|
J Biol Chem, Vol. 274, Issue 29, 20318-20327, July 16, 1999
Identification of P-glycoprotein Mutations Causing a Loss of
Steroid Recognition and Transport*
Quang D.
Vo and
Donald J.
Gruol
From the Sidney Kimmel Cancer Center,
San Diego, California 92121
 |
ABSTRACT |
P-glycoproteins transport a wide variety of
hydrophobic compounds out of cells. While the diversity of transported
molecules suggests a mechanism involving broad specificity, there is
evidence of significant discrimination within given classes of
molecules. One example of this behavior is transport of corticosteroids
by the murine mdr1 P-glycoprotein. The presence of hydroxyl
groups, associated with specific steroid carbon atoms, regulates the
ability of corticosteroids to be transported. This specificity is
demonstrated here by experiments measuring the ability of steroids to
inhibit drug transport. The results indicate that a keto oxygen
associated with the 3- and 20-carbon atoms, as well as a 17-carbon
hydroxyl group, each acts to enhance steroidal P-glycoprotein
inhibitory activity. Moreover, inhibitory steroids can be used for
directed selection of variant cells, expressing mutated P-glycoproteins with a severely impaired ability to transport dexamethasone. The five
mutations, reported here, are located within transmembrane domains
4-6, proximal to the cytoplasmic interface. The altered P-glycoproteins exhibit reduced capacity to be inhibited by specific steroids, suggesting decreased capacity to bind these molecules avidly.
Studies comparing the relative inhibitory activity of a series of
steroids indicate that these mutations alter recognition of the
17 -hydroxyl group and the 20-keto oxygen atom.
 |
INTRODUCTION |
P-glycoprotein (Pgp)1
expression causes increased resistance to dexamethasone-induced
apoptosis in murine thymoma cells as well as resistance to a variety of
other drugs (1). The likelihood that steroids are substrates for
Pgp-mediated transport is supported by the observations that
mdr1 P-glycoprotein expression leads to reduced
intracellular dexamethasone accumulation and inhibition of
hormone-dependent gene induction (2). Moreover, these
effects are reversed by drug transport inhibitors, such as verapamil, RU486 (3, 4), and PSC-833.2
However, the phenomenon of Pgp-dependent steroid resistance
is restricted at two levels. Glucocorticoid resistance is both
gene-specific and steroid-specific. The dual specificity is exemplified
by the following. 1) The mdr1, but not the mdr3,
Pgp conveys resistance to dexamethasone (54). 2) The degree of
resistance to a given steroid is highly dependent upon its structure.
The degree of Pgp-dependent resistance to steroids that
differ by only a single oxygen atom can be profoundly different. For
instance, the presence of a 17 -hydroxyl group is associated with a
greater shift in steroid sensitivity. Thus, the relative increase in
resistance to cortisol is greater than that for corticosterone, and the
shift for dexamethasone greater than 17-desoxydexamethasone (1). An
11 -hydroxyl group has an even greater effect. Cortexolone is nearly
identical to cortisol but lacks an 11 -hydroxyl group. No evidence of
increased resistance to cortexolone was observed, suggesting that it is
not efficiently transported. Similarly, there is evidence that
progesterone, which does not have any hydroxyl groups in its structure,
is not transported (1, 5).
Progesterone has been shown capable of reversing
Pgp-dependent drug resistance, inhibiting photoaffinity
labeling of Pgp by azidopine and serving as a photoaffinity label of
the human Pgp (5, 6). Therefore, it is evident that progesterone can
bind to Pgp, even if it is not transported. In general, the relative ability of steroids to reverse drug resistance and inhibit drug binding
to Pgp has been found to be highly dependent upon the hydrophobicity of
the individual steroids (7, 8). This behavior suggests a lack of
specificity in the interactions between the hormone and the protein but
may also reflect the relative ability of the steroids to accumulate
within the membranes containing the Pgp. The greater accumulation of
the more hydrophobic molecules would be reflected in the local
concentration of steroid available to interact with the Pgp. There is
very little evidence indicating the region(s) of the Pgp that interact
with steroids. One mutation, S941F, in the second half of the murine
mdr1 Pgp (transmembrane domain 11), was found to affect the
ability of progesterone to serve as an inhibitor of drug transport (9,
10). This mutation also caused a loss of adriamycin and colchicine
resistance. There has been considerable effort invested in the
characterization of drug resistance changes caused by Pgp mutations
(11). Mutations that have arisen in cultured cells selected for
resistance to specific drugs (12-14) and mutations introduced by
site-directed mutagenesis have been evaluated (10, 15-32). In many
cases, the resistance to one drug may increase while the resistance to
others either changes or remains the same. Altering a given amino acid in multiple ways can produce profoundly different changes in the drug
resistance profiles. In addition, trying to relate changes in
resistance to altered drug binding can produce unanticipated results.
The mutation G185V in the human Pgp causes increased colchicine
resistance and decreased vinblastine resistance. However, this mutation
was also reported to cause a decrease in colchicine binding affinity
and an increase in vinblastine binding affinity (33). It would be very
valuable to have a methodical means to identify mutations that alter
the interaction of specific drugs with Pgp. The work presented here
represents our progress in developing such an approach with steroid
inhibitors. It focuses upon the isolation of cell lines expressing
murine mdr1 Pgp that contain mutations that decrease the
ability of steroids to act as transport inhibitors. The overall
assumption is that the ability to inhibit drug transport primarily
reflects the ability of the steroid to bind to the Pgp at a
mechanistically important region of the protein. The results indicate
that steroids interact with the Pgp at a site involving transmembrane
domains 4-6. Moreover, the mutations appear to affect the protein's
interaction with specific steroid structural features.
 |
EXPERIMENTAL PROCEDURES |
Cell Culture--
WEHI-7 is a thymoma cell line obtained from a
female BALB/c mouse after exposure to x-irradiation (34). W7TB is a
derivative of WEHI-7 and is resistant to bromodeoxyuridine.
Bromodeoxyuridine resistance is unrelated to multidrug resistance. MS23
is a variant selected from W7TB through prolonged growth in low levels
of dexamethasone (35). HEK 293T is a human embryonal kidney
epithelial line, transformed with the adenovirus E1a and SV40 large T
antigen oncogenes. All of the cell lines were grown in suspension in
Dulbecco's modified Eagle's medium containing 10% fetal bovine
serum. The incubator was maintained at 37 °C and had a humidified
atmosphere of 13% CO2 and 87% air.
Selection of MS23 Variants--
Independent selections were
initiated by the mutagenesis of MS23 cells with
N-methyl-N'-nitro-N-nitrosoguanidine,
obtained from Sigma. This compound is an alkylating agent that
predominantly causes point mutations.
N-Methyl-N'-nitro-N-nitrosoguanidine
(2 µg/ml for 2 h) was used based on previous results with this
compound and WEHI-7 cells (36). After allowing sufficient time for the cells to recover and express the mutated genes (usually 4-5 days), the
cells were dispensed into multiwell dishes (1 × 105
cells/well) in medium containing a toxic drug and the P-glycoprotein inhibitor 5 -pregnane-17 -ol-3,20-dione (5 Podo). Three
independent mutagenesis/selection experiments have been carried out. In
the first, the variant was selected in 3 µM puromycin and
20 µM 5 Podo. In the second and third selections, the
variants were isolated from the combination of 3 µM
puromycin and 10 µM 5 Podo. Resistant colonies
typically appeared between 12 and 18 days. Each of the variant lines
was initially tested for changes in growth in the presence of
dexamethasone (10 and 30 nM) relative to MS23 cells. The
results of these evaluations identified those variants that had lost
significant steroid resistance.
Quantification of Drug Effects on Cellular
Proliferation--
The effect of drugs on cell proliferation was
measured as described previously (37). Briefly, cell cultures were set
up (5 × 104 cells/ml) in varied concentrations of
drugs and incubated for 7 days. The amount of accumulated cellular
material was assayed by measuring the turbidity of the cultures (660 nm) and by expressing the values as normalized to those from cultures
grown in the absence of drug. These relative turbidity values reflect
the amount of cellular material synthesized during the period of
incubation and provide a sensitive measure of the capacity of the cells
to proliferate, even if a large portion of them are killed. Typically, relative turbidity values of <5% represent situations where all of
the cells have lost viability. The LC50 value is defined as the concentration of drug that produces a relative turbidity value of
50%.
The relative ability of nontoxic pregnanes to reverse
P-glycoprotein-dependent drug resistance in cells was
evaluated as follows. A series of cultures (5 × 104
cells/ml) were grown with a fixed concentration of a toxic drug, to
which that cell line is normally resistant based upon its
P-glycoprotein expression. Increasing concentrations of the pregnane
were included in the culture medium, and the relative turbidity values
of the cultures were evaluated after 7 days. The inhibitory efficiency of the pregnane is expressed by an EC50 value defined as
the concentration of chemosensitizer that reduces the relative
turbidity value to 50%. The steroids used were obtained from
Steraloids Inc. (Newport, RI). All steroids were assessed, by
Steraloids, as a uniform single spot on TLC with >98% purity.
Sequence Analysis of the 5' Portion of the mdr1 Gene Expressed in
MS23 Cells--
Total cellular RNA was prepared as described by
Chomczynski and Sacchi (38). A modification of the PCR-based method,
rapid amplification of cDNA ends, was used to evaluate the 5'
sequence of the mdr1 mRNA (39). cDNA was synthesized
by primer extension from total RNA isolated from MS23 cells using a
primer (P1) that overlaps a portion of the exon 2 sequence,
CCTGCTGTTGGCGTATTTGGGATGTTTC. After heat-inactivating the reverse
transcriptase, the primer was removed from the sample using a QIAquick
PCR purification kit (Qiagen, Santa Clarita, CA). A poly(dA) tail was
added to the 5' end of the cDNA using terminal deoxynucleotidyl
transferase, 33 units/20-µl reaction (Life Technologies, Inc.). The
sample was extracted with phenol/chloroform, and the cDNA was
precipitated with ethanol. PCR amplification of the cDNA was
carried out using a primer (P2) that overlaps another portion of exon
2, GGGAAGAGCAGACAAGAACTTCTCGAAGATG, and the primer (P3),
GCTCTAGACTCGAGTCGACATCGT17. The PCR product was purified by
agarose gel electrophoresis and evaluated by direct DNA sequencing
using primer P2 (fmol DNA Sequencing System; Promega, Madison, WI). The sequencing reactions were subjected to
electrophoresis on 6% polyacrylamide urea gels, and the resulting gels
were analyzed by autoradiography.
Evaluation of mdr1 P-glycoprotein Mutations Expressed in the MS23
Variants--
RT-PCR was used to generate a series of overlapping
cDNA fragments encompassing the entire coding sequence of the
mdr1 gene expressed in MS23 and the variant cell lines:
MSPP-1, MSPP-7, MSPP-13, and MSPP-17. Five larger primary fragments
(A-E) were initially produced, and a series of subfragments
(A1-A4; B1-B4, C1-C3; D1-D3) were
generated using a set of nested primers. The primers used are shown in
Table I.
The individual PCR products were purified by agarose gel
electrophoresis and evaluated by direct DNA sequencing using the appropriate primers (fmol DNA Sequencing System, Promega,
Madison, WI) that had been end-labeled with 32P. All
primers were obtained from Life Technologies (Life Technologies, Inc.).
Isolation of Human Cells Expressing the Mouse mdr1
P-glycoproteins--
The murine mdr1 gene was introduced
into a modified version of the pMT2 (40, 41) expression vector as
described previously (54). The mdr1 gene in the pMTmdr
vector was also modified to include the change G to T at nucleotide 692 of the coding sequence. A 1606-bp fragment of the mdr1 gene
was removed from the pMTmdr vector using AflII and
ApaI and cloned into the Litmus 39 vector (New England
Biolabs). The resulting construct (Lit39-mdr/AfAp) was amplified,
purified, and digested with SacI and BglII to
remove a 715-bp portion of the mdr/AfAp insert. This subfragment was replaced with a similar 715-bp fragment containing the mutation G to T
at nucleotide 692 of the coding sequence. This is the mutation that was
found in samples from the MSPP-1 cells. The mutated 715-bp fragment was
generated as follows. RT-PCR with RNA from MSPP-1 cells was used to
generate a 788-bp fragment of the mdr1 gene encompassing
nucleotides 469-1256 of the coding sequence. This was carried out with
the primers CAGGAGATAGGCTGGTTTGATGTG and CCGCTCTTCACCTTCAGATTGAGG. The
fragment was purified and used in a second PCR amplification using
nested primers, TGATGTGCATGATGTTGGGGAGC and CCCTTCAAGATCTGAACTTCGCTTC.
The resulting 747-bp fragment was digested with SacI and
BglII to generate the appropriate 715-bp fragment of the
mdr1 gene to ligate into the opened Lit39-mdr/AfAp vector.
The mdr1 portion of the reconstituted Lit39-mdr/AfAp vector was sequenced to verify that no mutations other than the G to T at
nucleotide 692 had been introduced. The reconstituted Lit39-mdr/AfAp vector was digested with AflII and ApaI to
release the entire 1606-bp mdr1 fragment that was
reintroduced into the opened pMTmdr vector. The resulting vector was
designated as pMTmdr-692.
Purified pMTmdr and pMTmdr-692 plasmids were linearized by digestion
with the enzyme AhdI and used to transfect the human HEK
293T cell line by the calcium phosphate precipitation method. HEK 293T
cells exhibiting increased drug resistance were isolated by exposing
the cells to 6 µM puromycin. A colony of resistant cells
obtained using the pMTmdr plasmid was isolated and designated as
293Twt-3. A colony of resistant cells obtained using the pMTmdr-692 plasmid was isolated and designated as 293T-801-3. These cells have
increased resistance to puromycin and vincristine but not to
actinomycin D. RNA samples from HEK 293T, 293Twt-3, and 293T-801-3 cells were evaluated for evidence of murine mdr1 expression
using RT-PCR to generate amplified cDNA fragments (42). Only the
transfected cell lines had expression of the mdr1 gene, and
sequence analysis confirmed the expression of the normal and mutated
genes in the 293Twt-3 and 293T-801-3 cells, respectively.
Intracellular Steroid Accumulation--
Measurements of steroid
accumulation in intact cells were carried out by a method outlined
elsewhere (2). Briefly, lymphoid cells were collected by centrifugation
and resuspended (1 × 107 cells/ml) in fresh medium.
3H-Labeled dexamethasone was added (2 × 10 8 M final concentration), and the samples
were incubated for 60 min at 37 °C in a CO2 incubator.
After the incubation period, the cells were washed free of unbound
hormone using cold (0 °C) phosphate-buffered saline. Retained
hormone was measured with a scintillation counter.
 |
RESULTS |
Steroids can serve as substrates for Pgp efflux and/or inhibitors
of drug transport (4). Previous studies demonstrated that the
hydrophobicity of steroids is a strong determinant in their ability to
inhibit drug transport (7, 8). We have chosen to look further into this
issue using a circumscribed set of steroids, a series of 5 -pregnane
compounds containing a progressively increasing number of oxygen atoms.
This class of molecules was chosen because its members do not contain a
double bond in the steroid A-ring, a property that prevents them from
binding to glucocorticoid receptors with a significant affinity.
Consequently, 5 -pregnanes do not serve as activators of the
glucocorticoid receptor, an important consideration when using a cell
line (MS23) that undergoes apoptosis in response to the hormone. Fig.
1 illustrates the results of an
experiment comparing the ability of four pregnane compounds to reverse
puromycin resistance in the MS23 cell line. MS23 cells express the
mdr1 Pgp (1) and are more resistant to puromycin
(LC50 ~9.0 µM) compared with the
Pgp-deficient parental line W7TB (LC50 ~1.5
µM). In this experiment, all of the MS23 cultures were
grown in 3 µM puromycin, and the concentration of the
pregnane compounds was varied. 5 -Pregnane, the most hydrophobic of
the series, had no significant effect on the growth of the cells up to
a concentration of 20 µM. 5 -Pregnane-3-one was more effective (EC50 ~10 µM), followed by
5 -pregnane 3,20-dione (EC50 ~3 µM).
5 -Pregnane-17 -ol-3,20-dione (EC50 ~0.8
µM) was the most effective at reversing puromycin
resistance. Thus, for this series of compounds, the increased potential
of the steroid to make hydrogen bonding interactions enhanced the
ability to block the transporter. We have observed a similar pattern
for these compounds in their ability to increase accumulation of
dexamethasone and daunomycin in mdr1-expressing cell lines
(data not shown). These results, along with the specificity seen in the
capacity of the mdr1 Pgp to convey glucocorticoid resistance
(2), suggest that the protein may make discriminating interactions with
defined steroid structural elements. If this interpretation is correct,
it implies the existence of a steroid binding site and suggests that it
may be possible to identify Pgp mutations that alter the recognition of
specific steroid features.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 1.
Evaluation of pregnane's ability to reverse
puromycin resistance in MS23 cells. A series of MS23 cell
cultures, initially containing 5 × 104 cells, were
grown for 7 days in the presence of 3 µM puromycin and
varying concentrations of pregnane inhibitors. At the end of the
incubations, the turbidity values (660 nm) of the cultures were
measured and expressed as a percentage of the value obtained without
steroid. The steroid structures are shown for reference. ,
5 -pregnane; , 5 -pregnane-3-one; , 5 -pregnane-3,20-dione;
, 5 -pregnane-17 -ol-3,20-dione.
|
|
There are two examples in which Pgp expression, in murine cell lines,
resulted from transcription directed by promoters that are not normally
utilized (43). Gros and colleagues (43) found evidence of
mdr3 expression involving murine mammary tumor virus and
intracisternal A-particle elements in the mouse genome. In both cases,
the normal 5'-untranslated portion of the mdr3 mRNA was
altered to include retroviral long terminal repeat sequence through
changes in the normal patterns of initiation and splicing. Fig.
2 illustrates the results of a rapid
amplification of cDNA ends analysis of the 5' portion of the
mdr1 mRNA expressed in the MS23 cells. The data
demonstrate that the first mdr1 exon (untranslated) has been
replaced by intracisternal A-particle sequence. This finding suggests
that the mdr1 Pgp expression in MS23 cells is the result of
an infrequent event and is, therefore, likely to be produced from only
one copy of the gene. If this is the case, mutations in that gene
should result in unambiguous phenotypic changes in the drug resistance
profile, not obscured by a presence of the normal form of the protein.
The observations described above suggest a strategy for isolating MS23
variants expressing Pgp with altered ability to be inhibited by
pregnanes. Usually, the presence of a toxic drug and pregnane inhibitor
will result in cell death, since the inhibitor reverses drug
resistance. If the pregnane inhibitor is ineffective (due to a mutation
that alters steroid binding), the cells will retain their resistance and survive. Moreover, the cells expressing such a Pgp mutation should
display a distinctive phenotype. The MS23 variants will have reduced
resistance to dexamethasone-induced apoptosis.

View larger version (49K):
[in this window]
[in a new window]
|
Fig. 2.
