Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Takahashi, E.
Right arrow Articles by Berk, B. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takahashi, E.
Right arrow Articles by Berk, B. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 29, 20206-20214, July 16, 1999


p90RSK Is a Serum-stimulated Na+/H+ Exchanger Isoform-1 Kinase
REGULATORY PHOSPHORYLATION OF SERINE 703 OF Na+/H+ EXCHANGER ISOFORM-1*

Eiichi Takahashi, Jun-ichi Abe, Byron Gallis, Ruedi AebersoldDagger , Denise J. Spring§, Edwin G. Krebs§parallel , and Bradford C. Berk**Dagger Dagger

From the Departments of Medicine, Dagger  Molecular Biotechnology, § Pharmacology, and  Biochemistry and the parallel  Howard Hughes Medical Institute, University of Washington, Seattle, Washington 98195 and the ** Center for Cardiovascular Research, University of Rochester, Rochester, New York 14642

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The Na+/H+ exchanger isoform-1 (NHE-1) is the key member of a family of exchangers that regulates intracellular pH and cell volume. Activation of NHE-1 by growth factors is rapid, correlates with increased NHE-1 phosphorylation and cell alkalinization, and plays a role in cell cycle progression. By two-dimensional tryptic peptide mapping of immunoprecipitated NHE-1, we identify serine 703 as the major serum-stimulated amino acid. Mutation of serine 703 to alanine had no effect on acid-stimulated Na+/H+ exchange but completely prevented the growth factor-mediated increase in NHE-1 affinity for H+. In addition, we show that p90 ribosomal S6 kinase (p90RSK) is a key NHE-1 kinase since p90RSK phosphorylates NHE-1 serine 703 stoichiometrically in vitro, and transfection with kinase-inactive p90RSK inhibits serum-induced phosphorylation of NHE-1 serine 703 in transfected 293 cells. These findings establish p90RSK as a serum-stimulated NHE-1 kinase and a mediator of increased Na+/H+ exchange in vivo.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Intracellular pH (pHi)1 and cell volume are regulated in part by a family of ion exchangers termed the Na+/H+ exchangers. Among these proteins, Na+/H+ exchanger isoform-1 (NHE-1) is ubiquitous (1, 2). NHE-1 is activated by growth factors that alter its affinity for intracellular H+ and thereby cause cell alkalinization (1). Intracellular alkalinization mediated by NHE-1 (defined by amiloride-sensitive inhibition) is required for cell growth (3). Abnormalities in NHE-1 function may contribute to disease pathogenesis. In the NHE-1 knockout mouse, seizures develop at age 19 days (4). Increased NHE-1 activity has been demonstrated in cells and tissues of hypertensive humans and animals (5). The spontaneously hypertensive rat (SHR), a genetic model of hypertension, exhibits increased Na+/H+ exchange and increased vascular smooth muscle cell (VSMC) growth compared with the normotensive Wistar Kyoto rat (WKY) (6). In SHR there is no significant change in NHE-1 cDNA sequence (7), steady state mRNA levels (8), or protein expression (9). However, there is a significant increase in NHE-1 phosphorylation in response to growth factors in VSMC derived from the SHR compared with WKY (10). These results suggest that alterations in NHE-1 phosphorylation (and the responsible kinases) contribute to the SHR phenotype.

NHE-1 has been shown to be constitutively phosphorylated in growth-arrested cells. In response to growth factors, multiple sites show increased phosphorylation based on two-dimensional tryptic peptide maps (11). The amino acids phosphorylated by growth factors are located in the carboxyl-terminal 300 amino acids of the exchanger (12). Because changes in NHE-1 phosphorylation may regulate Na+/H+ exchange, these findings suggest that increased Na+/H+ exchange in the SHR is caused by an alteration in the activity of kinases that phosphorylate NHE-1. Thus, identification of growth factor-stimulated kinases that phosphorylate NHE-1 may provide insight into the pathogenesis of hypertension.

Several protein kinases have been proposed to regulate NHE-1, including Ca2+-calmodulin-dependent kinases (13), protein kinase C (14), p160 Rho-associated kinase (p160ROCK) (15), and members of the mitogen-activated protein (MAP) kinase family including ERK1/2 (1, 16), c-Jun amino-terminal kinase, and p38 (17). Data implicating a key role for ERK1/2 are strongest, since pharmacological inhibition of the MEK1-ERK1/2 pathway with PD98059 (18) or transfection with dominant-negative ERK1/2 (19-21) dramatically decreased growth factor-stimulated Na+/H+ exchange. It is not clear that ERK1/2 directly phosphorylate NHE-1, and it is possible that other kinase(s) downstream of ERK1/2 are responsible for NHE-1 phosphorylation.

We proposed previously that p90 ribosomal S6 kinase (p90RSK), a downstream substrate of ERK1/2 (22), was a physiologically relevant NHE-1 kinase (23, 24). This hypothesis was based on the following findings: 1) a 90-kDa kinase exhibited increased activity toward an NHE-1-GST fusion protein in lysates from SHR VSMC compared with WKY VSMC (24); 2) immunodepletion of p90RSK decreased the activity of the 90-kDa kinase; 3) PD98059 blocked growth factor-mediated activation of p90RSK and decreased NHE-1 phosphorylation; 4) p90RSK immunoprecipitated from angiotensin II stimulated VSMC-phosphorylated recombinant NHE-1 in vitro; 5) the time courses for stimulation of p90RSK and Na+/H+ exchange activity by angiotensin II were also similar (23). In the present study, we performed experiments with mutated NHE-1 and p90RSK proteins to assess their effects on growth factor-stimulated Na+/H+ exchange. The results indicate that p90RSK phosphorylates serine 703 of NHE-1, and this phosphorylation is required for growth factor stimulation of Na+/H+ exchange.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Materials-- Anti-NHE-1 antiserum (G116) was a gift from Dr. L. L. Ng (Leicester Royal Infirmary, UK); anti-p90RSK2 antibody was obtained from Santa Cruz Biotechnology (Santa Cruz, CA). NHE-1 synthetic peptides EP-1 (RRRARIGSDPLA) and EP-2 (MARARIGSDPLAYEPK) were from PeptidoGenic Research (Livermore, CA). The plasmid (pcDNA3.1) was obtained from Invitrogen (Carlsbad, CA). Human NHE-1 cDNA was a gift from Dr. L. Fliegel (University of Alberta, Canada). DN-RSK and WT-RSK have been described (25). Neomycin and PD98059 were from Calbiochem. Acetoxymethyl ester of 2',7'-bis(carboxyethyl)-5(6)-carboxyfluorescein (BCECF)-AM was from Molecular Probes (Eugene, OR). Activated p90RSK2 was obtained from Upstate Biotechnology Inc. (Lake Placid, NY). Sequencing grade trypsin was from Promega (Madison, WI). Thin layer cellulose plates were from Eastman Kodak Co.

Cell Culture-- VSMC were isolated from the thoracic aorta of 200-250-g male Harlan Sprague-Dawley rats (Harlan Sprague-Dawley) and maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 100 units/ml penicillin, 100 µg/ml streptomycin, and 10% calf serum (HyClone, Logan, UT) as described previously. VSMC (passages 5-13) were growth-arrested at 70-80% confluence by incubation in 0.5% calf serum/DMEM for 48 h prior to use. PS127A cells (Chinese hamster lung fibroblasts that overexpress human NHE-1) and PS120 cells (Chinese hamster lung fibroblasts deficient in NHE-1) were gifts of Dr. J. Pouyssegur (University of Nice, France). PS127A and PS120 cells were maintained in DMEM (pH 7.4-7.6) supplemented with 100 units/ml penicillin, 100 µg/ml streptomycin, and 5% FCS (Summit, Ft. Collins, CO). 293 cells (ATCC, CRL1573) were maintained in DMEM (pH 7.4-7.6) supplemented with 100 units/ml penicillin, 100 µg/ml streptomycin, and 10% FCS.

Preparation of Cell Lysates-- VSMC were harvested using modified Oncogene Science lysis buffer as described previously (23). PS127A, PS120, and 293 cells were harvested using NHE-1 lysis buffer (14). Cells were immediately frozen on ethanol/dry ice, and the cell lysates were then thawed on ice, scraped, sonicated, and centrifuged at 14,000 × g at 4 °C for 30 min. Supernatants were used immediately.

Immunoprecipitation of p90RSK-- For immunoprecipitation of p90RSK, cell lysates containing 200 µg of protein were incubated with anti-p90RSK (2 µg) antibody overnight at 4 °C and then incubated with 20 µl of protein G-agarose beads (Life Technologies, Inc.) for 2 h on a roller system at 4 °C. The beads were washed two times with 1 ml of lysis buffer, 2 times with 1 ml of LiCl wash buffer (500 mmol/liter LiCl, 100 mmol/liter Tris-Cl, pH 7.6, 0.1% Triton X-100, and 1 mmol/liter dithiothreitol), and two times with 1 ml of washing buffer (20 mmol/liter HEPES, pH 7.2, 2 mmol/liter EGTA, 10 mmol/liter MgCl2, 1 mmol/liter dithiothreitol, and 0.1% Triton X-100).

