![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 3, 1472-1478, January 15, 1999
,
From the Department of Pharmacology, The University of Michigan Medical School, Ann Arbor, Michigan 48109
| |
ABSTRACT |
|---|
|
|
|---|
It is established that the multiprotein heat
shock protein 90 (hsp90)-based chaperone system acts on the ligand
binding domain of the glucocorticoid receptor (GR) to form a GR·hsp90
heterocomplex and to convert the receptor ligand binding domain to the
steroid-binding state. Treatment of cells with the hsp90 inhibitor
geldanamycin inactivates steroid binding activity and increases the
rate of GR turnover. We show here that a portion of neuronal
nitric-oxide synthase (nNOS) exists as a molybdate-stabilized
nNOS·hsp90 heterocomplex in the cytosolic fraction of human embryonic
kidney 293 cells stably transfected with rat nNOS. Treatment of human
embryonic kidney 293 cells with geldanamycin both decreases nNOS
catalytic activity and increases the rate of nNOS turnover. Similarly,
geldanamycin treatment of nNOS-expressing Sf9 cells partially
inhibits nNOS activation by exogenous heme. Like the GR, purified
heme-free apo-nNOS is activated by the DE52-retained fraction of rabbit reticulocyte lysate, which also assembles nNOS·hsp90 heterocomplexes. However, in contrast to the GR, heterocomplex assembly with hsp90 is
not required for increased heme binding and nNOS activation in this
cell-free system. We propose that, in vivo, where access by
free heme is limited, the complete hsp90-based chaperone machinery is
required for sustained opening of the heme binding cleft and nNOS
activation, but in the heme-containing cell-free nNOS-activating system
transient opening of the heme binding cleft without hsp90 is sufficient
to facilitate heme binding.
Several transcription factors and protein kinases involved in
signal transduction are recovered from cells in association with the
ubiquitous heat shock protein
hsp901 (for review, see Refs.
1 and 2). These heterocomplexes with hsp90 are formed by a
multicomponent chaperone machinery consisting of hsp90, hsp70, Hop,
hsp40, p23, and probably also the hsp70-interacting protein Hip and the
GrpE-like protein BAG-1 (for review, see Ref. 3 and references
therein). As first shown for the glucocorticoid receptor (GR) (4) and
then for some other steroid receptors and the dioxin (Ah)
receptor, association of the ligand binding domain (LBD) with hsp90 is
required for the high affinity ligand binding conformation (1, 2).
Complexing of the GR with hsp90 also opens up both thiol moieties (5) and trypsin cleavage sites (6, 7) in the LBD to attack by a
thiol-derivatizing agent and the protease. These direct data, coupled
with recent genetic observations (8), support the notion (9, 10) that
the hsp90-based chaperone machinery directs an
ATP-dependent partial unfolding of the receptor LBD, thus
making the hydrophobic steroid-binding pocket accessible to steroid.
The problem of providing access of ligands to hydrophobic binding sites
situated in the interior of properly folded proteins is not unique to
steroid and dioxin receptors. To test whether the hsp90-based chaperone
machinery may play a more general role in opening up hydrophobic
binding clefts, we have asked whether this system facilitates the entry
of heme into its binding site in the interior of neuronal nitric-oxide
synthase (nNOS). The nitric-oxide synthases are cytochrome P450-type
hemoproteins that catalyze the formation of nitric oxide (NO) and
citrulline from L-arginine, O2, and NADPH (11,
12). NOS is active as a homodimer (13, 14), with each monomer binding
tightly 1 eq each of FAD, FMN, tetrahydrobiopterin, and heme (13,
15-17). The prosthetic heme is the site of oxygen activation, which is
required for the metabolism of L-arginine (15). The
heme-deficient monomer of NOS can be partially reconstituted in
vitro in the presence of heme, tetrahydrobiopterin, and arginine
to form the functional homodimer (18, 19). This is unlike the
microsomal P450 cytochromes, which have not been successfully
reconstituted with heme in vitro. We present here evidence
that the activity of nNOS is regulated by the hsp90-based chaperone
system and that hsp90 may facilitate heme binding in vivo.
Since covalent alterations of the prosthetic heme and inactivation of
P450 cytochromes are caused by drugs and xenobiotics as well as
endogenous compounds (20, 21), reconstitution of NOS activity by heme
may be an important process in regulation of the active enzyme.
In the course of our studies, Garcia-Cardeña et al.
(22) published that the endothelial isoform of NOS (eNOS) is activated by hsp90, and they were able to demonstrate direct activation of
purified eNOS catalytic activity by purified hsp90 in the absence of
added heme and other cofactors and without the co-chaperones of the
hsp90-based chaperone machinery. On the basis of these in
vitro results, they suggested that hsp90 may act as an allosteric modulator of eNOS. Although Garcia-Gardeña et al. (22)
found that hsp90 was not co-immunoprecipitated with nNOS from lysates of cerebellum, we show here that a portion of nNOS in HEK 293 cytosol
is recovered as a native nNOS·hsp90 heterocomplex and that nNOS
activity is reduced by the hsp90 inhibitor geldanamycin. As with the
GR, the DE52-retained fraction of reticulocyte lysate can assemble
heterocomplexes between hsp90 and purified apo-nNOS. This cell-free
system also activates apo-nNOS to the specific activity of holo-nNOS,
and activation is accompanied by increased heme association with the
enzyme. However, in contrast to activation of GR steroid binding
activity, activation of apo-nNOS heme binding activity in this
cell-free system does not require heterocomplex assembly with hsp90. We
speculate that the hsp90-based chaperone machinery activates nNOS
in vivo by facilitating heme entry into its binding site in
the enzyme interior. However, in the cell-free system where abundant
heme is readily available, transient opening of the heme binding cleft
by components of a reticulocyte protein folding/unfolding system may be
sufficient for promoting heme entry and nNOS activation without a
requirement for hsp90.
Materials
Untreated rabbit reticulocyte lysate was from Green Hectares
(Oregon, WI). 125I-Conjugated goat anti-mouse and
anti-rabbit IgGs were from NEN Life Science Products. The AC88
monoclonal IgG against hsp90 was from StressGen Biotechnologies
(Victoria, British Columbia, Canada), and rabbit antiserum (23) that
reacts with both hsp90 and hsp70 was kindly provided by Dr. Ettore
Appella (National Cancer Institute). The affinity purified rabbit IgG
against brain NOS used for immunoblotting nNOS was from Transduction
Laboratories (Lexington, KY). The BuGR2 monoclonal IgG antibody against
the GR was from Affinity Bioreagents (Neshanic Station, NJ). The rabbit
antiserum used to immunoprecipitate nNOS was raised against rat
neuronal NOS and was the generous gift of Dr. Lance Pohl (NHLBI,
Bethesda). The antibody was affinity purified prior to use. The
cDNA for rat neuronal NOS was kindly provided by Dr. Solomon Snyder
(Johns Hopkins Medical School, Baltimore).
Methods
Cell Culture and Cytosol Preparation--
Human embryonic kidney
(HEK) 293 cells stably transfected with rat neuronal NOS by Bredt
et al. (24) were obtained from Dr. Bettie Sue Masters
(University of Texas Health Science Center, San Antonio). HEK 293 cells
were cultured in Dulbecco's modified Eagle's medium supplemented with
calf serum and G418 (0.5 mg/ml) as described previously (25), except
that the L-arginine concentration was 100 µM.
HEK cells were harvested, washed with PBS, and homogenized with a
Tenbroeck ground glass homogenizer in 1 ml (per 108 cells)
of HE buffer (10 mM Hepes, pH 7.4, 1 mM EDTA)
with 20 mM sodium molybdate, 10 µg/ml trypsin inhibitor,
100 µM leupeptin, 0.5 µM pepstatin A, 2 µg/ml aprotinin, and 3 mM phenylmethylsulfonyl fluoride.
Homogenates were centrifuged for 10 min at 16,000 × g,
with the supernatant being the cytosol fraction. L cell cytosol for
immunoadsorption of GR was prepared as described previously (4).
Expression of nNOS in Sf9 Cells--
The nNOS cDNA
derived from pBluescript plasmid was subcloned into the
EcoRI and NotI sites of the transfer vector
PVL1393 as follows. The non-coding region from NotI
(position 4699) to NotI site on pBluescript was excised, and
the remaining cDNA was religated to remove the 3' EcoRI
site. Primers were synthesized (ACTGAATTCACCATGGAAGAGAACACGTTTGG and
GCTTTTCATCGTGGGGTCAATGG) to generate a polymerase chain reaction
product corresponding to position 346-906 as well as introducing an
EcoRI site. The sequence of the polymerase chain reaction
product was confirmed by the dideoxy chain termination method. The
polymerase chain reaction product was subcloned into the
EcoRI to BclI sites. The resulting clone was
directionally cloned into PVL1393. Recombinant baculovirus was cloned
by standard under-agarose plaque assays (26).
Sf9 cells were grown in SFM 900 II serum-free medium (Life
Technologies, Inc.) supplemented with Cytomax (Kemp Biotechnology, Rockville, MD) in suspension cultures maintained at 27 °C with continuous shaking (150 rpm). Cultures were infected in log phase of
growth with recombinant baculovirus at a multiplicity of infection of
1.0. In some cases, after 48 h, heme (24 µM) was
added as an albumin conjugate, prepared as described previously (27).
Cells were harvested and suspended in 1 volume of 10 mM
Hepes, pH 7.5, containing 320 mM sucrose, 100 µM EDTA, 0.1 mM dithiothreitol, 10 µg/ml
trypsin inhibitor, 100 µM leupeptin, 0.5 µM
pepstatin A, 2 µg/ml aprotinin, 3 mM
phenylmethanesulfonyl fluoride, and 10 µM
tetrahydrobiopterin, and the suspended cells were ruptured by Dounce homogenization.
Immunoadsorption and Western Blotting--
Native nNOS·hsp90
heterocomplexes were immunoadsorbed from 300 µl of HEK 293 cytosol
for 2 h at 4 °C with 15 µl of anti-nNOS IgG and subsequently
incubated with 8-µl pellets of protein A-Sepharose. Immune pellets
were washed three times with 1 ml of ice-cold TEG buffer (10 mM TES, pH 7.6, 50 mM NaCl, 4 mM
EDTA, 10% glycerol) containing both 20 mM sodium molybdate
(TEGM) and 0.4% Triton X-100. In Fig. 1A, some of the
samples were washed with radioimmune precipitation assay (RIPA) buffer
(50 mM Tris, pH 8.0, 150 mM NaCl, 1% Nonidet
P-40, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate). Immune
pellets were boiled in SDS sample buffer with 10% Purification of nNOS--
Lysates from infected Sf9 cells
(2 × 109) were centrifuged at 100,000 × g for 1 h. The supernatant fraction was loaded onto a
2',5'-ADP-Sepharose column (2 ml), and the nNOS was affinity purified
as described (28), except that 10 mM 2'-AMP in high salt
buffer was used to elute the protein. The nNOS-containing fraction was
concentrated and dialyzed against 50 mM Tris-HCl, pH 7.4, containing 100 mM NaCl, 10% glycerol, 0.1 mM
EDTA, 0.1 mM dithiothreitol, and 100 µM
tetrahydrobiopterin with the use of a ProDicon and a 100-kDa cut-off
membrane. The concentrated sample was stored at Assay of nNOS Activity--
nNOS activity was assayed by the
following three methods: 1) conversion of oxyhemoglobin to
methemoglobin; 2) assay of nitrate and nitrite released into the cell
growth medium; and 3) conversion of [14C]arginine to
citrulline. Conversion of oxyhemoglobin was assayed by adding 20 µl
of insect cell lysate to an assay solution containing 100 µM CaCl2, 100 µM NADPH, 100 µM arginine, 100 µM tetrahydrobiopterin, 100 unit/ml catalase, 10 µg/ml calmodulin, and 25 µM
oxyhemoglobin in a total volume of 200 µl of 50 mM
potassium phosphate, pH 7.4. The mixture was incubated at 25 °C, and
the rate of oxidation of oxyhemoglobin was monitored by measuring the
absorbance at DE52 Chromatography of Reticulocyte Lysate--
Rabbit
reticulocyte lysate (25 ml) was adsorbed to a 2.5 × 20-cm column
of DE52 equilibrated with HE buffer (10 mM Hepes, 1 mM EDTA, pH 7.35); the column was washed with 150 ml of HE
buffer with 20 mM sodium molybdate followed by 150 ml of HE
buffer alone, and proteins were eluted with a 400-ml gradient of 0-0.5
M KCl. Proteins in the drop-through and wash or in
DE52-retained material eluted with salt were concentrated and dialyzed
against HKD buffer (10 mM Hepes, 100 mM KCl, 5 mM dithiothreitol, pH 7.35). hsp90, hsp70, Hop, and p23
were detected in the DE52-retained material by resolving an aliquot of
each fraction by SDS-PAGE and Western blotting with appropriate
antibodies, and fractions were combined in three pools designated A-C
as described by Dittmar et al. (32). Pooled fractions were
dialyzed against HKD buffer, concentrated to 1 ml (1/25 the original
volume of lysate), and flash-frozen in small aliquots.
