|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 274, Issue 3, 1541-1548, January 15, 1999
From the Tumor Immunology Program, German Cancer Research Center,
Im Neuenheimer Feld 280, 69120 Heidelberg, Germany
Upon stimulation, CD95 (APO-1/Fas) recruits the
adapter molecule Fas-associated death domain protein (FADD)/MORT1 and
caspase-8 (FADD-like interleukin-1 Apoptosis is a form of programmed cell death that plays an
important role in tissue homeostasis. In the immune system, apoptosis is used for negative selection in the thymus and bone marrow and to
eliminate unwanted lymphocytes following an immune response (1, 2). A
subgroup of the TNF1/nerve
growth factor-receptor superfamily, the death receptors, has been shown
to induce apoptosis after triggering with ligand or agonistic
antibodies (3). The best characterized member of the death receptor
subfamily is CD95, also known as APO-1 or Fas. Stimulation of CD95 with
agonistic antibody leads to clustering of the receptor. This enables
the adapter molecule FADD/MORT1 (4, 5) and the death protease caspase-8
(FLICE, MACH, MCH5) (6-8), to bind to the receptor via homophilic
death domain and death effector domain (DED) interactions,
respectively, forming the death-inducing signaling complex (DISC) (9).
Recruitment of caspase-8 to the DISC leads to its proteolytic
activation, which initiates a cascade of caspases, leading to apoptosis
(10).
Stimulation of resting peripheral T cells (in the following referred to
as day 0 T cells) during an immune response leads to their activation
(day 1 T cells) resulting in increased expression of several genes
including IL-2 and CD95 (1). However, besides high CD95 surface
expression, day 1 T cells are resistant to CD95-mediated apoptosis (11,
12). Repeated stimulation of previously activated T cells results in
activation-induced cell death, which has been shown to involve the CD95
receptor/ligand system (13-16). After prolonged culture in the
presence of IL-2, activated T cells develop an apoptosis-sensitive
phenotype (day 6 T cells) (11, 12). Since CD95 surface expression does
not significantly change between day 1 and day 6 T cells, the
apoptosis-resistant phenotype of day 1 T cells must be caused by a
block in CD95 signal transduction. We have previously shown that
activation of caspase-8 at the DISC is inhibited in these resistant T
cells, whereas Bcl-xL is highly up-regulated (17).
Sensitivity toward CD95-mediated apoptosis can be modulated
e.g. by the viral caspase inhibitors CrmA or p35 (18-21) or
in certain cells (type II cells) by Bcl-2/Bcl-xL
overexpression inhibiting mitochondrial changes during apoptosis (22).
A new class of virus-encoded apoptosis-inhibitory molecules, designated
viral FLICE-inhibitory proteins (v-FLIPs), has been described (23-25). These molecules are composed of two death effector domains, a structure
resembling the N-terminal half of caspase-8. Via DED-DED interaction,
v-FLIPs are recruited to the CD95 DISC (23), preventing caspase-8
recruitment and processing and thereby CD95-induced apoptosis.
Recently, a cellular homologue of v-FLIP was identified by different
groups and termed c-FLIP (26), CASH (27), Casper (28), CLARP (29),
FLAME (30), I-FLICE (31), MRIT (32), and Usurpin (33). On the mRNA
level, c-FLIP seems to exist as multiple splice variants, but on the
protein level only two endogenous forms, c-FLIP and
c-FLIPshort could be detected (26, 28, 33). c-FLIP is
structurally similar to caspase-8, since it contains two death effector
domains and a caspase-like domain. However, this domain lacks residues
that are important for its catalytic activity, most notably the
cysteine within the active site. The short form of c-FLIP structurally
resembles v-FLIP. The role of c-FLIP in apoptosis signaling is
controversially discussed. Some reports have described it as a
proapoptotic molecule (27-29, 32) and others as an antiapoptotic
molecule (26, 27, 30, 31, 33). In addition, whether c-FLIP interacts
with FADD and/or caspase-8 is not clear. Some groups have reported that
c-FLIP can interact with both FADD and caspase-8 (26-28, 30, 32), while others could only detect an interaction between c-FLIP and caspase-8 (29, 31, 33). All of these studies were done in vitro or by overexpressing c-FLIP. The in vivo
situation of the endogenous protein remains unclear. However, it was
suggested that in day 1 T cells, the apoptosis-resistant phenotype
correlates with high c-FLIP expression, which was decreased in the
sensitive day 6 T cells (26).
To elucidate the role of c-FLIP in the CD95 pathway, we generated BJAB
cells stably overexpressing c-FLIP and monoclonal antibodies against
this protein. Using these tools, we now show that c-FLIP is
predominantly found as a 55-kDa isoform in most cell lines independent
of their resistant state toward CD95-mediated apoptosis. A minor c-FLIP
species of 27/28 kDa (c-FLIPshort) was also detected in
most cell lines. All forms of c-FLIP were found to be recruited to the
DISC. Expressed at high levels in stable transfectants, c-FLIP
completely blocked CD95-mediated apoptosis through inhibition of
caspase-8 processing at the DISC. The mechanism of this inhibition involves cleavage of c-FLIP. c-FLIP seems to play only a minor role in
apoptosis resistance of activated T cells, since it remained uncleaved
in the resistant T cells and could be detected in day 0, day 1, and day
6 T cells at equal amounts.
Cell Lines--
The Burkitt lymphomas Raji, BJAB, and SKW6.4;
the T cell lymphomas H9, CEM, and Jurkat; the monocytic cell line U937;
the cervix carcinoma HeLa; the breast carcinoma MCF-7; the colon
carcinoma HT29; the hepatoma cell line HepG2; the myorhabdosarcoma cell line KYM-1; and the small cell lung carcinomas SCLC 16H and NCI N592
were cultured in RPMI 1640 supplemented with 10% fetal calf serum, 50 µg/ml gentamycin, and 5 mM HEPES. The embryonic kidney line 293T was cultured in Dulbecco's modified Eagle's medium
supplemented with 10% fetal calf serum, 50 µg/ml gentamycin, and 10 mM HEPES. All cells were of human origin.
Cloning of c-FLIP--
An expressed sequence tag clone,
AA115792, containing the complete c-FLIP open reading frame was
identified by searching the public expressed sequence tag data base
with a DED search profile. c-FLIP was amplified by polymerase chain
reaction using the primers
CCGCTCGAGCGGATGTCTGCTGAAGTCATCCATCAGGTTG and
GCTCTAGAGCTAAGTAGGAGAGGATAAGTTTCTTTCT and cloned into the
mammalian expression vector pEFrsFLAG containing a N-terminal FLAG
epitope tag sequence. The c-FLIP sequence was determined by automated
DNA sequence analysis and found to be identical to the published
sequences of FLAME- Fusion Proteins, Antibodies, and Reagents--
Using standard
polymerase chain reaction and cloning techniques, 6-His-tagged FLIP and
GST-N-c-FLIP (amino acids 1-194) were generated as fusion proteins and
purified as described (9). The affinity-purified rabbit polyclonal
antibody RF60 was generated against a peptide spanning amino acids
190-209 as described previously (34). The anti-c-FLIP mAb NF6 (mouse
IgG1) was generated against GST-N-c-FLIP as described (35). The
anti-CD95 mouse mAb anti-APO-1 (IgG3) recognizes an epitope of the
extracellular part of human CD95 (36), and the mouse mAb C15 (IgG2b)
recognizes the p18 subunit of caspase-8 (35). Anti-FADD and
anti-extracellular signal-regulated kinase-1 mAbs were purchased from
Transduction Laboratories, and the anti-extracellular signal-regulated
kinase-1/2 polyclonal antiserum was a gift of B. Schraven (University
of Heidelberg). The horseradish peroxidase-coupled goat anti-mouse IgG1
and IgG2b antibodies and goat anti-rabbit IgG antibody were purchased
from Southern Biotechnologies and Santa Cruz Biotechnology, Inc. (Santa
Cruz, CA), respectively. All chemicals used were of analytical grade
and were purchased from Merck or Sigma.
Immunoprecipitation and Western Blot--
Immunoprecipitation of
the CD95 DISC was carried out as described (37, 38). For
immunoprecipitation of c-FLIP, 107 cells either
unstimulated or treated with 1 µg/ml anti-APO-1 for 10 min were lysed
in lysis buffer (20 mM Tris/HCl, pH 7.4, 1% Triton X-100,
10% glycerol, 150 mM NaCl, 1 mM
phenylmethylsulfonyl fluoride, and 1 µg/ml of leupeptin, antipain,
chymostatin, and pepstatin A) as described (9), and the lysate was
incubated with 20 µg of anti-c-FLIP affinity-purified rabbit
polyclonal antibody (RF60) coupled to anti-rabbit IgG beads (Sigma) for
1 h at 4 °C.
For Western blot analysis, postnuclear supernatant equivalents of
106 cells or 50 µg of protein as determined by the BCA
method (Pierce) were separated by 12% SDS-polyacrylamide gel
electrophoresis, blotted onto a nitrocellulose membrane (Amersham
Pharmacia Biotech) and blocked with 5% nonfat drymilk in PBS/Tween
(0.05% Tween 20 in PBS). After washing with PBS/Tween, the blots were
incubated for 16 h with NF6 anti-c-FLIP, C15 anti-caspase-8,
anti-FADD, or anti-mitogen-activated protein kinase antibodies at
4 °C. Blots were washed again with PBS/Tween, incubated with
horseradish peroxidase-coupled isotype-specific secondary antibodies
(1:20,000) for 1 h at room temperature, washed again, and
developed with a chemiluminescence reagent (NEN Life Science Products).
To quantify the amount of c-FLIP and caspase-8 in cellular lysates, the
specific anti-c-FLIP (NF6) and anti-caspase-8 (C15) monoclonal
antibodies were used in a Western blot analysis to compare the signal
obtained from endogenous expressed c-FLIP and caspase-8 with defined
amounts of 6-HIS-c-FLIP and 6-HIS-caspase-8.
For stripping, blots were incubated for 30 min in a buffer containing
62.5 mM Tris/HCl, pH 6.8, 2% SDS, and 100 mM
Preparation of Primary T Cells--
Human peripheral T cells
were prepared as described previously (12). For activation, resting T
cells (day 0) were cultured at 2 × 106 cells/ml with
1 µg/ml phytohemagglutinin for 16 h (day 1). Day 1 T cells were
then washed three times and cultured for an additional 5 days in the
presence of 25 units/ml or 100 units/ml IL-2 (day 6).
Cytotoxicity Assay--
For assaying apoptosis, 106
cells were incubated in 24-well-plates with or without 1 µg/ml
anti-APO-1 plus 10 ng/ml protein A in medium for 16 h at 37 °C.
Cells were centrifuged briefly in a Minifuge (Heraeus) at 4000 rpm for
5 min, washed once with PBS, and resuspended in a buffer containing
0.1% (w/v) sodium citrate, 0.1% (v/v) Triton X-100, and 50 µg/ml
propidium iodide (Sigma). After incubation at 4 °C in the dark for
at least 16 h, apoptotic nuclei were quantified by FACScan (Becton
Dickinson). Specific apoptosis was calculated as follows: (percentage
of experimental apoptosis Cell Transfections--
BJAB cells were transfected by
electroporation (960 microfarads, 200 V) using a Gene PulserTM
(Bio-Rad) with control vector (pEFrsFLAG) or c-FLIP expression vector
(pEFrsFLAG-c-FLIP). Transfectants were selected in supplemented RPMI
1640 medium containing 1 µg/ml puromycin (Sigma). High expressing
clones were identified by Western blot analysis using the anti-c-FLIP
mAb NF6.
Identification and Cloning of c-FLIP--
Recently, a molecule
that was found to be structurally related to caspase-8, c-FLIP, was
identified containing two DEDs at its N terminus (Refs. 26-33; see
"Experimental Procedures"). The role of c-FLIP in apoptosis
signaling is controversial. Some reports have described it as an
inducer (27-29, 32), whereas others have found it to be an inhibitor
of death receptor-induced apoptosis (26, 27, 30, 31, 33). To clarify
this controversy, we generated molecular tools to study the role of
c-FLIP in CD95-mediated apoptosis in more detail.
Nine different cDNA variants were reported for c-FLIP. To test
which isoforms of c-FLIP are expressed on the protein level, we
generated a monoclonal antibody (NF6) against this molecule. Using this
antibody, we screened 15 different cell lines representing 10 histotypes by Western blot analysis. The antibody used recognizes an
epitope in the N-terminal half of c-FLIP that is present in all
reported isoforms. In all cell lines, c-FLIP was predominantly expressed only in two isoforms, designated c-FLIP (55 kDa) and c-FLIPshort (27/28 kDa) (Fig.
1A), with c-FLIP being the
prominently expressed isoform in most cell lines. The CD95 signaling
molecules caspase-8 (Fig. 1B) and FADD (Fig. 1C)
were present in most of these cell lines. Several of the cell lines
expressing c-FLIP were found to be highly sensitive to CD95-mediated
apoptosis (data not shown), inconsistent with a role of c-FLIP as an
apoptosis inhibitor. However, quantitative Western blot analysis
revealed that the expression level of c-FLIP in these cell lines was
over 100 times lower than the amount of caspase-8 (data not shown). c-FLIP was shown to inhibit death receptor-mediated apoptosis only when
expressed at high levels. Therefore, the amount of c-FLIP being
expressed in these cell lines may not be sufficient to block apoptosis.
Overexpression of c-FLIP Blocks Apoptosis and Caspase-8
Processing--
To raise c-FLIP expression levels, N-terminal
FLAG-tagged c-FLIP was stably transfected into BJAB cells. High
expressing clones were identified by Western blotting using the NF6
monoclonal antibody. The transfected c-FLIP migrated with a slightly
reduced mobility compared with the endogenous protein due to the FLAG
tag (Fig. 2A). This enabled us
to determine the additional amount of c-FLIP that was introduced into
the cell. Next we checked the transfected clones for their sensitivity
to CD95-mediated apoptosis. Overexpression of c-FLIP resulted in cells
resistant to CD95-induced apoptosis when compared with mock-transfected
cells (Fig. 2B). To exclude clonal effects, three different
clones were tested showing the same phenotype. The amount of c-FLIP in
the stably transfected BJAB cells correlated with apoptosis resistance
(data not shown). Therefore, c-FLIP is an antiapoptotic molecule that
needs to be present at high amounts to block apoptosis.
To determine the step in apoptosis signaling at which c-FLIP inhibits
CD95-mediated apoptosis, we tested for activation of caspase-8 as one
of the first detectable events after receptor triggering. In vector
transfected cells, procaspase-8 was processed after activation of CD95,
and the active p18 subunit was detectable in the cytosol (Fig.
2C). In contrast, in c-FLIP transfectants procaspase-8
cleavage was completely blocked. Therefore, c-FLIP must work upstream
of caspase-8 activation, probably at the receptor complex.
Interestingly, although caspase-8 was not cleaved in the transfected
cells, c-FLIP was processed after CD95 triggering to a p43 form (Fig.
2D). Notably, in cells with elevated c-FLIP levels, the
amount of p43 c-FLIP remained stable over the stimulation period of
3 h, whereas endogenous c-FLIP was hardly detectable after 30 min
of receptor stimulation.
c-FLIP Is Recruited to the CD95 DISC--
Since c-FLIP is
structurally similar to caspase-8, it was likely that c-FLIP, like
caspase-8, was recruited to the CD95 DISC through the adapter molecule
FADD. Therefore, we immunoprecipitated either the unstimulated or the
stimulated CD95 receptor and tested for associated c-FLIP by Western
blot analysis. As shown in Fig. 3A, both c-FLIP and
c-FLIPshort associated with CD95 in a
stimulation-dependent fashion. However, the full-length
c-FLIP molecule was not detected in the DISC, but only the cleaved
form, p43, which was also found in cellular lysates after CD95
triggering (Figs. 2D and 3A). This cleavage
product was detected by an antibody against the N terminus of the
molecule, and it associated with the CD95 DISC. Therefore, in analogy
to caspase-8, p43-c-FLIP very likely represents the cleavage product of
c-FLIP after removal of the p10 subunit (Fig. 3B).
We next tested how levels of c-FLIP present in the transfected cells
would influence caspase-8 recruitment and processing at the CD95 DISC.
As shown in Fig. 3C, caspase-8 was recruited to the CD95
receptor only after stimulation. Recruitment and activation of
caspase-8 was normal in the vector-transfected cells only expressing low amounts of endogenous c-FLIP as demonstrated by the presence of
both full-length and cleaved caspase-8. However, only the cleaved form
of caspase-8 was detectable at the activated CD95 receptor in the
c-FLIP-transfected clones. We have previously shown that the p43 and
p41 intermediates arise from the two different caspase-8 isoforms after
their activation at the CD95 DISC (10, 35). Thus, c-FLIP overexpression
allows initial cleavage of caspase-8 but blocks further recruitment of
procaspase-8 to the DISC, thereby blocking the conversion of cytosolic
procaspase-8 to the active enzyme.
c-FLIP Does Not Interact with FADD and Caspase-8 in the
Cytoplasm--
After having established that c-FLIP can act as an
inhibitor of CD95 DISC activity, the question remained whether c-FLIP
can interact with caspase-8 or FADD in the cytosol, which could be another potential molecular mechanism of c-FLIP-mediated apoptosis resistance. Such a cytosolic interaction has been described by others
(26-33) using transient overexpression or in vitro systems. To test if endogenous amounts of c-FLIP were able to interact with FADD
or caspase-8, we immunoprecipitated c-FLIP with an affinity-purified rabbit polyclonal anti-c-FLIP antibody from the lysates of either untreated or anti-CD95-treated cells (Fig.
4, anti-c-FLIP (rbAb)). We
then analyzed the immunoprecipitates by Western blotting using monoclonal antibodies against c-FLIP, caspase-8, or FADD. Without CD95
triggering, both full-length c-FLIP and c-FLIPshort were immunoprecipitated (Fig. 4A, lane 1).
However, no interactions with caspase-8 or FADD could be detected (Fig.
4, B and C, lane 1). After
CD95 receptor stimulation, c-FLIP was also immunoprecipitated as the
processed p43 form (Fig. 4A, lane 2).
In addition, caspase-8 and FADD were now coimmunoprecipitated with
c-FLIP (Fig. 4, B and C, lane
2). However, after CD95 triggering, c-FLIP interacted predominantly with the cleavage intermediates of caspase-8 (Fig. 4B, lane 2), which was even more
pronounced in cells with high c-FLIP expression levels (Fig.
4B, lane 4). Since these forms of
caspase-8 are mostly found at the DISC (compare with Fig.
3B), which is formed after CD95 triggering, we conclude that
c-FLIP interacts with caspase-8 and FADD at the receptor level.
Therefore, no association between c-FLIP and caspase-8 or FADD could be
detected without receptor triggering. The same results were obtained by immunoprecipitating either FADD or caspase-8 and testing for associated molecules by Western blot analysis using antibodies against c-FLIP, caspase-8, and FADD (data not shown). This demonstrates that no stable
preformed complex between FADD, caspase-8, and c-FLIP exists in the
cytoplasm in vivo.
Role of c-FLIP in Resistance of Activated T Cells toward
CD95-mediated Apoptosis--
We have demonstrated that c-FLIP inhibits
caspase-8 processing and thereby apoptosis only when present at
elevated levels. We have previously shown that short term activated T
cells are resistant to CD95-induced apoptosis caused by a block in
caspase-8 activation at the DISC (17). This phenotype would be
consistent with c-FLIP being involved in this apoptosis resistance. To
investigate this possibility, we isolated peripheral blood T cells (day
0) and activated them with phytohemagglutinin for 16 h (day 1),
which resulted in strong up-regulation of CD95. As reported,
cross-linking of CD95 in these cells did not result in significant
apoptosis induction (Fig. 5A).
Continuous culturing for 5 days in the presence of IL-2 (25 units/ml or
100 units/ml) (days 2-6) rendered T cells sensitive to CD95-mediated
apoptosis (Fig. 5A) without significant changes in CD95
surface expression (data not shown). During these kinetics, the
expression levels of c-FLIP and caspase-8 did not change neither at 25 units/ml IL-2 (Fig. 5A) nor at 100 units/ml IL-2 (data not
shown).
Testing for caspase-8 cleavage after CD95 triggering in day 1 and day 6 T cells revealed that the resistant day 1 T cells have a defect in
caspase-8 activation (Fig. 5B), consistent with previously
published data (17). In addition, at day 1 no c-FLIP cleavage could be
detected after CD95 triggering. Since apoptosis inhibition by c-FLIP
involves the cleavage of this protein (Fig. 2D), resistance
of day 1 T cells cannot simply be due to expression of c-FLIP. A more
general defect in DISC formation in the resistant day 1 T cells was
detected using Western blot analysis (Fig. 5D). We did not
find significant amounts of FADD, c-FLIP, and caspase-8 coimmunoprecipitated with activated CD95 in day 1 T cells, whereas all
three molecules were detectable at day 6. Therefore, the resistance toward CD95-mediated apoptosis in day 1 T cells may be caused by
reduced DISC formation rather than by expression of c-FLIP.
The early events in the signal transduction pathway of the
apoptosis-inducing receptor CD95 have been well characterized. Clustering of the receptor leads to formation of the DISC, which involves binding of the adapter molecule FADD to the death domain of
CD95 and subsequent recruitment of caspase-8 (9). Binding of caspase-8
to the DISC results in its proteolytic activation, presumably through
an autocatalytic mechanism (10). Although caspase-8 is able to undergo
autoproteolytic maturation when cross-linked (39-41), the active
caspase-8 enzyme cannot activate its own proform (10). Therefore,
cytosolic procaspase-8 has to be recruited to the CD95 DISC to become
activated. This implies that the DISC has to be functional throughout
the stimulation to transduce the complete apoptotic signal. Disturbance
of the DISC leads to a block in ongoing caspase-8 activation reducing
the amount of active caspase-8 formed determining whether the cell will
survive or undergo apoptosis.
We have previously shown that overexpression of a viral protein,
v-FLIP, containing two DEDs interfered with the function of the DISC by
competing with caspase-8 for binding to receptor bound FADD (23).
Recently, a human homolog of v-FLIP, c-FLIP, was cloned (26-33).
Depending on the transient overexpression or the in vitro
pull-down systems used c-FLIP was shown to either promote or to inhibit
apoptosis. High overexpression of DED-containing molecules has been
shown to induce apoptosis by aggregation and the formation of
nonphysiological death effector filaments, leading to the activation of
caspases (42). This may be the reason why several groups found a
proapoptotic function of c-FLIP in transient overexpression systems
(27-29, 32). No stable expression clone has been described in which
c-FLIP had a proapoptotic effect.
In all reports, associations of c-FLIP with FADD or caspase-8 were
found using transient overexpression or in vitro systems. Using anti-c-FLIP monoclonal antibodies and stable c-FLIP
transfectants, we have now studied the function of c-FLIP in
vivo. We show that c-FLIP has an antiapoptotic function, and we
have elucidated the mechanism of this inhibition. Furthermore, testing
endogenous proteins we could not detect any constitutive association
between c-FLIP, FADD, and caspase-8. Only after CD95 triggering are all three molecules recruited to the CD95 receptor complex.
The way c-FLIP inactivates the DISC is by blocking further recruitment
of caspase-8 into the complex. This leads to inhibition of caspase-8
activation, since procaspase-8 is no longer able to replace the
cleavage products at the DISC in order to become activated (Fig.
6). This mechanism provides an
explanation of how the amount of c-FLIP determines the degree of
apoptosis-resistance. Small amounts of c-FLIP as endogenously present
in most cells are only able to block a few receptor complexes, and
caspase-8 is still sufficiently activated at the remaining DISCs,
leading to apoptosis. The more c-FLIP is expressed, the more receptor complexes are blocked, making the cell resistant to CD95-induced apoptosis.
c-FLIP has a high affinity to bind to the DISC. Despite the fact that
c-FLIP is expressed endogenously at low levels, it was readily
detectable at the DISC level. It therefore seems that most of the
intracellular pool of endogenous c-FLIP binds to the DISC, providing an
explanation for the rapid cleavage of this molecule detectable minutes
after stimulation of CD95. High c-FLIP expression in the stable c-FLIP
transfectants resulted in increased binding of c-FLIP to the DISC,
indicating that the DISC has a high capacity to bind c-FLIP as opposed
to caspase-8, of which only a fraction can be found bound to the DISC.
These data suggest that the affinity of the DISC to bind c-FLIP is
higher than to bind caspase-8, consistent with the function of c-FLIP
to prevent further recruitment of caspase-8 to the DISC. This model was
confirmed by demonstrating that in CD95-stimulated cells caspase-8 can
be coimmunoprecipitated with endogenous c-FLIP, probably because both
molecules were complexed with FADD at the activated CD95 receptor (Fig.
4). However, in this complex, mainly the caspase-8 cleavage products
were found, suggesting that in a receptor complex containing c-FLIP the
recruitment of full-length caspase-8 is inhibited.
c-FLIP has also been shown to block TNF-RI-, DR3-, and TRAIL-R-induced
apoptosis (26, 27, 30, 31), implying a similar mechanism of signal
transduction by these receptors. To date, nothing is known about the
in vivo receptor complex of DR3 or one of the TRAIL
receptors. It has been shown that endogenous amounts of the signaling
molecules TRADD, RIP, and TRAF2 are recruited to the activated TNF-RI
(43-45). However, no FADD or caspase-8 could be detected in this
complex (28),2 although cells
lacking FADD or caspase-8 expression are resistant to TNF-induced
apoptosis (46-49). Therefore, either the complex TNF-RI with TRADD,
FADD, and caspase-8 is too unstable to be detected by
immunoprecipitation, or FADD and caspase-8 are involved in an
intracellularly formed complex that could then be a target of
c-FLIP.
In summary, since the amount of endogenous c-FLIP present in all cells
tested is insufficient to block apoptosis in cells with high CD95
expression, c-FLIP could play a role in vivo in blocking
CD95-mediated apoptosis in tissues with low receptor expression.
Alternatively, c-FLIP might regulate apoptosis induced by other death
receptors that are usually expressed at much lower levels than CD95.
CD95-mediated apoptosis of peripheral activated T cells has recently
been suggested to be regulated by c-FLIP expression (26, 50). Short
term activated (day 1) T cells are resistant, and T cells additionally
cultured in the presence of IL-2 for 5 days (day 6 T cells) are CD95
apoptosis-sensitive (12, 17). It is unlikely that c-FLIP is the cause
for the resistance of day 1 T cells for the four following reasons. 1)
The amount of c-FLIP detected in the resistant T cells was similar to
the amount of c-FLIP detected in many of the apoptosis-sensitive cell
lines in which the caspase-8/c-FLIP ratio was about 100:1. This makes it unlikely that the expressed amount of c-FLIP would be sufficient to
block CD95-mediated apoptosis of activated T cells that express high
amounts of CD95. 2) In our hands, the expression of c-FLIP both on the
mRNA level (data not shown) and the protein level (Fig.
5C) was essentially the same when day 1 and day 6 T cells were compared. This was found to be independent of the concentration of
IL-2 used to culture the T cells. 3) c-FLIP in day 1 T cells is not
cleaved after triggering the CD95 receptor. Both endogenous and
overexpressed c-FLIP were cleaved during CD95-mediated apoptosis in the
BJAB cells in c-FLIP-inhibited apoptosis. 4) Day 1 T cells seem to have
a general defect in formation of the DISC including recruitment of
FADD. Hence, none of the DISC components (caspase-8, FADD, or c-FLIP)
was efficiently coimmunoprecipitated with the activated CD95 receptor
in day 1 T cells. These data strongly indicate that an as yet
unidentified component rather than c-FLIP regulates formation of the
DISC in the resistant T cells.
In a recent report, we described a defect in DISC formation in these
day 1 T cells (17). Using metabolically labeled T cells and analysis of
anti-CD95 immunoprecipitates on two-dimensional gels, we concluded that
procaspase-8 was not recruited to the activated CD95 receptor in the
day 1 T cells. However, the apparent amount of metabolically labeled
FADD recruited by CD95 when comparing day 1 and day 6 T cells appeared
to be similar. We therefore predicted a protein carrying a DED that
would act as a resistance factor preventing binding of caspase-8 to the
DISC-bound FADD. However, due to the labeling method, the amount of
DISC components recruited could not be quantified. Monoclonal
antibodies available against all known DISC components now revealed
that day 1 T cells have a more general defect in DISC formation, since
the amount of all components (FADD, caspase-8, and c-FLIP) bound to the
activated receptor was severely reduced. Such a general defect in
formation of the DISC was recently found in certain cell lines that
were designated type II cells (22). In these cells, very little active caspase-8 is formed at the DISC, which is not sufficient to directly activate caspase-3 but enough to activate mitochondria. Mitochondrial involvement is therefore essential for the execution of apoptosis in
type II cells. Only in these cells could apoptosis be inhibited by
overexpression of either Bcl-2 or Bcl-xL that blocked all
apoptogenic activity of mitochondria. Type I cells were shown to
undergo CD95-mediated apoptosis independently of mitochondrial
functions. Apoptosis in these cells with strong DISC formation could
not be blocked by overexpressed Bcl-2 (22). It is interesting to note
that day 1 T cells were shown to have elevated levels of
Bcl-xL (17, 51), which have been shown to block
CD95-mediated apoptosis in type II cells with low DISC formation (22).
One could therefore hypothesize the following: Day 1 T cells behave
like type II cells, since they do not form a proper DISC and cannot
generate enough active caspase-8 to activate caspase-3 directly. They
depend on the activity of mitochondria. However, Bcl-xL in
these cells is strongly up-regulated, and the mitochondria are
therefore blocked in their apoptogenic activity. Hence, the cells are
CD95 apoptosis-resistant. After prolonged incubation with IL-2, the T
cells turn into type I-like cells, since they now form a DISC and
recruit and activate caspase-8 at the DISC (17). These cells are
probably independent of mitochondrial involvement in apoptosis and have
down-regulated Bcl-xL.
In summary, day 1 T cells are probably resistant to CD95-mediated
apoptosis because they seem to be type II-like cells that are protected
by overexpression of Bcl-xL or, as it was recently suggested, by Bcl-x- We thank A. Strasser for providing the
pEFrsFLAG expression vector and Maja Krützfeldt for help with the
cloning of c-FLIP.
*
This work was supported by grants of the Deutsche
Forschungsgemeinschaft (to M. E. P.), the Bundesministerium für
Forschung und Technologie, and the Tumor Center Heidelberg/Mannheim.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed. E-mail:
m.peter{at}dkfz-heidelberg.de.
The abbreviations used are:
TNF, tumor necrosis
factor; FADD, Fas-associated death domain protein; FLICE, FADD-like
interleukin-1 2
F. C. Kischkel, P. H. Krammer, and M. E. Peter, unpublished data.
The Role of c-FLIP in Modulation of CD95-induced Apoptosis*
,,
ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References
-converting enzyme
(FLICE)/MACH/MCH5) into the death-inducing signaling complex (DISC).
Recently, a molecule with sequence homology to caspase-8 was
identified, termed cellular FLICE-inhibitory protein (c-FLIP). c-FLIP
has been controversially reported to possess apoptosis-promoting and
-inhibiting functions. Using c-FLIP-specific monoclonal antibodies, we
now show that c-FLIP is expressed in two isoforms, both of which, like
FADD and caspase-8, are recruited to the CD95 DISC in a
stimulation-dependent fashion. In stably transfected BJAB
cells, c-FLIP blocks caspase-8 activation at the DISC and thereby
inhibits CD95-mediated apoptosis. During this process, both caspase-8
and c-FLIP undergo cleavage between the p18 and p10 subunits,
generating two stable intermediates of 43 kDa that stay bound to the
DISC. c-FLIP has been suggested to play a role in protecting activated
peripheral T cells from CD95-mediated apoptosis (Irmler, M., Thome, M.,
Hahne, M., Schneider, P., Hofmann, K., Steiner, V., Bodmer, J. L.,
Schroter, M., Burns, K., Mattmann, C., Rimoldi, D., French, L. E.,
and Tschopp, J. (1997) Nature 388, 190-195). In contrast
to this hypothesis, neither caspase-8 nor c-FLIP were cleaved in these
cells, ruling out c-FLIP as the main factor regulating DISC activity.
Moreover, recruitment of FADD, caspase-8, and c-FLIP to the DISC was
strongly reduced in the apoptosis-resistant but readily detectable in
the apoptosis-sensitive T cells.
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
, MRIT, I-FLICE-L, c-FLIPlong, and
Casper (26, 28, 30-32).
-mercaptoethanol at 60 °C. Then the blots were washed six times
for 10 min in PBS/Tween and blocked again in 5% nonfat dry milk.
percentage of spontaneous
apoptosis)/(100 percentage of spontaneous apoptosis) × 100.
RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References
View larger version (62K):
[in a new window]
Fig. 1.
c-FLIP is the main expressed isoform in cell
lines representing different tissues. A, 50 µg of
cellular lysates of each indicated cell line were subjected to 12%
SDS-polyacrylamide gel electrophoresis and Western blot analysis using
NF6 anti-c-FLIP mAb. The same blot was stripped and developed with C15
anti-caspase-8 mAb (B) or anti-FADD mAb (C),
respectively. The cell lines represent the following histotypes: B
cells (BJAB, Raji, SKW6.4), T cells (H9, CEM, Jurkat), monocytes
(U937), kidney (293T), cervix (HeLa), breast (MCF-7), colon (HT29),
liver (HepG2), muscle (KYM-1), and lung (SCLC 16H, NCI N592).
View larger version (42K):
[in a new window]
Fig. 2.
c-FLIP overexpression blocks CD95-mediated
apoptosis by inhibiting caspase-8 processing. A, c-FLIP
expression of transfected BJAB cells. Cellular lysates of empty vector
(BJAB-control) or FLAG-c-FLIP-transfected BJAB cells
(BJAB-c-FLIP) were analyzed by Western blot analysis using NF6
anti-c-FLIP mAb. The transfected FLAG-tagged c-FLIP migrates with a
reduced mobility compared with the endogenous protein. B,
transfected BJAB cells were incubated with (+) or without ( )
anti-CD95 mAb cross-linked with protein A for 16 h. Apoptosis was
then measured by propidium iodide staining of nuclei. C and
D, time course of caspase-8 (C) and c-FLIP
(D) processing in BJAB-control and BJAB-c-FLIP cells. Cells
were stimulated with 1 µg/ml anti-CD95 mAb for the indicated periods
of time and subsequently lysed. Cleavage of caspase-8 and c-FLIP was
determined by Western blot analysis using the anti-caspase-8 mAb C15
and the anti-c-FLIP mAb NF6. Migration positions of caspase-8, the
active subunit p18, c-FLIP, and p43 of c-FLIP and their FLAG-tagged
counterparts are indicated.
View larger version (32K):
[in a new window]
Fig. 3.
c-FLIP is recruited to the CD95 DISC and
blocks its activity. A, BJAB cells transfected with
empty vector (BLAB-control) or FLAG-c-FLIP expression
plasmid (BJAB-c-FLIP) were triggered with 2 µg/ml
anti-CD95 antibody (anti-APO-1) for 5 min and then lysed (+), or
anti-CD95 was added after lysis ( ). CD95 DISC was then
immunoprecipitated using Protein A-Sepharose. The coimmunoprecipitated
c-FLIP was analyzed by Western blot analysis using anti-c-FLIP mAb NF6
(DISC). To analyze cellular lysates (lysate), BJAB-control cells were
treated for 15 min with anti-CD95 mAb (1 µg/ml) (+) or left untreated
(), lysed and analyzed by Western blotting. The migration positions
of full-length c-FLIP, c-FLIPshort, the processed p43 form,
and their FLAG-tagged counterparts are indicated. B,
schematic representation of the detected caspase-8 and c-FLIP forms.
C, the CD95 DISC was immunoprecipitated as described above
and analyzed for caspase-8 using the C15 mAb. Migration positions of
full-length caspase-8/a, caspase-8/b, and their intermediate cleavage
products p43 and p41 are indicated.
View larger version (56K):
[in a new window]
Fig. 4.
c-FLIP interacts with caspase-8 and FADD
only at the DISC. BJAB cells transfected with empty vector
(BJAB-control) or FLAG-c-FLIP expression plasmid
(BLAB-c-FLIP) were left untreated ( ) or stimulated with 1 µg/ml anti-CD95 mAb for 10 min (+) and subsequently lysed. c-FLIP was
then immunoprecipitated using the affinity-purified rabbit polyclonal
anti-c-FLIP antibody (rbAb) RF60 coupled to anti-rabbit IgG
beads. The immunoprecipitates (IP) were analyzed by Western
blotting (WB) using anti-c-FLIP mAb NF6 (A),
anti-caspase-8 mAb C15 (B), or anti-FADD mAb (C).
Migration positions of the detected proteins are indicated.
View larger version (41K):
[in a new window]
Fig. 5.
c-FLIP is not responsible for apoptosis
resistance of day 1 T cells. A, sensitivity of
activated T cells to CD95-mediated apoptosis. The sensitivity of
resting T cells (d0), T cells treated overnight with
phytohemagglutinin (d1), and T cells subsequently cultured
with 25 units/ml ( 
) or 100 units/ml (
) IL-2
(d2-d6) to CD95-mediated apoptosis was determined as
described under "Experimental Procedures." 30 µg of cellular
lysates were subjected to 12% SDS-polyacrylamide gel electrophoresis
and analyzed by Western blotting using C15 anti-caspase-8 or NF6
anti-c-FLIP mAbs. To normalize for equal protein loading, a Western
blot for mitogen-activated protein kinase using a monoclonal
anti-extracellular signal-regulated kinase-1 antibody was included.
Shown is the analysis with 25 units/ml IL-2. B and
C, purified d1 or d6 primary human T
cells were stimulated with anti-CD95 mAb (2 µg/ml) for the indicated
periods of time and subsequently lysed. 30 µg of cellular lysates
were subjected to 12% SDS-polyacrylamide gel electrophoresis and
analyzed by Western blotting using C15 anti-caspase-8 (B),
NF6 anti-c-FLIP (C), or polyclonal rabbit anti-extracellular
signal-regulated kinase-1/2 (C) antibodies. Migration
positions of the detected proteins are indicated. D, Western
blot analysis of the CD95 DISC of day 1 and day 6 T cells.
108 T cells were triggered for 1 min with 2 µg/ml
anti-CD95 mAb at 37 °C at a density of 2 × 106
cells/ml and subsequently lysed. CD95 DISC was immunoprecipitated using
protein A-Sepharose beads (+), and subsequently the unstimulated CD95
receptor was immunoprecipitated using anti-CD95 mAb covalently coupled
to cyanogenbromide-activated Sepharose beads (). Immunoprecipitates
were analyzed by Western blotting using anti-c-FLIP, anti-caspase-8,
and anti-FADD mAbs. Migration positions of the detected proteins are
indicated.
DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
View larger version (30K):
[in a new window]
Fig. 6.
Model for c-FLIP-mediated resistance to
CD95-induced apoptosis. A, triggering of CD95 with
agonistic anti-CD95 mAb leads to the recruitment of FADD and caspase-8
to the receptor. Binding of caspase-8 results in its activation by
autoproteolytic cleavage and the release of the active subunits. The
remaining caspase-8 prodomain is replaced by uncleaved procaspase-8,
which then starts a new activation cycle. B, in the presence
of c-FLIP, both caspase-8 and c-FLIP are recruited to the activated
receptor. After initial cleavage of both molecules, the cleavage
intermediates remain bound to the receptor and can no longer be
replaced by procaspase-8. This prevents caspase-8 activation and
renders the cell resistant to CD95-induced apoptosis.
(52). We have shown that day 6 T cells can
acquire a sensitive phenotype without IL-2-mediated down-regulation of
c-FLIP leading to strong caspase-8 activation at the DISC. In summary,
we have not found an indication that c-FLIP regulates the apoptosis
sensitivity of peripheral T cells. Future experiments will be aimed to
identify tissues that express low levels of CD95 in which endogenous
levels of c-FLIP regulate apoptosis sensitivity through death receptors
to find a physiological function of this molecule. However, the data
already show that overexpression of c-FLIP should be a novel tool to
protect certain therapeutically useful cells. One example would be to
prolong the lifetime of tumor-specific killer cells.
ACKNOWLEDGEMENTS
FOOTNOTES
These two authors contributed equally to this work.
converting enzyme; c-FLIP, cellular FLICE-inhibitory
protein; v-FLIP, viral FLICE-inhibitory protein; DED, death effector
domain; DISC, death-inducing signaling complex; mAb, monoclonal
antibody; IL-2, interleukin-2; PBS, phosphate-buffered saline.
REFERENCES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  M. Bagnoli, F. Ambrogi, S. Pilotti, P. Alberti, A. Ditto, M. Barbareschi, E. Galligioni, E. Biganzoli, S. Canevari, and D. Mezzanzanica c-FLIPL expression defines two ovarian cancer patient subsets and is a prognostic factor of adverse outcome Endocr. Relat. Cancer, June 1, 2009; 16(2): 443 - 453. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Meier, D. Golshayan, E. Blanc, M. Pascual, and M. Burnier Oxidized LDL Modulates Apoptosis of Regulatory T Cells in Patients with ESRD J. Am. Soc. Nephrol., June 1, 2009; 20(6): 1368 - 1384. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Shi, T. Tran, R. Sobkoviak, and R. M. Pope Activation-induced Degradation of FLIPL Is Mediated via the Phosphatidylinositol 3-Kinase/Akt Signaling Pathway in Macrophages J. Biol. Chem., May 22, 2009; 284(21): 14513 - 14523. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. W. Yu, P. D. Jeffrey, and Y. Shi Mechanism of procaspase-8 activation by c-FLIPL PNAS, May 19, 2009; 106(20): 8169 - 8174. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Pawar, L. Ma, C. H. Byon, H. Liu, E.-Y. Ahn, N. Jhala, J. P. Arnoletti, J. M. McDonald, and Y. Chen Molecular Mechanisms of Tamoxifen Therapy for Cholangiocarcinoma: Role of Calmodulin Clin. Cancer Res., February 15, 2009; 15(4): 1288 - 1296. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Haimerl, A. Erhardt, G. Sass, and G. Tiegs Down-regulation of the De-ubiquitinating Enzyme Ubiquitin-specific Protease 2 Contributes to Tumor Necrosis Factor-{alpha}-induced Hepatocyte Survival J. Biol. Chem., January 2, 2009; 284(1): 495 - 504. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. N. Lavrik, T. Mock, A. Golks, J. C. Hoffmann, S. Baumann, and P. H. Krammer CD95 Stimulation Results in the Formation of a Novel Death Effector Domain Protein-containing Complex J. Biol. Chem., September 26, 2008; 283(39): 26401 - 26408. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. P. Komarov, O. W. Rokhlin, C.-A. Yu, and A. V. Gudkov Functional genetic screening reveals the role of mitochondrial cytochrome b as a mediator of FAS-induced apoptosis PNAS, September 23, 2008; 105(38): 14453 - 14458. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Ueffing, M. Schuster, E. Keil, K. Schulze-Osthoff, and I. Schmitz Up-regulation of c-FLIPshort by NFAT contributes to apoptosis resistance of short-term activated T cells Blood, August 1, 2008; 112(3): 690 - 698. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Travert, P. Ame-Thomas, C. Pangault, A. Morizot, O. Micheau, G. Semana, T. Lamy, T. Fest, K. Tarte, and T. Guillaudeux CD40 Ligand Protects from TRAIL-Induced Apoptosis in Follicular Lymphomas through NF-{kappa}B Activation and Up-Regulation of c-FLIP and Bcl-xL J. Immunol., July 15, 2008; 181(2): 1001 - 1011. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Yang, P. K. Epling-Burnette, J. S. Painter, J. Zou, F. Bai, S. Wei, and T. P. Loughran Jr Antigen activation and impaired Fas-induced death-inducing signaling complex formation in T-large-granular lymphocyte leukemia Blood, February 1, 2008; 111(3): 1610 - 1616. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Orbach, J. Rachmilewitz, M. Parnas, J.-H. Huang, M. L. Tykocinski, and M. Dranitzki-Elhalel CTLA-4 {middle dot} FasL Induces Early Apoptosis of Activated T Cells by Interfering with Anti-Apoptotic Signals J. Immunol., December 1, 2007; 179(11): 7287 - 7294. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Fluhr, S. Krenzer, G. M. Stein, B. Stork, M. Deperschmidt, D. Wallwiener, S. Wesselborg, M. Zygmunt, and P. Licht Interferon-{gamma} and tumor necrosis factor-{alpha} sensitize primarily resistant human endometrial stromal cells to Fas-mediated apoptosis J. Cell Sci., December 1, 2007; 120(23): 4126 - 4133. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Hasegawa, Y. Yamada, K. Komiyama, M. Hayashi, M. Ishibashi, T. Sunazuka, T. Izuhara, K. Sugahara, K. Tsuruda, M. Masuda, et al. A novel natural compound, a cycloanthranilylproline derivative (Fuligocandin B), sensitizes leukemia cells to apoptosis induced by tumor necrosis factor related apoptosis-inducing ligand (TRAIL) through 15-deoxy-{Delta}12, 14 prostaglandin J2 production Blood, September 1, 2007; 110(5): 1664 - 1674. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. H. Song, M. C.L. Tse, A. Bellail, S. Phuphanich, F. Khuri, N. M. Kneteman, and C. Hao Lipid Rafts and Nonrafts Mediate Tumor Necrosis Factor Related Apoptosis-Inducing Ligand Induced Apoptotic and Nonapoptotic Signals in Non Small Cell Lung Carcinoma Cells Cancer Res., July 15, 2007; 67(14): 6946 - 6955. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. S. Misra, J. Q. Russell, A. Koenig, J. A. Hinshaw-Makepeace, R. Wen, D. Wang, H. Huo, D. R. Littman, U. Ferch, J. Ruland, et al. Caspase-8 and c-FLIPL Associate in Lipid Rafts with NF-{kappa}B Adaptors during T Cell Activation J. Biol. Chem., July 6, 2007; 282(27): 19365 - 19374. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Troeger, I. Schmitz, M. Siepermann, L. Glouchkova, U. Gerdemann, G. E. Janka-Schaub, K. Schulze-Osthoff, and D. Dilloo Up-regulation of c-FLIPS+R upon CD40 stimulation is associated with inhibition of CD95-induced apoptosis in primary precursor B-ALL Blood, July 1, 2007; 110(1): 384 - 387. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. R. Wilson, K. M. McLaughlin, M. McEwan, H. Sakai, K. M.A. Rogers, K. M. Redmond, P. G. Johnston, and D. B. Longley c-FLIP: A Key Regulator of Colorectal Cancer Cell Death Cancer Res., June 15, 2007; 67(12): 5754 - 5762. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Elmore Apoptosis: A Review of Programmed Cell Death Toxicol Pathol, June 1, 2007; 35(4): 495 - 516. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. A. Mawji, C. D. Simpson, R. Hurren, M. Gronda, M. A. Williams, J. Filmus, J. Jonkman, R. S. Da Costa, B. C. Wilson, M. P. Thomas, et al. Critical Role for Fas-Associated Death Domain-Like Interleukin-1-Converting Enzyme-Like Inhibitory Protein in Anoikis Resistance and Distant Tumor Formation J Natl Cancer Inst, May 16, 2007; 99(10): 811 - 822. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. M.A. Rogers, M. Thomas, L. Galligan, T. R. Wilson, W. L. Allen, H. Sakai, P. G. Johnston, and D. B. Longley Cellular FLICE-inhibitory protein regulates chemotherapy-induced apoptosis in breast cancer cells Mol. Cancer Ther., May 1, 2007; 6(5): 1544 - 1551. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Meinander, T. S. Soderstrom, A. Kaunisto, M. Poukkula, L. Sistonen, and J. E. Eriksson Fever-Like Hyperthermia Controls T Lymphocyte Persistence by Inducing Degradation of Cellular FLIPshort J. Immunol., March 15, 2007; 178(6): 3944 - 3953. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. J. Rautajoki, E. M. Marttila, T. A. Nyman, and R. Lahesmaa Interleukin-4 Inhibits Caspase-3 by Regulating Several Proteins in the Fas Pathway during Initial Stages of Human T Helper 2 Cell Differentiation Mol. Cell. Proteomics, February 1, 2007; 6(2): 238 - 251. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. L. Hyer, T. Samuel, and J. C. Reed The FLIP-Side of Fas Signaling Clin. Cancer Res., October 15, 2006; 12(20): 5929 - 5931. [Full Text] [PDF]
|
|
|
|
 |
|
 E. M. Jung, J.-W. Park, K. S. Choi, J.-W. Park, H. I. Lee, K.-S. Lee, and T. K. Kwon Curcumin sensitizes tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-mediated apoptosis through CHOP-independent DR5 upregulation Carcinogenesis, October 1, 2006; 27(10): 2008 - 2017. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Palacios, R. Yerbes, and A. Lopez-Rivas Flavopiridol Induces Cellular FLICE-Inhibitory Protein Degradation by the Proteasome and Promotes TRAIL-Induced Early Signaling and Apoptosis in Breast Tumor Cells. Cancer Res., September 1, 2006; 66(17): 8858 - 8869. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Abe, M.-A. Shibata, and Y. Otsuki Caspase cascade of Fas-mediated apoptosis in human normal endometrium and endometrial carcinoma cells Mol. Hum. Reprod., September 1, 2006; 12(9): 535 - 541. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. L. Snow, S. L. Lambert, Y. Natkunam, C. O. Esquivel, S. M. Krams, and O. M. Martinez EBV Can Protect Latently Infected B Cell Lymphomas from Death Receptor-Induced Apoptosis. J. Immunol., September 1, 2006; 177(5): 3283 - 3293. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. D. Austin, D. A. Lawrence, A. A. Peden, E. E. Varfolomeev, K. Totpal, A. M. De Maziere, J. Klumperman, D. Arnott, V. Pham, R. H. Scheller, et al. Death-receptor activation halts clathrin-dependent endocytosis PNAS, July 5, 2006; 103(27): 10283 - 10288. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Golks, D. Brenner, P. H. Krammer, and I. N. Lavrik The c-FLIP-NH2 terminus (p22-FLIP) induces NF-{kappa}B activation J. Exp. Med., May 15, 2006; 203(5): 1295 - 1305. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Krueger, S. C. Fas, M. Giaisi, M. Bleumink, A. Merling, C. Stumpf, S. Baumann, D. Holtkotte, V. Bosch, P. H. Krammer, et al. HTLV-1 Tax protects against CD95-mediated apoptosis by induction of the cellular FLICE-inhibitory protein (c-FLIP) Blood, May 15, 2006; 107(10): 3933 - 3939. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. H. Song, A. Bellail, M. C. L. Tse, V. W. Yong, and C. Hao Human astrocytes are resistant to Fas ligand and tumor necrosis factor-related apoptosis-inducing ligand-induced apoptosis. J. Neurosci., March 22, 2006; 26(12): 3299 - 3308. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Sohn, G. Totzke, F. Essmann, K. Schulze-Osthoff, B. Levkau, and R. U. Janicke The proteasome is required for rapid initiation of death receptor-induced apoptosis. Mol. Cell. Biol., March 1, 2006; 26(5): 1967 - 1978. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. D. Schimmer, M. P. Thomas, R. Hurren, M. Gronda, M. Pellecchia, G. R. Pond, M. Konopleva, D. Gurfinkel, I. A. Mawji, E. Brown, et al. Identification of Small Molecules that Sensitize Resistant Tumor Cells to Tumor Necrosis Factor-Family Death Receptors Cancer Res., February 15, 2006; 66(4): 2367 - 2375. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Maksimow, T. S. Soderstrom, S. Jalkanen, J. E. Eriksson, and A. Hanninen Fas costimulation of naive CD4 T cells is controlled by NF-{kappa}B signaling and caspase activity J. Leukoc. Biol., February 1, 2006; 79(2): 369 - 377. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Hasegawa, Y. Yamada, K. Komiyama, M. Hayashi, M. Ishibashi, T. Yoshida, T. Sakai, T. Koyano, T.-S. Kam, K. Murata, et al. Dihydroflavonol BB-1, an extract of natural plant Blumea balsamifera, abrogates TRAIL resistance in leukemia cells Blood, January 15, 2006; 107(2): 679 - 688. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Gilot, A.-L. Serandour, G. P. Ilyin, D. Lagadic-Gossmann, P. Loyer, A. Corlu, A. Coutant, G. Baffet, M. E. Peter, O. Fardel, et al. A role for caspase-8 and c-FLIPL in proliferation and cell-cycle progression of primary hepatocytes Carcinogenesis, December 1, 2005; 26(12): 2086 - 2094. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. M. Jung, J. H. Lim, T. J. Lee, J.-W. Park, K. S. Choi, and T. K. Kwon Curcumin sensitizes tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-induced apoptosis through reactive oxygen species-mediated upregulation of death receptor 5 (DR5) Carcinogenesis, November 1, 2005; 26(11): 1905 - 1913. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. E. Futter, J. G. Crowston, and B. D. S. Allan Interaction with Collagen IV Protects Lens Epithelial Cells from Fas-Dependent Apoptosis by Stimulating the Production of Soluble Survival Factors Invest. Ophthalmol. Vis. Sci., September 1, 2005; 46(9): 3256 - 3262. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. A. Barrington, M. Zhang, X. Zhong, H. Jonsson, N. Holodick, A. Cherukuri, S. K. Pierce, T. L. Rothstein, and M. C. Carroll CD21/CD19 Coreceptor Signaling Promotes B Cell Survival during Primary Immune Responses J. Immunol., September 1, 2005; 175(5): 2859 - 2867. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Pellegrini, S. Bath, V. S. Marsden, D. C. S. Huang, D. Metcalf, A. W. Harris, and A. Strasser FADD and caspase-8 are required for cytokine-induced proliferation of hemopoietic progenitor cells Blood, September 1, 2005; 106(5): 1581 - 1589. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Scotta, L. Tuosto, A. M. Masci, L. Racioppi, E. Piccolella, and L. Frasca Hypervariable region 1 variant acting as TCR antagonist affects hepatitis C virus-specific CD4+ T cell repertoire by favoring CD95-mediated apoptosis J. Leukoc. Biol., August 1, 2005; 78(2): 372 - 382. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Hashimoto, J. Nakajima-Shimada, and T. Aoki Trypanosoma cruzi Posttranscriptionally Up-Regulates and Exploits Cellular FLIP for Inhibition of Death-inducing Signal Mol. Biol. Cell, August 1, 2005; 16(8): 3521 - 3528. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Poukkula, A. Kaunisto, V. Hietakangas, K. Denessiouk, T. Katajamaki, M. S. Johnson, L. Sistonen, and J. E. Eriksson Rapid Turnover of c-FLIPshort Is Determined by Its Unique C-terminal Tail J. Biol. Chem., July 22, 2005; 280(29): 27345 - 27355. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. P. Beier, J. Wischhusen, M. Gleichmann, E. Gerhardt, A. Pekanovic, A. Krueger, V. Taylor, U. Suter, P. H. Krammer, M. Endres, et al. FasL (CD95L/APO-1L) Resistance of Neurons Mediated by Phosphatidylinositol 3-Kinase-Akt/Protein Kinase B-Dependent Expression of Lifeguard/Neuronal Membrane Protein 35 J. Neurosci., July 20, 2005; 25(29): 6765 - 6774. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. A. Sharp, D. A. Lawrence, and A. Ashkenazi Selective Knockdown of the Long Variant of Cellular FLICE Inhibitory Protein Augments Death Receptor-mediated Caspase-8 Activation and Apoptosis J. Biol. Chem., May 13, 2005; 280(19): 19401 - 19409. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Dohrman, T. Kataoka, S. Cuenin, J. Q. Russell, J. Tschopp, and R. C. Budd Cellular FLIP (Long Form) Regulates CD8+ T Cell Activation through Caspase-8-Dependent NF-{kappa}B Activation J. Immunol., May 1, 2005; 174(9): 5270 - 5278. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Q. Nhan, W. C. Liles, and S. M. Schwartz Role of Caspases in Death and Survival of the Plaque Macrophage Arterioscler. Thromb. Vasc. Biol., May 1, 2005; 25(5): 895 - 903. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Golks, D. Brenner, C. Fritsch, P. H. Krammer, and I. N. Lavrik c-FLIPR, a New Regulator of Death Receptor-induced Apoptosis J. Biol. Chem., April 15, 2005; 280(15): 14507 - 14513. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Bosque, J. Pardo, M{a} J. Martinez-Lorenzo, M. Iturralde, I. Marzo, A. Pineiro, M{a} A. Alava, J. Naval, and A. Anel Down-regulation of normal human T cell blast activation: roles of APO2L/TRAIL, FasL, and c- FLIP, Bim, or Bcl-x isoform expression J. Leukoc. Biol., April 1, 2005; 77(4): 568 - 578. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. S. Misra, D. M. Jelley-Gibbs, J. Q. Russell, G. Huston, S. L. Swain, and R. C. Budd Effector CD4+ T Cells Generate Intermediate Caspase Activity and Cleavage of Caspase-8 Substrates J. Immunol., April 1, 2005; 174(7): 3999 - 4009. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Song and C. O. Jacob The Mouse Cell Surface Protein TOSO Regulates Fas/Fas Ligand-induced Apoptosis through Its Binding to Fas-associated Death Domain J. Biol. Chem., March 11, 2005; 280(10): 9618 - 9626. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-E. Kim and S. R. Tannenbaum Insulin Regulates Cleavage of Procaspase-9 via Binding of X Chromosome-Linked Inhibitor of Apoptosis Protein in HT-29 Cells Cancer Res., December 15, 2004; 64(24): 9070 - 9075. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Marconi, P. Atzei, C. Panza, C. Fila, R. Tiberio, F. Truzzi, T. Wachter, M. Leverkus, and C. Pincelli FLICE/caspase-8 activation triggers anoikis induced by {beta}1-integrin blockade in human keratinocytes J. Cell Sci., November 15, 2004; 117(24): 5815 - 5823. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A Sturm, A Z A Leite, S Danese, K A Krivacic, G A West, S Mohr, J W Jacobberger, and C Fiocchi Divergent cell cycle kinetics underlie the distinct functional capacity of mucosal T cells in Crohn's disease and ulcerative colitis Gut, November 1, 2004; 53(11): 1624 - 1631. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Naito, R. Katayama, T. Ishioka, A. Suga, K. Takubo, M. Nanjo, C. Hashimoto, M. Taira, S. Takada, R. Takada, et al. Cellular FLIP Inhibits {beta}-Catenin Ubiquitylation and Enhances Wnt Signaling Mol. Cell. Biol., October 1, 2004; 24(19): 8418 - 8427. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. D. Bannerman, K. T. Eiting, R. K. Winn, and J. M. Harlan FLICE-Like Inhibitory Protein (FLIP) Protects Against Apoptosis and Suppresses NF-{kappa}B Activation Induced by Bacterial Lipopolysaccharide Am. J. Pathol., October 1, 2004; 165(4): 1423 - 1431. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-H. Kim, J.-W. Park, J.-Y. Lee, and T. K. Kwon Sodium butyrate sensitizes TRAIL-mediated apoptosis by induction of transcription from the DR5 gene promoter through Sp1 sites in colon cancer cells Carcinogenesis, October 1, 2004; 25(10): 1813 - 1820. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Shah and P. W. Sylvester Tocotrienol-Induced Caspase-8 Activation Is Unrelated to Death Receptor Apoptotic Signaling in Neoplastic Mammary Epithelial Cells Experimental Biology and Medicine, September 1, 2004; 229(8): 745 - 755. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Raftery, D. Wieland, S. Gronewald, A. A. Kraus, T. Giese, and G. Schonrich Shaping Phenotype, Function, and Survival of Dendritic Cells by Cytomegalovirus-Encoded IL-10 J. Immunol., September 1, 2004; 173(5): 3383 - 3391. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Mezzanzanica, E. Balladore, F. Turatti, E. Luison, P. Alberti, M. Bagnoli, M. Figini, A. Mazzoni, F. Raspagliesi, M. Oggionni, et al. CD95-Mediated Apoptosis Is Impaired at Receptor Level by Cellular FLICE-Inhibitory Protein (Long Form) in Wild-Type p53 Human Ovarian Carcinoma Clin. Cancer Res., August 1, 2004; 10(15): 5202 - 5214. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Morath, M. Mueller, H. Goldschmidt, V. Schwenger, G. Opelz, and M. Zeier Malignancy in Renal Transplantation J. Am. Soc. Nephrol., June 1, 2004; 15(6): 1582 - 1588. [Full Text] [PDF]
|
|
|
|
|
|
Z. Wu, M. Roberts, M. Porter, F. Walker, E. J. Wherry, J. Kelly, M. Gadina, E. M. Silva, G. A. DosReis, M. F. Lopes, et al. Viral FLIP Impairs Survival of Activated T Cells and Generation of CD8+ T Cell Memory J. Immunol., May 15, 2004; 172(10): 6313 - 6323. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Conticello, F. Pedini, A. Zeuner, M. Patti, M. Zerilli, G. Stassi, A. Messina, C. Peschle, and R. De Maria IL-4 Protects Tumor Cells from Anti-CD95 and Chemotherapeutic Agents via Up-Regulation of Antiapoptotic Proteins J. Immunol., May 1, 2004; 172(9): 5467 - 5477. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Kataoka and J. Tschopp N-Terminal Fragment of c-FLIP(L) Processed by Caspase 8 Specifically Interacts with TRAF2 and Induces Activation of the NF-{kappa}B Signaling Pathway Mol. Cell. Biol., April 1, 2004; 24(7): 2627 - 2636. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Schmitz, H. Weyd, A. Krueger, S. Baumann, S. C. Fas, P. H. Krammer, and S. Kirchhoff Resistance of Short Term Activated T Cells to CD95-Mediated Apoptosis Correlates with De Novo Protein Synthesis of c-FLIPshort J. Immunol., February 15, 2004; 172(4): 2194 - 2200. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Aouad, L. Y. Cohen, E. Sharif-Askari, E. K. Haddad, A. Alam, and R.-P. Sekaly Caspase-3 Is a Component of Fas Death-Inducing Signaling Complex in Lipid Rafts and Its Activity Is Required for Complete Caspase-8 Activation during Fas-Mediated Cell Death J. Immunol., February 15, 2004; 172(4): 2316 - 2323. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Wang, Y. Zhou, H. P. Kim, R. Song, R. Zarnegar, S. W. Ryter, and A. M. K. Choi Hepatocyte Growth Factor Protects against Hypoxia/Reoxygenation-induced Apoptosis in Endothelial Cells J. Biol. Chem., February 13, 2004; 279(7): 5237 - 5243. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Skurk, H. Maatz, H.-S. Kim, J. Yang, M. R. Abid, W. C. Aird, and K. Walsh The Akt-regulated Forkhead Transcription Factor FOXO3a Controls Endothelial Cell Viability through Modulation of the Caspase-8 Inhibitor FLIP J. Biol. Chem., January 9, 2004; 279(2): 1513 - 1525. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L.-W. Fang, T.-S. Tai, W.-N. Yu, F. Liao, and M.-Z. Lai Phosphatidylinositide 3-Kinase Priming Couples c-FLIP to T Cell Activation J. Biol. Chem., January 2, 2004; 279(1): 13 - 18. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. K. A. Mongini, A. E. Jackson, S. Tolani, R. J. Fattah, and J. K. Inman Role of Complement-Binding CD21/CD19/CD81 in Enhancing Human B Cell Protection from Fas-Mediated Apoptosis J. Immunol., November 15, 2003; 171(10): 5244 - 5254. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Q. Wang, T. Quan, T. He, T. F. Franke, J. J. Voorhees, and G. J. Fisher Epidermal Growth Factor Receptor-dependent, NF-{kappa}B-independent Activation of the Phosphatidylinositol 3-Kinase/Akt Pathway Inhibits Ultraviolet Irradiation-induced Caspases-3, -8, and -9 in Human Keratinocytes J. Biol. Chem., November 14, 2003; 278(46): 45737 - 45745. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Gnesutta and A. Minden Death Receptor-Induced Activation of Initiator Caspase 8 Is Antagonized by Serine/Threonine Kinase PAK4 Mol. Cell. Biol., November 1, 2003; 23(21): 7838 - 7848. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Gati, N. Guerra, C. Gaudin, S. Da Rocha, B. Escudier, Y. Lecluse, A. Bettaieb, S. Chouaib, and A. Caignard CD158 Receptor Controls Cytotoxic T-Lymphocyte Susceptibility to Tumor-Mediated Activation-Induced Cell Death by Interfering with Fas Signaling Cancer Res., November 1, 2003; 63(21): 7475 - 7482. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Zazzeroni, S. Papa, A. Algeciras-Schimnich, K. Alvarez, T. Melis, C. Bubici, N. Majewski, N. Hay, E. De Smaele, M. E. Peter, et al. Gadd45{beta} mediates the protective effects of CD40 costimulation against Fas-induced apoptosis Blood, November 1, 2003; 102(9): 3270 - 3279. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. J. Panka and J. W. Mier Canstatin Inhibits Akt Activation and Induces Fas-dependent Apoptosis in Endothelial Cells J. Biol. Chem., September 26, 2003; 278(39): 37632 - 37636. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Schmitz, A. Krueger, S. Baumann, H. Schulze-Bergkamen, P. H. Krammer, and S. Kirchhoff An IL-2-Dependent Switch Between CD95 Signaling Pathways Sensitizes Primary Human T Cells Toward CD95-Mediated Activation-Induced Cell Death J. Immunol., September 15, 2003; 171(6): 2930 - 2936. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. H. Song, D. K. Song, M. Herlyn, K. C. Petruk, and C. Hao Cisplatin Down-Regulation of Cellular Fas-associated Death Domain-like Interleukin-1{beta}-converting Enzyme-like Inhibitory Proteins to Restore Tumor Necrosis Factor-related Apoptosis-inducing Ligand-induced Apoptosis in Human Melanoma Cells Clin. Cancer Res., September 15, 2003; 9(11): 4255 - 4266. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Leverkus, A. D. McLellan, M. Heldmann, A. O. Eggert, E.-B. Brocker, N. Koch, and E. Kampgen MHC class II-mediated apoptosis in dendritic cells: a role for membrane-associated and mitochondrial signaling pathways Int. Immunol., August 1, 2003; 15(8): 993 - 1006. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. H. Kim, M. Ajaz, A. Lokshin, and Y. J. Lee Role of Antiapoptotic Proteins in Tumor Necrosis Factor-related Apoptosis-inducing Ligand and Cisplatin-augmented Apoptosis Clin. Cancer Res., August 1, 2003; 9(8): 3134 - 3141. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Liedtke, N. Groger, M. P. Manns, and C. Trautwein The Human Caspase-8 Promoter Sustains Basal Activity through SP1 and ETS-like Transcription Factors and Can Be Up-regulated by a p53-dependent Mechanism J. Biol. Chem., July 18, 2003; 278(30): 27593 - 27604. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. L. Aron, M. R. Parthun, G. Marcucci, S. Kitada, A. P. Mone, M. E. Davis, T. Shen, T. Murphy, J. Wickham, C. Kanakry, et al. Depsipeptide (FR901228) induces histone acetylation and inhibition of histone deacetylase in chronic lymphocytic leukemia cells concurrent with activation of caspase 8-mediated apoptosis and down-regulation of c-FLIP protein Blood, July 15, 2003; 102(2): 652 - 658. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Grambihler, H. Higuchi, S. F. Bronk, and G. J. Gores cFLIP-L Inhibits p38 MAPK Activation: AN ADDITIONAL ANTI-APOPTOTIC MECHANISM IN BILE ACID-MEDIATED APOPTOSIS J. Biol. Chem., July 11, 2003; 278(29): 26831 - 26837. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. D. Bannerman and S. E. Goldblum Mechanisms of bacterial lipopolysaccharide-induced endothelial apoptosis Am J Physiol Lung Cell Mol Physiol, June 1, 2003; 284(6): L899 - L914. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Munoz-Pinedo, C. Ruiz-Ruiz, C. Ruiz de Almodovar, C. Palacios, and A. Lopez-Rivas Inhibition of Glucose Metabolism Sensitizes Tumor Cells to Death Receptor-triggered Apoptosis through Enhancement of Death-inducing Signaling Complex Formation and Apical Procaspase-8 Processing J. Biol. Chem., April 4, 2003; 278(15): 12759 - 12768. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Newton and A. Strasser Caspases signal not only apoptosis but also antigen-induced activation in cells of the immune system Genes & Dev., April 1, 2003; 17(7): 819 - 825. [Full Text] [PDF]
|
|
|
|
|
|
J. Zhang, T. Bardos, Q. Shao, J. Tschopp, K. Mikecz, T. T. Glant, and A. Finnegan IL-4 Potentiates Activated T Cell Apoptosis Via an IL-2-Dependent Mechanism J. Immunol., April 1, 2003; 170(7): 3495 - 3503. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. W. Lee, Y. Park, J. K. Yoo, S. Y. Choi, and Y. C. Sung Inhibition of TCR-Induced CD8 T Cell Death by IL-12: Regulation of Fas Ligand and Cellular FLIP Expression and Caspase Activation by IL-12 J. Immunol., March 1, 2003; 170(5): 2456 - 2460. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. F. Yang, C. Xiao, W. H. Roa, P. H. Krammer, and C. Hao Calcium/Calmodulin-dependent Protein Kinase II Regulation of c-FLIP Expression and Phosphorylation in Modulation of Fas-mediated Signaling in Malignant Glioma Cells J. Biol. Chem., February 21, 2003; 278(9): 7043 - 7050. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Perez and E. White E1A Sensitizes Cells to Tumor Necrosis Factor Alpha by Downregulating c-FLIPS J. Virol., February 15, 2003; 77(4): 2651 - 2662. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Hietakangas, M. Poukkula, K. M. Heiskanen, J. T. Karvinen, L. Sistonen, and J. E. Eriksson Erythroid Differentiation Sensitizes K562 Leukemia Cells to TRAIL-Induced Apoptosis by Downregulation of c-FLIP Mol. Cell. Biol., February 15, 2003; 23(4): 1278 - 1291. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Djerbi, K.-B. Abdul-Majid, M. Abedi-Valugerdi, T. Olsson, R. A. Harris, and A. Grandien Expression of the Long Form of Human FLIP by Retroviral Gene Transfer of Hemopoietic Stem Cells Exacerbates Experimental Autoimmune Encephalomyelitis J. Immunol., February 15, 2003; 170(4): 2064 - 2073. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I.-J. Chung, C. Dai, and S. B. Krantz Stem cell factor increases the expression of FLIP that inhibits IFNgamma -induced apoptosis in human erythroid progenitor cells Blood, February 15, 2003; 101(4): 1324 - 1328. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Leverkus, M. R. Sprick, T. Wachter, T. Mengling, B. Baumann, E. Serfling, E.-B. Brocker, M. Goebeler, M. Neumann, and H. Walczak Proteasome Inhibition Results in TRAIL Sensitization of Primary Keratinocytes by Removing the Resistance-Mediating Block of Effector Caspase Maturation Mol. Cell. Biol., February 1, 2003; 23(3): 777 - 790. [Abstract] [Full Text]
|
|
|
|
|
|
H. Higuchi, J.-H. Yoon, A. Grambihler, N. Werneburg, S. F. Bronk, and G. J. Gores Bile Acids Stimulate cFLIP Phosphorylation Enhancing TRAIL-mediated Apoptosis J. Biol. Chem., January 3, 2003; 278(1): 454 - 461. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Mor, E. Sapi, V. M. Abrahams, T. Rutherford, J. Song, X.-Y. Hao, S. Muzaffar, and F. Kohen Interaction of the Estrogen Receptors with the Fas Ligand Promoter in Human Monocytes J. Immunol., January 1, 2003; 170(1): 114 - 122. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Steenbergen, C. A. Afshari, J. G. Petranka, J. Collins, K. Martin, L. Bennett, A. Haugen, P. Bushel, and E. Murphy Alterations in apoptotic signaling in human idiopathic cardiomyopathic hearts in failure Am J Physiol Heart Circ Physiol, January 1, 2003; 284(1): H268 - H276. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Ducoroy, O. Micheau, S. Perruche, L. Dubrez-Daloz, D. de Fornel, P. Dutartre, P. Saas, and E. Solary LF 15-0195 immunosuppressive agent enhances activation-induced T-cell death by facilitating caspase-8 and caspase-10 activation at the DISC level Blood, January 1, 2003; 101(1): 194 - 201. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Nitobe, S. Yamaguchi, M. Okuyama, N. Nozaki, M. Sata, T. Miyamoto, Y. Takeishi, I. Kubota, and H. Tomoike Reactive oxygen species regulate FLICE inhibitory protein (FLIP) and susceptibility to Fas-mediated apoptosis in cardiac myocytes Cardiovasc Res, January 1, 2003; 57(1): 119 - 128. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |