/6 mice. Thus, it is possible that the LDL receptor participates in foam cell formation when
levels of LDL or total cholesterol are not high enough to completely
down-regulate the macrophage LDLR.
In conclusion, the wider relevance of these results lay in the proof
that expression of LDLR from macrophages in the artery wall directly
mediates the progression of atherosclerosis and that protective changes
in the macrophage can overcome atherogenic changes such as diet-induced
hyperlipidemia in the plasma compartment. The contribution of
macrophage LDLR to foam cell formation and atherosclerosis may be
substantial given the large body of evidence implicating
triglyceride-rich remnant lipoproteins in human atherosclerotic disease
(33, 34). In addition, the majority of people who die of coronary heart
disease have normal to modestly elevated levels of cholesterol (35), a
setting in which the macrophage LDLR may contribute significantly to
foam cell formation. This concept emphasizes the need for developing
therapeutic strategies, based either on drugs or gene transfer, aimed
at reducing the recruitment of monocytes in the artery wall or delaying
macrophage transformation into foam cells to reduce the development and
progression of coronary atherosclerosis.
| |
ACKNOWLEDGEMENTS |
|---|
We are grateful to A. Major for helpful comments on the manuscript and to K. Carter for expert technical assistance.
| |
FOOTNOTES |
|---|
* This work was supported in part by American Heart Association Grant-in-aid 95011450 and by National Institutes of Health Grant HL53989-01.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
¶ Established Investigator of the American Heart Association. Supported by Clinical Investigator Development Award HL-02925 from the National Institutes of Health. To whom correspondence should be addressed: Div. of Endocrinology, Vanderbilt University School of Medicine, 715 Medical Research Building II, Nashville, TN 37232-6303. Tel.: 615-936-1653; Fax: 615-936-1667; E-mail: macrae.linton{at}mcmail.vanderbilt.edu.
Supported by a National Institutes of Health Diabetes Research
Training Grant or sergio.fazio{at}mcmail.vanderbilt.edu.
** Established Investigator of the American Heart Association.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: LDLR, low density lipoprotein receptor; BMT, bone marrow transplantation; VLDL, very low density lipoproteins; LDL, low density lipoproteins; IDL, intermediate density lipoproteins; HDL, high density lipoproteins.
| |
REFERENCES |
|---|
|
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  J. F. Navarro, C. Mora, M. Gomez, M. Muros, C. Lopez-Aguilar, and J. Garcia Influence of renal involvement on peripheral blood mononuclear cell expression behaviour of tumour necrosis factor-{alpha} and interleukin-6 in type 2 diabetic patients Nephrol. Dial. Transplant., March 1, 2008; 23(3): 919 - 926. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. R. Babaev, H. Ishiguro, L. Ding, P. G. Yancey, D. E. Dove, W. J. Kovacs, C. F. Semenkovich, S. Fazio, and M. F. Linton Macrophage Expression of Peroxisome Proliferator Activated Receptor-{alpha} Reduces Atherosclerosis in Low-Density Lipoprotein Receptor Deficient Mice Circulation, September 18, 2007; 116(12): 1404 - 1412. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. R. Romeo, K. S. Moulton, and A. Kazlauskas Attenuated Expression of Profilin-1 Confers Protection From Atherosclerosis in the LDL Receptor Null Mouse Circ. Res., August 17, 2007; 101(4): 357 - 367. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Altenburg, L. Johnson, J. Wilder, and N. Maeda Apolipoprotein E4 in Macrophages Enhances Atherogenesis in a Low Density Lipoprotein Receptor-dependent Manner J. Biol. Chem., March 16, 2007; 282(11): 7817 - 7824. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. D. Overton, P. G. Yancey, A. S. Major, M. F. Linton, and S. Fazio Deletion of Macrophage LDL Receptor-Related Protein Increases Atherogenesis in the Mouse Circ. Res., March 16, 2007; 100(5): 670 - 677. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. A. Cassis, D. L. Rateri, H. Lu, and A. Daugherty Bone Marrow Transplantation Reveals That Recipient AT1a Receptors Are Required to Initiate Angiotensin II-Induced Atherosclerosis and Aneurysms Arterioscler. Thromb. Vasc. Biol., February 1, 2007; 27(2): 380 - 386. [Abstract] [Full Text] [PDF]
|
|
|
|