Phosphorylation of NHE-1 Peptide-1 (EP-1)-- Immunoprecipitated p90RSK was incubated at 30 °C for 5 min in 200 µl of kinase reaction buffer (30 µM HEPES, pH 7.4, 10 mM MgCl2, 50 µM ATP, 50 µCi/ml [gamma -32P]ATP) with various concentrations of EP-1. The reactions were centrifuged for 10 s at 5000 rpm, and 10 µl of the supernatant was collected and applied to 1 × 1-cm P-81 paper. The P-81 paper was washed 4 times for 2 min with 0.1% phosphoric acid and incorporated 32P measured by scintillation counting (26). Nonspecific phosphorylation was determined by subtraction of the counts from reactions containing the same concentration of EP-1 without p90RSK. For the analysis of the stoichiometry of phosphorylation of EP-1, four immunoprecipitates were incubated together at 30 °C in 400 µl of kinase reaction buffer as described above with 10 µM EP-1, and samples were removed at the times indicated.

Phosphorylation and Purification of the NHE-1 Peptide-2 (EP-2)-- Immunoprecipitated p90RSK was incubated at 30 °C for 30 min in 200 µl of kinase reaction buffer containing 100 µM EP-2. The reaction was centrifuged for 5 min at 5000 rpm, and the supernatant was collected and digested with 2 µg of trypsin at 37 °C overnight. The pH was adjusted to 8.4 with ammonium bicarbonate and ammonium hydroxide. Tryptic phosphopeptides were purified on a C18 reverse phase high pressure liquid chromatography column. The mass and sequence of the peptides were determined using a triple quadrupole mass spectrometer (Finnigan MAT, San Jose, CA) as described previously (27).

In Vitro p90RSK Reaction Using GST-NHE-1 Fusion Protein as a Substrate-- Immunoprecipitated p90RSK from PS127A cells stimulated by 20% FCS for 5 min was incubated at 30 °C for 10 min in 200 µl of kinase reaction buffer containing 10 µg of GST-NHE-1 fusion protein (which contains amino acids 675-725 of human NHE-1 (23)).

In Vivo Labeling and Phosphopeptide Mapping-- PS127A cells, transfected PS120 cells, and transfected 293 cells were metabolically labeled with [32P]orthophosphate, using previously published protocols (28) with slight modification. In brief, cells deprived of serum for 8 h were exposed to phosphate-free medium for 15 h and then labeled with 250 µCi/ml [32P]orthophosphate for 3 h. Cells were stimulated with 20% FCS for 5 min and were harvested. NHE-1 was immunoprecipitated, washed six times with lysis buffer, and boiled in Laemmli sample buffer containing 100 mM dithiothreitol. For phosphopeptide mapping, the immunoprecipitates were fractionated by 7.5% SDS-polyacrylamide gel electrophoresis and transferred to nitrocellulose membranes. The phosphorylated NHE-1 was identified by autoradiography, excised, and digested with trypsin following established protocols (29). The resulting peptides were fractionated by two-dimensional phosphopeptide mapping (29). In brief, the peptides were separated in the first dimension by electrophoresis (1,000 V for 1.5 h; 10% acetic acid, 1% pyridine in water, pH 3.3) and in the second dimension by ascending chromatography (37% 1-butanol, 25% pyridine, 9% acetic acid in water, pH 5.0) (30) for 2 h. The phosphorylated peptides were detected by autoradiography, and the radioactivity was analyzed on a PhosphorImager (Molecular Dynamics, Sunnyvale, CA). To permit comparison of fold change in 32P incorporation among different experiments, the following calculation was performed. The normalization constant, k, was determined for each experiment by Equation 1: P1 densitometric volume in 20% FCS sample divided by P1 densitometric value in 0.5% FCS times k = 1.0. The normalized value for each phosphopeptide was then determined by Equation 2: Px densitometric volume in 20% FCS sample divided by Px densitometric value in 0.5% FCS times k.

In Vitro NHE-1 Phosphorylation by p90RSK-- NHE-1 was immunoprecipitated from a lysate of 500 µg of serum-deprived PS127A cells with the G116 NHE-1 antibody and protein A-agarose beads. The immunoprecipitant was incubated at 30 °C for 30 min in 50 µl of kinase reaction buffer containing 0.5 units of active p90RSK2. The reaction was stopped by washing 6 times with the lysis buffer and then subjected to tryptic two-dimensional phosphopeptide mapping as described above.

Plasmid and Cell Transfections-- Serine 703 was mutated to alanine using polymerase chain reaction with the following primers (the mutated residues is shown in bold): 2090 CTCGGGCCCGCATCGGCGCAGACCCAC 2116. Wild type NHE-1 (NHE-1(WT)) and the S703A mutant NHE-1 (NHE-1(S703A)) were inserted into pcDNA3.1 using HaeIII and XbaI. PS120 cells were seeded at 40% confluence onto 60-mm dishes 24 h prior to transfection and transfected with 4 µg of plasmid DNA using the LipofectAMINE Plus method (Qiagen, Hilden, Germany). After 6 h of incubation with the DNA-lipid complexes, the cells were re-fed with serum-containing medium. Two days post-transfection, the transfected cells were trypsinized and seeded onto three 100-mm dishes in medium containing 1000 µg/ml neomycin. After 1 week of selection, cell colonies were picked and expanded into individual cultures. Transfected PS120 cells were maintained in DMEM, 5% FCS with 1000 µg/ml neomycin, and every week cells were subjected to acid selection to maintain high level expression of NHE-1 as described previously (31). In brief, cells were exposed to 50 mM NH4Cl in TBSS (135 mM NaCl, 5 mM KCl, 1.5 mM CaCl2, 1.0 mM MgCl2, 200 mg/dl glucose, 20 mM HEPES, 20 mM Tris, pH 7.4) for 1 h followed by low NaCl/choline Cl solution buffer (130 mM choline Cl, 5 mM NaCl, 5 mM KCl, 1.5 mM CaCl2, 1.0 mM MgCl2, 200 mg/dl glucose, 20 mM HEPES, 20 mM Tris, pH 6.5) for 1 h.

For transient transfection to 293 cells, cells were seeded at 80-90% confluence onto 100-mm dishes 24 h prior to transfection and co-transfected with 1.5 µg of pcDNA NHE-1 and 1.5 µg of pcDNA LacZ, pMT2 DN-RSK, or pMT2 WT-RSK using LipofectAMINE Plus method. After 6 h of incubation with the DNA-lipid complexes, the cells were re-fed with serum-containing medium. On the next day, cells were serum-deprived to 0.8% calf serum and labeled with [32P]orthophosphate.

pHi Measurement-- Na+/H+ exchange was determined by ethyl isopropyl amiloride-sensitive pHi recovery following acid loading as described previously using the fluorescent pH-sensitive dye, BCECF (32, 33). Fluorescent measurements (excitation at 500 and 450 nm with emission at 530 nm) were made with a PTI Delta scan spectrofluorometer. Briefly, cells were grown on glass coverslips coated with gelatin and growth-arrested at 70-80% confluence by incubation in 0.5% calf serum/DMEM for 24 h prior to use. Cells were loaded with 3 µM BCECF-AM in serum-free DMEM at 37 °C for 30 min, washed twice, and incubated in a HEPES-Tris balanced salt solution (HBSS, 130 mM NaCl, 5 mM KCl, 1.5 mM CaCl2 1.0 mM MgCl2, and 20 mM HEPES buffered to pH 7.4 at 37 °C with Tris base) for 30 min. Cells were acid-loaded with 20 µM nigericin in KCl solution (135 mM KCl, 10 mM HEPES, pH 6.5). After the pHi decreased to 6.5, the solution was changed to TBSS, pH 7.4. The nigericin/high K+ technique was used to calibrate the relationship between excitation ratio (F500/450) and pHi. The rate of pHi recovery was converted to mmol of H+/min/liter cells (JH) by multiplying by the buffering power. Buffering power was determined by stepwise reduction of NH4Cl under conditions in which ion fluxes were completely inhibited (5 mM BaCl2, 30 µM ethyl isopropyl amiloride). The data were then plotted as mmol of H+/min/liter cells (JH) versus pHi .

Statistics-- Values presented are means ± S.D. Student's t test was used when appropriate. p values < 0.05 were considered statistically significant.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Serum Stimulates Phosphorylation of NHE-1 in Cultured Cells-- It has been shown previously that serum stimulates phosphorylation of NHE-1 and that the majority of the de novo incorporation occurs in a single tryptic peptide of NHE-1 (30). We performed two-dimensional tryptic phosphopeptide mapping of immunoprecipitated NHE-1 from PS127A fibroblasts that were maintained in 0.5% FCS (Fig. 1A) or stimulated with 20% FCS for 5 min (Fig. 1B). Five major phosphopeptides were identified (see scheme in Fig. 1C). To analyze changes in phosphorylation among different experiments, the intensity change of each spot was normalized to spot P1 using the calculations described under "Experimental Procedures." This normalization obviated the need to demonstrate that equal quantities of NHE-1 were expressed and immunoprecipitated for different experiments and cell preparations. Unlike previous investigations that showed growth factors increase the phosphorylation of only one peptide (30), we found two serum-stimulated NHE-1 phosphopeptides (Fig. 1, A and B). These phosphopeptides, termed P4 and P5 (Fig. 1C), showed 4.2 ± 0.8-fold and 11.3 ± 0.7-fold increases (n = 3, all analyses are mean ± S.D.), respectively, in response to 20% FCS (Fig. 1D). Based on the magnitude of the serum-stimulated increase in phosphorylation and electrophoretic mobility, we believe that phosphopeptide P5 is the same tryptic peptide described by other investigators.


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 1.   Serum-stimulated phosphorylation of NHE-1: presence of two serum-stimulated phosphopeptides. Two-dimensional tryptic phosphopeptide maps of NHE-1 were prepared from PS127A cells maintained in 0.5% FCS (A) or stimulated with 20% FCS for 5 min (B). The origins are shown as black circles at the left lower corners. C, scheme for two-dimensional phosphopeptide map of NHE-1 identifies 5 major phosphopeptides. D, PhosphorImager analysis of the relative volume of each phosphopeptide spot. Data were normalized to spot P1 as described under "Experimental Procedures." Results are the mean ± S.D., n = 3.