Characterization of the 5' portion of the
mdr1 RNA transcripts, expressed in MS23 cells, by
rapid amplification of cDNA ends analysis. A,
primer 1 was used to generate cDNA that was initiated within the
exon 2 portion of the mdr1 RNA. Poly(dA) was added to the 5'
end of the cDNA using terminal transferase. PCR amplification of
the modified cDNA was carried out using primer 2 and an adapter
primer 3, which contains a (dT)17 tail at its 3' end. The
resulting fragment was approximately 450 bp in length. B,
the 450-bp fragment was purified by agarose gel electrophoresis and
directly sequenced using 32P-labeled primer 2. After 29 nucleotides, the sequence diverged from that of the normal
mdr1 gene. The divergence took place at the boundary between
mdr1 exons 1 and 2. The 226-base sequence 5' to the boundary
was determined and is displayed in juxtaposition with intracisternal
A-particle sequence.
|
|
In an effort to isolate variants expressing mutated Pgp, a sample of
mutagenized MS23 cells was exposed to the combination of puromycin
5 Podo for 21 days. A single resistant clone of cells was obtained
and designated as MSPP-1. The growth of this variant represents a
frequency of survival of 5 × 10 8. Fig.
3 depicts the drug resistance profile of
MSPP-1 cells compared with W7TB and MS23 cells. Fig. 3A
demonstrates that there was a complete reversal of dexamethasone
resistance in the MSPP-1 cells. In comparison, there was no change in
the vincristine resistance relative to the MS23 cells (Fig.
3B), nor was there a change in taxol resistance (data not
shown). The MSPP-1 cells also exhibited increased resistance to
colchicine (Fig. 3C) and a decreased resistance to puromycin
(Fig. 3D) and daunomycin (data not shown). The decrease in
puromycin resistance was not severe enough to compromise survival in 3 µM puromycin, the concentration used in the selection of the MSPP-1 cells.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 3.
Comparison of drug sensitivity profiles in
W7TB, MS23, and MSPP-1 cells. Cultures of W7TB MS23 and MSPP-1
cells (5 × 104 cells) were grown in increasing
concentrations of the indicated drugs for 7 days. At the end of the
incubation period, the turbidities of the cultures were measured and
analyzed as in Fig. 1. A, dexamethasone; B,
vincristine; C, colchicine; D, puromycin. ,
W7TB; , MS23; , MSPP-1.
|
|
The reversal of dexamethasone resistance in the MSPP-1 variant
indicates that the Pgp expressed in these cells has lost the capacity
to cause an efflux of the steroid. Therefore, MSPP-1 cells should be
able to accumulate more of the hormone than the MS23 cells. Fig.
4 demonstrates that the reduction in
dexamethasone accumulation, seen for MS23, was completely reversed.
MSPP-1 cells accumulate as much hormone as the Pgp-deficient W7TB
cells. Furthermore, if this loss of resistance and increase in hormone
accumulation is due to the Pgp's decreased capacity to bind steroids,
this diminished interaction should be reflected in a loss in pregnane inhibitor activity. The fact that the vincristine resistance in MSPP-1
remained the same as MS23 has allowed a comparison of the relative
effectiveness of the pregnane inhibitors in the two cell lines. This
was accomplished using a strategy similar to the one used for the
experiment represented in Fig. 1. A series of cultures was grown in
medium containing a nontoxic (for MS23 and MSPP-1) concentration of
vincristine and a range of pregnane concentrations. Fig.
5A shows that there was no
difference in the ability of 5 -pregnane-3-one to reverse vincristine
resistance between MS23 and MSPP-1 cells. In comparison, MSPP-1
required 9 times as much 5 -pregnane 3,20-dione as MS23 to reverse
the resistance (Fig. 5B). We interpret the results of Fig.
5, A and B, to indicate that the putative
mutation in the MSPP-1 Pgp does not have the capacity to significantly affect recognition of the 5 -pregnane-3-one portion of the structure but does alter the recognition of a 20-keto group. The results shown in
Fig. 5C demonstrate that the shift in relative inhibitory capacity was even greater with 5 -pregnane-17 -ol-3,20-dione. In
this instance, it required 33-fold more of the pregnane to inhibit
vincristine resistance in the MSPP-1 cells. This observation indicates
that the putative mutation alters the recognition of both the 20-keto
and 17-hydroxyl groups and confirms the basis for survival of the
MSPP-1 cells during the selection. The possibility that recognition of
the 17-hydroxyl group has been compromised is supported by the results
in Fig. 5D. MSPP-1 required 3-fold more
5 -androstan-17 -ol-3-one to reverse the vincristine resistance than did the MS23 cells.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 4.
Accumulation of dexamethasone in W7TB, MS23,
and MSPP-1 cells. Samples (2 × 107) of W7TB,
MS23, and MSPP-1 cells were incubated with
[3H]dexamethasone (2 × 10 8
M) for 1 h. At the end of the incubation, the cells
were pelleted and washed (three times) to remove unbound hormone, and
the amount of intracellular hormone was measured in a scintillation
counter. The values of bound hormone are normalized per 2 × 107 cells. Triplicate samples were analyzed.
|
|

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 5.
Reversal of vincristine resistance in MS23
and MSPP-1 cells by pregnane P-glycoprotein inhibitors. Parallel
sets of MS23 and MSPP-1 cell cultures were set up (5 × 104 cells/ml) containing 15 nM vincristine.
Neither of the cell lines is sensitive to vincristine at this
concentration. The cultures also contained the indicated concentrations
of pregnane inhibitors. The results were analyzed as in Fig. 1.
A, 5 -pregnane-3-one; B,
5 -pregnane-3,20-dione; C, 5 -pregnane-17 -ol-3,20-dione;
D, 5 -androstan-17 -ol-3-one. , MS23; ,
MSPP-1.
|
|
Two additional selections have been made with MS23 cells and a series
of variants resistant to the combination of puromycin and 5 Podo
isolated. This represents frequencies of survival of 7.8 × 10 7 and 2.5 × 10 7. As in the first
example, the selections were carried out in multiwell dishes with each
well initially containing 105 cells. This condition acts to
ensure that there is a clonal isolation of variants. However, each set
has the possibility of containing siblings of common progenitors due to
growth during the recovery period after mutagenesis.
RT-PCR was employed to generate a series of overlapping cDNA
fragments spanning the entire coding sequence of the mdr1
gene expressed in a series (8) of variants and MS23 cells. Each DNA
fragment was sequenced and compared with the sequence of the murine
mdr1 gene (44). In each case, only one sequence difference was found between MS23 and the variant within the entire sequence of
the gene. Fig. 6 depicts a side by side
comparison of the MS23 and MSPP-17 sequences near the site of the
mutation in the variant cell line. The analysis was of the noncoding
strand. There was a complete disappearance of the C band in the MSPP-17
sample at position 901 and the generation of a band at the T lane.
Thus, the difference was a G to A transition at nucleotide 901 of the coding sequence that resulted in an amino acid change of A301T. This
site is within the proposed transmembrane domain 5, 6 amino acids away
from the membrane/cytoplasm boundary. It is important to note that,
since the DNA fragments were not cloned prior to sequencing, this
change is indicative of the entire population of PCR-generated
fragments. Thus, the results confirm that the expression of the
mdr1 Pgp in these cell lines is from a single copy of the
gene. The data also provide confirmation of the clonal nature of the
variant cell lines. A mixture of expressed P-glycoprotein genes with
mutations at different positions would not show a complete change from
one nucleotide to another.

View larger version (148K):
[in this window]
[in a new window]
|
Fig. 6.
A comparison of the B1 fragment sequences in
samples from MS23 and MSPP-17 cells. Purified B1 fragments
obtained by RT-PCR were sequenced using a 5'-32P-labeled
primer. The samples were analyzed by electrophoresis through a 6%
polyacrylamide urea gel, and the resulting gel was subjected to
autoradiography. A portion (~ ) of the resulting pattern is
depicted. The left-hand member of each pair of sequencing
bands is from the MS23 sample. The right-hand member of the
pair is from the MSPP-17 sample. The arrow indicates the
site of a mutation in the sample from the MSPP-17 cells.
|
|
Table II provides a summary of the drug
resistance profiles of the eight variants for six different toxic drugs
including dexamethasone. Since we have chosen to study variants with a
pronounced loss of steroid resistance, the results with
dexamethasone reflect this precondition. None of the analyzed
variants exhibited an increase in actinomycin D resistance that would
be indicative of expression of the mdr3 gene. In nearly all
of the variants, there was at least a 33% loss in puromycin
resistance. Also listed are the five amino acid changes predicted from
the mutations that were found. The results show that the W231L change
was found in variants from three independent selections, while the
A301V change was observed in two independent selections. The alanine
301 was found to be mutated in two ways, A301T and A301V, by changes at two adjacent bases. There is consistency in the phenotypes of the
variants with the same mutation that were isolated from independent selections. More importantly, the drug resistance profile is unique to
each of the mutated P-glycoproteins. We have evidence that, with the
exception of the MSPP-21 variant, each of the mutations results in the
lost recognition of the 17-hydroxyl group and the 20-keto oxygen (data
not shown). We have not been able to test the MSPP-21 cell line for
this property, since we have not identified a drug to which it has
unchanged resistance. Fig. 7 illustrates the position of the amino acids that are changed in their proposed relationship to the plasma membrane. All four of the amino acids are
located within the inner lipid leaflet, no more than 6 amino acids from
the cytoplasmic interface.
View this table:
[in this window]
[in a new window]
|
Table II
Profiles of changes in drug sensitivities for variants expressing
mutated P-glycoproteins
Changes in drug resistance were evaluated by measuring the LC50
values for the individual drugs in the W7TB, MS23, and variant cell
lines (as in Fig. 3). The change in drug resistance was calculated
according to the equation, Change = (VarLC50 MS23LC50/MS23LC50 W7TBLC50), where Change 0.5 = +,
1.0 = ++, 1.5 = +++, 2.0 = ++++,  0.33 = ,  0.67 =  ,  1.0 =   .
|
|

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 7.
The locations of pregnane-derived
P-glycoprotein mutations within the proposed relationship between the
protein and the plasma membrane. The filled
circles represent the amino acids that are altered by the
mutations found in the MSPP variants.
|
|
The Pgp mutation identified in the MSPP-1 cell line was introduced into
a copy of the mdr1 gene that had been cloned into a modified
form of the pMT2 expression vector (54). The plasmid was transfected
into HEK293T cells. Another plasmid, containing the normal gene, was
similarly transfected into these human cells. Colonies of cells,
resistant to 6 µM puromycin, were isolated and tested for
murine mdr1 P-glycoprotein expression by RT-PCR and direct
sequencing. The results verified that the normal and mutated genes were
expressed in the 293Twt-3 and 293T-801-3 variants, respectively. Fig.
8A depicts the puromycin
sensitivities of the nontransfected HEK293T, 293Twt-3, and 293T-801-3
cell lines. Also shown, for comparison, are the puromycin sensitivities
of the same three cell lines grown in the presence of 10 µM 5 Podo. The results demonstrate that the puromycin
sensitivity (LC50 = 0.40 µM) of the HEK293T
cells was not changed by the presence of the inhibitory steroid.
Neither was the sensitivity of the 293T-801-3 cells (LC50 = 14.5 µM), which is consistent with the expression of a
mutated protein. Only the sensitivity of the 293Twt-3 cells, expressing
the normal Pgp, was changed by the presence of 5 Podo (from
LC50 = 24.5 µM to LC50 = 3.9 µM). This change represents an 85% reversal of the
Pgp-dependent puromycin resistance. The relative inability
of the altered Pgp to be inhibited by 5 Podo was confirmed by an
experiment whose results are shown in Fig. 8B. Both the
293Twt-3 and 293T-801-3 cell lines were grown in 10 µM
puromycin, a concentration to which they are both resistant (Fig.
8A). The concentration of 5 Podo was varied to test its effectiveness in reversing this resistance. In the cells expressing the
normal gene (293Twt-3), the EC50 was 5.9 µM
5 Podo. The cells expressing the mutated protein required 4 times as
much steroid (EC50 = 24.9 µM). Taken
together, the results of Figs. 7 and 8 confirm that the mutation
producing the W231L change caused a reduction in the ability of
5 Podo to inhibit drug resistance.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 8.
Evaluation of
5 Podo's effect on puromycin sensitivities in
HEK293T cell lines. A, cultures of HEK293T, 293Twt-3,
and 293T801-3 cells (2 × 104 cells) were grown in
increasing concentrations of puromycin for 7 days. For each cell line,
a parallel set of cultures was grown containing 10 µM of
5 Podo. At the end of the incubation period, the cells were released
from the plates with trypsin, and the turbidity values of the cell
suspension were measured. Unfilled symbols,
without 5 Podo; filled symbols, with 5 Podo.
and , HEK293T; and , 293Twt-3; and , 293T801-3.
B, cultures (2 × 104 cells) of 293Twt-3
and 293T801-3 cells were grown for 7 days in the presence of 10 µM puromycin and increasing concentrations of 5 Podo.
At the end of the incubation period, the samples were analyzed as in
A. , 293Twt-3; , 293T801-3.
|
|
 |
DISCUSSION |
The efficiency of our strategy for obtaining variant cell lines
expressing mutated Pgp is enhanced by three elements. First, the
mdr1 gene in MS23 cells is expressed from a single allele, thus allowing an unambiguous evaluation of phenotypic changes resulting
from the mutations. Second, the pregnane inhibitors are nontoxic
steroids, structurally related to dexamethasone. Changes in the
Pgp's ability to interact with the steroid inhibitors are reflected by
a decrease in dexamethasone resistance. This property allows a simple
screen of a large number of variants for candidates expressing an
altered Pgp function that is related to steroid recognition. Third,
steroids are small molecules with a relatively limited number of sites
that can contribute to interactions with the protein. Modification of
one or two such interactions should have a large effect compared with
other inhibitors that have a more complex interaction with the protein.
To date, we have carried out four independent selections with the
combinations of 5 Podo and puromycin. 67 variant cell lines were
isolated. 36 of these exhibit loss of dexamethasone resistance and are
currently under evaluation. A significant number of these contain the
W231L mutation, suggesting that it may represent a mutational "hot
spot." We have screened the 31 variants that do not exhibit a change in steroid resistance and found a characteristic increase in resistance to actinomycin D. This property is indicative of mdr3 Pgp
expression (45). Co-expression of the mdr3 Pgp, since,
compared with mdr1, it is only weakly inhibited by 5 Podo
(54), could convey puromycin resistance and account for survival in the
selection process. We have used RT-PCR to verify mdr3
expression in several of these variant cell lines. It should be noted
that this selection should not be compromised by survival of cells with
glucocorticoid receptor mutations. Instead, the selection demands a
retained capacity to transport puromycin, while the effectiveness of
steroid Pgp inhibition is reduced. Thus, mutations resulting in a large
reduction of mdr1 P-glycoprotein function will not convey a
selective advantage.
The results of our analysis provide definitive support for the proposal
that the mdr1 P-glycoprotein can transport
dexamethasone out of cells, thus reducing the potential for
activation of glucocorticoid receptors. The location of the five
mutations described here is evidence that the interaction between
steroids and the Pgp involves the transmembrane portion of the first
half of the protein. The decrease in 5 Podo's inhibitory activity,
which results from the mutations, suggests that the primary effect of
the mutations may be upon steroid binding. Specifically, the data
indicate a lost recognition of the 20-keto oxygen and 17-hydroxyl
group. Fig. 1 demonstrated that both contribute to 5 Podo's
inhibitory activity. That recognition of both groups could be
simultaneously affected is not surprising, since they are associated
with adjacent carbon atoms. Previous studies had indicated that the
17-hydroxyl group contributed to dexamethasone's ability to be
transported (1). We believe that these observations are consistent with
the keto oxygen and 17-hydroxyl group acting to promote higher affinity binding between steroids and Pgp. However, it is unlikely that 5 Podo
is transported by the Pgp, since it lacks an 11 -hydroxyl group that
is a key determinant for steroid transport. Thus, it appears that
5 Podo has the necessary structural elements for avid binding to the
Pgp without its efficient removal from the protein through the
transport mechanism. Such a combination could account for its
effectiveness as a Pgp inhibitor relative to other steroids, such as
dexamethasone, which are efficiently transported (3, 4).
Kajiji et al. (10) have studied the effects of a S941F
mutation (transmembrane domain 11) on inhibitor activity in Chinese hamster ovary cells transfected with the mdr1 gene. They
reported that this mutation caused a strong reduction of photoaffinity labeling by iodoarylazidoprazosin and azidopine along with reduced vinblastine, adriamycin, and colchicine resistance. Compared with the
normal Pgp, progesterone was shown to cause a smaller reversal in
resistance to these three drugs with the mutated protein. However, this
reversal was an inhibition of an already compromised resistance, and
the effects that they observed were the result of exposure to a single
concentration (25 µM) of progesterone. In our studies (Fig. 5), we used a titrated reversal of vincristine resistance to
evaluate changes in the efficacy of the pregnane inhibitors, specifically because the vincristine sensitivity did not differ between
MS23 and the variant MSPP-1. In this way, we were able to determine the
relative concentrations of pregnanes needed to cause an equivalent
reversal of drug resistance in the two cell lines.
Others have used the combination of a Pgp inhibitor and toxic drug in
an effort to isolate variants expressing Pgp mutations affecting
inhibitor activity. Chen et al. (14) reported the isolation
of a human sarcoma line (DxP) expressing a mutated MDR1 Pgp that
exhibited a decreased response to cyclosporin-based transport inhibitors. The DxP cell line was isolated through a prolonged (1-year)
selection in the presence of the PSC-833 inhibitor and increasing
concentrations of doxorubicin (40-500 nM). The DxP cells
displayed decreased resistance to daunorubicin, paclitaxel, Vinca
alkaloids, and epipodophyllatoxins but not doxorubicin. DxP also
manifested decreased capacity to transport cyclosporin and rhodamine
123. In comparison with the point mutations that we have observed, the
mutation in the DxP MDR1 gene was a deletion that resulted in the loss
of the Phe335 amino acid in the transmembrane domain 6 portion of the protein. Site-directed mutagenesis has also been used to
explore the effects of substitution mutations at the Phe335
position (19). A F335A or F335S change caused increased resistance to
doxorubicin. A F335L change caused decreased resistance to doxorubicin.
The effects of these changes on the activity of cyclosporin inhibitors
was not reported.
Photoaffinity labeling experiments have indicated that there are two
regions of the Pgp that are involved in drug binding (46-51). These
regions include the transmembrane domains 5 and 6, as well as the 11 and 12 domains. More recently, Demmer et al. (52) used
iodomycin, a modified form of daunomycin, to map an anthracycline
binding site that included the 4 and 5 transmembrane domains of a
hamster Pgp. Our results are in accordance with that observation. Three
of the four steroid-related point mutations that we have found, located
in transmembrane domains 4 and 5, cause a decrease in daunomycin
resistance (Table II). Using a similar approach, Wu et al.
employed two benzophenone analogues of taxol to photoaffinity label the
mouse mdr1b (mdr1) Pgp (53). Each compound
preferentially labeled a different region located in the second half of
the protein. One labeled a fragment that includes half of transmembrane
domain 12 and extends past the Walker A motif in the second ATP binding
region. The other labeled a region that encompassed all of
transmembrane domain 7 and half of 8. Taken together, the results of
these studies suggest the possibility of overlapping
steroid-anthracycline sites within the first half of the protein and
another taxane site within the second half of the protein.
 |
ACKNOWLEDGEMENTS |
We thank Scott Wessels and Asako Yamamuro for
technical support and Alba Phippard for valuable suggestions for the
manuscript. We also thank Josh Bernd for help with the figures.
 |
FOOTNOTES |
*
This work was supported by National Institutes of Health
Grant DK51107.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: The Sidney Kimmel
Cancer Center, 10835 Altman Row, San Diego, CA 92121. Tel.: 619-450-5990 (ext. 306); Fax: 619-550-3998; E-mail:
dgruol@skcc.org.
2
D. Gruol, unpublished observation.
 |
ABBREVIATIONS |
The abbreviations used are:
Pgp, P-glycoprotein;
5 Podo, 5 -pregnane-17 -ol-3,20-dione;
RT, reverse transcriptase;
PCR, polymerase chain reaction;
bp, base pair(s).
 |
REFERENCES |
| 1.
|
Bourgeois, S.,
Gruol, D. J.,
Newby, R. F.,
and Rajah, F. M.
(1993)
Mol. Endocrinol.
7,
840-851[Abstract/Free Full Text]
|
| 2.
|
Gruol, D. J.,
and Bourgeois, S.
(1994)
Biochem. Cell Biol.
72,
561-571[Medline]
[Order article via Infotrieve]
|
| 3.
|
Gruol, D. J.,
Zee, M. C.,
Trotter, J.,
and Bourgeois, S.
(1994)
Cancer Res.
54,
3088-3091[Abstract/Free Full Text]
|
| 4.
|
Gruol, D. J.,
and Bourgeois, S.
(1997)
Cancer Res.
57,
720-727[Abstract/Free Full Text]
|
| 5.
|
Yang, C.-P. H.,
Cohen, D.,
Greenberger, L. M.,
Hsu, S. I.-H.,
and Horwitz, S. B.
(1990)
J. Biol. Chem.
265,
10282-10288[Abstract/Free Full Text]
|
| 6.
|
Qian, X.,
and Beck, W. T.
(1990)
J. Biol. Chem.
265,
18753-18756[Abstract/Free Full Text]
|
| 7.
|
Yang, C.-P. H.,
Goei DePinho, S.,
Greenberger, L. M.,
Arceci, R. J.,
and Horwitz, S. B.
(1989)
J. Biol. Chem.
264,
782-788[Abstract/Free Full Text]
|
| 8.
|
Barnes, K. M.,
Dickstein, B.,
Cutler, G. B., Jr.,
Fojo, T.,
and Bates, S. E.
(1996)
Biochemistry
35,
4820-4827[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Gros, P.,
Dhir, R.,
Croop, J.,
and Talbot, F.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
7289-7293[Abstract/Free Full Text]
|
| 10.
|
Kajiji, S.,
Talbot, F.,
Grizzuti, K.,
Van Dyke-Phillips, V.,
Agresti, M.,
Safa, A. R.,
and Gros, P.
(1993)
Biochemistry
32,
4185-4194[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Gottesman, M. M.,
Hrycyna, C. A.,
Schoenlein, P. V.,
Germann, U. A.,
and Pastan, I.
(1995)
Annu. Rev. Genet.
29,
607-649[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Choi, K.,
Chen, C.,
Kriegler, M.,
and Roninson, I. B.
(1988)
Cell
53,
519-529[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Devine, S. E.,
Ling, V.,
and Melera, P. W.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
4564-4568[Abstract/Free Full Text]
|
| 14.
|
Chen, G.,
Duran, G. E.,
Steger, K. A.,
Lacayo, N. J.,
Jaffrezou, J. P.,
Dumontet, C.,
and Sikic, B. I.
(1997)
J. Biol. Chem.
272,
5974-5982[Abstract/Free Full Text]
|
| 15.
|
Currier, S. J.,
Ueda, K.,
Willingham, M. C.,
Pastan, I.,
and Gottesman, M. M.
(1989)
J. Biol. Chem.
264,
14376-14381[Abstract/Free Full Text]
|
| 16.
|
Currier, S. J.,
Kane, S. E.,
Willingham, M. C.,
Cardarelli, C. O.,
Pastan, I.,
and Gottesman, M. M.
(1992)
J. Biol. Chem.
267,
25153-25159[Abstract/Free Full Text]
|
| 17.
|
Dhir, R.,
Grizzuti, K.,
Kajiji, S.,
and Gros, P.
(1993)
Biochemistry
32,
9492-9499[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Loo, T. W.,
and Clarke, D. M.
(1993)
J. Biol. Chem.
268,
3143-3149[Abstract/Free Full Text]
|
| 19.
|
Loo, T. W.,
and Clarke, D. M.
(1993)
J. Biol. Chem.
268,
19965-19972[Abstract/Free Full Text]
|
| 20.
|
Loo, T. W.,
and Clarke, D. M.
(1994)
J. Biol. Chem.
269,
7243-7248[Abstract/Free Full Text]
|
| 21.
|
Loo, T. W.,
and Clarke, D. M.
(1994)
Biochemistry
33,
14049-14057[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Loo, T. W.,
and Clarke, D. M.
(1996)
J. Biol. Chem.
271,
15414-15419[Abstract/Free Full Text]
|
| 23.
|
Hanna, M.,
Brault, M.,
Kwan, T.,
Kast, C.,
and Gros, P.
(1996)
Biochemistry
35,
3625-3635[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Muller, M.,
Bakos, E.,
Welker, E.,
Varadi, A.,
Germann, U. A.,
Gottesman, M. M.,
Morse, B. S.,
Roninson, I. B.,
and Sarkadi, B.
(1996)
J. Biol. Chem.
271,
1877-1883[Abstract/Free Full Text]
|
| 25.
|
Loo, T. W.,
and Clarke, D. M.
(1997)
J. Biol. Chem.
272,
31945-31948[Abstract/Free Full Text]
|
| 26.
|
Taguchi, Y.,
Kino, K.,
Morishima, M.,
Komano, T.,
Kane, S. E.,
and Ueda, K.
(1997)
Biochemistry
36,
8883-8889[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Bakos, E.,
Klein, I.,
Welker, E.,
Szabo, K.,
Muller, M.,
Sarkadi, B.,
and Varadi, A.
(1997)
Biochem. J.
323,
777-783
|
| 28.
|
Hafkemeyer, P.,
Dey, S.,
Ambudkar, S. V.,
Hrycyna, C. A.,
Pastan, I.,
and Gottesman, M. M.
(1998)
Biochemistry
37,
16400-16409[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Beaudet, L.,
Urbatsch, I. L.,
and Gros, P.
(1998)
Biochemistry
37,
9073-9082[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Urbatsch, I. L.,
Beaudet, L.,
Carrier, I.,
and Gros, P.
(1998)
Biochemistry
37,
4592-4602[CrossRef][Medline]
[Order article via Infotrieve]
|
| 31.
|
Kwan, T.,
and Gros, P.
(1998)
Biochemistry
37,
3337-3350[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Loo, T. W.,
and Clarke, D. M.
(1998)
Methods Enzymol.
292,
480-492[Medline]
[Order article via Infotrieve]
|
| 33.
|
Safa, A. R.,
Stern, R. K.,
Choi, K.,
Agresti, M.,
Tamai, I.,
Mehta, N. D.,
and Roninson, I. B.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
7225-7229[Abstract/Free Full Text]
|
| 34.
|
Harris, A. W.,
Bankhurst, A. D.,
Mason, S.,
and Warner, N. L.
(1973)
J. Immunol.
110,
431-438[Abstract/Free Full Text]
|
| 35.
|
Johnson, D. M.,
Newby, R. F.,
and Bourgeois, S.
(1984)
Cancer Res.
44,
2435-2440[Abstract/Free Full Text]
|
| 36.
|
Gruol, D. J.,
and Dalton, D. K.
(1984)
J. Cell. Physiol.
119,
107-118[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Gruol, D. J.,
Rajah, F. M.,
and Bourgeois, S.
(1989)
Mol. Endocrinol.
3,
2119-2127[Abstract/Free Full Text]
|
| 38.
|
Chomczynski, P.,
and Sacchi, N.
(1987)
Anal. Biochem.
162,
156-159[Medline]
[Order article via Infotrieve]
|
| 39.
|
Frohman, M. A.
(1990)
in
PCR Protocols
(Innis, M. A.
, Gelfand, D. H.
, Sninsky, J. J.
, and White, T. J., eds), 1st Ed.
, pp. 28-38, Academic Press, Inc., San Diego
|
| 40.
|
Wong, G. G.,
Witek, J. S.,
Temple, P. A.,
Wilkens, K. M.,
Leary, A. C.,
Luxenberg, D. P.,
Jones, S. S.,
Brown, E. L.,
Kay, R. M.,
Orr, E. C.,
Shoemaker, C.,
Golde, D. W.,
Kaufman, R. J.,
Hewick, R. M.,
Wang, E. A.,
and Clark, S. C.
(1985)
Science
228,
810-815[Abstract/Free Full Text]
|
| 41.
|
Kaufman, R. J.,
Davies, M. V.,
Pathak, V. K.,
and Hershey, J. W. B.
(1989)
Mol. Cell. Biol.
9,
946-958[Abstract/Free Full Text]
|
| 42.
|
Kawasaki, E. S.
(1990)
in
PCR Protocols
(Innis, M. A.
, Gelfand, D. H.
, Sninsky, J. J.
, and White, T. J., eds), 1st Ed.
, pp. 21-27, Academic Press, Inc., San Diego
|
| 43.
|
Lepage, P.,
Devault, A.,
and Gros, P.
(1993)
Mol. Cell. Biol.
13,
7380-7392[Abstract/Free Full Text]
|
| 44.
|
Gros, P.,
Croop, J.,
and Housman, D.
(1986)
Cell
27,
371-380
|
| 45.
|
Devault, A.,
and Gros, P.
(1990)
Mol. Cell. Biol.
10,
1652-1663[Abstract/Free Full Text]
|
| 46.
|
Bruggemann, E. P.,
Germann, U. A.,
Gottesman, M. M.,
and Pastan, I.
(1989)
J. Biol. Chem.
264,
15483-15488[Abstract/Free Full Text]
|
| 47.
|
Bruggemann, E. P.,
Currier, S. J.,
Gottesman, M. M.,
and Pastan, I.
(1992)
J. Biol. Chem.
267,
21020-21026[Abstract/Free Full Text]
|
| 48.
|
Greenberger, L. M.,
Yang, C.-P. H.,
Gindin, E.,
and Horwitz, S. B.
(1990)
J. Biol. Chem.
265,
4394-4401[Abstract/Free Full Text]
|
| 49.
|
Greenberger, L. M.
(1993)
J. Biol. Chem.
268,
11417-11425[Abstract/Free Full Text]
|
| 50.
|
Zhang, X.,
Collins, K. I.,
and Greenberger, L. M.
(1995)
J. Biol. Chem.
270,
5441-5448[Abstract/Free Full Text]
|
| 51.
|
Morris, D. I.,
Greenberger, L. M.,
Bruggemann, E. P.,
Cardarelli, C.,
Gottesman, M. M.,
Pastan, I.,
and Seamon, K. B.
(1995)
Mol. Pharmacol.
46,
329-337[Abstract]
|
| 52.
|
Demmer, A.,
Thole, H.,
Kubesch, P.,
Brandt, T.,
Raida, M.,
Fislage, R.,
and Tummler, B.
(1997)
J. Biol. Chem.
272,
20913-20919[Abstract/Free Full Text]
|
| 53.
|
Wu, Q.,
Bounaud, P. Y.,
Kuduk, S. D.,
Yang, C. P.,
Ojima, I.,
Horwitz, S. B.,
and Orr, G. A.
(1998)
Biochemistry
37,
11272-11279[CrossRef][Medline]
[Order article via Infotrieve]
|
| 54.
| Gruol, D. (1999) Biochem. Pharmacol., in
press
|
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
R. A. De Sousa Peixoto, S. Turban, J. H. Battle, K. E. Chapman, J. R. Seckl, and N. M. Morton
Preadipocyte 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Is a Keto-Reductase and Contributes to Diet-Induced Visceral Obesity in Vivo
Endocrinology,
April 1, 2008;
149(4):
1861 - 1868.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Adler and E. Bibi
Determinants of Substrate Recognition by the Escherichia coli Multidrug Transporter MdfA Identified on Both Sides of the Membrane
J. Biol. Chem.,
March 5, 2004;
279(10):
8957 - 8965.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. W. Loo, M. C. Bartlett, and D. M. Clarke
Substrate-induced Conformational Changes in the Transmembrane Segments of Human P-glycoprotein. DIRECT EVIDENCE FOR THE SUBSTRATE-INDUCED FIT MECHANISM FOR DRUG BINDING
J. Biol. Chem.,
April 11, 2003;
278(16):
13603 - 13606.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Gruol, M. N. King, and M. E. Kuehne
Evidence for the Locations of Distinct Steroid and Vinca Alkaloid Interaction Domains within the Murine mdr1b P-Glycoprotein
Mol. Pharmacol.,
November 1, 2002;
62(5):
1238 - 1248.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Gruol, J. Bernd, A. E. Phippard, I. Ojima, and R. J. Bernacki
The Use of a Novel Taxane-Based P-Glycoprotein Inhibitor to Identify Mutations That Alter the Interaction of the Protein with Paclitaxel
Mol. Pharmacol.,
July 1, 2001;
60(1):
104 - 113.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
E. Bello-Reuss, S. Ernest, O. B. Holland, and M. R. Hellmich
Role of multidrug resistance P-glycoprotein in the secretion of aldosterone by human adrenal NCI-H295 cells
Am J Physiol Cell Physiol,
June 1, 2000;
278(6):
C1256 - C1265.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|