|
J Biol Chem, Vol. 274, Issue 29, 20206-20214, July 16, 1999
p90RSK Is a Serum-stimulated
Na+/H+ Exchanger Isoform-1 Kinase
REGULATORY PHOSPHORYLATION OF SERINE 703 OF
Na+/H+ EXCHANGER ISOFORM-1*
Eiichi
Takahashi,
Jun-ichi
Abe,
Byron
Gallis,
Ruedi
Aebersold ,
Denise J.
Spring§,
Edwin G.
Krebs§¶ , and
Bradford C.
Berk**
From the Departments of Medicine, Molecular
Biotechnology, § Pharmacology, and ¶ Biochemistry and
the Howard Hughes Medical Institute, University of Washington,
Seattle, Washington 98195 and the ** Center for Cardiovascular
Research, University of Rochester, Rochester, New York 14642
 |
ABSTRACT |
The Na+/H+
exchanger isoform-1 (NHE-1) is the key member of a family of exchangers
that regulates intracellular pH and cell volume. Activation of NHE-1 by
growth factors is rapid, correlates with increased NHE-1
phosphorylation and cell alkalinization, and plays a role in cell cycle
progression. By two-dimensional tryptic peptide mapping of
immunoprecipitated NHE-1, we identify serine 703 as the major
serum-stimulated amino acid. Mutation of serine 703 to alanine had no
effect on acid-stimulated Na+/H+ exchange but
completely prevented the growth factor-mediated increase in NHE-1
affinity for H+. In addition, we show that p90 ribosomal S6
kinase (p90RSK) is a key NHE-1 kinase since
p90RSK phosphorylates NHE-1 serine 703 stoichiometrically
in vitro, and transfection with kinase-inactive
p90RSK inhibits serum-induced phosphorylation of NHE-1
serine 703 in transfected 293 cells. These findings establish
p90RSK as a serum-stimulated NHE-1 kinase and a mediator of
increased Na+/H+ exchange in
vivo.
 |
INTRODUCTION |
Intracellular pH
(pHi)1 and cell
volume are regulated in part by a family of ion exchangers termed the
Na+/H+ exchangers. Among these proteins,
Na+/H+ exchanger isoform-1 (NHE-1) is
ubiquitous (1, 2). NHE-1 is activated by growth factors that alter its
affinity for intracellular H+ and thereby cause cell
alkalinization (1). Intracellular alkalinization mediated by NHE-1
(defined by amiloride-sensitive inhibition) is required for cell growth
(3). Abnormalities in NHE-1 function may contribute to disease
pathogenesis. In the NHE-1 knockout mouse, seizures develop at age 19 days (4). Increased NHE-1 activity has been demonstrated in cells and
tissues of hypertensive humans and animals (5). The spontaneously
hypertensive rat (SHR), a genetic model of hypertension, exhibits
increased Na+/H+ exchange and increased
vascular smooth muscle cell (VSMC) growth compared with the
normotensive Wistar Kyoto rat (WKY) (6). In SHR there is no significant
change in NHE-1 cDNA sequence (7), steady state mRNA levels
(8), or protein expression (9). However, there is a significant
increase in NHE-1 phosphorylation in response to growth factors in VSMC
derived from the SHR compared with WKY (10). These results suggest that
alterations in NHE-1 phosphorylation (and the responsible kinases)
contribute to the SHR phenotype.
NHE-1 has been shown to be constitutively phosphorylated in
growth-arrested cells. In response to growth factors, multiple sites
show increased phosphorylation based on two-dimensional tryptic peptide
maps (11). The amino acids phosphorylated by growth factors are located
in the carboxyl-terminal 300 amino acids of the exchanger (12). Because
changes in NHE-1 phosphorylation may regulate
Na+/H+ exchange, these findings suggest that
increased Na+/H+ exchange in the SHR is caused
by an alteration in the activity of kinases that phosphorylate NHE-1.
Thus, identification of growth factor-stimulated kinases that
phosphorylate NHE-1 may provide insight into the pathogenesis of hypertension.
Several protein kinases have been proposed to regulate NHE-1, including
Ca2+-calmodulin-dependent kinases (13), protein
kinase C (14), p160 Rho-associated kinase (p160ROCK) (15),
and members of the mitogen-activated protein (MAP) kinase family
including ERK1/2 (1, 16), c-Jun amino-terminal kinase, and p38 (17).
Data implicating a key role for ERK1/2 are strongest, since
pharmacological inhibition of the MEK1-ERK1/2 pathway with PD98059 (18)
or transfection with dominant-negative ERK1/2 (19-21) dramatically
decreased growth factor-stimulated Na+/H+
exchange. It is not clear that ERK1/2 directly phosphorylate NHE-1, and
it is possible that other kinase(s) downstream of ERK1/2 are
responsible for NHE-1 phosphorylation.
We proposed previously that p90 ribosomal S6 kinase
(p90RSK), a downstream substrate of ERK1/2 (22), was a
physiologically relevant NHE-1 kinase (23, 24). This hypothesis was
based on the following findings: 1) a 90-kDa kinase exhibited increased activity toward an NHE-1-GST fusion protein in lysates from SHR VSMC
compared with WKY VSMC (24); 2) immunodepletion of p90RSK
decreased the activity of the 90-kDa kinase; 3) PD98059 blocked growth
factor-mediated activation of p90RSK and decreased NHE-1
phosphorylation; 4) p90RSK immunoprecipitated from
angiotensin II stimulated VSMC-phosphorylated recombinant NHE-1
in vitro; 5) the time courses for stimulation of
p90RSK and Na+/H+ exchange activity
by angiotensin II were also similar (23). In the present study, we
performed experiments with mutated NHE-1 and p90RSK
proteins to assess their effects on growth factor-stimulated Na+/H+ exchange. The results indicate that
p90RSK phosphorylates serine 703 of NHE-1, and this
phosphorylation is required for growth factor stimulation of
Na+/H+ exchange.
 |
EXPERIMENTAL PROCEDURES |
Materials--
Anti-NHE-1 antiserum (G116) was a gift from Dr.
L. L. Ng (Leicester Royal Infirmary, UK); anti-p90RSK2
antibody was obtained from Santa Cruz Biotechnology (Santa Cruz, CA).
NHE-1 synthetic peptides EP-1 (RRRARIGSDPLA) and EP-2
(MARARIGSDPLAYEPK) were from PeptidoGenic Research (Livermore, CA). The
plasmid (pcDNA3.1) was obtained from Invitrogen (Carlsbad, CA).
Human NHE-1 cDNA was a gift from Dr. L. Fliegel (University of
Alberta, Canada). DN-RSK and WT-RSK have been described (25). Neomycin
and PD98059 were from Calbiochem. Acetoxymethyl ester of
2',7'-bis(carboxyethyl)-5(6)-carboxyfluorescein (BCECF)-AM was from
Molecular Probes (Eugene, OR). Activated p90RSK2 was
obtained from Upstate Biotechnology Inc. (Lake Placid, NY). Sequencing
grade trypsin was from Promega (Madison, WI). Thin layer cellulose
plates were from Eastman Kodak Co.
Cell Culture--
VSMC were isolated from the thoracic aorta of
200-250-g male Harlan Sprague-Dawley rats (Harlan Sprague-Dawley) and
maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented
with 100 units/ml penicillin, 100 µg/ml streptomycin, and 10% calf serum (HyClone, Logan, UT) as described previously. VSMC (passages 5-13) were growth-arrested at 70-80% confluence by incubation in
0.5% calf serum/DMEM for 48 h prior to use. PS127A cells (Chinese hamster lung fibroblasts that overexpress human NHE-1) and PS120 cells
(Chinese hamster lung fibroblasts deficient in NHE-1) were gifts of Dr.
J. Pouyssegur (University of Nice, France). PS127A and PS120 cells were
maintained in DMEM (pH 7.4-7.6) supplemented with 100 units/ml
penicillin, 100 µg/ml streptomycin, and 5% FCS (Summit, Ft. Collins,
CO). 293 cells (ATCC, CRL1573) were maintained in DMEM (pH 7.4-7.6)
supplemented with 100 units/ml penicillin, 100 µg/ml streptomycin,
and 10% FCS.
Preparation of Cell Lysates--
VSMC were harvested using
modified Oncogene Science lysis buffer as described previously (23).
PS127A, PS120, and 293 cells were harvested using NHE-1 lysis buffer
(14). Cells were immediately frozen on ethanol/dry ice, and the cell
lysates were then thawed on ice, scraped, sonicated, and centrifuged at
14,000 × g at 4 °C for 30 min. Supernatants were
used immediately.
Immunoprecipitation of p90RSK--
For
immunoprecipitation of p90RSK, cell lysates containing 200 µg of protein were incubated with anti-p90RSK (2 µg)
antibody overnight at 4 °C and then incubated with 20 µl of
protein G-agarose beads (Life Technologies, Inc.) for 2 h on a
roller system at 4 °C. The beads were washed two times with 1 ml of
lysis buffer, 2 times with 1 ml of LiCl wash buffer (500 mmol/liter
LiCl, 100 mmol/liter Tris-Cl, pH 7.6, 0.1% Triton X-100, and 1 mmol/liter dithiothreitol), and two times with 1 ml of washing buffer
(20 mmol/liter HEPES, pH 7.2, 2 mmol/liter EGTA, 10 mmol/liter
MgCl2, 1 mmol/liter dithiothreitol, and 0.1% Triton
X-100).
Phosphorylation of NHE-1 Peptide-1
(EP-1)--
Immunoprecipitated p90RSK was incubated at
30 °C for 5 min in 200 µl of kinase reaction buffer (30 µM HEPES, pH 7.4, 10 mM MgCl2, 50 µM ATP, 50 µCi/ml [ -32P]ATP) with
various concentrations of EP-1. The reactions were centrifuged for
10 s at 5000 rpm, and 10 µl of the supernatant was collected and
applied to 1 × 1-cm P-81 paper. The P-81 paper was washed 4 times
for 2 min with 0.1% phosphoric acid and incorporated 32P
measured by scintillation counting (26). Nonspecific phosphorylation was determined by subtraction of the counts from reactions containing the same concentration of EP-1 without p90RSK. For the
analysis of the stoichiometry of phosphorylation of EP-1, four
immunoprecipitates were incubated together at 30 °C in 400 µl of
kinase reaction buffer as described above with 10 µM
EP-1, and samples were removed at the times indicated.
Phosphorylation and Purification of the NHE-1 Peptide-2
(EP-2)--
Immunoprecipitated p90RSK was incubated at
30 °C for 30 min in 200 µl of kinase reaction buffer containing
100 µM EP-2. The reaction was centrifuged for 5 min at
5000 rpm, and the supernatant was collected and digested with 2 µg of
trypsin at 37 °C overnight. The pH was adjusted to 8.4 with ammonium
bicarbonate and ammonium hydroxide. Tryptic phosphopeptides were
purified on a C18 reverse phase high pressure liquid chromatography
column. The mass and sequence of the peptides were determined using a
triple quadrupole mass spectrometer (Finnigan MAT, San Jose, CA) as
described previously (27).
In Vitro p90RSK Reaction Using GST-NHE-1 Fusion
Protein as a Substrate--
Immunoprecipitated p90RSK from
PS127A cells stimulated by 20% FCS for 5 min was incubated at 30 °C
for 10 min in 200 µl of kinase reaction buffer containing 10 µg of
GST-NHE-1 fusion protein (which contains amino acids 675-725 of
human NHE-1 (23)).
In Vivo Labeling and Phosphopeptide Mapping--
PS127A cells,
transfected PS120 cells, and transfected 293 cells were metabolically
labeled with [32P]orthophosphate, using previously
published protocols (28) with slight modification. In brief, cells
deprived of serum for 8 h were exposed to phosphate-free medium
for 15 h and then labeled with 250 µCi/ml
[32P]orthophosphate for 3 h. Cells were stimulated
with 20% FCS for 5 min and were harvested. NHE-1 was
immunoprecipitated, washed six times with lysis buffer, and boiled in
Laemmli sample buffer containing 100 mM dithiothreitol. For
phosphopeptide mapping, the immunoprecipitates were fractionated by
7.5% SDS-polyacrylamide gel electrophoresis and transferred to
nitrocellulose membranes. The phosphorylated NHE-1 was identified by
autoradiography, excised, and digested with trypsin following
established protocols (29). The resulting peptides were fractionated by
two-dimensional phosphopeptide mapping (29). In brief, the peptides
were separated in the first dimension by electrophoresis (1,000 V for
1.5 h; 10% acetic acid, 1% pyridine in water, pH 3.3)
and in the second dimension by ascending chromatography (37%
1-butanol, 25% pyridine, 9% acetic acid in water, pH 5.0) (30) for
2 h. The phosphorylated peptides were detected by autoradiography,
and the radioactivity was analyzed on a PhosphorImager (Molecular
Dynamics, Sunnyvale, CA). To permit comparison of fold change in
32P incorporation among different experiments, the
following calculation was performed. The normalization constant,
k, was determined for each experiment by Equation 1: P1
densitometric volume in 20% FCS sample divided by P1 densitometric
value in 0.5% FCS times k = 1.0. The normalized value
for each phosphopeptide was then determined by Equation 2: Px
densitometric volume in 20% FCS sample divided by Px
densitometric value in 0.5% FCS times k.
In Vitro NHE-1 Phosphorylation by p90RSK--
NHE-1
was immunoprecipitated from a lysate of 500 µg of serum-deprived
PS127A cells with the G116 NHE-1 antibody and protein A-agarose beads.
The immunoprecipitant was incubated at 30 °C for 30 min in 50 µl
of kinase reaction buffer containing 0.5 units of active
p90RSK2. The reaction was stopped by washing 6 times with
the lysis buffer and then subjected to tryptic two-dimensional
phosphopeptide mapping as described above.
Plasmid and Cell Transfections--
Serine 703 was mutated to
alanine using polymerase chain reaction with the following primers (the
mutated residues is shown in bold): 2090 CTCGGGCCCGCATCGGCGCAGACCCAC 2116. Wild type NHE-1
(NHE-1(WT)) and the S703A mutant NHE-1 (NHE-1(S703A)) were inserted
into pcDNA3.1 using HaeIII and XbaI. PS120
cells were seeded at 40% confluence onto 60-mm dishes 24 h prior
to transfection and transfected with 4 µg of plasmid DNA using the
LipofectAMINE Plus method (Qiagen, Hilden, Germany). After 6 h of
incubation with the DNA-lipid complexes, the cells were re-fed with
serum-containing medium. Two days post-transfection, the transfected
cells were trypsinized and seeded onto three 100-mm dishes in medium
containing 1000 µg/ml neomycin. After 1 week of selection, cell
colonies were picked and expanded into individual cultures. Transfected PS120 cells were maintained in DMEM, 5% FCS with 1000 µg/ml
neomycin, and every week cells were subjected to acid selection to
maintain high level expression of NHE-1 as described previously (31). In brief, cells were exposed to 50 mM NH4Cl in
TBSS (135 mM NaCl, 5 mM KCl, 1.5 mM
CaCl2, 1.0 mM MgCl2, 200 mg/dl
glucose, 20 mM HEPES, 20 mM Tris, pH 7.4) for
1 h followed by low NaCl/choline Cl solution buffer (130 mM choline Cl, 5 mM NaCl, 5 mM KCl,
1.5 mM CaCl2, 1.0 mM
MgCl2, 200 mg/dl glucose, 20 mM HEPES, 20 mM Tris, pH 6.5) for 1 h.
For transient transfection to 293 cells, cells were seeded at 80-90%
confluence onto 100-mm dishes 24 h prior to transfection and
co-transfected with 1.5 µg of pcDNA NHE-1 and 1.5 µg of
pcDNA LacZ, pMT2 DN-RSK, or pMT2 WT-RSK using LipofectAMINE Plus
method. After 6 h of incubation with the DNA-lipid complexes, the
cells were re-fed with serum-containing medium. On the next day, cells were serum-deprived to 0.8% calf serum and labeled with
[32P]orthophosphate.
pHi Measurement--
Na+/H+
exchange was determined by ethyl isopropyl amiloride-sensitive
pHi recovery following acid loading as described previously
using the fluorescent pH-sensitive dye, BCECF (32, 33). Fluorescent
measurements (excitation at 500 and 450 nm with emission at 530 nm)
were made with a PTI Delta scan spectrofluorometer. Briefly, cells were
grown on glass coverslips coated with gelatin and growth-arrested at
70-80% confluence by incubation in 0.5% calf serum/DMEM for 24 h prior to use. Cells were loaded with 3 µM BCECF-AM in
serum-free DMEM at 37 °C for 30 min, washed twice, and incubated in
a HEPES-Tris balanced salt solution (HBSS, 130 mM NaCl, 5 mM KCl, 1.5 mM CaCl2 1.0 mM MgCl2, and 20 mM HEPES buffered
to pH 7.4 at 37 °C with Tris base) for 30 min. Cells were
acid-loaded with 20 µM nigericin in KCl solution (135 mM KCl, 10 mM HEPES, pH 6.5). After the
pHi decreased to 6.5, the solution was changed to TBSS, pH 7.4. The nigericin/high K+ technique was used to calibrate the
relationship between excitation ratio (F500/450) and pHi. The
rate of pHi recovery was converted to mmol of
H+/min/liter cells (JH) by
multiplying by the buffering power. Buffering power was determined by
stepwise reduction of NH4Cl under conditions in which ion
fluxes were completely inhibited (5 mM BaCl2,
30 µM ethyl isopropyl amiloride). The data were then
plotted as mmol of H+/min/liter cells
(JH) versus pHi .
Statistics--
Values presented are means ± S.D.
Student's t test was used when appropriate. p
values < 0.05 were considered statistically significant.
 |
RESULTS |
Serum Stimulates Phosphorylation of NHE-1 in Cultured
Cells--
It has been shown previously that serum stimulates
phosphorylation of NHE-1 and that the majority of the de
novo incorporation occurs in a single tryptic peptide of NHE-1
(30). We performed two-dimensional tryptic phosphopeptide mapping of
immunoprecipitated NHE-1 from PS127A fibroblasts that were maintained
in 0.5% FCS (Fig. 1A) or
stimulated with 20% FCS for 5 min (Fig. 1B). Five major
phosphopeptides were identified (see scheme in Fig. 1C). To
analyze changes in phosphorylation among different experiments, the
intensity change of each spot was normalized to spot P1 using the
calculations described under "Experimental Procedures." This normalization obviated the need to demonstrate that equal quantities of
NHE-1 were expressed and immunoprecipitated for different experiments and cell preparations. Unlike previous investigations that showed growth factors increase the phosphorylation of only one peptide (30),
we found two serum-stimulated NHE-1 phosphopeptides (Fig. 1,
A and B). These phosphopeptides, termed P4 and P5
(Fig. 1C), showed 4.2 ± 0.8-fold and 11.3 ± 0.7-fold increases (n = 3, all analyses are mean ± S.D.), respectively, in response to 20% FCS (Fig. 1D).
Based on the magnitude of the serum-stimulated increase in
phosphorylation and electrophoretic mobility, we believe that phosphopeptide P5 is the same tryptic peptide described by other investigators.

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 1.
Serum-stimulated phosphorylation of NHE-1:
presence of two serum-stimulated phosphopeptides. Two-dimensional
tryptic phosphopeptide maps of NHE-1 were prepared from PS127A cells
maintained in 0.5% FCS (A) or stimulated with 20% FCS for
5 min (B). The origins are shown as black circles
at the left lower corners. C, scheme for
two-dimensional phosphopeptide map of NHE-1 identifies 5 major
phosphopeptides. D, PhosphorImager analysis of the relative
volume of each phosphopeptide spot. Data were normalized to spot P1 as
described under "Experimental Procedures." Results are the
mean ± S.D., n = 3.
|
|
The MEK1 Inhibitor PD98059 Decreases Phosphorylation of
Phosphopeptide P5--
We and others (24) have observed that
phosphorylation of NHE-1 in response to serum is inhibited by PD98059
suggesting that at least one NHE-1 kinase is regulated by the MEK1 and
ERK1/2 pathway. Because we also found that ERK1/2 did not readily
phosphorylate recombinant NHE-1-(625-747) as shown by a stoichiometry
of only <0.05 (mol of phosphate/mol of total substrate) in an immune
complex kinase reaction (17), it is unlikely that ERK1/2 are NHE-1
kinases. However, we previously reported that a 90-kDa NHE-1 kinase
(with characteristics consistent with p90RSK) was a
possible NHE-1 kinase based on the intensity of phosphorylation and
immunodepletion experiments. Activation of this 90-kDa kinase by serum
was inhibited by PD98059, consistent with reports that p90RSK is activated by the MEK1-ERK1/2 pathway. To identify
which NHE-1 phosphopeptides might be substrates for p90RSK,
we studied the effect of MEK1 inhibition on serum stimulation of NHE-1
phosphorylation. The concentration of PD98059 required to inhibit
p90RSK-dependent phosphorylation of NHE-1 was
determined by incubating PS127A cells with PD98059 (10, 50, and 100 µM) for 1 h. Cells were then stimulated with 20%
FCS for 5 min followed by p90RSK immunoprecipitation. An
immune complex kinase assay was then performed using
GST-NHE-1-(625-747) as substrate (23). There was a >10-fold
stimulation of p90RSK by 20% FCS measured by GST-NHE-1
phosphorylation (Fig. 2A,
1st and 3rd lanes). PD98059 inhibited p90RSK
activity in a concentrationdependent manner (Fig. 2A,
4th to 6th lanes) which was significant (58 ± 7%
inhibition, n = 3) at 100 µM (Fig.
2B). To determine the effect of MEK1 inhibition in vivo, PS127A cells were maintained in 0.5% FCS and incubated with 0.2% Me2SO (vehicle) or 100 µM PD98059 for
1 h. The cells were then kept in 0.5% serum (Fig. 2C)
or stimulated with 20% FCS for 5 min. NHE-1 was immunoprecipitated and
two-dimensional tryptic phosphopeptide analysis performed.
Phosphorylation of phosphopeptide P5 was significantly inhibited by 100 µM PD98059 (62 ± 7%, n = 3),
whereas phosphorylation of P4 was not significantly changed in
subsequent experiments (Fig. 2F). Based on the findings that phosphopeptide P5 showed the greatest increase in phosphorylation in
response to serum, was dependent on MEK1, and co-migrated with a
serum-stimulated peptide previously reported, subsequent studies focused on this phosphopeptide.

View larger version (45K):
[in this window]
[in a new window]
|
Fig. 2.
The MEK1 inhibitor PD98059 inhibits
serum-stimulated p90RSK activity and NHE-1
phosphorylation. A, inhibition of p90RSK
activity by PD98059 (PD) was determined using an in
vitro kinase assay. PS127A cells were maintained in 0.5% serum
and then pretreated with 10, 50, or 100 µM PD98059 for
1 h as shown. Cells were then treated with 20% FCS for 5 min;
p90RSK was immunoprecipitated, and its activity was
measured by phosphorylation of GST-NHE-1. B, inhibition of
20% FCS-stimulated p90RSK activity by increasing
concentrations of PD98059. Densitometric analysis of data shown in
A normalized to 20% FCS stimulated values in the absence of
PD98059 which was set to 100% (n = 3).
C-E, two-dimensional tryptic phosphopeptide maps of NHE-1
from PS127A cells stimulated by 20% FCS for 5 min. Cells were
maintained in 0.5% serum and then treated according to the following
protocols: C, 0.5% serum, 0 µM PD98059;
D, 20% FCS, 0 µM PD98059; E, 20%
FCS, 100 µM PD98059 for 1 h; F,
inhibition of 20% FCS-stimulated maximal 32P incorporation
into NHE-1 phosphopeptides after treatment with 100 µM
PD98059 (n = 3). Values are normalized to P1 which was
set to 100%. All data were shown as mean ± S.D. *,
p < 0.05
|
|
Immunoprecipitated p90RSK Phosphorylates NHE-1
Peptide-1 (EP-1) to High Stoichiometry--
Previous results from our
laboratory showed that p90RSK specifically phosphorylates
serine and/or threonine residues located between amino acids 670 and
714 of NHE-1 in vitro (23). Sequence analysis revealed a
consensus p90RSK phosphorylation motif (RXXS)
(34) at amino acids 700-703 (Fig. 3A).
To characterize this site of NHE-1 as a substrate for
p90RSK, an NHE-1 peptide (EP-1, RRRARIGSDPLA) containing a
single serine was synthesized (Fig. 3A). Activated
p90RSK was immunoprecipitated from rat VSMC stimulated with
200 nM angiotensin II for 5 min. An in vitro
kinase reaction was then performed with activated p90RSK
and EP-1. Fig. 3B depicts the rate of incorporation of
32P into EP-1 as a function of substrate concentration. A
Lineweaver-Burk plot of the data in Fig. 3B yielded a
Km of 8.2 ± 0.4 µM
(n = 3, Fig. 3C). Incubation of 10 µM EP-1 with activated, immunoprecipitated
p90RSK for 30 min produced a stoichiometric phosphorylation
of EP-1 (Fig. 3D). The relatively high affinity of
p90RSK for the EP-1 peptide and a stoichiometry ~1.0
suggests that serine 703 of NHE-1 is a physiological site of
phosphorylation by p90RSK.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 3.
Kinetics and stoichiometry of phosphorylation
of the synthetic NHE-1 peptide (EP-1) mediated by
p90RSK. A, the amino acid sequence of the
NHE-1-predicted phosphorylation site by p90RSK in
vitro and the sequence of synthetic peptides (EP-1 and EP-2) and
tryptic phospho-EP-2. B, rate of incorporation of phosphate
into EP-1 as a function of EP-1 concentration. Active
p90RSK was immunoprecipitated from angiotensin
II-stimulated vascular smooth muscle cells and an in vitro
kinase assay performed with the indicated concentrations of EP-1.
32P incorporation was determined by liquid scintillation
spectrometry (mean ± S.D., n = 3). C,
Lineweaver-Burk plot of data in A. D,
stoichiometry of phosphorylation of 10 µM EP-1 by
p90RSK.
|
|
A Synthetic NHE-1 Phosphopeptide Containing Serine 703 Co-migrates
with Phosphopeptide P5--
To confirm that serine 703 is the amino
acid phosphorylated in response to serum, we performed co-migration
studies of synthetic and endogenous NHE-1 tryptic phosphopeptides. We
designed a synthetic peptide that included serine 703 and the
surrounding amino acid sequence of NHE-1 (EP-2, Fig.
3A). Based on this sequence, we predicted that EP-2 would
generate the endogenous phosphopeptide P5 when cleaved by trypsin. To
generate phosphorylated EP-2, activated p90RSK was
immunoprecipitated from rat VSMC stimulated with 200 nM
angiotensin II for 5 min. An immune complex kinase reaction was then
performed with EP-2 as substrate. The phosphorylated peptide was then
cleaved with trypsin, purified by reverse phase high pressure liquid
chromatography, and analyzed by mass spectrometry. Tryptic cleaved,
phospho-EP-2 (tryptic pEP-2, sequence, IGpSDPLYEPK, where pS is
phosphoserine) was then subjected to two-dimensional peptide mapping
and shown to migrate as a single spot (Fig.
4A). The electrophoretic
mobility of tryptic pEP-2 was very similar to P5 of endogenous NHE-1
immunoprecipitated from PS127A cells stimulated by 20% FCS (Fig.
4B). To confirm that P5 and tryptic pEP-2 were identical,
tryptic pEP-2 (sample in Fig. 4A) and tryptic endogenous
NHE-1 peptides (sample in Fig. 4B) were mixed and subjected
to two-dimensional peptide mapping. Tryptic pEP-2 co-migrated with
endogenous phosphopeptide P5 (Fig. 4C).

View larger version (82K):
[in this window]
[in a new window]
|
Fig. 4.
Phosphopeptide P5 co-migrates with a
synthetic NHE-1 peptide (EP-2) that contains serine 703. Two-dimensional tryptic phosphopeptide maps of tryptic-cleaved,
phosphorylated EP-2 peptide (pEP-2) in vitro by
immunoprecipitated p90RSK (A); NHE-1
immunoprecipitated from PS127A cells stimulated with 20% FCS for 5 min
(B); A and B mixed together
(C); NHE-1 immunoprecipitated from PS127A cells (in 0.5%
FCS) and phosphorylated in vitro by active
p90RSK2 (D).
|
|
To show that phosphopeptide P5 is a good substrate for
p90RSK, NHE-1 was immunoprecipitated from PS127A cells, and
an in vitro kinase reaction was performed with activated
p90RSK. Phosphorylated endogenous NHE-1 was then
trypsinized and subjected to two-dimensional peptide mapping (Fig.
4D). Only a single phosphopeptide that co-migrated with P5
and tryptic pEP-2 was observed. Thus, only serine 703 appears to be
phosphorylated by p90RSK in vitro, despite the
fact that NHE-1 has five potential p90RSK phosphorylation
sites based on the RXXS motif (RERS (56), RFTS (325), RLRS
(648), RIGS (703), and RCLS (796)).
Mutation of Serine 703 Specifically Inhibits Serum Stimulation of
Phosphopeptide P5--
To provide additional evidence that serine 703 is phosphorylated in response to serum, we mutated serine 703 to
alanine (S703A) in NHE-1. The mutated NHE-1 (NHE-1(S703A)) or wild type
NHE-1 (NHE-1(WT)) proteins were then stably expressed in PS120
fibroblasts that lack all known NHE isoforms (35). In brief, PS120
cells were transfected with appropriate cDNAs and selected for
expression of NHE-1(S703A) or NHE-1(WT) by maintenance in neomycin. To
select for clones with high levels of protein expression, acid loading and recovery was performed weekly (31). Equal expression of full-length
Na+/H+ exchanger was confirmed by
immunoprecipitation and Western blot analysis with anti-NHE-1 antibody
(G116) (36) for at least three different clones (not shown).
Transfected PS120 cells were maintained in 0.5% FCS or stimulated with
20% FCS for 5 min. NHE-1 was then immunoprecipitated, and
two-dimensional tryptic phosphopeptide mapping was performed. The
phosphopeptide map of NHE-1 from PS120 expressing NHE-1(WT) maintained
in 0.5% FCS (Fig. 5A) or
stimulated with 20% FCS for 5 min (Fig. 5B) was similar to
the map of NHE-1 from PS127A cells (Fig. 1A). However, in
the NHE-1 map from PS120 cells expressing NHE-1(S703A), phosphopeptide
P5 was completely absent in both cells maintained in 0.5% FCS (Fig.
5C) or stimulated 20% FCS for 5 min (Fig. 5D),
consistent with serine 703 being the phosphorylated amino acid present
in this tryptic peptide.

View larger version (63K):
[in this window]
[in a new window]
|
Fig. 5.
NHE-1(S703A) does not yield a
serum-stimulated phosphopeptide P5. Two-dimensional tryptic
phosphopeptide maps of NHE-1 immunoprecipitated from PS120 cells
expressing NHE-1(WT) in 0.5% FCS (A) and in 20% FCS for 5 min (B); NHE-1 immunoprecipitated from serum-stimulated
PS120 cells expressing NHE-1(S703A) in 0.5% FCS (C) and in
20% FCS for 5 min (D).
|
|
Serum-stimulated Na+/H+ Exchange Is
Inhibited in Cells Transfected with NHE-1(S703A)--
To determine the
functional consequences of mutating NHE-1 serine 703, stably
transfected PS120 cells were analyzed for serum-stimulated Na+/H+ exchange. Transfected PS120 cells were
acid-loaded to an intracellular pH of 6.5 by exposure to 20 µM nigericin (a K+/H+ ionophore)
in the presence of 135 mM KCl (pH 6.5) as described previously (33). In non-transfected PS120 cells, which lack functional
NHE-1, there was a very slow recovery from the acid load that was not
altered by treatment with 20% FCS (Fig.
6A). In PS120 cells
transfected with NHE-1(WT) there was a rapid pHi recovery to a
resting pHi of 7.0 within 300 s (Fig. 6B). When
these cells were treated with 20% FCS, there was an increase in both
the rate and extent of intracellular alkalinization (Fig. 6B). Both the pHi recovery and serum-stimulated
recovery were due to expression of NHE-1 as there was ~100%
inhibition by 1 µM ethyl isopropyl amiloride (not shown).
PS120 cells expressing NHE-1(S703A) also showed a rapid pHi
recovery from the acid load, which did not differ significantly from
cells expressing NHE-1(WT) (compare control in Fig. 6, B and
C). However, there was no stimulation of pHi
recovery by 20% FCS in the NHE-1(S703A) expressing cells (Fig.
6C). These results indicate that phosphorylation of serine
703 is required for the serum stimulation of
Na+/H+ exchange but is not necessary for
acid-stimulated Na+/H+ exchange.

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 6.
NHE-1(S703A)-transfected cells exhibit
decreased growth factor-stimulated pHi recovery from an acid
load. PS120 cells were stably transfected with NHE-1(S703A) or
NHE-1(WT) cDNAs. Intracellular pH was lowered by exposure to
nigericin and KCl, pH 6.5. The external buffer was changed from the KCl
solution, pH 6.5, to TBSS, pH 7.4, at time 0. A, PS120 cells
transfected with pcDNA3.1 alone exhibited minimal pHi
recovery. B, PS120 cells expressing NHE-1(WT) exhibited
rapid pHi recovery. The rate and extent of pHi recovery
were stimulated in cells pretreated with 20% FCS for 5 min.
C, PS120 cells expressing NHE-1(S703A) exhibited rapid
pHi recovery. The rate and extent of pHi recovery were
not changed by pretreatment with 20% FCS. The rate of proton flux
(JH) during acid recovery was calculated for
PS120 cells transfected with NHE-1(WT) or NHE-1(S703A) (D).
At pH 6.8, only PS120 cells expressing NHE-1(WT) showed increased
JH (E) (mean ± S.D.,
n = 3). PS120 cells were stably transfected with
NHE-1(S703A) or NHE-1(WT) cDNAs. Cells were incubated in TBSS, pH
7.4, until a stable pHi was obtained. Cells were stimulated
with 1 unit/ml -thrombin (F) at the time 0. The magnitude
of intracellular alkalinization was compared at 300 s after
agonist stimulation (G). The difference between PS120 cells
stably transfected with NHE-1(S703A) or NHE-1(WT) cDNAs was
significant for -thrombin (mean ± S.D., n = 3, p < 0.05).
|
|
The ability of serum to stimulate Na+/H+
exchange has previously been shown to be due to an increase in affinity
for intracellular H+ (37, 38). Kinetic analysis of the
H+ flux showed that there was no significant difference in
kinetic properties of NHE-1(WT) compared with NHE-1(S703A) when
stimulated by acidification alone with maximal
JH values of 2.07 and 2.42 mmol of
H+/min/liter cells at pHi 6.70 and pH50
values (pHi at half-maximal JH) of 6.82 and 6.84, respectively (Fig. 6D). In cells transfected with
NHE-1(WT), 20% FCS increased the maximal JH
significantly to 4.51 mmol of H+/min/liter cells at
pHi 6.70 and shifted the pH50 to 6.96, consistent
with a decrease in Km for H+, as shown
by a shift to the right in the JH
versus pHi plot (37, 38). In contrast, cells
transfected with NHE-1(S703A) had a maximal JH
of 2.68 mmol of H+/min/liter cells at pHi 6.70 and
a pH50 of 6.85 which differed significantly from NHE-1(WT)
(p < 0.01, n = 4, Fig.
6D).
-Thrombin-stimulated Na+/H+ Exchange Is
Inhibited in Cells Transfected with NHE-1(S703A)--
To confirm that
the effect of the S703A mutation is a general property for multiple
growth factors, transfected PS120 cells were also stimulated with
-thrombin (1 units/ml) which has been reported to increase NHE-1
phosphorylation and stimulate NHE-1 in transfected PS120 cells (12). In
these experiments no acid loading was performed which obviated any
nonspecific effects of nigericin. In addition, stimulation of
Na+/H+ exchange under these conditions can only
be due to a change in affinity for intracellular H+, as
intracellular pH should be at equilibrium. In PS120 cells transfected
with NHE-1(WT), -thrombin increased pHi by 0.16 ± 0.04 pH units (n = 3) (Fig. 6, F-G). In
contrast, a much smaller intracellular alkalinization was elicited by
-thrombin in cells transfected with NHE-1(S703A) (0.05 ± 0.02 pH units, n = 3, p < 0.05 versus NHE-1(WT)). Based on these findings we conclude that
phosphorylation of serine 703 is essential for the growth
factor-mediated shift in H+ affinity of NHE-1.
Transfection of p90RSK cDNA Modulates
Phosphorylation of NHE-1 Serine 703--
To show that
p90RSK phosphorylates NHE-1 serine 703 in vivo,
we transiently co-transfected 293 cells with cDNAs for NHE(WT) and either wild type p90RSK (WT-RSK) or a kinase-inactive
p90RSK that functions as a dominant-negative (DN-RSK) (25,
39). We utilized 293 cells (which express endogenous human NHE-1) for these experiments because they exhibited much higher transfection efficiency than PS127A cells. Transfected 293 cells were serum-deprived for 24 h, labeled with [32P]orthophosphate, and then
stimulated with 20% FCS for 5 min. Labeled NHE-1(WT) was
immunoprecipitated and analyzed by two-dimensional tryptic
phosphopeptide mapping. To compare changes in phosphorylation of
phosphopeptides P4 and P5 among different experiments, the intensity of
each spot was normalized to the fold increase observed in response to
20% FCS in LacZ-transfected cells using the calculations described
under "Experimental Procedures" (Fig.
7, A and B). In 293 cells transfected with WT-RSK, phosphopeptide P5 phosphorylation was
increased by 34 ± 5% compared with LacZ-transfected cells, whereas there was no significant change in P4 phosphorylation (Fig. 7,
C and E). In contrast, in 293 cells transfected
with DN-RSK there was a significant inhibition of P5 phosphorylation ( 24 ± 6%) compared with LacZ-transfected cells (Fig. 7,
D and E). There was no significant change in P4
phosphorylation in DN-RSK-transfected cells. These data indicate that
p90RSK is a serum-stimulated kinase that specifically
phosphorylates P5 (and hence serine 703) in cultured cells.

View larger version (58K):
[in this window]
[in a new window]
|
Fig. 7.
Co-transfection of 293 cells with NHE-1(WT)
and WT-RSK or DN-RSK alters serum-stimulated phosphorylation of
phosphopeptide P5. Two-dimensional tryptic phosphopeptide maps of
NHE-1(WT) immunoprecipitated from 293 cells transiently transfected
with WT-p90RSK (WT-RSK) or kinase-inactive
p90RSK (DN-RSK) cDNA. A, cells were
transfected with NHE-1(WT) and LacZ and maintained in 0.5% FCS.
B, cells were transfected with NHE-1(WT) and LacZ and
stimulated with 20% FCS for 5 min. C, cells were
transfected with NHE-1(WT) and DN-RSK and stimulated with 20% FCS.
D, cells were transfected with NHE-1(WT) and WT-RSK and
stimulated with 20% FCS. E, PhosphorImager analysis of the
relative volume of phosphopeptides P2-P5. Data were first normalized
to spot P1 as described under "Experimental Procedures" except that
control cells were the LacZ-transfected cells maintained in 0.5% FCS.
Second, the fold increase in response to 20% FCS was then normalized
to 100% for each experiment. Finally, the change in relative volume of
each spot was compared in PS120 cells co-transfected with WT-RSK or
DN-RSK. Results are the mean ± S.D., n = 3 (p < 0.05 for P5).
|
|
 |
DISCUSSION |
In the present study we report that p90RSK is a
serum-activated NHE-1 kinase, and we identify human NHE-1 serine 703 as
an amino acid whose phosphorylation is required for serum stimulation
of Na+/H+ exchange. Serine 703 is a part of a
consensus p90RSK phosphorylation motif (RXXS) in
NHE-1, similar to the p90RSK consensus motifs reported
previously (34). Characterization of p90RSK as an NHE-1
kinase represents a new function for this serine-threonine kinase and
may have important implications for control of cell proliferation and
diseases such as hypertension. Stimulation of Na+/H+ exchange is a universal feature of
growth factor receptor activation and is required for cell
proliferation (35, 37, 38, 40). Increased
Na+/H+ exchange is a common feature in both
hypertensive animal models and patients with essential hypertension
(5). Because increased NHE-1 activity and phosphorylation are present
in the SHR genetic model of hypertension (6, 10), it is possible that
growth factor stimulation of p90RSK activity is important
in the pathogenesis of hypertension.
Phosphorylation of NHE-1--
In fibroblasts, Sardet et
al. (40, 41) showed that the phosphorylation state of a
transfected Na+/H+ exchanger correlated
temporally with growth factor-stimulated intracellular alkalinization.
Epidermal growth factor, -thrombin, and okadaic acid phosphorylated
a set of common serine sites. However, the role of phosphorylation in
regulating NHE-1 activity has been controversial, since phosphorylation
is not required for activation by certain mediators such as muscarinic
agonists and hyperosmotic stress (28, 42). In fact, truncation of the NHE-1 cytoplasmic tail distal to amino acid 635 abolishes the major
sites of phosphorylation and greatly reduces (but does not eliminate)
growth factor activation of NHE-1 (43). These results suggest that key
serine residues carboxyl to amino acid 635 are required for NHE-1
activation but that other regulatory mechanisms such as binding of
associated proteins (44, 45) are also important.
Two-dimensional Tryptic Phosphopeptide Mapping of NHE-1
Demonstrates Two Serum-stimulated Peptides--
Two-dimensional
tryptic phosphopeptide maps of phosphorylated NHE-1 have been reported
by several investigators (10, 12, 15, 30, 41) to show five peptides, at
least one of which is increased by serum. It is not possible to compare
directly the present study with previous reports because the
experimental protocols differ. We observed two peptides, P4 and P5,
that were significantly stimulated by serum (Fig. 1). Phosphopeptide P4 is not an insufficiently cleaved P5 peptide since mutation of serine
703 to alanine removed peptide P5 without effect on P4 (Fig. 5). Thus,
our results suggest that there are at least two serum-stimulated
phosphopeptides in NHE-1.
p90RSK Phosphorylates Ser-703 in Vitro--
Several
results indicate that serine 703 is a physiologically important site
for p90RSK-mediated phosphorylation of NHE-1. Sequence
analysis demonstrated a consensus p90RSK phosphorylation
motif, RXXS (amino acids 700-703 in NHE-1), similar to the
p90RSK consensus motif reported previously (34). By using
this sequence we designed a synthetic peptide (EP-1) and characterized
the kinetics and stoichiometry of phosphorylation by p90RSK
(Fig. 3). The calculated Km of 8 µM
and stoichiometry ~1.0 for EP-1 phosphorylation compares favorably to
the Km of 5 µM reported for
p90RSK phosphorylation of the 40 S ribosomal subunit S6
protein (46). In addition, serine 703 was the only site in
immunoprecipitated endogenous NHE-1 phosphorylated by purified
activated p90RSK (Fig. 4D), despite the fact
that NHE-1 has several RXXS motifs. We were unable to
determine which isoform of p90RSK mediates EP-1
phosphorylation because the available antibodies immunoprecipitate all
isoforms of p90RSK (23).
Serine 703 Is the Serum-stimulated Phosphorylation Site in
NHE-1--
We showed that the serum-stimulated tryptic peptide P5
comigrated with a synthetic phosphorylated peptide (EP-2) designed to
mimic endogenous P5 (Fig. 4C). The "tryptic cleaved
phospho-EP-2" was confirmed by mass spectroscopic analysis to have
the sequence IGpSDPLYEPK. These results indicate that P5 also has the
sequence IGpSDPLYEPK and that there is only a single phosphoserine in
the endogenous P5 (Ser-703). These conclusions are further supported by
the complete loss of P5 phosphorylation when serine 703 was mutated to
alanine. It should be noted that P4 is a separate serum-stimulated phosphopeptide whose sequence and physiologic importance remains to be determined.
Growth Factor Stimulation of NHE-1 Phosphorylation Involves a
MEK1-ERK1/2-p90RSK Pathway--
This report defines NHE-1
as a new substrate for p90RSK and establishes a novel role
for p90RSK in cell function. Identification of
p90RSK is not surprising because several recent studies
suggest that the MEK1-ERK1/2 pathway is important in activation of
NHE-1. These studies include inhibition of serum-stimulated NHE-1
activity in fibroblasts by dominant-negative ERK1/2 (16, 19) and
inhibition of NHE-1 activation in platelets with PD98059 (20). Mitogen stimulation of ERK1/2 via MEK1 is required for phosphorylation and
activation of p90RSK (47, 48) since PD98059 prevents
activation of p90RSK (47). Indeed, MAP kinases directly
phosphorylate p90RSK (22) at MAP kinase sites (47). We
found that 100 µM PD98059 inhibited p90RSK
activity and NHE-1 phosphorylation (specifically peptide P5) by 60%.
Since serum-stimulated phosphorylation of NHE-1 occurs at a
p90RSK consensus sequence (RXXS) and this
phosphorylation is inhibited by PD98059, these data suggest that
p90RSK directly phosphorylates NHE-1 in the cell.
Protein kinases reported to phosphorylate NHE-1 include
Ca2+-calmodulin-dependent kinases (13), protein
kinase C(14), p160 Rho-associated kinase (p160ROCK)(15),
ERK1/2 (1, 16), c-Jun amino-terminal kinase (17), and p38 (17). None of
these kinases appear to phosphorylate directly NHE-1 based on the
kinetics and stoichiometry of phosphorylation. For example, we found
that recombinant NHE-1 was a substrate for ERK1/2, p38, and
p90RSK, but the stoichiometry of phosphorylation observed
for p90RSK was 20-fold greater than the other kinases (17).
Bianchini et al. (19) also failed to show significant kinase
activity of ERK1/2 toward recombinant NHE-1. Tominaga et al.
(15) showed recently that p160ROCK phosphorylated
recombinant NHE-1, but two peptides appeared in the two-dimensional
tryptic phosphopeptide maps suggesting nonspecific phosphorylation.
Finally, we showed that transfection of WT-RSK increased
phosphorylation of P5 while transfection of DN-RSK inhibited phosphorylation of P5 specifically (Fig. 7). Thus, multiple
characteristics of NHE-1 phosphorylation and p90RSK
function indicate that the MEK1-ERK1/2-p90RSK pathway is
involved in serum-stimulated phosphorylation of NHE-1.
Functional Analysis of NHE-1-S703A Mutant--
It has been
proposed that modulation of the exchanger by phosphorylation shifts the
pH range over which the exchanger's "pHi sensor" regulates
ion exchange (1). It appears that phosphorylation of serine 703 is
required for this shift in the pHi sensor, because the
serum-mediated increase in NHE-1 affinity for H+ was
abolished in the S703A mutant (Fig. 6). Our data disagree with some
conclusions of previous studies that used deletion-mutation analysis of
NHE-1. It was suggested that a negative regulatory domain was lost by
deletions carboxyl to amino acid 698 (12, 31). Serine residues
essential for activity were proposed to exist within the domain
encompassed by amino acids 567-636, as deletions carboxyl to amino
acid 636 decreased growth factor activation by ~50% (12, 31, 49). A
possible explanation to reconcile these data is that alterations in
structure that regulate function are more likely to occur with deletion
analysis. Thus we believe that phosphorylation of serine 703 is one of
the critical regulatory mechanisms for NHE-1 function.
How might phosphorylation of serine 703 augment NHE-1 activity? One
mechanism may involve interactions with the calmodulin binding domain
(residues 567-635) which acts as a negative regulatory domain and is
critical for growth factor regulation of NHE-1 (43). Recently, a
calcineurin B homologous protein termed CHP was shown to interact with
NHE-1 by binding to this domain (44). Overexpression of CHP inhibited
serum- and GTPase-stimulated NHE-1 activity suggesting that CHP may be
released upon growth factor stimulation. It is possible that
phosphorylation of serine 703 may change the structure of NHE-1 in this
part of the molecule through backbone folding and non-covalent
interactions to enhance calmodulin and/or CHP release. In addition to
serine 703, other serines are also phosphorylated in response to serum
(e.g. serine(s) in the P4 peptide), suggesting that
cooperative interactions among two or more serines may be required to
activate NHE-1. Another mechanism may involve interactions with
regulatory proteins. NHE-RF, a functional regulatory protein that binds
to the carboxyl tail of NHE-3 via a PDZ domain, was discovered (50,
51). Although NHE-1 does not have a PDZ domain, Goss et al.
(45) identified a 24-kDa protein that co-immunoprecipitated with NHE-1.
These data suggest that future efforts to identify proteins that
interact specifically with phosphorylated NHE-1 may provide further
insight into mechanisms by which the Na+/H+
exchanger is regulated.
 |
ACKNOWLEDGEMENTS |
We are grateful to Paul Haynes, Julian Watts,
and Steve Gygi as well as many members of the Berk laboratory for assistance.
 |
FOOTNOTES |
*
This work was supported by grants from the National
Institutes of Health (to B. C. B and R. A.) and the Howard Hughes
Medical Institute (to E. G. K.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.

To whom correspondence should be addressed: Center for
Cardiovascular Research, Box 679, University of Rochester, Rochester, NY 14642. Tel.: 716-273-1946; Fax: 716-473-1573; E-mail:
bradford_berk@urmc.rochester.edu.
 |
ABBREVIATIONS |
The abbreviations used are:
pHi, intracellular pH;
NHE-1, Na+/H+ exchanger
isoform-1;
SHR, spontaneously hypertensive rat;
VSMC, vascular smooth
muscle cell;
WKY, Wistar Kyoto rat;
MAP, mitogen-activated protein;
ERK, extracellular signal-regulated kinase;
GST, glutathione
S-transferase;
BCECF-AM, acetoxymethyl ester of
2',7'-bis(carboxyethyl)-5(6)-carboxyfluorescein;
DMEM, Dulbecco's
modified Eagle's medium;
FCS, fetal calf serum;
MEK1, MAP
kinase/extracellular signal-regulated kinase 1;
WT, wild type.
 |
REFERENCES |
| 1.
|
Noel, J.,
and Pouysségur, J.
(1995)
Am. J. Physiol.
268,
C283-C296[Abstract/Free Full Text]
|
| 2.
|
Orlowski, J.,
and Grinstein, S.
(1997)
J. Biol. Chem.
272,
22373-22376[Free Full Text]
|
| 3.
|
Chambard, J. C.,
and Pouyssegur, J.
(1986)
Exp. Cell Res.
164,
282-294[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Cox, G. A.,
Lutz, C. M.,
Yang, C. L.,
Biemesderfer, D.,
Bronson, R. T.,
Fu, A.,
Aronson, P. S.,
Noebels, J. L.,
and Frankel, W. N.
(1997)
Cell
91,
139-148[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Siffert, W.,
and Dusing, R.
(1995)
Hypertension
26,
649-655[Abstract/Free Full Text]
|
| 6.
|
Berk, B. C.,
Vallega, G.,
Muslin, A. J.,
Gordon, H. M.,
Canessa, M.,
and Alexander, R. W.
(1989)
J. Clin. Invest.
83,
822-829
|
| 7.
|
Orlowski, J.,
Kandasamy, R. A.,
and Shull, G. E.
(1992)
J. Biol. Chem.
267,
9331-9339[Abstract/Free Full Text]
|
| 8.
|
Lucchesi, P. A.,
DeRoux, N.,
and Berk, B. C.
(1994)
Hypertension
24,
734-738[Abstract/Free Full Text]
|
| 9.
|
Siczkowski, M.,
Davies, J. E.,
and Ng, L. L.
(1994)
J. Hypertens.
12,
775-781[Medline]
[Order article via Infotrieve]
|
| 10.
|
Siczkowski, M.,
Davies, J. E.,
and Ng, L. L.
(1995)
Circ. Res.
76,
825-831[Abstract/Free Full Text]
|
| 11.
|
Goss, G. G.,
Woodside, M.,
Wakabayashi, S.,
Pouysségur, J.,
Waddell, T.,
Downey, G. P.,
and Grinstein, S.
(1994)
J. Biol. Chem.
269,
8741-8748[Abstract/Free Full Text]
|
| 12.
|
Wakabayashi, S.,
Bertrand, B.,
Shigekawa, M.,
Fafournoux, P.,
and Pouysségur, J.
(1994)
J. Biol. Chem.
269,
5583-5588[Abstract/Free Full Text]
|
| 13.
|
Fliegel, L.,
Walsh, M. P.,
Singh, D.,
Wong, C.,
and Barr, A.
(1992)
Biochem. J.
282,
139-145
|
| 14.
|
Fafournoux, P.,
Ghysdael, J.,
Sardet, C.,
and Pouysségur, J.
(1991)
Biochemistry
30,
9510-9515[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Tominaga, T.,
Ishizaki, T.,
Narumiya, S.,
and Barber, D. L.
(1998)
EMBO J.
17,
4712-4722[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Wang, H.,
Silva, N. L.,
Lucchesi, P. A.,
Haworth, R.,
Wang, K.,
Michalak, M.,
Pelech, S.,
and Fliegel, L.
(1997)
Biochemistry
36,
9151-9158[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Kusuhara, M.,
Takahashi, E.,
Peterson, T. E.,
Abe, J.,
Ishida, M.,
Han, J.,
Ulevitch, R.,
and Berk, B. C.
(1998)
Circ. Res.
83,
824-831[Abstract/Free Full Text]
|
| 18.
|
Dudley, D. T.,
Pang, L.,
Decker, S. J.,
Bridges, A. J.,
and Saltiel, A. R.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
7686-7689[Abstract/Free Full Text]
|
| 19.
|
Bianchini, L.,
L'Allemain, G.,
and Pouysségur, J.
(1997)
J. Biol. Chem.
272,
271-279[Abstract/Free Full Text]
|
| 20.
|
Aharonovitz, O.,
and Granot, Y.
(1996)
J. Biol. Chem.
271,
16494-16499[Abstract/Free Full Text]
|
| 21.
| Sabri, A., Corrinne, T. C., and Lucchesi, P. A. (1997)
Circulation 96, I-46 (abstr.)
|
| 22.
|
Sturgill, T. W.,
Ray, B. L.,
Erikson, E.,
and Maller, J. L.
(1988)
Nature
334,
715-718[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Takahashi, E.,
Abe, J.,
and Berk, B. C.
(1997)
Circ. Res.
81,
268-273[Abstract/Free Full Text]
|
| 24.
|
Phan, V.,
Kusuhara, M.,
Lucchesi, P. A.,
and Berk, B. C.
(1997)
Hypertension
29,
1265-1272[Abstract/Free Full Text]
|
| 25.
|
Spring, D. J.,
and Krebs, E. G.
(1999)
Mol. Cell. Biol.
19,
317-320[Abstract/Free Full Text]
|
| 26.
|
Glass, D. B.,
Masaracchia, R. A.,
Feramisco, J. R.,
and Kemp, B. E.
(1978)
Anal. Biochem.
87,
566-575[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Figeys, D.,
Gygi, S. P.,
Zhang, Y.,
Watts, J.,
Gu, M.,
and Aebersold, R.
(1998)
Electrophoresis
19,
1811-1818[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Grinstein, S.,
Woodside, M.,
Sardet, C.,
Pouysségur, J.,
and Rotin, D.
(1992)
J. Biol. Chem.
267,
23823-23828[Abstract/Free Full Text]
|
| 29.
|
Watts, J. D.,
Affolter, M.,
Krebs, D. L.,
Wange, R. L.,
Samelson, L. E.,
and Aebersold, R.
(1994)
J. Biol. Chem.
269,
29520-29529[Abstract/Free Full Text]
|
| 30.
|
McSwine, R. L.,
Babnigg, G.,
Musch, M. W.,
Chang, E. B.,
and Villereal, M. L.
(1994)
J. Cell. Physiol.
161,
351-357[CrossRef][Medline]
[Order article via Infotrieve]
|
| 31.
|
Wakabayashi, S.,
Fafournoux, P.,
Sardet, C.,
and Pouysségur, J.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
2424-2428[Abstract/Free Full Text]
|
| 32.
|
Mitsuka, M.,
and Berk, B. C.
(1991)
Am. J. Physiol.
260,
C562-C569[Abstract/Free Full Text]
|
| 33.
|
Berk, B. C.,
Aronow, M. S.,
Brock, T. A.,
Cragoe, E., Jr.,
Gimbrone, M. A., Jr.,
and Alexander, R. W.
(1987)
J. Biol. Chem.
262,
5057-5064[Abstract/Free Full Text]
|
| 34.
|
Erikson, E.,
and Maller, J. L.
(1988)
Second Messengers and Phosphoproteins
12,
135-143[Medline]
[Order article via Infotrieve]
|
| 35.
|
Pouysségur, J.,
Sardet, C.,
Franch, A.,
L'Allemain, G.,
and Paris, S.
(1984)
Proc. Natl. Acad. Sci. U. S. A.
81,
4833-4837[Abstract/Free Full Text]
|
| 36.
|
Kelly, M. P.,
Quinn, P. A.,
Davies, J. E.,
and Ng, L. L.
(1997)
Circ. Res.
80,
853-860[Abstract/Free Full Text]
|
| 37.
|
Paris, S.,
and Pouyssegur, J.
(1984)
J. Biol. Chem.
259,
10989-10994[Abstract/Free Full Text]
|
| 38.
|
Moolenaar, W. H.,
Tsien, R. Y.,
van der Saag, P. T.,
and de Laat, S. W.
(1983)
Nature
304,
645-648[CrossRef][Medline]
[Order article via Infotrieve]
|
| 39.
|
Grove, J. R.,
Price, D. J.,
Banerjee, P.,
Balasubramanyam, A.,
Ahmad, M. F.,
and Avruch, J.
(1993)
Biochemistry
32,
7727-7738[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Sardet, C.,
Counillon, L.,
Franchi, A.,
and Pouysségur, J.
(1990)
Science
247,
723-726[Abstract/Free Full Text]
|
| 41.
|
Sardet, C.,
Fafournoux, P.,
and Pouysségur, J.
(1991)
J. Biol. Chem.
266,
19166-19171[Abstract/Free Full Text]
|
| 42.
|
Robertson, M. A.,
Woodside, M.,
Foskett, J. K.,
Orlowski, J.,
and Grinstein, S.
(1997)
J. Biol. Chem.
272,
287-294[Abstract/Free Full Text]
|
| 43.
|
Wakabayashi, S.,
Bertrand, B.,
Ikeda, T.,
Pouysségur, J.,
and Shigekawa, M.
(1994)
J. Biol. Chem.
269,
13710-13715[Abstract/Free Full Text]
|
| 44.
|
Lin, X.,
and Barber, D. L.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
12631-12636[Abstract/Free Full Text]
|
| 45.
|
Goss, G.,
Orlowski, J.,
and Grinstein, S.
(1996)
Am. J. Physiol.
39,
C1493-C1502
|
| 46.
|
Erikson, E.,
and Maller, J. L.
(1986)
J. Biol. Chem.
261,
350-355[Abstract/Free Full Text]
|
| 47.
|
Dalby, K. N.,
Morrice, N.,
Caudwell, F. B.,
Avruch, J.,
and Cohen, P.
(1998)
J. Biol. Chem.
273,
1496-1505[Abstract/Free Full Text]
|
| 48.
|
Nguyen, T. T.,
Scimeca, J.-C.,
Filloux, C.,
Peraldi, P.,
Carpentier, J.-L.,
and van Obberghen, E. V.
(1993)
J. Biol. Chem.
268,
9803-9810[Abstract/Free Full Text]
|
| 49.
|
Bertrand, B.,
Wakabayashi, S.,
Ikeda, T.,
Pouysségur, J.,
and Shigekawa, M.
(1994)
J. Biol. Chem.
269,
13703-13709[Abstract/Free Full Text]
|
| 50.
|
Weinman, E. J.,
Steplock, D.,
Wang, Y.,
and Shenolikar, S.
(1995)
J. Clin. Invest.
95,
2143-2149
|
| 51.
|
Hall, R. A.,
Premont, R. T.,
Chow, C. W.,
Blitzer, J. T.,
Pitcher, J. A.,
Claing, A.,
Stoffel, R. H.,
Barak, L. S.,
Shenolikar, S.,
Weinman, E. J.,
Grinstein, S.,
and Lefkowitz, R. J.
(1998)
Nature
392,
626-630[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
A. Mandal, M. Shahidullah, N. A. Delamere, and M. A. Teran
Elevated hydrostatic pressure activates sodium/hydrogen exchanger-1 in rat optic nerve head astrocytes
Am J Physiol Cell Physiol,
July 1, 2009;
297(1):
C111 - C120.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Schneider, C.-M. Stock, P. Dieterich, B. H. Jensen, L. B. Pedersen, P. Satir, A. Schwab, S. T. Christensen, and S. F. Pedersen
The Na+/H+ exchanger NHE1 is required for directional migration stimulated via PDGFR-{alpha} in the primary cilium
J. Cell Biol.,
April 6, 2009;
185(1):
163 - 176.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Ortiz-Acevedo, R. R. Rigor, H. M. Maldonado, and P. M. Cala
Activation of Na+/H+ and K+/H+ exchange by calyculin A in Amphiuma tridactylum red blood cells: implications for the control of volume-induced ion flux activity
Am J Physiol Cell Physiol,
November 1, 2008;
295(5):
C1316 - C1325.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Szokodi, R. Kerkela, A.-M. Kubin, B. Sarman, S. Pikkarainen, A. Konyi, I. G. Horvath, L. Papp, M. Toth, R. Skoumal, et al.
Functionally Opposing Roles of Extracellular Signal-Regulated Kinase 1/2 and p38 Mitogen-Activated Protein Kinase in the Regulation of Cardiac Contractility
Circulation,
October 14, 2008;
118(16):
1651 - 1658.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. K. Snabaitis, F. Cuello, and M. Avkiran
Protein Kinase B/Akt Phosphorylates and Inhibits the Cardiac Na+/H+ Exchanger NHE1
Circ. Res.,
October 10, 2008;
103(8):
881 - 890.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. L. Grenier, K. Abu-ihweij, G. Zhang, S. M. Ruppert, R. Boohaker, E. R. Slepkov, K. Pridemore, J.-J. Ren, L. Fliegel, and A. R. Khaled
Apoptosis-induced alkalinization by the Na+/H+ exchanger isoform 1 is mediated through phosphorylation of amino acids Ser726 and Ser729
Am J Physiol Cell Physiol,
October 1, 2008;
295(4):
C883 - C896.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. W. Good, T. George, and B. A. Watts III
Nerve Growth Factor Inhibits Na+/H+ Exchange and Formula Absorption through Parallel Phosphatidylinositol 3-Kinase-mTOR and ERK Pathways in Thick Ascending Limb
J. Biol. Chem.,
September 26, 2008;
283(39):
26602 - 26611.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Lu, J.-i. Abe, J. Taunton, Y. Lu, T. Shishido, C. McClain, C. Yan, S. P. Xu, T. M. Spangenberg, and H. Xu
Reactive Oxygen Species-Induced Activation of p90 Ribosomal S6 Kinase Prolongs Cardiac Repolarization Through Inhibiting Outward K+ Channel Activity
Circ. Res.,
August 1, 2008;
103(3):
269 - 278.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. C. Zaun, A. Shrier, and J. Orlowski
Calcineurin B Homologous Protein 3 Promotes the Biosynthetic Maturation, Cell Surface Stability, and Optimal Transport of the Na+/H+ Exchanger NHE1 Isoform
J. Biol. Chem.,
May 2, 2008;
283(18):
12456 - 12467.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-S. Jung, H.-Y. Kim, J. Kim, M.-G. Lee, J. Pouyssegur, and E. Kim
Physical Interactions and Functional Coupling between Daxx and Sodium Hydrogen Exchanger 1 in Ischemic Cell Death
J. Biol. Chem.,
January 11, 2008;
283(2):
1018 - 1025.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. D. Johnstone, P. F. Speake, and C. P. Sibley
Epidermal growth factor and sphingosine-1-phosphate stimulate Na+/H+ exchanger activity in the human placental syncytiotrophoblast
Am J Physiol Regulatory Integrative Comp Physiol,
December 1, 2007;
293(6):
R2290 - R2294.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Luo, D. B. Kintner, G. E. Shull, and D. Sun
ERK1/2-p90RSK-mediated Phosphorylation of Na+/H+ Exchanger Isoform 1: A ROLE IN ISCHEMIC NEURONAL DEATH
J. Biol. Chem.,
September 21, 2007;
282(38):
28274 - 28284.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Xue, D. Zhou, H. Yao, O. Gavrialov, M. J. McConnell, B. D. Gelb, and G. G. Haddad
Novel functional interaction between Na+/H+ exchanger 1 and tyrosine phosphatase SHP-2
Am J Physiol Regulatory Integrative Comp Physiol,
June 1, 2007;
292(6):
R2406 - R2416.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. E. Malo, L. Li, and L. Fliegel
Mitogen-activated Protein Kinase-dependent Activation of the Na+/H+ Exchanger Is Mediated through Phosphorylation of Amino Acids Ser770 and Ser771
J. Biol. Chem.,
March 2, 2007;
282(9):
6292 - 6299.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Cuello, A. K. Snabaitis, M. S. Cohen, J. Taunton, and M. Avkiran
Evidence for Direct Regulation of Myocardial Na+/H+ Exchanger Isoform 1 Phosphorylation and Activity by 90-kDa Ribosomal S6 Kinase (RSK): Effects of the Novel and Specific RSK Inhibitor fmk on Responses to {alpha}1-Adrenergic Stimulation
Mol. Pharmacol.,
March 1, 2007;
71(3):
799 - 806.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. J. Schoonheim, H. Veiga, D. da Costa Pereira, G. Friso, K. J. van Wijk, and A. H. de Boer
A Comprehensive Analysis of the 14-3-3 Interactome in Barley Leaves Using a Complementary Proteomics and Two-Hybrid Approach
Plant Physiology,
February 1, 2007;
143(2):
670 - 683.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Mishima, S. Wakabayashi, and C. Kojima
Solution Structure of the Cytoplasmic Region of Na+/H+ Exchanger 1 Complexed with Essential Cofactor Calcineurin B Homologous Protein 1
J. Biol. Chem.,
January 26, 2007;
282(4):
2741 - 2751.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. H. Turner, M. N. Garnovskaya, S. D. Coaxum, T. M. Vlasova, M. Yakutovich, D. M. Lefler, and J. R. Raymond
Ca2+-Calmodulin and Janus Kinase 2 Are Required for Activation of Sodium-Proton Exchange by the Gi-Coupled 5-Hydroxytryptamine1a Receptor
J. Pharmacol. Exp. Ther.,
January 1, 2007;
320(1):
314 - 322.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. A. Watts III, T. George, and D. W. Good
Aldosterone inhibits apical NHE3 and HCO3- absorption via a nongenomic ERK-dependent pathway in medullary thick ascending limb
Am J Physiol Renal Physiol,
November 1, 2006;
291(5):
F1005 - F1013.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. K. Snabaitis, R. D'Mello, S. Dashnyam, and M. Avkiran
A Novel Role for Protein Phosphatase 2A in Receptor-mediated Regulation of the Cardiac Sarcolemmal Na+/H+ Exchanger NHE1
J. Biol. Chem.,
July 21, 2006;
281(29):
20252 - 20262.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Maekawa, J.-i. Abe, T. Shishido, S. Itoh, B. Ding, V. K. Sharma, S.-S. Sheu, B. C. Blaxall, and B. C. Berk
Inhibiting p90 Ribosomal S6 Kinase Prevents Na+-H+ Exchanger-Mediated Cardiac Ischemia-Reperfusion Injury
Circulation,
May 30, 2006;
113(21):
2516 - 2523.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Fujiwara, K. Higuchi, T. Takashima, M. Hamaguchi, T. Hayakawa, K. Tominaga, T. Watanabe, N. Oshitani, Y. Shimada, and T. Arakawa
Roles of epidermal growth factor and Na+/H+ exchanger-1 in esophageal epithelial defense against acid-induced injury
Am J Physiol Gastrointest Liver Physiol,
April 1, 2006;
290(4):
G665 - G673.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. B. Kintner, A. Look, G. E. Shull, and D. Sun
Stimulation of astrocyte Na+/H+ exchange activity in response to in vitro ischemia depends in part on activation of ERK1/2
Am J Physiol Cell Physiol,
October 1, 2005;
289(4):
C934 - C945.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Itoh, B. Ding, C. P. Bains, N. Wang, Y. Takeishi, T. Jalili, G. L. King, R. A. Walsh, C. Yan, and J.-i. Abe
Role of p90 Ribosomal S6 Kinase (p90RSK) in Reactive Oxygen Species and Protein Kinase C {beta} (PKC-{beta})-mediated Cardiac Troponin I Phosphorylation
J. Biol. Chem.,
June 24, 2005;
280(25):
24135 - 24142.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Baumgartner, H. Patel, and D. L. Barber
Na+/H+ exchanger NHE1 as plasma membrane scaffold in the assembly of signaling complexes
Am J Physiol Cell Physiol,
October 1, 2004;
287(4):
C844 - C850.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Aker, A. K Snabaitis, I. Konietzka, A. van de Sand, K. Bongler, M. Avkiran, G. Heusch, and R. Schulz
Inhibition of the Na+/H+ exchanger attenuates the deterioration of ventricular function during pacing-induced heart failure in rabbits
Cardiovasc Res,
August 1, 2004;
63(2):
273 - 282.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Al-Khalili, O. Kotova, H. Tsuchida, I. Ehren, E. Feraille, A. Krook, and A. V. Chibalin
ERK1/2 Mediates Insulin Stimulation of Na,K-ATPase by Phosphorylation of the {alpha}-Subunit in Human Skeletal Muscle Cells
J. Biol. Chem.,
June 11, 2004;
279(24):
25211 - 25218.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. P. Roux and J. Blenis
ERK and p38 MAPK-Activated Protein Kinases: a Family of Protein Kinases with Diverse Biological Functions
Microbiol. Mol. Biol. Rev.,
June 1, 2004;
68(2):
320 - 344.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Takahashi, K. Fukuda, S. Miyoshi, M. Murata, T. Kato, M. Ita, T. Tanabe, and S. Ogawa
Leukemia Inhibitory Factor Activates Cardiac L-Type Ca2+ Channels via Phosphorylation of Serine 1829 in the Rabbit Cav1.2 Subunit
Circ. Res.,
May 14, 2004;
94(9):
1242 - 1248.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. V. Mukhin, M. N. Garnovskaya, M. E. Ullian, and J. R. Raymond
ERK Is Regulated by Sodium-Proton Exchanger in Rat Aortic Vascular Smooth Muscle Cells
J. Biol. Chem.,
January 16, 2004;
279(3):
1845 - 1852.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. S. Haworth, C. McCann, A. K. Snabaitis, N. A. Roberts, and M. Avkiran
Stimulation of the Plasma Membrane Na+/H+ Exchanger NHE1 by Sustained Intracellular Acidosis: EVIDENCE FOR A NOVEL MECHANISM MEDIATED BY THE ERK PATHWAY
J. Biol. Chem.,
August 22, 2003;
278(34):
31676 - 31684.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. E. Cavet, S. Lehoux, and B. C. Berk
14-3-3beta Is a p90 Ribosomal S6 Kinase (RSK) Isoform 1-binding Protein That Negatively Regulates RSK Kinase Activity
J. Biol. Chem.,
May 9, 2003;
278(20):
18376 - 18383.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. N. Garnovskaya, Y. V. Mukhin, T. M. Vlasova, and J. R. Raymond
Hypertonicity Activates Na+/H+ Exchange through Janus Kinase 2 and Calmodulin
J. Biol. Chem.,
May 2, 2003;
278(19):
16908 - 16915.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Wakabayashi, T. Hisamitsu, T. Pang, and M. Shigekawa
Mutations of Arg440 and Gly455/Gly456 Oppositely Change pH Sensing of Na+/H+ Exchanger 1
J. Biol. Chem.,
March 28, 2003;
278(14):
11828 - 11835.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Avkiran and R. S Haworth
Regulatory effects of G protein-coupled receptors on cardiac sarcolemmal Na+/H+ exchanger activity: signalling and significance
Cardiovasc Res,
March 15, 2003;
57(4):
942 - 952.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Pang, S. Wakabayashi, and M. Shigekawa
Expression of Calcineurin B Homologous Protein 2 Protects Serum Deprivation-induced Cell Death by Serum-independent Activation of Na+/H+ Exchanger
J. Biol. Chem.,
November 8, 2002;
277(46):
43771 - 43777.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. C. Rothstein, K. L. Byron, R. E. Reed, L. Fliegel, and P. A. Lucchesi
H2O2-induced Ca2+ overload in NRVM involves ERK1/2 MAP kinases: role for an NHE-1-dependent pathway
Am J Physiol Heart Circ Physiol,
August 1, 2002;
283(2):
H598 - H605.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q.-S. Qiu, Y. Guo, M. A. Dietrich, K. S. Schumaker, and J.-K. Zhu
Regulation of SOS1, a plasma membrane Na+/H+ exchanger in Arabidopsisthaliana, by SOS2 and SOS3
PNAS,
June 11, 2002;
99(12):
8436 - 8441.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. A. Watts III and D. W. Good
ERK mediates inhibition of Na+/H+ exchange and HCO3- absorption by nerve growth factor in MTAL
Am J Physiol Renal Physiol,
June 1, 2002;
282(6):
F1056 - F1063.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. K Snabaitis, D. J Hearse, and M. Avkiran
Regulation of sarcolemmal Na+/H+ exchange by hydrogen peroxide in adult rat ventricular myocytes
Cardiovasc Res,
February 1, 2002;
53(2):
470 - 480.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Takeishi, Q. Huang, J.-i. Abe, W. Che, J.-D. Lee, H. Kawakatsu, B. D Hoit, Bradford.C Berk, and R. A Walsh
Activation of mitogen-activated protein kinases and p90 ribosomal S6 kinase in failing human hearts with dilated cardiomyopathy
Cardiovasc Res,
January 1, 2002;
53(1):
131 - 137.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. R. Khaled, A. N. Moor, A. Li, K. Kim, D. K. Ferris, K. Muegge, R. J. Fisher, L. Fliegel, and S. K. Durum
Trophic Factor Withdrawal: p38 Mitogen-Activated Protein Kinase Activates NHE1, Which Induces Intracellular Alkalinization
Mol. Cell. Biol.,
November 15, 2001;
21(22):
7545 - 7557.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. A. Richards, V. C. Dreisbach, L. O. Murphy, and J. Blenis
Characterization of Regulatory Events Associated with Membrane Targeting of p90 Ribosomal S6 Kinase 1
Mol. Cell. Biol.,
November 1, 2001;
21(21):
7470 - 7480.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Wei, E. C. Rothstein, L. Fliegel, L. J. Dell'Italia, and P. A. Lucchesi
Differential MAP kinase activation and Na+/H+ exchanger phosphorylation by H2O2 in rat cardiac myocytes
Am J Physiol Cell Physiol,
November 1, 2001;
281(5):
C1542 - C1550.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Ibata-Ombetta, T. Jouault, P.-A. Trinel, and D. Poulain
Role of extracellular signal-regulated protein kinase cascade in macrophage killing of Candida albicans
J. Leukoc. Biol.,
July 1, 2001;
70(1):
149 - 154.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-i. Abe, C. P. Baines, and B. C. Berk
Role of Mitogen-Activated Protein Kinases in Ischemia and Reperfusion Injury : The Good and the Bad
Circ. Res.,
March 31, 2000;
86(6):
607 - 609.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. K. Snabaitis, H. Yokoyama, and M. Avkiran
Roles of Mitogen-Activated Protein Kinases and Protein Kinase C in {alpha}1A-Adrenoceptor-Mediated Stimulation of the Sarcolemmal Na+-H+ Exchanger
Circ. Res.,
February 4, 2000;
86(2):
214 - 220.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Counillon and J. Pouyssegur
The Expanding Family of Eucaryotic Na+/H+ Exchangers
J. Biol. Chem.,
January 7, 2000;
275(1):
1 - 4.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Takeishi, J.-i. Abe, J.-D. Lee, H. Kawakatsu, R. A. Walsh, and B. C. Berk
Differential Regulation of p90 Ribosomal S6 Kinase and Big Mitogen-Activated Protein Kinase 1 by Ischemia/Reperfusion and Oxidative Stress in Perfused Guinea Pig Hearts
Circ. Res.,
December 3, 1999;
85(12):
1164 - 1172.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. V. Mukhin, T. Vlasova, A. A. Jaffa, G. Collinsworth, J. L. Bell, B. G. Tholanikunnel, T. Pettus, W. Fitzgibbon, D. W. Ploth, J. R. Raymond, et al.
Bradykinin B2 Receptors Activate Na+/H+ Exchange in mIMCD-3 Cells via Janus Kinase 2 and Ca2+/Calmodulin
J. Biol. Chem.,
May 11, 2001;
276(20):
17339 - 17346.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Lehoux, J.-i. Abe, J. A. Florian, and B. C. Berk
14-3-3 Binding to Na+/H+ Exchanger Isoform-1 Is Associated with Serum-dependent Activation of Na+/H+ Exchange
J. Biol. Chem.,
May 4, 2001;
276(19):
15794 - 15800.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. N. Moor, X. T. Gan, M. Karmazyn, and L. Fliegel
Activation of Na+/H+ Exchanger-directed Protein Kinases in the Ischemic and Ischemic-reperfused Rat Myocardium
J. Biol. Chem.,
May 4, 2001;
276(19):
16113 - 16122.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Yan, K. Nehrke, J. Choi, and D. L. Barber
The Nck-interacting Kinase (NIK) Phosphorylates the Na+-H+ Exchanger NHE1 and Regulates NHE1 Activation by Platelet-derived Growth Factor
J. Biol. Chem.,
August 10, 2001;
276(33):
31349 - 31356.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|