The MEK1 Inhibitor PD98059 Decreases Phosphorylation of Phosphopeptide P5-- We and others (24) have observed that phosphorylation of NHE-1 in response to serum is inhibited by PD98059 suggesting that at least one NHE-1 kinase is regulated by the MEK1 and ERK1/2 pathway. Because we also found that ERK1/2 did not readily phosphorylate recombinant NHE-1-(625-747) as shown by a stoichiometry of only <0.05 (mol of phosphate/mol of total substrate) in an immune complex kinase reaction (17), it is unlikely that ERK1/2 are NHE-1 kinases. However, we previously reported that a 90-kDa NHE-1 kinase (with characteristics consistent with p90RSK) was a possible NHE-1 kinase based on the intensity of phosphorylation and immunodepletion experiments. Activation of this 90-kDa kinase by serum was inhibited by PD98059, consistent with reports that p90RSK is activated by the MEK1-ERK1/2 pathway. To identify which NHE-1 phosphopeptides might be substrates for p90RSK, we studied the effect of MEK1 inhibition on serum stimulation of NHE-1 phosphorylation. The concentration of PD98059 required to inhibit p90RSK-dependent phosphorylation of NHE-1 was determined by incubating PS127A cells with PD98059 (10, 50, and 100 µM) for 1 h. Cells were then stimulated with 20% FCS for 5 min followed by p90RSK immunoprecipitation. An immune complex kinase assay was then performed using GST-NHE-1-(625-747) as substrate (23). There was a >10-fold stimulation of p90RSK by 20% FCS measured by GST-NHE-1 phosphorylation (Fig. 2A, 1st and 3rd lanes). PD98059 inhibited p90RSK activity in a concentrationdependent manner (Fig. 2A, 4th to 6th lanes) which was significant (58 ± 7% inhibition, n = 3) at 100 µM (Fig. 2B). To determine the effect of MEK1 inhibition in vivo, PS127A cells were maintained in 0.5% FCS and incubated with 0.2% Me2SO (vehicle) or 100 µM PD98059 for 1 h. The cells were then kept in 0.5% serum (Fig. 2C) or stimulated with 20% FCS for 5 min. NHE-1 was immunoprecipitated and two-dimensional tryptic phosphopeptide analysis performed. Phosphorylation of phosphopeptide P5 was significantly inhibited by 100 µM PD98059 (62 ± 7%, n = 3), whereas phosphorylation of P4 was not significantly changed in subsequent experiments (Fig. 2F). Based on the findings that phosphopeptide P5 showed the greatest increase in phosphorylation in response to serum, was dependent on MEK1, and co-migrated with a serum-stimulated peptide previously reported, subsequent studies focused on this phosphopeptide.


View larger version (45K):
[in this window]
[in a new window]
 
Fig. 2.   The MEK1 inhibitor PD98059 inhibits serum-stimulated p90RSK activity and NHE-1 phosphorylation. A, inhibition of p90RSK activity by PD98059 (PD) was determined using an in vitro kinase assay. PS127A cells were maintained in 0.5% serum and then pretreated with 10, 50, or 100 µM PD98059 for 1 h as shown. Cells were then treated with 20% FCS for 5 min; p90RSK was immunoprecipitated, and its activity was measured by phosphorylation of GST-NHE-1. B, inhibition of 20% FCS-stimulated p90RSK activity by increasing concentrations of PD98059. Densitometric analysis of data shown in A normalized to 20% FCS stimulated values in the absence of PD98059 which was set to 100% (n = 3). C-E, two-dimensional tryptic phosphopeptide maps of NHE-1 from PS127A cells stimulated by 20% FCS for 5 min. Cells were maintained in 0.5% serum and then treated according to the following protocols: C, 0.5% serum, 0 µM PD98059; D, 20% FCS, 0 µM PD98059; E, 20% FCS, 100 µM PD98059 for 1 h; F, inhibition of 20% FCS-stimulated maximal 32P incorporation into NHE-1 phosphopeptides after treatment with 100 µM PD98059 (n = 3). Values are normalized to P1 which was set to 100%. All data were shown as mean ± S.D. *, p < 0.05

Immunoprecipitated p90RSK Phosphorylates NHE-1 Peptide-1 (EP-1) to High Stoichiometry-- Previous results from our laboratory showed that p90RSK specifically phosphorylates serine and/or threonine residues located between amino acids 670 and 714 of NHE-1 in vitro (23). Sequence analysis revealed a consensus p90RSK phosphorylation motif (RXXS) (34) at amino acids 700-703 (Fig. 3A). To characterize this site of NHE-1 as a substrate for p90RSK, an NHE-1 peptide (EP-1, RRRARIGSDPLA) containing a single serine was synthesized (Fig. 3A). Activated p90RSK was immunoprecipitated from rat VSMC stimulated with 200 nM angiotensin II for 5 min. An in vitro kinase reaction was then performed with activated p90RSK and EP-1. Fig. 3B depicts the rate of incorporation of 32P into EP-1 as a function of substrate concentration. A Lineweaver-Burk plot of the data in Fig. 3B yielded a Km of 8.2 ± 0.4 µM (n = 3, Fig. 3C). Incubation of 10 µM EP-1 with activated, immunoprecipitated p90RSK for 30 min produced a stoichiometric phosphorylation of EP-1 (Fig. 3D). The relatively high affinity of p90RSK for the EP-1 peptide and a stoichiometry ~1.0 suggests that serine 703 of NHE-1 is a physiological site of phosphorylation by p90RSK.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 3.   Kinetics and stoichiometry of phosphorylation of the synthetic NHE-1 peptide (EP-1) mediated by p90RSK. A, the amino acid sequence of the NHE-1-predicted phosphorylation site by p90RSK in vitro and the sequence of synthetic peptides (EP-1 and EP-2) and tryptic phospho-EP-2. B, rate of incorporation of phosphate into EP-1 as a function of EP-1 concentration. Active p90RSK was immunoprecipitated from angiotensin II-stimulated vascular smooth muscle cells and an in vitro kinase assay performed with the indicated concentrations of EP-1. 32P incorporation was determined by liquid scintillation spectrometry (mean ± S.D., n = 3). C, Lineweaver-Burk plot of data in A. D, stoichiometry of phosphorylation of 10 µM EP-1 by p90RSK.

A Synthetic NHE-1 Phosphopeptide Containing Serine 703 Co-migrates with Phosphopeptide P5-- To confirm that serine 703 is the amino acid phosphorylated in response to serum, we performed co-migration studies of synthetic and endogenous NHE-1 tryptic phosphopeptides. We designed a synthetic peptide that included serine 703 and the surrounding amino acid sequence of NHE-1 (EP-2, Fig. 3A). Based on this sequence, we predicted that EP-2 would generate the endogenous phosphopeptide P5 when cleaved by trypsin. To generate phosphorylated EP-2, activated p90RSK was immunoprecipitated from rat VSMC stimulated with 200 nM angiotensin II for 5 min. An immune complex kinase reaction was then performed with EP-2 as substrate. The phosphorylated peptide was then cleaved with trypsin, purified by reverse phase high pressure liquid chromatography, and analyzed by mass spectrometry. Tryptic cleaved, phospho-EP-2 (tryptic pEP-2, sequence, IGpSDPLYEPK, where pS is phosphoserine) was then subjected to two-dimensional peptide mapping and shown to migrate as a single spot (Fig. 4A). The electrophoretic mobility of tryptic pEP-2 was very similar to P5 of endogenous NHE-1 immunoprecipitated from PS127A cells stimulated by 20% FCS (Fig. 4B). To confirm that P5 and tryptic pEP-2 were identical, tryptic pEP-2 (sample in Fig. 4A) and tryptic endogenous NHE-1 peptides (sample in Fig. 4B) were mixed and subjected to two-dimensional peptide mapping. Tryptic pEP-2 co-migrated with endogenous phosphopeptide P5 (Fig. 4C).


View larger version (82K):
[in this window]
[in a new window]
 
Fig. 4.   Phosphopeptide P5 co-migrates with a synthetic NHE-1 peptide (EP-2) that contains serine 703. Two-dimensional tryptic phosphopeptide maps of tryptic-cleaved, phosphorylated EP-2 peptide (pEP-2) in vitro by immunoprecipitated p90RSK (A); NHE-1 immunoprecipitated from PS127A cells stimulated with 20% FCS for 5 min (B); A and B mixed together (C); NHE-1 immunoprecipitated from PS127A cells (in 0.5% FCS) and phosphorylated in vitro by active p90RSK2 (D).

To show that phosphopeptide P5 is a good substrate for p90RSK, NHE-1 was immunoprecipitated from PS127A cells, and an in vitro kinase reaction was performed with activated p90RSK. Phosphorylated endogenous NHE-1 was then trypsinized and subjected to two-dimensional peptide mapping (Fig. 4D). Only a single phosphopeptide that co-migrated with P5 and tryptic pEP-2 was observed. Thus, only serine 703 appears to be phosphorylated by p90RSK in vitro, despite the fact that NHE-1 has five potential p90RSK phosphorylation sites based on the RXXS motif (RERS (56), RFTS (325), RLRS (648), RIGS (703), and RCLS (796)).