Purification of hsp70 and hsp90--
hsp70 was purified from the
DE52 fraction pool A of rabbit reticulocyte lysate by chromatography on
ATP-agarose and elution with ATP followed by ammonium sulfate
precipitation exactly as described previously (33). hsp90 was purified
from the DE52 fraction B of rabbit reticulocyte lysate by
chromatography on hydroxylapatite followed by chromatography over
ATP-agarose as described previously (33).
Glucocorticoid Receptor Heterocomplex
Reconstitution--
Glucocorticoid receptors were immunoadsorbed from
250 to 300-µl aliquots of L cell cytosol by rotation for 2 h at
4 °C with 8 µl of protein A-Sepharose prebound with BuGR antibody.
Prior to incubation with reticulocyte lysate, immunoadsorbed receptors were stripped of associated hsp90 by incubating the immunopellet an
additional 2 h at 4 °C with 0.5 M NaCl followed by
one wash with 1 ml of TEG and a second wash with 1 ml of Hepes buffer
(10 mM Hepes, pH 7.4). BuGR immune pellets (8 µl of
protein A-Sepharose) containing GR stripped of hsp90 were incubated
with 50 µl of rabbit reticulocyte lysate, with the DE52 drop-through
and wash material, with the DE52-retained proteins of reticulocyte
lysate, or with fractions A-C of the retained proteins (each at 10 µl) and adjusted to 50 µl with HKD buffer. Dithiothreitol (1 µl)
was added to each incubation to a final concentration of 5 mM, and 5 µl of an ATP-regenerating system (50 mM ATP, 250 mM creatine phosphate, 20 mM MgOAc, and 100 units/ml creatine phosphokinase) were
added to all assays to yield a final assay volume of 56 µl. The assay
mixtures were incubated for 20 min at 30 °C with resuspension of the
pellets by shaking the tubes every 5 min. At the end of the incubation, one-fourth of the suspension was removed for assay of steroid binding,
and the remainder was used for Western blotting of receptor and
associated hsp90 as described previously (32). Steroid binding is
expressed as the counts/min of [3H]triamcinolone
acetonide bound per GR immune pellet prepared from 100 µl of L cell cytosol.
Cell-free Activation of Apo-nNOS--
Apo-nNOS (5.6 µg)
purified from Sf9 cells incubated in heme-free medium was
incubated for 1.5 h at 20 °C with 2.5 µl of the ATP-regenerating system, 3.5 µl of a cofactor mixture (100 µM FAD, 100 µM FMN, 1 mM
L-arginine, 100 µM tetrahydrobiopterin, 200 units/ml superoxide dismutase, 2000 units/ml catalase), and other
additions as noted in the figure legends adjusted to a total incubation
volume of 35 µl with HKD buffer. At the end of the incubation, nNOS
activity was assayed by conversion of [14C]arginine to
citrulline. It should be noted that the apo-nNOS contained minor
amounts of holoprotein, which is produced during recombinant expression
of nNOS in insect cells due to endogenous heme synthesis.
Heme Assay--
The amount of heme was determined by high
pressure liquid chromatography as described previously (34). Samples
were injected onto a high pressure liquid chromatography column (C4
Vydac, 5 µm, 0.21 × 15 cm) equilibrated with solvent A (0.1%
trifluoroacetic acid) at a flow rate of 0.3 ml/min. A gradient was run
to 75% solvent B (0.1% trifluoroacetic acid in acetonitrile) over 30 min and then to 100% solvent B over the next 5 min. Absorbance at 400 nm was monitored. Myoglobin (horse heart) was used as a standard.
The ferrous-carbonyl complex was determined from the CO difference
spectrum of the reduced protein with the use of an extinction coefficient of 91 mM Neuronal NOS Exists in Native Heterocomplexes with hsp90--
To
detect native nNOS·hsp90 heterocomplexes, cytosol from HEK 293 cells
expressing rat nNOS was immunoadsorbed with nNOS-specific rabbit
antiserum, and both the nNOS and the co-immunoadsorbed hsp90 in the
washed immune pellet were detected by Western blotting. As shown in
Fig. 1A, nNOS immunopellets
washed with buffer containing 20 mM molybdate and either
0.1% (lane 2) or 0.4% (lane 4) Triton X-100
contained hsp90. But hsp90 was dissociated from nNOS in pellets washed
under harsher detergent conditions with RIPA buffer (lane
6), despite the presence of molybdate as a heterocomplex stabilizing agent. Garcia-Cardeña et al. (22) lysed
cerebella in buffer under harsh detergent conditions (1% Triton X-100,
1% sodium deoxycholate, 0.1% SDS), and it is not surprising that nNOS·hsp90 heterocomplexes were not detected, despite the presence of
1 mM vanadate as a stabilizing agent in their lysis buffer. The native rat nNOS·human hsp90 heterocomplexes immunoadsorbed from
HEK 293 cytosol behaved like steroid receptor·hsp90 heterocomplexes (1) in that they dissociated when the immune pellets were suspended in
buffer and incubated at 25 °C (cf. lane 6 with
lane 2 in Fig. 1B), and this thermal dissociation
was inhibited by molybdate (lane 4).
Effect of Geldanamycin Treatment on HEK Cell
nNOS--
Geldanamycin is a benzoquinonone ansamycin antibiotic that
binds to the nucleotide-binding site of hsp90 and specifically blocks
hsp90 function (36-39). In geldanamycin-treated cells, proteins that
are regulated by hsp90 are degraded more rapidly by a
ubiquitin-dependent proteosomal mechanism (for review, see
Ref. 2). In Fig. 2A, HEK 293 cells were treated with 10 µM geldanamycin, and the
amount of nNOS protein decreased ~50% in 24 h. Consistent with
a geldanamycin-dependent increase in the rate of nNOS
turnover, a similar decrease in nNOS occurred when translation of new
enzyme was blocked with cycloheximide (Fig. 2A). The effect
of geldanamycin is concentration-dependent, with a
substantial decrease in nNOS protein being observed at 1 µM antibiotic (Fig. 2B).
Fig. 3 shows the effect of a 6-h
treatment with 10 µM geldanamycin on HEK 293 cell nNOS
activity. In that 24 h of treatment with geldanamycin are required
to decrease nNOS protein levels by 50% (Fig. 2), the 80% decrease in
nNOS activity observed after 6 h of treatment with geldanamycin
(Fig. 3) cannot be accounted for by increased nNOS degradation. As also
shown in Fig. 3, treatment with the calcium ionophore A23187 increases
nNOS activity and co-treatment with geldanamycin inhibits the enzyme
activity. Both the geldanamycin-mediated reduction in nNOS activity and
the increase in rate of nNOS turnover support the proposal that hsp90
regulates nNOS function in intact HEK 293 cells.
Effect of Geldanamycin on Heme Stimulation of nNOS Activity in
Sf9 Cells--
Sf9 cells have very low levels of
endogenous heme, and addition of exogenous heme to the culture medium
causes an increase in nNOS activity in infected cells. In the
experiments shown in Fig. 4, Sf9
cells expressing rat nNOS were incubated in the presence of heme, and
cells were harvested at various times for assay of nNOS activity by
conversion of oxyhemoglobin to methemoglobin. Addition of heme
(closed circles) increases nNOS activity 7-fold with respect
to the activity in the absence of exogenous heme (open
squares). This heme-dependent increase in nNOS
activity is inhibited ~30% by geldanamycin (open circles
and bars in inset).
Fractionation of the nNOS Activating Activity in Reticulocyte
Lysate--
Reticulocyte lysate contains all of the components
required to assemble heterocomplexes between hsp90 and steroid
receptors or protein kinases (for review, see Refs. 1 and 2). As shown in Fig. 5A, incubation of
immunoadsorbed, hsp90-free, mouse GR with rabbit reticulocyte lysate
results in assembly of a GR·hsp90 heterocomplex (Western
blot) and generation of steroid binding activity (bar
graph). When the components of reticulocyte lysate are separated
into drop-through and retained fractions by passage through DE52, the
GR·hsp90 assembly activity is present in the DE52-retained fraction
(Fig. 5A).
In the cell-free GR·hsp90 heterocomplex assembly system, the receptor
is immobilized by immunoadsorption to protein A-Sepharose beads prior
to incubation with reticulocyte lysate. We attempted to mimic this
system by immobilizing nNOS by adsorption to ADP-agarose beads and then
incubating with reticulocyte lysate, but this was not successful, and
we found it necessary to incubate purified apo-nNOS in solution with
the activating system of reticulocyte lysate. A second major difference
in cell-free conditions of steroid receptor and nNOS activation is that
the apo-nNOS is somewhat unstable at higher temperatures (40), and we
incubate it with reticulocyte-activating system at room temperature
rather than at 30 °C.
Cell-free reactivation of apo-nNOS is shown in Fig. 5B. nNOS
was purified from Sf9 cells grown in the presence or absence of
heme to yield the heme-containing holo-nNOS and heme-depleted apo-nNOS
standards shown at the left of Fig. 5B. When the
apo-nNOS is incubated at 20 °C in reactivation mix but without
lysate, the level of enzyme activity decreases by about half, as
indicated by the apo-nNOS control (Apo Ctl). Incubation with
1.2 µM heme (HM) yields a somewhat higher
activity as does incubation in the presence of reticulocyte lysate
(RL). But unfractionated reticulocyte lysate does not
activate nNOS activity like it activates the steroid binding activity
of the GR shown in Fig. 5A. Reticulocyte lysate has an
extremely high concentration of heme, and high concentrations of heme
are toxic to nNOS. The vast majority of the heme is present in the DE52
drop-through fraction (DT) of lysate, which does not activate apo-nNOS. However, the DE52-retained fraction (RET)
of lysate activates the apo-nNOS to the level of holo-nNOS
(cf. RET with Holo Std in Fig.
5B). This DE52-retained fraction does not have nNOS activity
or contain nNOS by immunoblotting, but it contains 33 µM
total (bound and free) heme. It is important to note that geldanamycin
did not inhibit reactivation by the DE52 retentate, suggesting that
hsp90 is not required for activation of nNOS by this cell-free system.
Fractionation of the Activity in the DE52 Retentate--
The
DE52-retained portion of lysate eluted with salt was divided into three
subfractions (A-C) containing different components of the hsp90-based
chaperone machinery as described by Dittmar et al. (32). The
fractions eluting in the first half of the salt gradient were combined
to form subfraction A, which contains most of the hsp70, the majority
of hsp40, and all of the Hop, Hip, and BAG-1, fractions eluting at
higher salt were combined to form subfraction B, which contains hsp90,
and fractions eluting at highest salt form subfraction C which contains
p23 (3, 32). After contraction and dialysis, these three pooled
subfractions were used to activate GR steroid binding activity and nNOS
enzymatic activity. As we have reported previously (32) and as shown in Fig. 6A, all three
subfractions of reticulocyte lysate are required for activation of GR
steroid binding activity.
In the in vitro activation experiment of Fig. 5B,
nNOS was reactivated under conditions where heme was present. In
contrast, in the experiments of Figs. 5A and 6A,
the GR was first assembled into a stable GR·hsp90 heterocomplex and
subsequently incubated with steroid. In Fig. 6B, the GR was
reactivated in the presence of ligand in the same manner as for
apo-nNOS activation. When the GR is incubated with subfraction A in the
presence of steroid, which binds to steroid-binding sites immediately
as they are opened up, no steroid binding is generated unless purified
hsp90 is also present (Fig. 6B). It should be noted that
GR·hsp90 heterocomplexes are highly unstable in the absence of the
stabilizing protein p23 (in subfraction C) or molybdate; thus, steroid
must be present during heterocomplex assembly to detect conversion of
the receptor to the steroid binding state (41). The activation of GR
steroid binding activity by the combination of hsp90 and subfraction A is inhibited by geldanamycin (Fig. 6B). It is important to
note that hsp90 alone is inactive in the absence of the co-chaperones in subfraction A (Fig. 6B).
In contrast to the inability of the hsp90-free subfraction A to
activate GR steroid binding activity, this fraction is fully active at
activating nNOS, and subfractions B and C produce no activation beyond
that obtained with heme alone (Fig.
7A). Addition of purified
hsp90 to subfraction A does not increase nNOS activation beyond the
effect achieved with A alone, nor does either purified hsp90 or hsp70
alone activate nNOS, nor does hsp90 or hsp70 increase the activation
produced by addition of free heme (data not shown). Thus, in
vitro activation of GR steroid binding activity is strictly hsp90-dependent (Fig. 6B), whereas activation of
nNOS does not require hsp90 (Fig. 7A), and neither protein
is activated by hsp90 alone.
Subfraction A contains about 100 µM heme, whereas B and C
contain ~2 µM heme. However, the presence of a high
concentration of heme in subfraction A cannot account for the nNOS
activating activity of subfraction A. The activation of 1 µM purified apo-nNOS by free heme is maximum at 1-1.5
µM heme, and at higher concentrations free heme becomes
inhibitory (Fig. 7B). Essentially all of the heme in the
DE52-retained fraction of reticulocyte lysate and subfractions A-C is
bound to DE52-retained proteins, and we do not know the concentrations
of free heme when these fractions are incubated with purified apo-nNOS.
The major hemoprotein found in the retained fraction is hemoglobin,
which is known to be able to release its heme prosthetic group and
reconstitute apomyoglobin (42). Thus, it is likely that
hemoglobin-bound heme and not free heme is the source of the heme
during reconstitution. It is clear that cell-free activation of
apo-nNOS is accompanied by an increase in enzyme-associated heme. We
have assayed the nNOS-bound heme by its absorbance in the
ferrous-carbonyl complex. The purified apo-nNOS preparation contained
approximately one-fifth the amount of heme per mol of monomer as the
purified holo-nNOS preparation, and after activation by the
DE52-retained fraction of lysate, the apo-nNOS contained the same
amount of heme as the holo-nNOS. The 5-fold increase in nNOS-associated
heme is consistent with the ~5-fold increase in enzyme activity
obtained under our cell-free activation conditions (Figs. 5B
and 7A).
Despite the fact that nNOS activation in vitro does not
require hsp90, the DE52-retained fraction of lysate, which was shown to
activate nNOS in Figs. 5B and 7A, forms
nNOS·hsp90 heterocomplexes (Fig. 7C, lane 4). In Fig.
7C, hsp90 was immunoblotted with the AC88 monoclonal IgG,
which recognizes the rabbit hsp90 assembled into a heterocomplex with
the rat nNOS by the chaperone machinery of reticulocyte lysate but does
not recognize insect hsp90 from the Sf9 cells that produced the
nNOS (43). As shown in Fig. 7D, the apo-nNOS preparation
contains a significant amount of insect (Sf9-derived) hsp70 and
a trace amount of insect hsp90, both of which were detected by
immunoblotting with an antiserum that recognizes both of the insect
hsps (43). Immunoadsorption of the purified apo-nNOS preparation is
accompanied by co-immunoadsorption of the Sf9 hsp70 (data not
shown); thus, a portion of the purified apo-enzyme is bound by this
component of the chaperone system.
It is clear from Fig. 1 that nNOS in HEK 293 cells is associated
with hsp90, as was reported recently for eNOS (22). In contrast to
hormone-free steroid receptors, which are present in
molybdate-stabilized cytosols entirely as stable 9 S receptor·hsp90 heterocomplexes, we estimate that only 5-10% of the nNOS in HEK 293 cytosol is bound to hsp90. This suggests that the association of nNOS
with hsp90 may be much more dynamic than that of steroid receptors. The
binding of steroid to the receptor·hsp90 heterocomplex causes the
complex to dissociate (1), and a similar dissociation might occur when
heme binds to nNOS in HEK 293 cells. This could also explain the
relatively low level of nNOS·hsp90 heterocomplexes obtained in the
heme-containing cell-free system from reticulocyte lysate (Fig.
7C). Despite the low fraction of nNOS that is bound to hsp90
at any particular time, treatment of HEK 293 cells with the hsp90
inhibitor geldanamycin over a period of several hours substantially
increases the rate of nNOS turnover (Fig. 2) and decreases nNOS
activity (Fig. 3), implying that hsp90 is important for both nNOS
stability and function in the intact cell.
Geldanamycin was first reported by Joly et al. (44) to
inhibit inducible NOS activity in rat smooth muscle and murine brain endothelial cells. These authors were unaware that geldanamycin, which
was thought for many years to be a protein kinase inhibitor, had been
shown by Whitesell et al. (36) to interact with hsp90 rather
than with the hsp90-bound protein kinases themselves. Thus, Joly
et al. (44) suggested that geldanamycin inhibited a protein kinase required for inducible NOS induction. Garcia-Cardena et al. (22) then showed that geldanamycin inhibited eNOS activity in
cultured human endothelial cells. Because they found that purified hsp90 bound directly to purified eNOS and facilitated eNOS-mediated catalysis in vitro, they speculated that hsp90 may act in
cells as an allosteric modulator of eNOS by inducing a conformational change in the enzyme or by stabilizing the dimeric form. Although we
find that geldanamycin treatment of intact HEK 293 cells results in
profound inhibition of nNOS activity, we find no effect of purified
hsp90 on the activity of purified nNOS, and we suggest an alternative
mechanism may explain the hsp90 effect on nNOS activity in HEK 293 cells.
Because a major action of the hsp90-based chaperone machinery on the GR
is to open the steroid binding cleft sufficiently to create a high
affinity steroid-binding site, we speculated that it might act in a
similar manner to open the heme binding cleft in nNOS to facilitate
heme entry. Thus, we asked if geldanamycin would block the heme-induced
increase in nNOS activity in Sf9 cells. Although geldanamycin
inhibited about 30% of the heme-induced increase (Fig. 4), which
occurs within an hour in Sf9 cells, the effect of geldanamycin
over several hours in HEK 293 cells was much greater (Fig. 3). When we
then utilized the DE52-retained fraction of reticulocyte lysate to
activate purified apo-nNOS in vitro, there was no inhibition
by geldanamycin (Fig. 5B). A reasonable explanation of the
progressive loss in geldanamycin sensitivity as we proceed from the HEK
cell to apo-nNOS activation in vitro may relate to the
levels of free heme that are available to the enzyme in the different
environments. For example, apo-nNOS activation in vitro is
occurring in the presence of heme that can enter a heme binding cleft
as soon as it is opened. Thus, even transient opening of the heme
binding cleft by components of a reticulocyte protein folding/unfolding
machinery that segregate with subfraction A (e.g. hsp70,
hsp40, Hop, Hip, and BAG-1) may be sufficient when a significant
concentration of free heme is present. In intact HEK 293 cells,
however, very little free heme is available to the enzyme, and a longer
term of cleft opening that is produced by the entire hsp90-based
chaperone system is required to facilitate heme entry. Heme activation
of apo-nNOS in Sf9 cells may reflect an intermediate situation.
Here, there is a gradient of free heme from the outside to the inside
of the cell, with sufficient free heme in the nNOS environment to
permit activation of a significant portion of the enzyme via transient opening of the heme binding cleft. Inasmuch as the hsp90 component of
the machinery is not required to ensure a longer term opening of the
heme-binding site, the inhibition of apo-nNOS activation produced by
geldanamycin in the heme-treated Sf9 cells is less than the
geldanamycin inhibition of nNOS activity in HEK 293 cells.
The reactivation of apo-nNOS achieved under cell-free conditions in
this work is the most extensive activation achieved to date. Hemmens
et al. (45) have reported activation of rat apo-nNOS to a
specific activity of 344 nmol of citrulline/min/mg when the purified
enzyme reconstituted with hemin was treated with 100 µM
tetrahydrobiopterin and 1 mM L-arginine in the
presence of 30 mM dithiothreitol over a period of 4 h.
Here, we activate apo-nNOS to the level of purified holo-nNOS (500-600
nmol of citrulline/min/mg) with the DE52-retained components of
reticulocyte lysate. When we assay the heme in our purified holo-nNOS
preparation, we find there is approximately 1 mol of heme per 2 mol of
nNOS. However, the amount of nNOS is based on the protein concentration
of the purified enzyme preparation which, as shown by staining with
Coomassie Blue (Fig. 7D), contains considerable
(~30-40%) NOS cleavage products and hsp70. The holo-nNOS was
purified from Sf9 cells that were incubated for 3 h with
oxyhemoglobin, which produces maximal nNOS activation, and when our
holo-nNOS preparation is further purified over a Sephacryl S300HR
column, the specific activity increases to approximately 1000 nmol of
citrulline/min/mg. For comparison, the activity of native nNOS is in
the range of 1000 to 1200 nmol of citrulline/min/mg. Thus, the
reactivation we achieve may be nearly complete. Our findings on the
reactivation of apo-nNOS under cell-free conditions are limited to the
recombinantly expressed apo-nNOS produced in Sf9 cells grown in
heme-deficient medium. In this respect, the chemical preparation of an
apo-nNOS that could be reactivated would be a major technical advance.
![]()
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
![]()
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
-mercaptoethanol,
and proteins were resolved on 7% SDS-polyacrylamide gels. Proteins
were then transferred to Immobilon-P membranes and probed with 0.1%
anti-nNOS and 1 µg/ml AC88 for hsp90. The immunoblots were then
incubated a second time with 125I-conjugated goat
anti-mouse and anti-rabbit IgGs to visualize the immunoreactive bands.
80 °C.
401-411 nm with a microtiter plate
reader as described (29). The amount of nitrate and nitrite in the cell
medium was assayed by the use of nitrate reductase and quantitation by
the Griess method as described (30). To assay conversion of arginine to
citrulline, an aliquot (5 µl) of incubation mixture was added to an
assay solution containing 1 mM CaCl2, 1 mM NADPH, 50 µM [14C]arginine
(32 mCi/mmol), 100 µM tetrahydrobiopterin, 10 µg/ml calmodulin, in a total volume of 100 µl of 40 mM
potassium phosphate, pH 7.4. The assay mixture was incubated at
37 °C for 5 min, and the amount of [14C]citrulline was
determined as described previously (31).
1 (25, 35). Apo-nNOS was
treated with the DE52-retained proteins of reticulocyte lysate as
described above. A portion of this mixture (200 µl) was added to a
solution containing 20% glycerol and 0.1 mM EDTA in 1.8 ml
of 0.1 M potassium phosphate, pH 7.4. The difference spectrum was measured with the use of an Aminco-DW2 spectrophotometer modified with the OLIS-DW2 operating system.
![]()
RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References

View larger version (29K):
[in a new window]
Fig. 1.
Neuronal NOS exists in native heterocomplexes
with hsp90. A, stability of nNOS·hsp90
heterocomplexes. nNOS was immunoadsorbed from HEK 293 cytosol with
nonimmune serum (lanes 1, 3, and 5) or anti-nNOS
antibody (lanes 2, 4 and 6), and the immune
pellets were washed three times under the following conditions:
lanes 1 and 2, TEGM buffer with 0.1% Triton
X-100; lanes 3 and 4, TEGM buffer with 0.4%
Triton X-100; lanes 5 and 6, RIPA buffer
containing 20 mM molybdate. nNOS and hsp90 were resolved by
SDS-PAGE and Western blotting. B, molybdate stabilization of
nNOS·hsp90 heterocomplexes. Immune pellets prepared as above and
washed three times with TEGM plus 0.4% Triton X-100 were suspended in
HE buffer and incubated for 25 min at 25 °C. At the end of the
incubation, all samples were washed three times with TEGM buffer plus
0.4% Triton X-100. Conditions are as follows: lanes 1 and
2, zero time (no incubation); lanes 3 and
4, incubation at 25 °C with 20 mM molybdate;
lanes 5 and 6, incubation at 25 °C without
molybdate.

View larger version (15K):
[in a new window]
Fig. 2.
Geldanamycin treatment of HEK 293 cells
reduces the level of NOS protein. A, HEK 293 cells
(2 × 105 cells/2 cm2 well) were treated
24 h with 10 µM GA, 40 µM
cycloheximide (CX), or 0.1% dimethyl sulfoxide
(Control, C). B, cells were treated 24 h
with 1 or 10 µM GA. In both cases, the amount of nNOS
protein was determined in aliquots (1 µg of protein/lane) of cell
lysates by Western blotting and quantitation using a laser
densitometer. The graphs present means ± S.E. of three samples,
and the inset in A shows the Western blot of one
set of samples.

View larger version (14K):
[in a new window]
Fig. 3.
Geldanamycin treatment reduces NOS
activity. HEK 293 cells (5 × 104 cells/well)
were treated for 6 h with 10 µM geldanamycin and/or
10 µM A23187, and the amount of nitrate and nitrite in
the medium was assayed by the Griess method. Data are means ± S.E. of triplicate samples. There were no differences in cell count
between conditions.

View larger version (26K):
[in a new window]
Fig. 4.
Geldanamycin partially inhibits heme-mediated
nNOS activation in Sf9 cells. Sf9 cells expressing
nNOS were divided into 3 aliquots and incubated in the absence of heme
or GA, in the presence of 24 µM heme without GA, or in
the presence of heme and GA, which was added 30 min prior to heme
addition at time 0. At the indicated times, cell aliquots were
harvested, and nNOS activity was assayed by the oxyhemoglobin oxidation
method. The data in the time courses represent the mean ± S.E. of
triplicate samples from a single experiment. The inset
presents the mean ± S.E. from three separate experiments 1 h
after heme addition. The difference between 1-h samples
GA and +GA is
significant at p < 0.05.

View larger version (17K):
[in a new window]
Fig. 5.
Activation of GR steroid binding activity and
of apo-nNOS by the DE52-retained fraction of rabbit reticulocyte
lysate. Rabbit reticulocyte lysate (25 ml) was chromatographed on
a column of DE52, and the fractions constituting the drop-through and
the DE52-retained material that was eluted with KCl were pooled,
contracted, and dialyzed as described under "Experimental
Procedures." A, activation of GR steroid binding activity.
GR immune pellets that were stripped of hsp90 (Str) were
incubated with the ATP-regenerating system and whole reticulocyte
lysate (RL), the drop-through (DT) fraction of
lysate, or the DE52-retained (RET) material in lysate. GR
and hsp90 were assayed in each sample by Western blotting, and a
portion of the immune pellet was incubated with 50 nM
[3H]triamcinolone acetonide to determine steroid binding
activity (bar graph). B, activation of apo-nNOS.
Rat apo-nNOS was purified from nNOS-expressing Sf9 cells
cultured in the absence of exogenous heme. Aliquots (5.6 µg) of
purified apo-nNOS were then incubated 1.5 h at 20 °C with
cofactor mix, ATP-regenerating system, and buffer alone (Apo
Ctl), 1.2 µM heme (HM), 25 µl of
reticulocyte lysate, 12.5 µl of drop-through, 12.5 µl of
DE52-retained material, or 12.5 µl of DE52-retained material plus 10 µM GA. nNOS activity was assayed by conversion of
[14C]arginine to citrulline. The holo-nNOS and apo-nNOS
standards were simply assayed for nNOS activity without any prior
incubation at 20 °C.

View larger version (16K):
[in a new window]
Fig. 6.
GR activation by subfractions of the DE52
retentate. The fractions of reticulocyte lysate eluted from DE52
with a salt gradient were divided into three subfractions
(A-C) as described under "Experimental Procedures."
A, activation of GR steroid binding activity with
subfractions A-C. Stripped GR immune pellets
(Str) were incubated 20 min at 30 °C with whole
reticulocyte lysate (RL) or 10 µl each of DE52
subfractions A, B, and C alone or in the
combinations indicated. At the end of the incubation, steroid binding
was assayed by incubating the washed immune pellets with
[3H]triamcinolone acetonide. B, hsp90 is
required for activation of GR steroid binding activity. Stripped GR
immune pellets (Str) were incubated 20 min at 30 °C in
the presence of [3H]triamcinolone acetonide and 10 µl
of DE52 subfraction A, A plus 70 µg of purified hsp90, A plus hsp90
and 10 µM geldanamycin, or hsp90 alone.

View larger version (15K):
[in a new window]
Fig. 7.
hsp90 is not required for activation of nNOS
in vitro. A, activation of apo-nNOS
with subfractions A-C. Aliquots of purified apo-nNOS were
incubated 1.5 h at 20 °C with 12.5 µl of unfractionated DE52
retentate (RET) or 5 µl each of DE52 subfractions A, B,
and C alone or in the combinations indicated. At the end of the
incubation, nNOS activity was assayed by conversion of
[14C]arginine to citrulline. B, effect of free
heme on nNOS activity. Aliquots of purified apo-nNOS (1 µM) were incubated 1.5 h at 20 °C with cofactor
mix and various concentrations of heme. nNOS activity was assayed by
conversion of [14C]arginine to citrulline. C,
assembly of nNOS·hsp90 heterocomplexes. Purified apo-nNOS was
immunoadsorbed to protein A-Sepharose with non-immune (lanes
1 and 3) or anti-nNOS (lanes 2 and
4) antibody. The nNOS immune pellets were incubated for 20 min at 30 °C with reticulocyte lysate (lanes 1 and
2) or the DE52-retained fraction of lysate (lanes
3 and 4). The immune pellets were then washed, and nNOS
and hsp90 were detected by Western blotting. The AC88 antibody used to
probe for hsp90 recognizes rabbit hsp90 but not the hsp90 of the
Sf9 cells that produced the nNOS (43). D, purified
rat apo-nNOS contains insect hsp70. Samples (8 µg) of the purified
nNOS preparation were resolved by SDS-PAGE and stained with Coomassie
Blue (CB) or immunoblotted (IB) with anti-nNOS or
rabbit antiserum that reacts with both hsp70 and hsp90 of Sf9
cells. The photos are of the bands developed with the
peroxidase-conjugated counterantibody.
![]()
DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
| |
ACKNOWLEDGEMENTS |
|---|
We thank Bettie Sue Masters, Solomon Snyder, Lance Pohl, and Ettore Appella for providing cDNAs and antisera used in this work. We also thank Dan Rotrosen for help in baculovirus-mediated expression of nNOS.
| |
FOOTNOTES |
|---|
* This investigation was supported in part by National Institutes of Health Grants ES08365 (to Y. O.) and DK31573 (to W. B. P.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Trainee under Pharmacological Sciences Training Program Grant
GM07767 from the National Institutes of Health.
§ Postdoctoral Fellow of the University of Michigan and Parke-Davis Partnership in Chemical and Biological Sciences.
¶ To whom correspondence should be addressed: Dept. of Pharmacology, the University of Michigan Medical School, Medical Science Research Bldg. III, Ann Arbor, MI 48109-0632; Fax: 313-763-4450.
Recipient of the Burroughs Wellcome Fund New Investigator
Award in Toxicology.
The abbreviations used are: hsp, heat shock protein; GR, glucocorticoid receptor; NOS, nitric-oxide synthase; PAGE, polyacrylamide gel electrophoresis; LBD, ligand binding domain; RIPA, radioimmune precipitation assay; GA, geldanamycin; nNOS, neuronal NOS; eNOS, endothelial NOS, HEK, human embryonic kidney; BuGR, anti-GR IgG; TES, 2-{[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]amino}ethanesulfonic acid.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
D. M. Dudzinski and T. Michel Life history of eNOS: Partners and pathways Cardiovasc Res, July 15, 2007; 75(2): 247 - 260. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Salmi, K. E. Morris, S. J. Roux, and D. M. Porterfield Nitric Oxide and cGMP Signaling in Calcium-Dependent Development of Cell Polarity in Ceratopteris richardii Plant Physiology, May 1, 2007; 144(1): 94 - 104. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Cordelier, J.-P. Esteve, S. Najib, L. Moroder, N. Vaysse, L. Pradayrol, C. Susini, and L. Buscail Regulation of Neuronal Nitric-oxide Synthase Activity by Somatostatin Analogs following SST5 Somatostatin Receptor Activation J. Biol. Chem., July 14, 2006; 281(28): 19156 - 19171. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. M. Murphy, Y. Morishima, J. J. Kovacs, T.-P. Yao, and W. B. Pratt Regulation of the Dynamics of hsp90 Action on the Glucocorticoid Receptor by Acetylation/Deacetylation of the Chaperone J. Biol. Chem., October 7, 2005; 280(40): 33792 - 33799. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Papapetropoulos, Z. Zhou, C. Gerassimou, G. Yetik, R. C. Venema, C. Roussos, W. C. Sessa, and J. D. Catravas Interaction between the 90-kDa Heat Shock Protein and Soluble Guanylyl Cyclase: Physiological Significance and Mapping of the Domains Mediating Binding Mol. Pharmacol., October 1, 2005; 68(4): 1133 - 1141. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-M. Peng, Y. Morishima, G. J. Jenkins, A. Y. Dunbar, M. Lau, C. Patterson, W. B. Pratt, and Y. Osawa Ubiquitylation of Neuronal Nitric-oxide Synthase by CHIP, a Chaperone-dependent E3 Ligase J. Biol. Chem., December 17, 2004; 279(51): 52970 - 52977. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Y. Dunbar, Y. Kamada, G. J. Jenkins, E. R. Lowe, S. S. Billecke, and Y. Osawa Ubiquitination and Degradation of Neuronal Nitric-Oxide Synthase in Vitro: Dimer Stabilization Protects the Enzyme from Proteolysis Mol. Pharmacol., October 1, 2004; 66(4): 964 - 969. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Billecke, D. I. Draganov, Y. Morishima, P. J. M. Murphy, A. Y. Dunbar, W. B. Pratt, and Y. Osawa The Role of hsp90 in Heme-dependent Activation of Apo-neuronal Nitric-oxide Synthase J. Biol. Chem., July 16, 2004; 279(29): 30252 - 30258. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Jiang, D. Cyr, R. W. Babbitt, W. C. Sessa, and C. Patterson Chaperone-dependent Regulation of Endothelial Nitric-oxide Synthase Intracellular Trafficking by the Co-chaperone/Ubiquitin Ligase CHIP J. Biol. Chem., December 5, 2003; 278(49): 49332 - 49341. [Abstract] [Full Text] [PDF] |
||||
![]() |
|