![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 3, 1415-1422, January 15, 1999
-regulated Variant of HOXA9*
From the Department of Cell Biology, Lerner Research Institute of The Cleveland Clinic Foundation, Cleveland, Ohio 44195
| |
ABSTRACT |
|---|
|
|
|---|
The expression of the class 1 homeobox (HOX)
family of "master control" transcription factors has been studied
principally in embryogenesis and neoplasia in which HOX genes play a
critical role in cell proliferation, migration, and differentiation. We wished to test whether HOX family members were also involved in a
differentiation-like process occurring in normal, diploid adult cells,
that is, cytokine-induced activation of endothelial cells (EC).
Screening of a human EC cDNA library yielded several members of the
A and B groups of HOX transcription factors. One clone represented a
novel, alternatively spliced variant of the human HOXA9
gene containing a new exon and the expression of which was driven by a
novel promoter. This variant termed HOXA9EC appeared restricted to cells of endothelial lineage, i.e. expressed
by human EC from multiple sources, but not by fibroblasts, smooth muscle cells, or several transformed cell lines. HOXA9EC
mRNA was rapidly down-regulated in EC in response to tumor necrosis factor- Little is known about the molecular mechanisms that regulate and
maintain endothelial cells
(EC)1 in their differentiated
state or the types of aberrations in the expression of regulatory genes
that lead to an activated or pathological state of these cells (1) One
important category of nuclear proteins which we hypothesized to be
involved in these processes is the homeobox (HOX) class of
transcription factors. These "master regulatory" genes specify and
govern the body plan of organisms and have been shown to regulate
development and differentiation in all metazoa ranging from sponges to
vertebrates (for review see Ref. 2). The salient feature of the HOX
proteins is a highly conserved 60-amino acid "homeodomain" that
allows for sequence-specific DNA binding to regulate target gene
expression. Ablation of HOX genes causes homeotic transformations
(3-11), and abnormal expression of specific HOX genes can cause both
neoplastic transformation in cultured cells and tumors in mammals
(12-15). The pattern of HOX gene expression is thought to progress
from dictating pattern formation during embryogenesis to a more
restricted role in maintaining the differentiated state of cells in an
adult organism (2, 16). In addition to the restricted expression of a
subset of HOX genes in a tissue, these transcription factors are known
to be alternatively spliced (17-22), transcribed from multiple
promoters (23-26), post-transcriptionally regulated (27, 28), and
post-translationally modified (29, 30).
The pursuit of HOX genes of consequence in vascular cell
differentiation and proliferation is a new field. Investigators have begun to identify HOX genes that may play a regulatory role in the
adult cardiovascular system (31-33). To date, these studies have
focused on the smooth muscle cell with few published reports discussing
HOX gene expression in EC (34, 35). The endothelium plays a dynamic
role at sites of inflammation and during cell-mediated immune
responses. Quiescent EC when activated in response to treatment with
cytokines, such as TNF- As a first step toward determining the possible involvement of HOX gene
expression in the biology of EC activation, we have isolated several
HOX genes expressed by human EC. Here we report on the characterization
of an EC-expressed, novel variant of HOXA9, which is
transcribed from a novel promoter that shows both autoregulation as
well as modulation during EC activation.
cDNA and Genomic Cloning--
A human umbilical vein EC
cDNA library in
The HOXA9 genomic clones were obtained by screening a human
placental genomic DNA library in Lambda EMBL3
(CLONTECH) using a uniformly
32P-labeled HOXA9EC cDNA probe. The
intervening region between the exons was polymerase chain
reaction-amplified and sequenced using appropriate exon-specific
oligonucleotide primers. Direct sequencing of the Lambda EMBL3 clone
containing the HOXA9 genomic DNA confirmed the authenticity
of the sequence. The sequence analysis was performed using MacVector
software (Oxford Molecular Group).
Synthesis of GST-HOXA9EC Fusion Protein in E. coli--
The
HOXA9EC cDNA insert in lambda gt11 was excised with
EcoRI and cloned into the EcoRI site of pGEX2T,
in-frame with the GST-coding sequence. Following transformation in
E. coli HB101, the orientation of the insert was determined
by sequencing the DNA. Production of the GST-HOXA9EC fusion
protein was induced by isopropyl- Electrophoretic Mobility Shift Assay (EMSA)--
The EMSA probes
were synthesized by annealing the two overlapping primers and
gel-purified on 12% non-denaturing polyacrylamide gel. The
double-stranded oligonucleotides were 5'-end-labeled with
[ RNase Protection Analysis (RPA) and cRNA Probes--
Total RNA,
isolated using Trizol reagent (Life Technologies, Inc.), was obtained
from human mesenteric artery EC, human aortic smooth muscle (provided
by Carol de la Motte, Cleveland Clinic Research Institute, Cleveland),
skeletal muscle (provided by Dr. Linda Graham, University of Michigan,
Ann Arbor), and various cultured cells. RNase protection was performed
on 10 µg of RNA following the recommended protocol (Ambion).
Uniformly 32P-labeled cRNA probes were generated from
HOXA9EC (EC exon (E1), 245-644; homeodomain exon,
2114-2465), human E-selectin (49), and human Transient Transfection Assays--
The luciferase reporter
constructs were made by subcloning the Cloning of EC Homeobox cDNAs and Identification of a Novel
Variant of HOXA9--
A degenerate oligonucleotide probe targeted to
the highly conserved third helix of the homeodomain (48) was used to
screen a human umbilical vein EC cDNA library. Eighty cDNA
clones that hybridized to the probe were isolated and sequenced; 66 were confirmed to contain homeodomains. Identity of the clones was
established by sequencing the boundaries of the cDNA inserts as
well as the region within and around the homeodomain. We identified
cDNAs of HOXA1, HOXA2, HOXA4, HOXA5, HOXA7, HOXA9,
HOXB2, HOXB4, HOXB6, HOXB7, and an unlinked homeobox gene
HLX. No members of the other two subgroups of HOX genes, C
or D, were isolated among the cloned endothelial cDNAs.
Two partial cDNA clones of 1.6 and 1.4 kb were found to contain the
homeodomain and 3'-UTR of the HOXA9 gene as previously reported (13), but their sequences differed from reported sequence upstream of the conserved splice site previously reported for both the
murine Hoxa-9 cDNA (52) and a partial cDNA of
chicken Hoxa-9 (53). These clones therefore represented
novel transcripts encoded by the HOXA9 gene (Fig.
1A). The sequence of the
1.6-kb cDNA, which we have termed HOXA9EC, exhibited a
continuous open reading frame with a novel N-terminal 116 amino acids
leading into the HOXA9 homeodomain. This sequence when
scanned against the data base showed homology to the human
HOXA9 cDNAs cloned from CD34+ cells
(GenBankTM accession number U82759), from the human fetus
(GenBankTM accession number U41813) (13), and to a human
PAC sequence spanning 7p-15 to p-21 (GenBankTM accession
number AC004080). It was also homologous to the murine
(GenBankTM accession numbers M28449, AB008914, and
AB005457) (52, 54), alternatively spliced guinea pig Hoxa-9
cDNAs (GenBankTM accession numbers X13536 and X13537)
(21), chicken Hoxa-9 cDNA (GenBankTM
accession number X97750) (53), and a Mexican salamander Hoxa-9 cDNA (GenBankTM accession number
U20941) (55). The novel HOXA9EC cDNA sequence, which
differed from the previously described Hoxa-9 cDNAs from various species, was apparently the result of differential splicing. The internal splice acceptor site located within the novel exon had
been reported by others to be used during maturation of guinea pig
Hox-a9A mRNA (21) and in the fusion between
Hoxa-10 exon 1A and Hoxa-9 (17). This site has
also been reported to serve as the breakpoint for the t(7;11)(p15;p15)
translocation that causes an in-frame fusion of NUP98 and
HOXA9 in acute myeloid leukemia (13).
The 1.4-kb clone HOXA9NT
(non-translatable) contained multiple termination
codons in all three possible reading frames upstream of the homeodomain
and lacked a favorable AUG, suggesting that it did not code for a
homeodomain-containing protein. Other HOX transcripts that lack
homeodomain-coding open reading frames include the bovine
HoxA9 cDNA,2
Xenopus Xhox36 (17), murine Hoxa-1
(56), Hoxa-10 (17), and Hoxc-6 (57).
The protein-coding region of HOXA9EC was subcloned into the
pGEX2T vector, and the resulting glutathione S-transferase
(GST) fusion protein was induced in Escherichia coli and
purified (Fig. 1B). The sequence-specific DNA-binding
properties of the GST-HOXA9EC were examined by
electrophoretic mobility shift assay (Fig. 1C). GST-HOXA9EC showed preferential binding to a double-stranded
oligonucleotide containing the recognition site of the Abd-B
homeodomain, as defined by Benson et al. (17). Competition
with excess unlabeled oligonucleotide containing either a mutated
Abd-B binding sequence or the Antennapedia homeodomain recognition sequence did not alter the binding of HOXA9EC to the Abd-B sequence.
By using the partial HOXA9EC cDNA as a probe, a second
round of screening of the EC cDNA library yielded four
HOXA9EC overlapping clones constituting a complete coding
sequence (Fig. 2A). The HOXA9EC mRNA was found to encode a 30-kDa homeodomain
protein containing an N-terminal polyhistidine tract, a motif found in many HOX proteins, and a centrally located proline-tyrosine pair that
is conserved in HOX genes of the Abd-B class (58).
A human genomic DNA library in Lambda EMBL3 was screened to isolate
clones containing HOXA9EC. The 5' boundary of the novel exon
was determined by RNase protection analysis of a cRNA probe generated
from a 493-bp genomic DNA fragment containing the 5'-UTR and its
upstream region (Fig. 2B). Primer extension of the
HOXA9EC mRNA was performed to determine the 5'-UTR (Fig.
2C) and the transcription initiation site was found to
coincide with the 5' boundary of the novel exon, suggesting that this
exon and the A9 homeodomain-coding exon were sufficient to generate the
HOXA9EC transcript.
Direct sequencing using exon-specific, oligonucleotide primers
confirmed that one of the HOXA9 genomic clones contained the exons encoding the A9 homeodomain, the novel HOXA9EC exon,
and the first exon of the previously reported HOXA9 cDNA
isolated from fetal tissue (13). The novel HOXA9EC 5' exon
was found to be separated by a 990-bp intron from the common 3' exon
containing the HOXA9 homeodomain. Polymerase chain reaction
amplification using exon-specific primers, followed by sequencing,
confirmed the presence of a 3.7-kb intron separating the 5' exon of the fetal HOXA9 cDNA sequence that splices to the
HOXA9 homeodomain-containing exon (13) and
HOXA9EC exon 1. The colocalization of the previously mapped
fetal HOXA9 exon upstream of the EC exon 1 and the
HOXA9 homeodomain exon in the human genomic clones confirmed
that HOXA9EC cDNA was derived from the HOXA9
locus (Fig. 2D).
Specificity of HOXA9EC Expression--
Northern analysis of human
umbilical vein EC mRNA revealed a single 2.1-kb transcript
hybridizing to either the full-length HOXA9EC cDNA probe
(Fig. 3A) or the
HOXA9EC exon L-specific probe (not shown) suggesting that
HOXA9 transcribes a single major transcript of low abundance
in EC. This was in contrast to the expression of the murine
Hoxa-9 gene that was shown to encode a major transcript of
2.5 kb (52). The RPA using a HOXA9EC exon 1-specific probe revealed that HOXA9EC was expressed in freshly isolated EC
from human mesenteric artery but not in smooth muscle cells from the same artery (Fig. 3B). HOXA9EC expression was
also examined in a variety of cultured cells by RPA using the exon
1-specific probe. HOXA9EC mRNA was detected in primary
cultures of human aortic, as well as microvascular, EC, but not in
fibroblasts, smooth muscle cells, or a series of transformed cell lines
(Fig. 3C).
A multiple tissue Northern blot probed with full-length
HOXA9EC cDNA revealed a major 2.5-kb transcript in
skeletal muscle and a weak signal for a similar transcript in kidney
(Fig. 3D). No such hybridization was detected with a
HOXA9EC exon 1-specific probe (not shown) suggesting that
the HOXA9EC-specific exon may not be expressed in skeletal
muscle and kidney. We then confirmed by RPA that the A9
homeodomain-coding exon, but not the EC exon, was expressed in skeletal
muscle (Fig. 3E). Our failure to detect HOXA9EC
message in vascularized tissues may be due to the low abundance of this
message in EC and the fact that EC comprise only a small fraction of
the cellular content of these tissues.
Rapid Down-regulation of HOXA9EC Transcription by
TNF-
Pretreatment of human umbilical vein EC with cycloheximide did not
block the effect of TNF- HOXA9EC Is Transcribed from an Auto-regulated TNF-
Multiple examples exist of HOX gene autoregulation in systems where
these genes must be continuously expressed to maintain the
differentiated state of a cell (2, 16, 63). We tested whether
HOXA9EC exhibited autoregulation in EC. In cotransfection experiments a 4-fold increase in HOXA9EC promoter activity
was observed in response to overexpression of HOXA9EC (Fig.
6A). This up-regulation of the
HOXA9EC promoter was TNF- The HOX family of transcription factors regulate proliferation and
differentiation in the developing embryo and play a critical role in
the early events of embryonic pattern formation. HOX gene expression is
often developmental stage-specific and tissue-specific, and the
developmental potential of a particular tissue may be governed by the
different types of HOX genes expressed in that tissue (64). It is also
possible that the maintenance of the differentiated state of a cell
type depends on the regulated expression of HOX gene family members.
The dearth of information on HOX gene function in adult and
differentiated tissue is striking when compared with our knowledge of
the role of HOX genes during embryogenesis (2). The possibility that
this gene family may also play a role in defining either the quiescent,
non-activated state or the cytokine-stimulated state of cells has also
received little attention, and this formed the rationale for the
current study.
We have isolated and identified several HOX cDNAs from EC. Results
of extensive screening revealed that out of the four groups of
clustered HOX genes, only two groups, namely the A and B classes, were
present in our cultured EC library. Two novel cDNAs containing the
HOXA9 homeodomain sequence, termed HOXA9NT and
HOXA9EC, differed at the N terminus from the previously
reported alternatively spliced partial cDNAs of Hoxa-9
from guinea pig (53), as well as the HOXA9 cDNA isolated
from a fetal human library (13). The HOXA9NT cDNA
represented a non-translatable transcript arising from the HOXA9 locus. This mRNA may play a post-transcriptional
regulatory role as has been suggested for several HOX gene transcripts
in Xenopus embryos (65) and for one of the transcripts from
the Hoxa-10 locus (17) which has been shown to be incapable
of translation. HOXA9EC on the other hand has an open
reading frame capable of generating a 29-kDa homeodomain-containing
protein, the N-terminal 170 amino acids of which are contributed by a
novel exon. Our studies to date with cultured cells indicate that this
exon is expressed exclusively in cells of endothelial lineage. It
contains an internal splice acceptor site that has previously been
noted in the alternative splicing of both a guinea pig
HOX17A transcript and a reported chimeric mouse transcript
in which Hoxa-10 splices with Hoxa-9 (17). These
results indicate that at least 3 exons are present in the mature
HOX17A and Hoxa-10/Hoxa-9 transcripts. This
internal splice acceptor site is also involved in the t(7;11)(1p5;p15) translocation in acute myeloid leukemia in which the HOXA9
homeodomain is fused in-frame to NUP98 (13). The disruption
of the Hoxa-9 gene in mice has been shown to disturb
hematopoiesis (66) and to lead to vertebral anteriorization in the
lumbar region. The latter phenotype is more dramatic in mice targeted
for both Hoxb-9 and Hoxd-9 (9) suggesting the
possibility of functional redundancy among the Hox9 genes
(9, 67).
Our Northern blot analysis demonstrated that HOXA9EC existed
as a single transcript of 2.1 kb in EC. Exon mapping of genomic clones,
as well as primer extension experiments, indicated that the complete
open reading frame and 5'-UTR of HOXA9EC were contained within 2 exons separated by a 990-bp intron. This finding raised the
possibility of an alternative promoter that directed transcription of
the HOXA9EC gene in EC. A number of HOX genes are
transcribed from alternative promoters resulting in transcripts
differing in size, stability, and tissue distribution (23-26). The
duplication and reduplication of HOX genes on separate chromosomes and
subsequent provision of their individual regulatory elements ensures a
diversity of expression unique to homologous genes of the HOX complex.
We have shown that a novel promoter for HOXA9EC is contained
in the genomic sequence immediately upstream of the transcription
initiation site. This promoter may provide the cis-acting, control
elements that ensure the proper timing, level, and tissue specificity
of HOXA9EC gene expression.
Activation of the endothelium is a differentiation-like process,
believed to be critical in the initiation of a variety of inflammatory
processes in the vessel wall and in adjacent tissue (1, 59). The
activation process includes the induction of leukocyte adhesion
molecules on the EC surface leading to hyperadhesivity between
leukocytes and the endothelium, changes in the expression of growth
regulatory and vasoreactive molecules, and a shifting from an
anti-coagulant to a procoagulant phenotype. There is a growing
literature demonstrating the involvement of multiple transcription factors in cytokine-mediated induction of activation-related genes. Potential players include the Rel family member NF- Our studies suggest two distinct hypotheses for the role of
HOXA9EC in EC gene expression. Since this novel gene within
the HOXA9 locus is transcriptionally suppressed by the
inflammatory cytokine TNF-
due to an apparent reduction in transcriptional rate. Reporter construct studies showed that the 400 base pairs of genomic DNA directly 5' to the transcription initiation site of
HOXA9EC contained the information required for both
up-regulation in response to cotransfection with a HOXA9EC
expression vector and tumor necrosis factor-
-dependent
down-regulation of this gene. These results provide evidence of a novel
HOX family member that may participate in either the suppression or the
genesis of EC activation.
![]()
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
or interleukin-1
, exhibit morphological changes and synthesize new proteins not present in resting endothelium (1). The signaling pathways leading to the expression of specific genes
involved in the promotion or suppression of EC activation have not yet
been defined. Promoter analysis of many EC genes that are induced in
response to immune or inflammatory reactions show that ubiquitous
transcription factors, such as NF-
B, ATF-2/c-Jun, and HMG-I(Y), are
necessary, but not sufficient, to account for EC-specific gene
expression (36-41). There is increasing evidence that homeodomain
proteins provide control of tissue-specific gene expression by
heterodimerizing with other transcription factors (42-47).
![]()
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
gtll (a gift from Vishva M. Dixit, Genentech,
San Francisco) was screened using a 128-fold degenerate oligonucleotide
probe directed toward the highly conserved third helix of the
homeodomain and containing two inosine residues. The probe had the
following sequence: (where I indicates inosine)
5'-C(G/T)IC(G/T)(A/G)TT(C/T)TG(A/G)AACCAIA(C/T)(C/T)TT-3' (48). We
screened 500,000 plaque-forming units and purified 80 cDNA clones.
Direct sequencing (Fmol Sequencing, Promega) of the cDNA inserts in
the phage was performed using 32P-end-labeled
oligonucleotide primers specific to the right and left arm of the phage
adjacent to the 5' and 3' boundary of the cDNA insert. To confirm
the presence of a conserved homeodomain, sequencing was performed with
the oligonucleotide primer used to screen the library as well as its
reverse complement. Identity of the cloned cDNAs was established by
homology searches performed against the GeneBankTM
nucleotide data base using the Blast algorithm.
-D-thiogalactoside (1 mM), and the cells were lysed by sonication in
phosphate-buffered saline containing 0.5% Nonidet P-40 (Sigma). The
lysate was incubated with glutathione-Sepharose beads for 6 h at
4 °C. Beads were washed 4 times with 50 volumes of lysis buffer, and
protein was eluted with 10 mM glutathione in 25 mM Tris (pH 7.5). Purity of the protein was determined by Coomassie staining following SDS-polyacrylamide gel electrophoresis.
-32P]ATP and T4 polynucleotide kinase and purified
from unincorporated nucleotides by a spin column method. EMSA was
performed by incubating 50,000 dpm of probe with 50 ng of
GST-HOXA9EC fusion protein in the presence of 10 mM HEPES (pH 7.5), 75 mM KCl, 1 mM
dithiothreitol (DTT), 10 µg/ml poly(dI-dC), 5 µg/ml bovine serum
albumin, and 15% glycerol. The reaction mixture was incubated at
20 °C for 45 min and then subjected to electrophoresis in a
nondenaturing 5% polyacrylamide gel in 0.25× TBE (Tris borate-EDTA)
at 20 °C. The EMSA results were visualized using a PhosphorImager
(Molecular Dynamics).
-actin (50). A genomic
DNA fragment containing the 5'-untranslated region (UTR) and upstream
sequence of HOXA9EC (
416 to +85) was used to synthesize a
cRNA probe to determine the 5' boundary of the
HOXA9EC-specific exon by RNase protection analysis. The size
of the 5'-UTR of HOXA9EC transcript was determined by
reverse transcriptase-dependent primer extension (51)
of human umbilical vein EC poly(A)+ RNA using a
32P-end-labeled antisense oligonucleotide to region 125 to
145 of the HOXA9EC sequence.
416 to +86 region of the
HOXA9EC genomic sequence (Fig. 2A) in pGL3
(Promega) in both the forward and reverse orientations. Lipofectin
(Life Technologies, Inc.)-mediated transfections of cultured cells at
50% confluence were carried out with endotoxin-free DNA for 6 h,
and cells were allowed to recover in serum-containing media for 2-4 h
before TNF-
treatment. Reporter activity was measured in
triplicate and corrected for transfection efficiency by cotransfecting
with pRSV
-galactosidase DNA and measuring the
-galactosidase
activity with a Galactolight Plus detection system (Tropix). For
cotransfection experiments, HOXA9EC genomic DNA (
416 to
+2819) was subcloned in pGEM-T (Promega) and a Hoxa-2 (48)
cDNA was subcloned into the pcDNA3 expression vector (Invitrogen).
![]()
RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References

View larger version (37K):
[in a new window]
Fig. 1.
A, schematic of alternative splicing
used in generating multiple transcripts containing the HOXA9
homeodomain. One splice site (
) is responsible for generating a
common exon containing the homeodomain (black) and the
3'-untranslated region, and an internal splice acceptor site (
)
present in the coding region of HOXA9EC generates three
transcripts containing unique 5' exons: (i),
HOXA9EC (open box); (ii), guinea pig
Hoxa-9A (21) and Hoxa-10/Hoxa-9 chimeric (17)
mRNA (vertical stripes), and (iii) guinea pig
Hoxa-9B (21) and human fetal HOXA9 (13)
(diagonal stripes). B,
SDS-polyacrylamide gel electrophoresis of GST-HOXA9EC fusion
protein. Lanes 1 and 2 contain total protein from
uninduced and isopropylthiogalactoside-induced E. coli
cells, respectively. In lane 3 the arrow shows
GST-HOXA9EC fusion protein purified by glutathione-Sepharose
affinity chromatography. The lane designated M contains
molecular weight standards as indicated. C, the
Abd-B sequence-specific binding of GST-HOXA9EC
fusion protein. Electrophoretic mobility shift assay was performed
using a 32P-end-labeled, double-stranded
Abd-B-binding site consensus sequence oligomer
(GGATCCTGCAATTTTATTAATGACGTC). Lane 1 shows the control
binding reaction. Lanes 2 and 3 show the result
of competition reactions containing a 50-fold molar excess of an
unlabeled mutant (GGATCCTGCAATTTTGCTAATGACGTC) oligomer and the wild
type oligomer, respectively.

View larger version (66K):
[in a new window]
Fig. 2.
A, composite DNA sequence of cDNAs
and genomic clones of HOXA9EC. The sequence in
lowercase from
429 to
1 and 647 to 1563 denote the intervening sequences separating the
HOXA9EC exon 1 from the exons encoding fetal
HOXA9 (13) and the HOXA9 homeodomain-coding exon
(HD), respectively; the triangle marks the
internal splice acceptor site present in HOXA9EC; the
putative TATA box, CAAT box, and polyadenylation sequence are in
bold. The single letter amino acid code is used for the
HOXA9EC protein. The HOXA9 homeodomain is shown
in italics; the polyhistidine tract and the Pro-Tyr
dipeptide are underlined. B, the 5' boundary of
the HOXA9EC exon E1 was determined by RNase protection
analysis of a cRNA probe generated from the HOXA9 genomic
DNA sequence (
420 to 155) and hybridized to 20 µg of total RNA from
human umbilical vein EC. C, identification of the
transcription initiation site of HOXA9EC. Primer extension
was performed on 5 µg of poly(A)+ RNA from human
umbilical vein EC using reverse transcriptase and a
32P-end-labeled oligonucleotide primer complementary to
bases 120-145 (GCTCAGCTCATCCGCGGCGTCGGCGC). The extension products
were separated on a denaturing polyacrylamide gel. D,
localization of the novel HOXA9EC-specific exon. The lambda
EMBL3 clone containing human HOXA9 was sequenced to
determine the location of the HOXA9 homeodomain-containing
exon (HD), the novel exon of HOXA9EC
(E1), and the exon specific to the HOXA9 cDNA
isolated from a human fetal cDNA library (F1, Ref. 13).

View larger version (56K):
[in a new window]
Fig. 3.
A, expression of HOXA9EC
mRNA. Northern blot analysis of poly(A)+ RNA (4 µg)
from cultured human umbilical vein EC revealed a single 2.1-kb
transcript identified by the HOXA9EC cDNA probe.
B, in vivo expression of HOXA9EC.
Total RNA (~5 µg each) from freshly isolated endothelium from human
mesenteric artery (MA), smooth muscle cells from human
mesenteric artery (MASMC), and cultured human umbilical vein
EC (HUVEC) were subjected to RNase protection analysis with
a cRNA probe generated from exon E1 (303-641, Fig. 2A). A
-actin cRNA probe was included as a control. C,
HOXA9EC expression was detected in cultured EC but not cells
of other lineages. RNase protection analysis was performed using total
RNA (10 µg) isolated from various cultured cells hybridized to the
cRNA probe generated from exon E1 of HOXA9EC. A
-actin
cRNA probe was included as a control. D, Northern blot
analysis of HOXA9EC expression. A multi-tissue Northern blot
(CLONTECH) containing poly(A)+ RNA
isolated from human tissue was hybridized to uniformly
32P-labeled HOXA9EC cDNA. E,
HOXA9EC exon E1 was not expressed in skeletal muscle. RNase
protection analysis of total RNA (10 µg) isolated from human skeletal
muscle and probed with either HOXA9EC exon E1-specific cRNA
or homeodomain containing exon (HD)-specific RNA. A
-actin cRNA probe was included as a control.
--
Activation of the endothelium is a differentiation-like
process, believed to be critical in the initiation of a variety of inflammatory processes in the vessel wall (59, 60). To determine whether HOXA9EC expression was involved in the process of EC
activation, we measured the steady state levels of HOXA9EC
mRNA in resting and TNF-
-activated human umbilical vein EC. We
observed a rapid and nearly complete (>8 fold) down-regulation in the
steady state level of HOXA9EC mRNA in response to
TNF-
treatment for 4 h (Fig. 4A). E-selectin as a marker of
EC activation served to verify the efficacy of TNF-
in stimulating
these cells. Similar down-regulation of HOXA9EC mRNA was
observed in EC treated with either interleukin-1
or
lipopolysaccharide but not phorbol 12-myristate 13-acetate (not
shown).

View larger version (30K):
[in a new window]
Fig. 4.
A, TNF-
-dependent
down-regulation of HOXA9EC mRNA. Human umbilical vein EC
were treated with TNF-
(10 ng/ml for 4 h), and total RNA (10 µg) was subjected to RNase protection analysis with a mixture of cRNA
probes for the following genes: E-selectin,
-actin,
HOXA9EC novel exon (E1), and the HOXA9
homeodomain-containing exon (HD). B, the
down-regulation of HOXA9EC mRNA in response to TNF-
is independent of new protein synthesis. Umbilical vein EC were
pretreated for 1 h with cycloheximide (10 µg/ml, lane
1) and then treated with TNF-
(10 ng/ml) for an additional 2 or
4 h (lanes 2 and 3, respectively) in the
continued presence of cycloheximide. Total RNA was isolated from
control and TNF-
-treated EC and subjected to RNase protection
analysis using a cRNA probe for the HOXA9EC exon 1 (E1).
C, TNF-
has no effect on the half-life of
HOXA9EC mRNA. RNase protection analysis was performed to
detect HOXA9EC exon 1 mRNA. Total RNA was isolated at
various time points from human umbilical vein EC treated with either
(i) actinomycin D (5 µg/ml) alone or (ii) TNF-
(10 µg/ml) added
30 min after actinomycin D. The intensities of the protected bands were
compared by PhosphorImager analysis.
(Fig. 4B), indicating that new protein synthesis was not required for TNF-
-dependent
down-regulation of HOXA9EC mRNA. To determine whether
the down-regulation was due to de-stabilization of the existing
HOXA9EC mRNA in human umbilical vein EC or whether it
directly affected transcription of the HOXA9EC gene, we
measured the stability of the mRNA of the gene in the presence and
absence of TNF-
after blocking new transcription with actinomycin D
(Fig. 4C). The apparent half-life of the HOXA9EC
mRNA, approximately 90 min, was the same in actinomycin D-treated
human umbilical vein EC in the presence or absence of TNF-
,
suggesting that the TNF-
-dependent down-regulation
occurred at the level of transcription.
-responsive
Novel Promoter--
Based on primer extension assays the transcription
initiation site of HOXA9EC was localized to the novel EC
exon. This finding together with the transcript size of 2.1 kb
suggested that the EC-specific exon and the HOXA9
homeodomain-coding exon were sufficient to generate the
HOXA9EC transcript and that HOXA9EC may be
transcribed from a novel promoter element immediately upstream of the
EC-specific novel exon. Transient transfections of human umbilical vein
EC, human microvascular EC, bovine aortic EC, as well as HeLa and fibrosarcoma HT-1080 cell lines, with a plasmid containing a genomic DNA fragment (
420 to +16, Fig. 1A) consisting of the
putative HOXA9EC promoter driving a luciferase reporter
yielded 50-fold higher activity than the identical genomic
fragment cloned in the reverse orientation (Fig.
5). TNF-
treatment of the transfected cells resulted in a 40-60% reduction in HOXA9EC promoter
activity only in cells of endothelial origin. No such effect was
observed in either HeLa or HT-1080 cells, which are TNF-
-responsive
cell lines (61, 62). Thus, the EC-specific, TNF-
sensitivity of HOXA9EC transcription was shown to reside within 0.42 kb of
the novel promoter.

View larger version (45K):
[in a new window]
Fig. 5.
HOXA9EC promoter activity is repressed
by TNF-
in EC. HOXA9EC promoter DNA (
420 to +85)
was subcloned into a luciferase reporter vector pGL3 basic (Promega) in
both the forward and reverse orientation. Transient transfections were
carried out in triplicate using 1 µg of reporter plasmid DNA. TNF-
treatment (16 h) was initiated 2-4 h after the transfections in human
microvascular EC (HMVEC), human umbilical vein EC
(HUVEC), bovine aortic EC (BAEC), Hela and
HT-1080 cells. The reporter luciferase activity was normalized by
cotransfecting pRSV
-galactosidase DNA (0.2 µg). The
open and striped bars represent the reporter
activities of the HOXA9EC promoter constructs in reverse and
forward orientations in untreated control EC, respectively. The
solid bar shows the activity of the forward construct in
TNF-
-treated EC.
-sensitive, and it was specific
since neither the vector alone nor the expression of another HOX gene
expressed by EC Hoxa-2 had any effect on HOXA9EC promoter
activity. Under identical conditions, ectopic expression of
HOXA9EC in HeLa cells not only up-regulated promoter
activity but also conferred TNF-
sensitivity to the
HOXA9EC promoter (Fig. 6B).

View larger version (14K):
[in a new window]
Fig. 6.
HOXA9EC coexpression confers TNF-
sensitivity on the HOXA9EC promoter in a cell-independent
manner. Cotransfections were carried out in triplicate in bovine
aortic EC (A, BAEC) and HeLa cells (B) using 1 µg of HOXA9EC/pGL3 reporter DNA, 0.5 µg of vector DNA
either alone or containing either the HOXA9EC or Hoxa-2 DNA
inserts, and 0.2 µg of pRS+V
-galactosidase (control untreated
, TNF-
-treated
).
![]()
DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
B (36, 37, 68), a
cyclic AMP-independent ATF family member ATF2 (39), HMG-I(Y) (38), and
Egr-1 (69). Other unidentified factors specifically expressed in
endothelium may also play a role in this induction. Our results suggest
the possible involvement of HOXA9EC, since the novel
promoter we have identified is sensitive to TNF-
in an EC-specific manner.
, we might speculate that this gene is
constitutively expressed and helps to maintain a quiescent,
non-activated EC state. Autoregulation may help to preserve a
sufficient, steady state level of the short-lived HOXA9EC
transcript. In response to cytokines transcription of this
transcription factor gene is suppressed leading to a rapid and dramatic
reduction of HOXA9EC mRNA, and ultimately protein,
allowing EC to progress to an activated state. An alternative
hypothesis, albeit less simple, is that HOXA9EC acts in a
positive manner on activation genes in coordination with
cytokine-induced, transcription factors but that HOXA9EC mRNA down-regulation represents an "off switch" for
cytokine-induced genes in activated EC. The latter hypothesis would
help to explain the highly, transient nature of transcriptional
up-regulation of many of the cytokine-induced genes in EC. Future
studies will determine if either of these two possible mechanisms of
action of HOXA9EC is correct.
| |
ACKNOWLEDGEMENTS |
|---|
We thank David Schmitt for expert technical assistance; Dr. Vishva Dixit (Genentech, San Francisco, CA) for the gift of the EC library; Carol de la Motte for EC and smooth muscle cells from human mesenteric arteries; Amy Bunting for cell culture assistance; and Drs. Jing You and Jignesh Patel for assistance in the initial phases of identification and cloning of the HOX genes. We also thank Drs. Donna Driscoll and Paul Fox for helpful discussions. Human umbilical vein endothelial cells were provided by the cords collected through the Birthing Services Department at the Cleveland Clinic Foundation and the Perinatal Clinical Research Center (supported by National Institutes of Health GCRC Award RR-00080) at the Cleveland Metrohealth Hospital.
| |
FOOTNOTES |
|---|
* This work was supported by National Institutes of Health Grant HL 34727 (to P. E. D.), by an unrestricted grant for cardiovascular research from Berlex Biosciences, and by a grant (to C. V. P.) from the American Heart Association, Northeast Ohio Affiliate.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF010258 for the human HOXA9 gene.
To whom correspondence should be addressed: Dept. of Cell
Biology-NC10, Cleveland Clinic Lerner Research Institute, 9500 Euclid Ave., Cleveland, OH 44195. Tel.: 216-444-5849; Fax: 216-444-9404; E-mail: dicorlp{at}cesmtp.ccf.org.
The abbreviations used are: EC, endothelial cell; HOX, homeobox; GST, glutathione S-transferase; EMSA, electrophoretic mobility shift assay; UTR, untranslated region; kb, kilobase pair; bp, base pair; TNF, tumor necrosis factor; RPA, RNase protection analysis.
2 J. Q. You and P. E. DiCorleto, unpublished results.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
S. Bandyopadhyay, M. Z. Ashraf, P. Daher, P. H. Howe, and P. E. DiCorleto HOXA9 Participates in the Transcriptional Activation of E-Selectin in Endothelial Cells Mol. Cell. Biol., June 15, 2007; 27(12): 4207 - 4216. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Diehl, L. Rossig, A. M. Zeiher, S. Dimmeler, and C. Urbich The histone methyltransferase MLL is an upstream regulator of endothelial-cell sprout formation Blood, February 15, 2007; 109(4): 1472 - 1478. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Mace, S. L. Hansen, C. Myers, D. M. Young, and N. Boudreau HOXA3 induces cell migration in endothelial and epithelial cells promoting angiogenesis and wound repair J. Cell Sci., June 15, 2005; 118(12): 2567 - 2577. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Bruhl, C. Urbich, D. Aicher, A. Acker-Palmer, A. M. Zeiher, and S. Dimmeler Homeobox A9 Transcriptionally Regulates the EphB4 Receptor to Modulate Endothelial Cell Migration and Tube Formation Circ. Res., April 2, 2004; 94(6): 743 - 751. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Myers, A. Charboneau, I. Cheung, D. Hanks, and N. Boudreau Sustained Expression of Homeobox D10 Inhibits Angiogenesis Am. J. Pathol., December 1, 2002; 161(6): 2099 - 2109. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. H. Gorski and K. Walsh The Role of Homeobox Genes in Vascular Remodeling and Angiogenesis Circ. Res., November 10, 2000; 87(10): 865 - 872. [Abstract] [Full Text] |
||||
![]() |
C. Myers, A. Charboneau, and N. Boudreau Homeobox B3 Promotes Capillary Morphogenesis and Angiogenesis J. Cell Biol., January 24, 2000; 148(2): 343 - 352. [Abstract] [Full Text] [PDF] |
||||
![]() |
F McLaughlin, V. Ludbrook, I Kola, C. Campbell, and A. Randi Characterisation of the tumour necrosis factor (TNF)-(alpha) response elements in the human ICAM-2 promoter J. Cell Sci., January 12, 1999; 112(24): 4695 - 4703. [Abstract] [PDF] |
||||
| ||||||