Mutation of Serine 703 Specifically Inhibits Serum Stimulation of Phosphopeptide P5-- To provide additional evidence that serine 703 is phosphorylated in response to serum, we mutated serine 703 to alanine (S703A) in NHE-1. The mutated NHE-1 (NHE-1(S703A)) or wild type NHE-1 (NHE-1(WT)) proteins were then stably expressed in PS120 fibroblasts that lack all known NHE isoforms (35). In brief, PS120 cells were transfected with appropriate cDNAs and selected for expression of NHE-1(S703A) or NHE-1(WT) by maintenance in neomycin. To select for clones with high levels of protein expression, acid loading and recovery was performed weekly (31). Equal expression of full-length Na+/H+ exchanger was confirmed by immunoprecipitation and Western blot analysis with anti-NHE-1 antibody (G116) (36) for at least three different clones (not shown). Transfected PS120 cells were maintained in 0.5% FCS or stimulated with 20% FCS for 5 min. NHE-1 was then immunoprecipitated, and two-dimensional tryptic phosphopeptide mapping was performed. The phosphopeptide map of NHE-1 from PS120 expressing NHE-1(WT) maintained in 0.5% FCS (Fig. 5A) or stimulated with 20% FCS for 5 min (Fig. 5B) was similar to the map of NHE-1 from PS127A cells (Fig. 1A). However, in the NHE-1 map from PS120 cells expressing NHE-1(S703A), phosphopeptide P5 was completely absent in both cells maintained in 0.5% FCS (Fig. 5C) or stimulated 20% FCS for 5 min (Fig. 5D), consistent with serine 703 being the phosphorylated amino acid present in this tryptic peptide.


View larger version (63K):
[in this window]
[in a new window]
 
Fig. 5.   NHE-1(S703A) does not yield a serum-stimulated phosphopeptide P5. Two-dimensional tryptic phosphopeptide maps of NHE-1 immunoprecipitated from PS120 cells expressing NHE-1(WT) in 0.5% FCS (A) and in 20% FCS for 5 min (B); NHE-1 immunoprecipitated from serum-stimulated PS120 cells expressing NHE-1(S703A) in 0.5% FCS (C) and in 20% FCS for 5 min (D).

Serum-stimulated Na+/H+ Exchange Is Inhibited in Cells Transfected with NHE-1(S703A)-- To determine the functional consequences of mutating NHE-1 serine 703, stably transfected PS120 cells were analyzed for serum-stimulated Na+/H+ exchange. Transfected PS120 cells were acid-loaded to an intracellular pH of 6.5 by exposure to 20 µM nigericin (a K+/H+ ionophore) in the presence of 135 mM KCl (pH 6.5) as described previously (33). In non-transfected PS120 cells, which lack functional NHE-1, there was a very slow recovery from the acid load that was not altered by treatment with 20% FCS (Fig. 6A). In PS120 cells transfected with NHE-1(WT) there was a rapid pHi recovery to a resting pHi of 7.0 within 300 s (Fig. 6B). When these cells were treated with 20% FCS, there was an increase in both the rate and extent of intracellular alkalinization (Fig. 6B). Both the pHi recovery and serum-stimulated recovery were due to expression of NHE-1 as there was ~100% inhibition by 1 µM ethyl isopropyl amiloride (not shown). PS120 cells expressing NHE-1(S703A) also showed a rapid pHi recovery from the acid load, which did not differ significantly from cells expressing NHE-1(WT) (compare control in Fig. 6, B and C). However, there was no stimulation of pHi recovery by 20% FCS in the NHE-1(S703A) expressing cells (Fig. 6C). These results indicate that phosphorylation of serine 703 is required for the serum stimulation of Na+/H+ exchange but is not necessary for acid-stimulated Na+/H+ exchange.


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 6.   NHE-1(S703A)-transfected cells exhibit decreased growth factor-stimulated pHi recovery from an acid load. PS120 cells were stably transfected with NHE-1(S703A) or NHE-1(WT) cDNAs. Intracellular pH was lowered by exposure to nigericin and KCl, pH 6.5. The external buffer was changed from the KCl solution, pH 6.5, to TBSS, pH 7.4, at time 0. A, PS120 cells transfected with pcDNA3.1 alone exhibited minimal pHi recovery. B, PS120 cells expressing NHE-1(WT) exhibited rapid pHi recovery. The rate and extent of pHi recovery were stimulated in cells pretreated with 20% FCS for 5 min. C, PS120 cells expressing NHE-1(S703A) exhibited rapid pHi recovery. The rate and extent of pHi recovery were not changed by pretreatment with 20% FCS. The rate of proton flux (JH) during acid recovery was calculated for PS120 cells transfected with NHE-1(WT) or NHE-1(S703A) (D). At pH 6.8, only PS120 cells expressing NHE-1(WT) showed increased JH (E) (mean ± S.D., n = 3). PS120 cells were stably transfected with NHE-1(S703A) or NHE-1(WT) cDNAs. Cells were incubated in TBSS, pH 7.4, until a stable pHi was obtained. Cells were stimulated with 1 unit/ml alpha -thrombin (F) at the time 0. The magnitude of intracellular alkalinization was compared at 300 s after agonist stimulation (G). The difference between PS120 cells stably transfected with NHE-1(S703A) or NHE-1(WT) cDNAs was significant for alpha -thrombin (mean ± S.D., n = 3, p < 0.05).

The ability of serum to stimulate Na+/H+ exchange has previously been shown to be due to an increase in affinity for intracellular H+ (37, 38). Kinetic analysis of the H+ flux showed that there was no significant difference in kinetic properties of NHE-1(WT) compared with NHE-1(S703A) when stimulated by acidification alone with maximal JH values of 2.07 and 2.42 mmol of H+/min/liter cells at pHi 6.70 and pH50 values (pHi at half-maximal JH) of 6.82 and 6.84, respectively (Fig. 6D). In cells transfected with NHE-1(WT), 20% FCS increased the maximal JH significantly to 4.51 mmol of H+/min/liter cells at pHi 6.70 and shifted the pH50 to 6.96, consistent with a decrease in Km for H+, as shown by a shift to the right in the JH versus pHi plot (37, 38). In contrast, cells transfected with NHE-1(S703A) had a maximal JH of 2.68 mmol of H+/min/liter cells at pHi 6.70 and a pH50 of 6.85 which differed significantly from NHE-1(WT) (p < 0.01, n = 4, Fig. 6D).

alpha -Thrombin-stimulated Na+/H+ Exchange Is Inhibited in Cells Transfected with NHE-1(S703A)-- To confirm that the effect of the S703A mutation is a general property for multiple growth factors, transfected PS120 cells were also stimulated with alpha -thrombin (1 units/ml) which has been reported to increase NHE-1 phosphorylation and stimulate NHE-1 in transfected PS120 cells (12). In these experiments no acid loading was performed which obviated any nonspecific effects of nigericin. In addition, stimulation of Na+/H+ exchange under these conditions can only be due to a change in affinity for intracellular H+, as intracellular pH should be at equilibrium. In PS120 cells transfected with NHE-1(WT), alpha -thrombin increased pHi by 0.16 ± 0.04 pH units (n = 3) (Fig. 6, F-G). In contrast, a much smaller intracellular alkalinization was elicited by alpha -thrombin in cells transfected with NHE-1(S703A) (0.05 ± 0.02 pH units, n = 3, p < 0.05 versus NHE-1(WT)). Based on these findings we conclude that phosphorylation of serine 703 is essential for the growth factor-mediated shift in H+ affinity of NHE-1.

Transfection of p90RSK cDNA Modulates Phosphorylation of NHE-1 Serine 703-- To show that p90RSK phosphorylates NHE-1 serine 703 in vivo, we transiently co-transfected 293 cells with cDNAs for NHE(WT) and either wild type p90RSK (WT-RSK) or a kinase-inactive p90RSK that functions as a dominant-negative (DN-RSK) (25, 39). We utilized 293 cells (which express endogenous human NHE-1) for these experiments because they exhibited much higher transfection efficiency than PS127A cells. Transfected 293 cells were serum-deprived for 24 h, labeled with [32P]orthophosphate, and then stimulated with 20% FCS for 5 min. Labeled NHE-1(WT) was immunoprecipitated and analyzed by two-dimensional tryptic phosphopeptide mapping. To compare changes in phosphorylation of phosphopeptides P4 and P5 among different experiments, the intensity of each spot was normalized to the fold increase observed in response to 20% FCS in LacZ-transfected cells using the calculations described under "Experimental Procedures" (Fig. 7, A and B). In 293 cells transfected with WT-RSK, phosphopeptide P5 phosphorylation was increased by 34 ± 5% compared with LacZ-transfected cells, whereas there was no significant change in P4 phosphorylation (Fig. 7, C and E). In contrast, in 293 cells transfected with DN-RSK there was a significant inhibition of P5 phosphorylation (-24 ± 6%) compared with LacZ-transfected cells (Fig. 7, D and E). There was no significant change in P4 phosphorylation in DN-RSK-transfected cells. These data indicate that p90RSK is a serum-stimulated kinase that specifically phosphorylates P5 (and hence serine 703) in cultured cells.


View larger version (58K):
[in this window]
[in a new window]
 
Fig. 7.   Co-transfection of 293 cells with NHE-1(WT) and WT-RSK or DN-RSK alters serum-stimulated phosphorylation of phosphopeptide P5. Two-dimensional tryptic phosphopeptide maps of NHE-1(WT) immunoprecipitated from 293 cells transiently transfected with WT-p90RSK (WT-RSK) or kinase-inactive p90RSK (DN-RSK) cDNA. A, cells were transfected with NHE-1(WT) and LacZ and maintained in 0.5% FCS. B, cells were transfected with NHE-1(WT) and LacZ and stimulated with 20% FCS for 5 min. C, cells were transfected with NHE-1(WT) and DN-RSK and stimulated with 20% FCS. D, cells were transfected with NHE-1(WT) and WT-RSK and stimulated with 20% FCS. E, PhosphorImager analysis of the relative volume of phosphopeptides P2-P5. Data were first normalized to spot P1 as described under "Experimental Procedures" except that control cells were the LacZ-transfected cells maintained in 0.5% FCS. Second, the fold increase in response to 20% FCS was then normalized to 100% for each experiment. Finally, the change in relative volume of each spot was compared in PS120 cells co-transfected with WT-RSK or DN-RSK. Results are the mean ± S.D., n = 3 (p < 0.05 for P5).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In the present study we report that p90RSK is a serum-activated NHE-1 kinase, and we identify human NHE-1 serine 703 as an amino acid whose phosphorylation is required for serum stimulation of Na+/H+ exchange. Serine 703 is a part of a consensus p90RSK phosphorylation motif (RXXS) in NHE-1, similar to the p90RSK consensus motifs reported previously (34). Characterization of p90RSK as an NHE-1 kinase represents a new function for this serine-threonine kinase and may have important implications for control of cell proliferation and diseases such as hypertension. Stimulation of Na+/H+ exchange is a universal feature of growth factor receptor activation and is required for cell proliferation (35, 37, 38, 40). Increased Na+/H+ exchange is a common feature in both hypertensive animal models and patients with essential hypertension (5). Because increased NHE-1 activity and phosphorylation are present in the SHR genetic model of hypertension (6, 10), it is possible that growth factor stimulation of p90RSK activity is important in the pathogenesis of hypertension.

Phosphorylation of NHE-1-- In fibroblasts, Sardet et al. (40, 41) showed that the phosphorylation state of a transfected Na+/H+ exchanger correlated temporally with growth factor-stimulated intracellular alkalinization. Epidermal growth factor, alpha -thrombin, and okadaic acid phosphorylated a set of common serine sites. However, the role of phosphorylation in regulating NHE-1 activity has been controversial, since phosphorylation is not required for activation by certain mediators such as muscarinic agonists and hyperosmotic stress (28, 42). In fact, truncation of the NHE-1 cytoplasmic tail distal to amino acid 635 abolishes the major sites of phosphorylation and greatly reduces (but does not eliminate) growth factor activation of NHE-1 (43). These results suggest that key serine residues carboxyl to amino acid 635 are required for NHE-1 activation but that other regulatory mechanisms such as binding of associated proteins (44, 45) are also important.

Two-dimensional Tryptic Phosphopeptide Mapping of NHE-1 Demonstrates Two Serum-stimulated Peptides-- Two-dimensional tryptic phosphopeptide maps of phosphorylated NHE-1 have been reported by several investigators (10, 12, 15, 30, 41) to show five peptides, at least one of which is increased by serum. It is not possible to compare directly the present study with previous reports because the experimental protocols differ. We observed two peptides, P4 and P5, that were significantly stimulated by serum (Fig. 1). Phosphopeptide P4 is not an insufficiently cleaved P5 peptide since mutation of serine 703 to alanine removed peptide P5 without effect on P4 (Fig. 5). Thus, our results suggest that there are at least two serum-stimulated phosphopeptides in NHE-1.

p90RSK Phosphorylates Ser-703 in Vitro-- Several results indicate that serine 703 is a physiologically important site for p90RSK-mediated phosphorylation of NHE-1. Sequence analysis demonstrated a consensus p90RSK phosphorylation motif, RXXS (amino acids 700-703 in NHE-1), similar to the p90RSK consensus motif reported previously (34). By using this sequence we designed a synthetic peptide (EP-1) and characterized the kinetics and stoichiometry of phosphorylation by p90RSK (Fig. 3). The calculated Km of 8 µM and stoichiometry ~1.0 for EP-1 phosphorylation compares favorably to the Km of 5 µM reported for p90RSK phosphorylation of the 40 S ribosomal subunit S6 protein (46). In addition, serine 703 was the only site in immunoprecipitated endogenous NHE-1 phosphorylated by purified activated p90RSK (Fig. 4D), despite the fact that NHE-1 has several RXXS motifs. We were unable to determine which isoform of p90RSK mediates EP-1 phosphorylation because the available antibodies immunoprecipitate all isoforms of p90RSK (23).

Serine 703 Is the Serum-stimulated Phosphorylation Site in NHE-1-- We showed that the serum-stimulated tryptic peptide P5 comigrated with a synthetic phosphorylated peptide (EP-2) designed to mimic endogenous P5 (Fig. 4C). The "tryptic cleaved phospho-EP-2" was confirmed by mass spectroscopic analysis to have the sequence IGpSDPLYEPK. These results indicate that P5 also has the sequence IGpSDPLYEPK and that there is only a single phosphoserine in the endogenous P5 (Ser-703). These conclusions are further supported by the complete loss of P5 phosphorylation when serine 703 was mutated to alanine. It should be noted that P4 is a separate serum-stimulated phosphopeptide whose sequence and physiologic importance remains to be determined.

Growth Factor Stimulation of NHE-1 Phosphorylation Involves a MEK1-ERK1/2-p90RSK Pathway-- This report defines NHE-1 as a new substrate for p90RSK and establishes a novel role for p90RSK in cell function. Identification of p90RSK is not surprising because several recent studies suggest that the MEK1-ERK1/2 pathway is important in activation of NHE-1. These studies include inhibition of serum-stimulated NHE-1 activity in fibroblasts by dominant-negative ERK1/2 (16, 19) and inhibition of NHE-1 activation in platelets with PD98059 (20). Mitogen stimulation of ERK1/2 via MEK1 is required for phosphorylation and activation of p90RSK (47, 48) since PD98059 prevents activation of p90RSK (47). Indeed, MAP kinases directly phosphorylate p90RSK (22) at MAP kinase sites (47). We found that 100 µM PD98059 inhibited p90RSK activity and NHE-1 phosphorylation (specifically peptide P5) by 60%. Since serum-stimulated phosphorylation of NHE-1 occurs at a p90RSK consensus sequence (RXXS) and this phosphorylation is inhibited by PD98059, these data suggest that p90RSK directly phosphorylates NHE-1 in the cell.

Protein kinases reported to phosphorylate NHE-1 include Ca2+-calmodulin-dependent kinases (13), protein kinase C(14), p160 Rho-associated kinase (p160ROCK)(15), ERK1/2 (1, 16), c-Jun amino-terminal kinase (17), and p38 (17). None of these kinases appear to phosphorylate directly NHE-1 based on the kinetics and stoichiometry of phosphorylation. For example, we found that recombinant NHE-1 was a substrate for ERK1/2, p38, and p90RSK, but the stoichiometry of phosphorylation observed for p90RSK was 20-fold greater than the other kinases (17). Bianchini et al. (19) also failed to show significant kinase activity of ERK1/2 toward recombinant NHE-1. Tominaga et al. (15) showed recently that p160ROCK phosphorylated recombinant NHE-1, but two peptides appeared in the two-dimensional tryptic phosphopeptide maps suggesting nonspecific phosphorylation. Finally, we showed that transfection of WT-RSK increased phosphorylation of P5 while transfection of DN-RSK inhibited phosphorylation of P5 specifically (Fig. 7). Thus, multiple characteristics of NHE-1 phosphorylation and p90RSK function indicate that the MEK1-ERK1/2-p90RSK pathway is involved in serum-stimulated phosphorylation of NHE-1.

Functional Analysis of NHE-1-S703A Mutant-- It has been proposed that modulation of the exchanger by phosphorylation shifts the pH range over which the exchanger's "pHi sensor" regulates ion exchange (1). It appears that phosphorylation of serine 703 is required for this shift in the pHi sensor, because the serum-mediated increase in NHE-1 affinity for H+ was abolished in the S703A mutant (Fig. 6). Our data disagree with some conclusions of previous studies that used deletion-mutation analysis of NHE-1. It was suggested that a negative regulatory domain was lost by deletions carboxyl to amino acid 698 (12, 31). Serine residues essential for activity were proposed to exist within the domain encompassed by amino acids 567-636, as deletions carboxyl to amino acid 636 decreased growth factor activation by ~50% (12, 31, 49). A possible explanation to reconcile these data is that alterations in structure that regulate function are more likely to occur with deletion analysis. Thus we believe that phosphorylation of serine 703 is one of the critical regulatory mechanisms for NHE-1 function.

How might phosphorylation of serine 703 augment NHE-1 activity? One mechanism may involve interactions with the calmodulin binding domain (residues 567-635) which acts as a negative regulatory domain and is critical for growth factor regulation of NHE-1 (43). Recently, a calcineurin B homologous protein termed CHP was shown to interact with NHE-1 by binding to this domain (44). Overexpression of CHP inhibited serum- and GTPase-stimulated NHE-1 activity suggesting that CHP may be released upon growth factor stimulation. It is possible that phosphorylation of serine 703 may change the structure of NHE-1 in this part of the molecule through backbone folding and non-covalent interactions to enhance calmodulin and/or CHP release. In addition to serine 703, other serines are also phosphorylated in response to serum (e.g. serine(s) in the P4 peptide), suggesting that cooperative interactions among two or more serines may be required to activate NHE-1. Another mechanism may involve interactions with regulatory proteins. NHE-RF, a functional regulatory protein that binds to the carboxyl tail of NHE-3 via a PDZ domain, was discovered (50, 51). Although NHE-1 does not have a PDZ domain, Goss et al. (45) identified a 24-kDa protein that co-immunoprecipitated with NHE-1. These data suggest that future efforts to identify proteins that interact specifically with phosphorylated NHE-1 may provide further insight into mechanisms by which the Na+/H+ exchanger is regulated.

    ACKNOWLEDGEMENTS

We are grateful to Paul Haynes, Julian Watts, and Steve Gygi as well as many members of the Berk laboratory for assistance.

    FOOTNOTES

* This work was supported by grants from the National Institutes of Health (to B. C. B and R. A.) and the Howard Hughes Medical Institute (to E. G. K.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger Dagger To whom correspondence should be addressed: Center for Cardiovascular Research, Box 679, University of Rochester, Rochester, NY 14642. Tel.: 716-273-1946; Fax: 716-473-1573; E-mail: bradford_berk@urmc.rochester.edu.

    ABBREVIATIONS

The abbreviations used are: pHi, intracellular pH; NHE-1, Na+/H+ exchanger isoform-1; SHR, spontaneously hypertensive rat; VSMC, vascular smooth muscle cell; WKY, Wistar Kyoto rat; MAP, mitogen-activated protein; ERK, extracellular signal-regulated kinase; GST, glutathione S-transferase; BCECF-AM, acetoxymethyl ester of 2',7'-bis(carboxyethyl)-5(6)-carboxyfluorescein; DMEM, Dulbecco's modified Eagle's medium; FCS, fetal calf serum; MEK1, MAP kinase/extracellular signal-regulated kinase 1; WT, wild type.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Noel, J., and Pouysségur, J. (1995) Am. J. Physiol. 268, C283-C296[Abstract/Free Full Text]
2. Orlowski, J., and Grinstein, S. (1997) J. Biol. Chem. 272, 22373-22376[Free Full Text]
3. Chambard, J. C., and Pouyssegur, J. (1986) Exp. Cell Res. 164, 282-294[CrossRef][Medline] [Order article via Infotrieve]
4. Cox, G. A., Lutz, C. M., Yang, C. L., Biemesderfer, D., Bronson, R. T., Fu, A., Aronson, P. S., Noebels, J. L., and Frankel, W. N. (1997) Cell 91, 139-148[CrossRef][Medline] [Order article via Infotrieve]
5. Siffert, W., and Dusing, R. (1995) Hypertension 26, 649-655[Abstract/Free Full Text]
6. Berk, B. C., Vallega, G., Muslin, A. J., Gordon, H. M., Canessa, M., and Alexander, R. W. (1989) J. Clin. Invest. 83, 822-829
7. Orlowski, J., Kandasamy, R. A., and Shull, G. E. (1992) J. Biol. Chem. 267, 9331-9339[Abstract/Free Full Text]
8. Lucchesi, P. A., DeRoux, N., and Berk, B. C. (1994) Hypertension 24, 734-738[Abstract/Free Full Text]
9. Siczkowski, M., Davies, J. E., and Ng, L. L. (1994) J. Hypertens. 12, 775-781[Medline] [Order article via Infotrieve]
10. Siczkowski, M., Davies, J. E., and Ng, L. L. (1995) Circ. Res. 76, 825-831[Abstract/Free Full Text]
11. Goss, G. G., Woodside, M., Wakabayashi, S., Pouysségur, J., Waddell, T., Downey, G. P., and Grinstein, S. (1994) J. Biol. Chem. 269, 8741-8748[Abstract/Free Full Text]
12. Wakabayashi, S., Bertrand, B., Shigekawa, M., Fafournoux, P., and Pouysségur, J. (1994) J. Biol. Chem. 269, 5583-5588[Abstract/Free Full Text]
13. Fliegel, L., Walsh, M. P., Singh, D., Wong, C., and Barr, A. (1992) Biochem. J. 282, 139-145
14. Fafournoux, P., Ghysdael, J., Sardet, C., and Pouysségur, J. (1991) Biochemistry 30, 9510-9515[CrossRef][Medline] [Order article via Infotrieve]
15. Tominaga, T., Ishizaki, T., Narumiya, S., and Barber, D. L. (1998) EMBO J. 17, 4712-4722[CrossRef][Medline] [Order article via Infotrieve]
16. Wang, H., Silva, N. L., Lucchesi, P. A., Haworth, R., Wang, K., Michalak, M., Pelech, S., and Fliegel, L. (1997) Biochemistry 36, 9151-9158[CrossRef][Medline] [Order article via Infotrieve]
17. Kusuhara, M., Takahashi, E., Peterson, T. E., Abe, J., Ishida, M., Han, J., Ulevitch, R., and Berk, B. C. (1998) Circ. Res. 83, 824-831[Abstract/Free Full Text]
18. Dudley, D. T., Pang, L., Decker, S. J., Bridges, A. J., and Saltiel, A. R. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 7686-7689[Abstract/Free Full Text]
19. Bianchini, L., L'Allemain, G., and Pouysségur, J. (1997) J. Biol. Chem. 272, 271-279[Abstract/Free Full Text]
20. Aharonovitz, O., and Granot, Y. (1996) J. Biol. Chem. 271, 16494-16499[Abstract/Free Full Text]
21. Sabri, A., Corrinne, T. C., and Lucchesi, P. A. (1997) Circulation 96, I-46 (abstr.)
22. Sturgill, T. W., Ray, B. L., Erikson, E., and Maller, J. L. (1988) Nature 334, 715-718[CrossRef][Medline] [Order article via Infotrieve]
23. Takahashi, E., Abe, J., and Berk, B. C. (1997) Circ. Res. 81, 268-273[Abstract/Free Full Text]
24. Phan, V., Kusuhara, M., Lucchesi, P. A., and Berk, B. C. (1997) Hypertension 29, 1265-1272[Abstract/Free Full Text]
25. Spring, D. J., and Krebs, E. G. (1999) Mol. Cell. Biol. 19, 317-320[Abstract/Free Full Text]
26. Glass, D. B., Masaracchia, R. A., Feramisco, J. R., and Kemp, B. E. (1978) Anal. Biochem. 87, 566-575[CrossRef][Medline] [Order article via Infotrieve]
27. Figeys, D., Gygi, S. P., Zhang, Y., Watts, J., Gu, M., and Aebersold, R. (1998) Electrophoresis 19, 1811-1818[CrossRef][Medline] [Order article via Infotrieve]
28. Grinstein, S., Woodside, M., Sardet, C., Pouysségur, J., and Rotin, D. (1992) J. Biol. Chem. 267, 23823-23828[Abstract/Free Full Text]
29. Watts, J. D., Affolter, M., Krebs, D. L., Wange, R. L., Samelson, L. E., and Aebersold, R. (1994) J. Biol. Chem. 269, 29520-29529[Abstract/Free Full Text]
30. McSwine, R. L., Babnigg, G., Musch, M. W., Chang, E. B., and Villereal, M. L. (1994) J. Cell. Physiol. 161, 351-357[CrossRef][Medline] [Order article via Infotrieve]
31. Wakabayashi, S., Fafournoux, P., Sardet, C., and Pouysségur, J. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 2424-2428[Abstract/Free Full Text]
32. Mitsuka, M., and Berk, B. C. (1991) Am. J. Physiol. 260, C562-C569[Abstract/Free Full Text]
33. Berk, B. C., Aronow, M. S., Brock, T. A., Cragoe, E., Jr., Gimbrone, M. A., Jr., and Alexander, R. W. (1987) J. Biol. Chem. 262, 5057-5064[Abstract/Free Full Text]
34. Erikson, E., and Maller, J. L. (1988) Second Messengers and Phosphoproteins 12, 135-143[Medline] [Order article via Infotrieve]
35. Pouysségur, J., Sardet, C., Franch, A., L'Allemain, G., and Paris, S. (1984) Proc. Natl. Acad. Sci. U. S. A. 81, 4833-4837[Abstract/Free Full Text]
36. Kelly, M. P., Quinn, P. A., Davies, J. E., and Ng, L. L. (1997) Circ. Res. 80, 853-860[Abstract/Free Full Text]
37. Paris, S., and Pouyssegur, J. (1984) J. Biol. Chem. 259, 10989-10994[Abstract/Free Full Text]
38. Moolenaar, W. H., Tsien, R. Y., van der Saag, P. T., and de Laat, S. W. (1983) Nature 304, 645-648[CrossRef][Medline] [Order article via Infotrieve]
39. Grove, J. R., Price, D. J., Banerjee, P., Balasubramanyam, A., Ahmad, M. F., and Avruch, J. (1993) Biochemistry 32, 7727-7738[CrossRef][Medline] [Order article via Infotrieve]
40. Sardet, C., Counillon, L., Franchi, A., and Pouysségur, J. (1990) Science 247, 723-726[Abstract/Free Full Text]
41. Sardet, C., Fafournoux, P., and Pouysségur, J. (1991) J. Biol. Chem. 266, 19166-19171[Abstract/Free Full Text]
42. Robertson, M. A., Woodside, M., Foskett, J. K., Orlowski, J., and Grinstein, S. (1997) J. Biol. Chem. 272, 287-294[Abstract/Free Full Text]
43. Wakabayashi, S., Bertrand, B., Ikeda, T., Pouysségur, J., and Shigekawa, M. (1994) J. Biol. Chem. 269, 13710-13715[Abstract/Free Full Text]
44. Lin, X., and Barber, D. L. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 12631-12636[Abstract/Free Full Text]
45. Goss, G., Orlowski, J., and Grinstein, S. (1996) Am. J. Physiol. 39, C1493-C1502
46. Erikson, E., and Maller, J. L. (1986) J. Biol. Chem. 261, 350-355[Abstract/Free Full Text]
47. Dalby, K. N., Morrice, N., Caudwell, F. B., Avruch, J., and Cohen, P. (1998) J. Biol. Chem. 273, 1496-1505[Abstract/Free Full Text]
48. Nguyen, T. T., Scimeca, J.-C., Filloux, C., Peraldi, P., Carpentier, J.-L., and van Obberghen, E. V. (1993) J. Biol. Chem. 268, 9803-9810[Abstract/Free Full Text]
49. Bertrand, B., Wakabayashi, S., Ikeda, T., Pouysségur, J., and Shigekawa, M. (1994) J. Biol. Chem. 269, 13703-13709[Abstract/Free Full Text]
50. Weinman, E. J., Steplock, D., Wang, Y., and Shenolikar, S. (1995) J. Clin. Invest. 95, 2143-2149
51. Hall, R. A., Premont, R. T., Chow, C. W., Blitzer, J. T., Pitcher, J. A., Claing, A., Stoffel, R. H., Barak, L. S., Shenolikar, S., Weinman, E. J., Grinstein, S., and Lefkowitz, R. J. (1998) Nature 392, 626-630[CrossRef][Medline] [Order article via Infotrieve]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
A. Mandal, M. Shahidullah, N. A. Delamere, and M. A. Teran
Elevated hydrostatic pressure activates sodium/hydrogen exchanger-1 in rat optic nerve head astrocytes
Am J Physiol Cell Physiol, July 1, 2009; 297(1): C111 - C120.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
L. Schneider, C.-M. Stock, P. Dieterich, B. H. Jensen, L. B. Pedersen, P. Satir, A. Schwab, S. T. Christensen, and S. F. Pedersen
The Na+/H+ exchanger NHE1 is required for directional migration stimulated via PDGFR-{alpha} in the primary cilium
J. Cell Biol., April 6, 2009; 185(1): 163 - 176.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
A. Ortiz-Acevedo, R. R. Rigor, H. M. Maldonado, and P. M. Cala
Activation of Na+/H+ and K+/H+ exchange by calyculin A in Amphiuma tridactylum red blood cells: implications for the control of volume-induced ion flux activity
Am J Physiol Cell Physiol, November 1, 2008; 295(5): C1316 - C1325.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
I. Szokodi, R. Kerkela, A.-M. Kubin, B. Sarman, S. Pikkarainen, A. Konyi, I. G. Horvath, L. Papp, M. Toth, R. Skoumal, et al.
Functionally Opposing Roles of Extracellular Signal-Regulated Kinase 1/2 and p38 Mitogen-Activated Protein Kinase in the Regulation of Cardiac Contractility
Circulation, October 14, 2008; 118(16): 1651 - 1658.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
A. K. Snabaitis, F. Cuello, and M. Avkiran
Protein Kinase B/Akt Phosphorylates and Inhibits the Cardiac Na+/H+ Exchanger NHE1
Circ. Res., October 10, 2008; 103(8): 881 - 890.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
A. L. Grenier, K. Abu-ihweij, G. Zhang, S. M. Ruppert, R. Boohaker, E. R. Slepkov, K. Pridemore, J.-J. Ren, L. Fliegel, and A. R. Khaled
Apoptosis-induced alkalinization by the Na+/H+ exchanger isoform 1 is mediated through phosphorylation of amino acids Ser726 and Ser729
Am J Physiol Cell Physiol, October 1, 2008; 295(4): C883 - C896.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. W. Good, T. George, and B. A. Watts III
Nerve Growth Factor Inhibits Na+/H+ Exchange and Formula Absorption through Parallel Phosphatidylinositol 3-Kinase-mTOR and ERK Pathways in Thick Ascending Limb
J. Biol. Chem., September 26, 2008; 283(39): 26602 - 26611.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
Z. Lu, J.-i. Abe, J. Taunton, Y. Lu, T. Shishido, C. McClain, C. Yan, S. P. Xu, T. M. Spangenberg, and H. Xu
Reactive Oxygen Species-Induced Activation of p90 Ribosomal S6 Kinase Prolongs Cardiac Repolarization Through Inhibiting Outward K+ Channel Activity
Circ. Res., August 1, 2008; 103(3): 269 - 278.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. C. Zaun, A. Shrier, and J. Orlowski
Calcineurin B Homologous Protein 3 Promotes the Biosynthetic Maturation, Cell Surface Stability, and Optimal Transport of the Na+/H+ Exchanger NHE1 Isoform
J. Biol. Chem., May 2, 2008; 283(18): 12456 - 12467.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y.-S. Jung, H.-Y. Kim, J. Kim, M.-G. Lee, J. Pouyssegur, and E. Kim
Physical Interactions and Functional Coupling between Daxx and Sodium Hydrogen Exchanger 1 in Ischemic Cell Death
J. Biol. Chem., January 11, 2008; 283(2): 1018 - 1025.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
E. D. Johnstone, P. F. Speake, and C. P. Sibley
Epidermal growth factor and sphingosine-1-phosphate stimulate Na+/H+ exchanger activity in the human placental syncytiotrophoblast
Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2007; 293(6): R2290 - R2294.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Luo, D. B. Kintner, G. E. Shull, and D. Sun
ERK1/2-p90RSK-mediated Phosphorylation of Na+/H+ Exchanger Isoform 1: A ROLE IN ISCHEMIC NEURONAL DEATH
J. Biol. Chem., September 21, 2007; 282(38): 28274 - 28284.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J. Xue, D. Zhou, H. Yao, O. Gavrialov, M. J. McConnell, B. D. Gelb, and G. G. Haddad
Novel functional interaction between Na+/H+ exchanger 1 and tyrosine phosphatase SHP-2
Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2007; 292(6): R2406 - R2416.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. E. Malo, L. Li, and L. Fliegel
Mitogen-activated Protein Kinase-dependent Activation of the Na+/H+ Exchanger Is Mediated through Phosphorylation of Amino Acids Ser770 and Ser771
J. Biol. Chem., March 2, 2007; 282(9): 6292 - 6299.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
F. Cuello, A. K. Snabaitis, M. S. Cohen, J. Taunton, and M. Avkiran
Evidence for Direct Regulation of Myocardial Na+/H+ Exchanger Isoform 1 Phosphorylation and Activity by 90-kDa Ribosomal S6 Kinase (RSK): Effects of the Novel and Specific RSK Inhibitor fmk on Responses to {alpha}1-Adrenergic Stimulation
Mol. Pharmacol., March 1, 2007; 71(3): 799 - 806.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
P. J. Schoonheim, H. Veiga, D. da Costa Pereira, G. Friso, K. J. van Wijk, and A. H. de Boer
A Comprehensive Analysis of the 14-3-3 Interactome in Barley Leaves Using a Complementary Proteomics and Two-Hybrid Approach
Plant Physiology, February 1, 2007; 143(2): 670 - 683.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Mishima, S. Wakabayashi, and C. Kojima
Solution Structure of the Cytoplasmic Region of Na+/H+ Exchanger 1 Complexed with Essential Cofactor Calcineurin B Homologous Protein 1
J. Biol. Chem., January 26, 2007; 282(4): 2741 - 2751.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
J. H. Turner, M. N. Garnovskaya, S. D. Coaxum, T. M. Vlasova, M. Yakutovich, D. M. Lefler, and J. R. Raymond
Ca2+-Calmodulin and Janus Kinase 2 Are Required for Activation of Sodium-Proton Exchange by the Gi-Coupled 5-Hydroxytryptamine1a Receptor
J. Pharmacol. Exp. Ther., January 1, 2007; 320(1): 314 - 322.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
B. A. Watts III, T. George, and D. W. Good
Aldosterone inhibits apical NHE3 and HCO3- absorption via a nongenomic ERK-dependent pathway in medullary thick ascending limb
Am J Physiol Renal Physiol, November 1, 2006; 291(5): F1005 - F1013.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. K. Snabaitis, R. D'Mello, S. Dashnyam, and M. Avkiran
A Novel Role for Protein Phosphatase 2A in Receptor-mediated Regulation of the Cardiac Sarcolemmal Na+/H+ Exchanger NHE1
J. Biol. Chem., July 21, 2006; 281(29): 20252 - 20262.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
N. Maekawa, J.-i. Abe, T. Shishido, S. Itoh, B. Ding, V. K. Sharma, S.-S. Sheu, B. C. Blaxall, and B. C. Berk
Inhibiting p90 Ribosomal S6 Kinase Prevents Na+-H+ Exchanger-Mediated Cardiac Ischemia-Reperfusion Injury
Circulation, May 30, 2006; 113(21): 2516 - 2523.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
Y. Fujiwara, K. Higuchi, T. Takashima, M. Hamaguchi, T. Hayakawa, K. Tominaga, T. Watanabe, N. Oshitani, Y. Shimada, and T. Arakawa
Roles of epidermal growth factor and Na+/H+ exchanger-1 in esophageal epithelial defense against acid-induced injury
Am J Physiol Gastrointest Liver Physiol, April 1, 2006; 290(4): G665 - G673.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
D. B. Kintner, A. Look, G. E. Shull, and D. Sun
Stimulation of astrocyte Na+/H+ exchange activity in response to in vitro ischemia depends in part on activation of ERK1/2
Am J Physiol Cell Physiol, October 1, 2005; 289(4): C934 - C945.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Itoh, B. Ding, C. P. Bains, N. Wang, Y. Takeishi, T. Jalili, G. L. King, R. A. Walsh, C. Yan, and J.-i. Abe
Role of p90 Ribosomal S6 Kinase (p90RSK) in Reactive Oxygen Species and Protein Kinase C {beta} (PKC-{beta})-mediated Cardiac Troponin I Phosphorylation
J. Biol. Chem., June 24, 2005; 280(25): 24135 - 24142.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
M. Baumgartner, H. Patel, and D. L. Barber
Na+/H+ exchanger NHE1 as plasma membrane scaffold in the assembly of signaling complexes
Am J Physiol Cell Physiol, October 1, 2004; 287(4): C844 - C850.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. Aker, A. K Snabaitis, I. Konietzka, A. van de Sand, K. Bongler, M. Avkiran, G. Heusch, and R. Schulz
Inhibition of the Na+/H+ exchanger attenuates the deterioration of ventricular function during pacing-induced heart failure in rabbits
Cardiovasc Res, August 1, 2004; 63(2): 273 - 282.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Al-Khalili, O. Kotova, H. Tsuchida, I. Ehren, E. Feraille, A. Krook, and A. V. Chibalin
ERK1/2 Mediates Insulin Stimulation of Na,K-ATPase by Phosphorylation of the {alpha}-Subunit in Human Skeletal Muscle Cells
J. Biol. Chem., June 11, 2004; 279(24): 25211 - 25218.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
P. P. Roux and J. Blenis
ERK and p38 MAPK-Activated Protein Kinases: a Family of Protein Kinases with Diverse Biological Functions
Microbiol. Mol. Biol. Rev., June 1, 2004; 68(2): 320 - 344.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
E. Takahashi, K. Fukuda, S. Miyoshi, M. Murata, T. Kato, M. Ita, T. Tanabe, and S. Ogawa
Leukemia Inhibitory Factor Activates Cardiac L-Type Ca2+ Channels via Phosphorylation of Serine 1829 in the Rabbit Cav1.2 Subunit
Circ. Res., May 14, 2004; 94(9): 1242 - 1248.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. V. Mukhin, M. N. Garnovskaya, M. E. Ullian, and J. R. Raymond
ERK Is Regulated by Sodium-Proton Exchanger in Rat Aortic Vascular Smooth Muscle Cells
J. Biol. Chem., January 16, 2004; 279(3): 1845 - 1852.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. S. Haworth, C. McCann, A. K. Snabaitis, N. A. Roberts, and M. Avkiran
Stimulation of the Plasma Membrane Na+/H+ Exchanger NHE1 by Sustained Intracellular Acidosis: EVIDENCE FOR A NOVEL MECHANISM MEDIATED BY THE ERK PATHWAY
J. Biol. Chem., August 22, 2003; 278(34): 31676 - 31684.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. E. Cavet, S. Lehoux, and B. C. Berk
14-3-3beta Is a p90 Ribosomal S6 Kinase (RSK) Isoform 1-binding Protein That Negatively Regulates RSK Kinase Activity
J. Biol. Chem., May 9, 2003; 278(20): 18376 - 18383.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. N. Garnovskaya, Y. V. Mukhin, T. M. Vlasova, and J. R. Raymond
Hypertonicity Activates Na+/H+ Exchange through Janus Kinase 2 and Calmodulin
J. Biol. Chem., May 2, 2003; 278(19): 16908 - 16915.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Wakabayashi, T. Hisamitsu, T. Pang, and M. Shigekawa
Mutations of Arg440 and Gly455/Gly456 Oppositely Change pH Sensing of Na+/H+ Exchanger 1
J. Biol. Chem., March 28, 2003; 278(14): 11828 - 11835.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
M. Avkiran and R. S Haworth
Regulatory effects of G protein-coupled receptors on cardiac sarcolemmal Na+/H+ exchanger activity: signalling and significance
Cardiovasc Res, March 15, 2003; 57(4): 942 - 952.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Pang, S. Wakabayashi, and M. Shigekawa
Expression of Calcineurin B Homologous Protein 2 Protects Serum Deprivation-induced Cell Death by Serum-independent Activation of Na+/H+ Exchanger
J. Biol. Chem., November 8, 2002; 277(46): 43771 - 43777.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
E. C. Rothstein, K. L. Byron, R. E. Reed, L. Fliegel, and P. A. Lucchesi
H2O2-induced Ca2+ overload in NRVM involves ERK1/2 MAP kinases: role for an NHE-1-dependent pathway
Am J Physiol Heart Circ Physiol, August 1, 2002; 283(2): H598 - H605.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Q.-S. Qiu, Y. Guo, M. A. Dietrich, K. S. Schumaker, and J.-K. Zhu
Regulation of SOS1, a plasma membrane Na+/H+ exchanger in Arabidopsisthaliana, by SOS2 and SOS3
PNAS, June 11, 2002; 99(12): 8436 - 8441.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
B. A. Watts III and D. W. Good
ERK mediates inhibition of Na+/H+ exchange and HCO3- absorption by nerve growth factor in MTAL
Am J Physiol Renal Physiol, June 1, 2002; 282(6): F1056 - F1063.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
A. K Snabaitis, D. J Hearse, and M. Avkiran
Regulation of sarcolemmal Na+/H+ exchange by hydrogen peroxide in adult rat ventricular myocytes
Cardiovasc Res, February 1, 2002; 53(2): 470 - 480.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
Y. Takeishi, Q. Huang, J.-i. Abe, W. Che, J.-D. Lee, H. Kawakatsu, B. D Hoit, Bradford.C Berk, and R. A Walsh
Activation of mitogen-activated protein kinases and p90 ribosomal S6 kinase in failing human hearts with dilated cardiomyopathy
Cardiovasc Res, January 1, 2002; 53(1): 131 - 137.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. R. Khaled, A. N. Moor, A. Li, K. Kim, D. K. Ferris, K. Muegge, R. J. Fisher, L. Fliegel, and S. K. Durum
Trophic Factor Withdrawal: p38 Mitogen-Activated Protein Kinase Activates NHE1, Which Induces Intracellular Alkalinization
Mol. Cell. Biol., November 15, 2001; 21(22): 7545 - 7557.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. A. Richards, V. C. Dreisbach, L. O. Murphy, and J. Blenis
Characterization of Regulatory Events Associated with Membrane Targeting of p90 Ribosomal S6 Kinase 1
Mol. Cell. Biol., November 1, 2001; 21(21): 7470 - 7480.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. Wei, E. C. Rothstein, L. Fliegel, L. J. Dell'Italia, and P. A. Lucchesi
Differential MAP kinase activation and Na+/H+ exchanger phosphorylation by H2O2 in rat cardiac myocytes
Am J Physiol Cell Physiol, November 1, 2001; 281(5): C1542 - C1550.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
S. Ibata-Ombetta, T. Jouault, P.-A. Trinel, and D. Poulain
Role of extracellular signal-regulated protein kinase cascade in macrophage killing of Candida albicans
J. Leukoc. Biol., July 1, 2001; 70(1): 149 - 154.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J.-i. Abe, C. P. Baines, and B. C. Berk
Role of Mitogen-Activated Protein Kinases in Ischemia and Reperfusion Injury : The Good and the Bad
Circ. Res., March 31, 2000; 86(6): 607 - 609.
[Full Text] [PDF]


Home page
Circ. Res.Home page
A. K. Snabaitis, H. Yokoyama, and M. Avkiran
Roles of Mitogen-Activated Protein Kinases and Protein Kinase C in {alpha}1A-Adrenoceptor-Mediated Stimulation of the Sarcolemmal Na+-H+ Exchanger
Circ. Res., February 4, 2000; 86(2): 214 - 220.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Counillon and J. Pouyssegur
The Expanding Family of Eucaryotic Na+/H+ Exchangers
J. Biol. Chem., January 7, 2000; 275(1): 1 - 4.
[Full Text] [PDF]


Home page
Circ. Res.Home page
Y. Takeishi, J.-i. Abe, J.-D. Lee, H. Kawakatsu, R. A. Walsh, and B. C. Berk
Differential Regulation of p90 Ribosomal S6 Kinase and Big Mitogen-Activated Protein Kinase 1 by Ischemia/Reperfusion and Oxidative Stress in Perfused Guinea Pig Hearts
Circ. Res., December 3, 1999; 85(12): 1164 - 1172.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. V. Mukhin, T. Vlasova, A. A. Jaffa, G. Collinsworth, J. L. Bell, B. G. Tholanikunnel, T. Pettus, W. Fitzgibbon, D. W. Ploth, J. R. Raymond, et al.
Bradykinin B2 Receptors Activate Na+/H+ Exchange in mIMCD-3 Cells via Janus Kinase 2 and Ca2+/Calmodulin
J. Biol. Chem., May 11, 2001; 276(20): 17339 - 17346.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Lehoux, J.-i. Abe, J. A. Florian, and B. C. Berk
14-3-3 Binding to Na+/H+ Exchanger Isoform-1 Is Associated with Serum-dependent Activation of Na+/H+ Exchange
J. Biol. Chem., May 4, 2001; 276(19): 15794 - 15800.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. N. Moor, X. T. Gan, M. Karmazyn, and L. Fliegel
Activation of Na+/H+ Exchanger-directed Protein Kinases in the Ischemic and Ischemic-reperfused Rat Myocardium
J. Biol. Chem., May 4, 2001; 276(19): 16113 - 16122.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Yan, K. Nehrke, J. Choi, and D. L. Barber
The Nck-interacting Kinase (NIK) Phosphorylates the Na+-H+ Exchanger NHE1 and Regulates NHE1 Activation by Platelet-derived Growth Factor
J. Biol. Chem., August 10, 2001; 276(33): 31349 - 31356.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Takahashi, E.
Right arrow Articles by Berk, B. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takahashi, E.
Right arrow Articles by Berk, B. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement