J Biol Chem, Vol. 274, Issue 3, 1557-1565, January 15, 1999
The 100-kDa 2',5'-Oligoadenylate Synthetase Catalyzing
Preferentially the Synthesis of Dimeric pppA2'p5'A Molecules Is
Composed of Three Homologous Domains*
Dominique
Rebouillat
,
Alain
Hovnanian§,
Isabelle
Marié
, and
Ara G.
Hovanessian
¶
From the
Unité de Virologie et Imunologie
Cellulaire, ERS CNRS 572, Institut Pasteur, 75724 Paris Cédex 15, France and the § Wellcome Trust Centre for Human Genetics,
University of Oxford, Oxford OX1 2JD, United Kingdom
 |
ABSTRACT |
The 2-5A synthetases represent a family of
proteins implicated in the mechanism of the antiviral action of
interferon. When activated by double-stranded RNA, these proteins
polymerize ATP into 2'-5'-linked oligomers with the general formula
pppA(2'p5'A)n, n
1. Three
forms of human 2-5A synthetases have been described corresponding to
proteins of 40/46 (p40/p46), 69/71 (p69/p71), and 100 kDa (p100). Here
we describe the molecular cloning and characterization of p100. By
screening a cDNA expression library with a specific p100 polyclonal
antibody, we first isolated a 590-nucleotide cDNA fragment which
was subsequently used to isolate the full-length 6365-nucleotide
cDNA. This cDNA recognizes a distinct interferon-induced
messenger RNA of 7 kilobases. It has an open reading frame encoding a
protein of 1087 amino acids including the sequence of seven peptides
obtained by microsequencing of the natural p100 protein, which was
purified from interferon-treated human cells. p100 is composed of three
adjacent domains, each homologous to the previously defined catalytic
unit of 350 amino acids, which is present as one unit in p40/p46 and as
two units in p69/p71. The recombinant p100 synthesized preferentially
dimeric 2',5'-oligoadenylate molecules and displayed parameters for
maximum enzyme activity similar to the natural p100. These results
confirm that the enzymatic activity of p100 is distinct compared with that of p40/p46 and p69/p71.
 |
INTRODUCTION |
The 2-5A
synthetases1 are
interferon-induced proteins characterized by their capacity to catalyze
the synthesis of 2',5'-linked oligomers of adenosine from ATP with the
general formula pppA(2'p5'A)n, where
n
1 (1, 2). This mixture of oligonucleotides is referred to as 2-5A, and the enzymes that synthesize it are referred to under the generic term 2-5A synthetase (3) or as
2',5'-oligoadenylate synthetase (2',5'-OAS). Currently, the only known
function of 2-5A is to bind and activate a latent endoribonuclease
responsible for the degradation of viral and cellular RNAs (4, 5). This leads to inhibition of cellular protein synthesis, thus impairing viral
replication (for reviews see Refs. 6-8). The action of 2-5A in cells
is transient (9) because of a phosphodiesterase that cleaves
preferentially 2',5'-linked oligonucleotides (10). In vitro,
the synthesis of 2-5A requires activation of the 2',5'-OAS by
double-stranded (ds) RNA or single-stranded RNA with a defined secondary structure, such as the 5'-untranslated region of all human
immunodeficiency virus mRNAs that contains a stem-loop structure (11, 12). In intact cells or tissues, the 2',5'-OAS can become activated during virus infections due to the presence of genomic viral
dsRNA molecules, or as a result of the production of viral dsRNA
replicative intermediates during virus replication (13, 14). The
2',5'-OAS is present in most mammalian cells and tissues (15, 16).
Natural occurrence of 2-5A has clearly been demonstrated in
interferon-treated cells infected with EMCV (13), and results from
several laboratories have suggested that the 2-5A system (the OAS,
2-5A, and the endoribonuclease) plays a role, at least in part, in the
mechanism of the antiviral and antiproliferative action of interferon
(6-8, 17-20).
Three major forms of 2',5'-OAS have been described in
interferon-treated human cells corresponding to proteins of 40/46,
69/71, and 100 kDa (p40/p46, p69/p71, and p100, respectively; Refs.
21-24). The two isoforms p40/p46, are encoded by the same gene; they
are identical for their first 346 amino acids but have different
carboxyl termini generated by differential splicing (25-27).
Similarly, p69/p71 gathers two isoforms sharing a common amino terminus
of 683 residues but with different carboxyl termini, probably generated by differential splicing (28). Each form of human OAS is induced by
interferon
,
, and
, but in some cells there might be
differential expression and induction by interferon (21-23, 29-31).
The p40/p46 and p69/p71 are found to be associated with different
subcellular fractions such as mitochondrial, nuclear, and rough/smooth
microsomal fractions, whereas p100 is mainly associated with the
ribosomal fraction (21, 22, 24, 32). Ultrustructural localization studies on p69/p71 and p100 have confirmed their presence in the nucleus (33). Only p69/p71 is myristoylated (29), and, consistent with
this, this form of OAS has been found to be associated with the nuclear
and plasma membranes (29, 33). Interestingly, the three forms of OAS
have distinct enzymatic parameters thus suggesting that they might have
specific functions (21-23, 29-31, 34). In addition to the synthesis
of 2-5A molecules, partially purified OAS preparations have been shown
to catalyze in vitro the transfer of a nucleotide
monophosphate moiety to the 2'-OH end of a preformed 2-5A molecule or
to a nucleotide with the structure RpA like NAD+,
Ap4A, and tRNA (35-38). However, biological relevance of
these latter modified nucleotides is not yet clear. Moreover, GTP could be an alternative substrate for OAS p69 or P100 to catalyze the 2'-5'
transfer of a GMP moiety to a GTP molecule other than to a nucleotide
with the structure RpA (34). This latter observation is in agreement
with some reports suggesting a role for p100 in pre-messenger RNA
splicing (39).
In this article, we purified p100 from interferon
-treated human
Daudi cells, and after digestion with endo-lysine C the sequence of
several peptides was obtained by microsequencing. In parallel, by using
polyclonal antibodies specific to p100, we isolated a cDNA fragment
corresponding to p100 by screening an expression cDNA library
constructed with mRNAs from interferon-treated Daudi cells. The
identity of this isolated cDNA as that of p100 was confirmed by the
presence of the peptide sequences of the natural p100. Full-length
cDNA encoding p100 was achieved by screening additional cDNA
libraries and by RT-PCR approaches. The deduced amino acid sequence
from this cDNA revealed its tripartite nature compared with the
bipartite nature of p69/p71. Expression of the full-length cDNA
generated a 100-kDa protein, which was recognized by polyclonal and
monoclonal antibodies against p100, and manifested enzymatic activity
similar to the natural p100 from interferon-treated human cells.
 |
MATERIALS AND METHODS |
Reagents--
[
-32P]ATP (10 µCi/sample; 3000 Ci/mmol), [
-32P]ATP (10 µCi/sample; >5000 Ci/mmol),
poly(I)·poly(C), and protein A-agarose were purchased from Amersham
Pharmacia Biotech. TNT® coupled reticulocyte lysate system
for coupled transcription translation of cDNAs was purchased from
Promega. The monoclonal antibody (M2) against the FLAG marker peptide
was purchased from Kodak Scientific Imaging Systems, New Haven, CT.
Monoclonal antibody against the V5 epitope was purchased from
Invitrogen BV.
Monoclonal antibodies HLS 56/3 and 25/11, developed in our laboratory,
are specific for p69/p71 and p100 forms of 2',5'-OAS, respectively
(21). Ascitic fluid corresponding to this monoclonal antibody was
purified by affinity chromatography on protein A-agarose according to
the procedure recommended by the manufacturer (P. L. Biochemicals). The immunoaffinity-purified p100 preparations from
interferon
-treated Daudi cells were used to raise polyclonal antibodies in mice as described (31).
Cell Culture and Extracts--
Daudi cells were grown in
suspension in RPMI 1640 medium containing 10% fetal calf serum. HeLa
cells were grown in monolayer cultures in Dulbecco's medium containing
10% fetal calf serum. For treatment of cells with interferon,
exponentially growing cells were exposed to 1000 units/ml recombinant
interferon (specific activity, 108 IU/mg), either
(Roche, Basel, Switzerland) or
(Triton/Berlix Laboratories, Alamada
CA), or
interferon (specific activity, 2.5 × 107
IU/mg; Biogen, Cambridge MA) for 18-20 h for the preparation of cell
extracts or as indicated. Cell extracts were prepared by lysis of cells
in buffer I containing 20 mM Tris-HCl, pH 7.6, 50 mM KCl, 400 mM NaCl, 5 mM
2-mercaptoethanol, 1% Triton X-100, 1 mM EDTA, 0.2 mM phenylmethylsulfonyl fluoride, 100 units/ml aprotinin,
and 20% glycerol (v/v) as described (21).
Microsequencing of the Purified p100--
By affinity
chromatography using monoclonal antibody 25/11, p100 was purified from
extracts of interferon
-treated Daudi cells (109 cells).
The purified sample was eluted in electrophoresis sample buffer and
assayed by 7.5% polyacrylamide gel electrophoresis, the band
corresponding to p100 (about 100 µg; visualized after a slight
staining with Amido Black) was excised and was analyzed by
microsequencing after digestion with endo-lysine C, which cleaves peptides adjacent to lysine residues. The peptides were purified by a
high performance liquid chromatography column (DEAE-C18) using a
gradient of acetonitrile/trifluoroacetic acid (0.1%). The
microsequencing was carried out by the Micro-Sequencing Laboratory at
Institut Pasteur.
cDNA Libraries--
Oligo(dT) or random-primed cDNA
libraries in
gt10 and
gt11 were constructed using
polyadenylated RNA from a interferon
-treated Daudi cells (40).
The
gt11 cDNA library made of mRNA from human keratinocytes
was generously provided by Dr. Fiona Watt (Imperial Cancer
Research Fund, London, United Kingdom).
Isolation of cDNA Clones--
The
gt11 random-primed
expression cDNA library (6.0 × 105 plaques) was
screened using p100-specific murine polyclonal antibodies at 1:50
dilution and 125I-labeled goat anti-mouse antibodies. In
order to improve the specificity of the antigen-antibody reaction,
nitrocellulose filters after the plaque lift were processed by a
denaturation-renaturation procedure, in which the filters were
incubated successively in guanidine-HCl buffer at 1, 0.75, 0.5, and 0.1 N. Screening of the keratinocyte cDNA library was
performed using a cosmid clones containing the cluster of 2',5'-OAS
genes (41).
Construction of Library from a PAC Clone--
1 µg of DNA of a
PAC clone containing the gene encoding p100 (41) (PAC P336L20; from the
human PAC genomic library developed by P. de Jong) was digested by
XhoI following the manufacturer's recommendations (New
England Biolabs). Products of digestion were then subcloned in pBS(SK)
into the XhoI site. Positives clones containing the 5'
missing region of p100 were revealed by screening using a labeled
oligonucleotide located in the 5' part of the cDNA REB2
(198AGCACCCGCGGGGCAGCAGCAC177).
RT-PCR Conditions--
Total cytoplasmic RNA was prepared from
interferon
-treated HeLa cells using the RNAzol reagent. Briefly, 5 µg of total RNA were heat-denatured at 95 °C, then a reverse
transcription was carried out with the GSP3 primer located in the
cDNA 3A1
(2555AGATGATCTCGGCCCGCTTGTTGCC2531) at 42 °C
using 10 units of Moloney murine leukemia virus reverse transcriptase
(Boehringer Mannheim) in a total reaction volume of 25 µl. Five µl
of the resultant first-strand cDNA were amplified in 50-µl PCR
reactions using combination of the forward specific GSP1 primer located
in cDNA REB2 (724ATTGCTGACCATCTTCGCCTG744)
and the reverse GSP2 primer located in cDNA 3A1
(2435TGACCACCTTGATCACTTTGA2415). Amplification
conditions were as follows: 30 cycles at 94 °C for 30 s,
55 °C for 30 s, 72 °C for 1 min, followed by an extension step at 72 °C for 10 min. Vent polymerase (Biolabs) with higher fidelity than that observed for Taq DNA polymerase was used
for amplification reactions. PCR products were analyzed by
electrophoresis in 1.2% agarose gels. An addition of a single
adenosine at the 3' of the fragment was performed using Taq
polymerase (Cetus) as described previously (42). The fragment was
gel-purified and ligated directly into a plasmid pTAG vector (R & D
Systems). The resultant clones were characterized by sequencing.
Nucleotide Sequence Analysis--
DNA sequences were determined
by the Sanger dideoxy sequencing method using double-stranded DNA as a
template and SequenaseTM II as polymerase.
Northern Blot Analysis--
Total cytoplasmic RNA was prepared
by the single-step method of extraction (RNAzol-Bioprobe) according to
a procedure recommended by the manufacturer. Polyadenylated RNAs were
isolated from total cytoplasmic RNA using spun column (Amersham
Pharmacia Biotech kit). For Northern blot analysis, total RNA or
polyadenylated RNAs were size-fractionated in 1% agarose, 2.2 M formaldehyde gels and transferred to nylon membrane
(Hybond N+, Amersham Pharmacia Biotech). Membranes were
hybridized in RHS buffer (Amersham Pharmacia Biotech) at 55 °C for
2 h in the presence of 106 cpm/ml of
32P-random-primed cDNA probe (Megaprime, Amersham
Pharmacia Biotech). Membranes were washed in 0.1×x SSC at 55 °C. A
human glyceraldehyde-3-phosphate dehydrogenase probe was used to
rehybridize membranes and monitor that all lanes contained equivalent
amounts of RNA.
Construction of Plasmids Expressing Tagged
Proteins--
Full-length cDNA encoding p100 was subcloned in
pBS-SK (Stratagene) and then cloned in the vector pcDNAV53.1
(version A; Invitrogen) into the HindIII and ApaI
sites. The resulting expression vector was composed of the open reading
frame encoding p100 fused to the V5 epitope without 3'-noncoding
region. The vector pNeoSRaIII containing the full-length cDNA
encoding p69 2',5'-OAS fused to the FLAG epitope has been described
previously (33).
2',5'-OAS Activity Assay--
The activity of the natural forms
of p69/p71 and p100 2',5'-OAS could be efficiently assayed after
immunoprecipitation when incubated with dsRNA and ATP (21, 23). For the
recombinant proteins, the 2',5'-OAS activity was monitored after
immunoprecipitation of the tagged proteins p69FLAG or p100V5 using the
monoclonal antibody M2 specific to the FLAG epitope or the monoclonal
antibody specific to the V5 epitope, respectively. Extracts from
transfected cells (5 × 105) were incubated (2 h,
4 °C) with the monoclonal antibody M2 or anti-V5 coupled to agarose.
The binding was carried out in buffer I before washing extensively with
buffer I (three washes each representing at least 150 times the volume
of protein A-agarose) and buffer II (two washes): 10 mM
Hepes, pH 7.6, 50 mM KCl, 1 mM
MgCl2, 7 mM 2-mercaptoethanol, and 20%
glycerol (v/v). Cell extract volumes were adjusted in order to obtain
similar amounts of purified p69 and p100. The purified proteins,
immunoprecipitated using 50 µl of the antibody-agarose, were
incubated in the 2-5A reaction mixture (100 µl) containing 20 mM Hepes, 50 mM KCl, 25 mM
Mg(OAc)2, 7 mM 2-mercaptoethanol, 5 mM ATP, 10 mM creatine phosphate, 0.16 mg/ml
creatine kinase, 100 µg/ml poly(I)·poly(C), and
[
-32P]ATP or [
-32P]ATP (10 µCi/sample). The pH of the reaction mixture was adjusted to 6.5 and
7.5 for p69/p71 and p100 activity assays, respectively. The reaction
was stopped by heating (95 °C, 5 min), and the 2-5A products were
analyzed by electrophoresis on 20% polyacrylamide gels containing 7 M urea as described (34, 43).
Tranfections and Immunofluorescence--
Cells (106)
were transfected with 10 µg of DNA by calcium phosphate precipitation
using Hepes-buffered saline and standard protocols (44). After 48 h, cells were washed twice with phosphate-buffered saline, fixed for 10 min with paraformaldehyde in CSK buffer (10 mM PIPES, pH
6.8, 100 mM NaCl, 300 mM sucrose, 3 mM MgCl2, 2 mM EDTA) before
incubating (5 min) in phosphate-buffered saline containing 0.5% Triton
X-100 in order to permeabilize the cell membranes. Immunofluorescence
staining was carried out as described previously (45). Monoclonal
antibody anti-V5 or monoclonal antibody 25/11 specific for p100 were
used to reveal localization of recombinant p100-V5 or natural p100, respectively.
 |
RESULTS |
Purification and Peptide Sequencing of the Human Natural
p100--
The human 100 kDa form of 2',5'-OAS was purified from
interferon
-treated Daudi cells by affinity chromatography using the monoclonal antibody 11/25 specific for this protein (31). The purified
polypeptide was detected as a single Coomassie Blue-stained band of 100 kDa on SDS-polyacrylamide gel electrophoresis (data not shown).
Polyclonal antibodies against purified p100 preparations were produced
in mice as described (31). In addition, the band corresponding to p100
was excised from the polyacrylamide gel and digested with endo-lysine
C, and the purified peptides were processed for microsequencing (see
"Materials and Methods"). We were able to obtain the amino acid
sequence of eight peptides composed of 6-14 residues derived from the
p100 protein (shown below).
Cloning of a Full-length cDNA Encoding p100--
Polyclonal
antibodies raised against p100 were used to screen a
gt11 expression
library made from mRNA from interferon-treated Daudi cells.
Consistently, a cDNA clone was isolated (referred to as NT-15), the
nucleotide sequence of which had no homology with the sequence of
p40/p46 and p69/p71. Furthermore, this cDNA in Northern blot
experiments did not reveal any interferon-induced mRNA (data not
shown), and we concluded that NT-15 resulted from nonspecific binding
of the polyclonal antibodies. We then included a
denaturation-renaturation step of the proteins transferred onto the
nitrocellulose before incubation with the polyclonal antibodies (see
"Materials and Methods"). By this process, 10 cDNA clones were
isolated, 2 of which were NT-15, 4 that matched p40/p46, 2 clones
derived from a 56-kDa 2',5'-OAS-related protein (46), and only 1 clone
that was found to correspond to part of p100 (see results herein). This
single clone was identified upon screening 600,000 phage plaques.
Sequencing of this clone revealed a 590-nucleotide insert that had 55%
homology with p40/p46 and p69/p71, and contained motifs conserved
between these forms of 2',5'-OAS. Moreover, the deduced amino acid
sequence of this cDNA contained peptides that were homologous to
the amino acid sequence of three peptides (MGDPVQSK, SGLGHPI, and
SLNAVYPR) obtained by microsequencing of the natural p100. Screening of
the
gt10 cDNA library with this first isolated cDNA yielded
10 positive clones. The clone (REB2) with the longest insert of 1000 nucleotides was found to be incomplete both at its 5' and 3' end but
contained a new peptide sequence specific for p100 (peptide
ASLESWWQNPVPGL). In parallel, screening of a human keratinocyte
cDNA library, with cosmid clones containing the cluster of the
2',5'-OAS genes (41), led to the isolation of a 3.8-kb cDNA
referred to as 3A1. Sequence analysis of this cDNA revealed the
presence of a complete 2-5A synthetase-like domain highly homologous
to p40/p46 and p69/p71, and the presence of two nucleotide sequences
encoding two peptides obtained beforehand by peptide sequencing
(peptides WENPR and IPIQPWPVK). The presence of a TGA stop codon and a
3'-noncoding region of 2980 nucleotides in cDNA 3A1 indicated that
it should correspond to the 3' part of the full-length cDNA
encoding p100. In view of this, we carried out a specific RT-PCR by
using primers located at the 3' end of cDNA REB2 and at the 5' end
of cDNA 3A1. This generated a 1.7-kb cDNA fragment, named LC1,
which linked REB2 to 3A1. Sequence analysis of LC1 cDNA revealed a
complete 2-5A synthetase-like domain and the presence of a sequence
encoding a peptide specific for p100 (peptide: FPEQNVP). At this stage,
we had isolated overlapping cDNA clones encompassing 6233 nucleotides, encoding 1084 amino acids of p100, including the sequence
of the seven peptides specific to p100. However, this cDNA was
still devoid of an ATG initiation codon. An oligonucleotide localized
in the extreme 5' end of the cDNA REB2 was then successfully used
to screen a pBS/SK library constructed from PAC clone 336L20 containing
the p100 gene to isolate the missing 5' region (Fig.
1A).

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 1.
Cloning the full-length cDNA encoding
p100. A, the isolation of p100 related cDNA clones.
Clone REB2 (1000 nucleotides) was isolated from an oligo(dT)-primed
gt10 cDNA library using the labeled cDNA probe (590 nucleotides), which was initially isolated from a random primed gt11
expression library by screening with p100 specific polyclonal
antibodies. These gt10 and gt11 cDNA libraries were
constructed with mRNA from interferon-treated human cells (40).
cDNA 3A1 (3867 nt) was isolated by screening a keratinocyte
cDNA library with cosmid clones encompassing the cluster of
2',5'-OAS genes (41). The LC1 fragment between REB2 and 3A1 (1712 nt)
was obtained by RT-PCR using mRNA from interferon-treated HeLa
cells and GSP1, GSP2, and GSP3 primers. The 5' missing region of p100
cDNA (5TER) was isolated by screening a library constructed from a
PAC DNA containing the p100 gene with oligonucleotides locating in the
5' part of p100 cDNA as probe (see "Materials and Methods"). A
complete cDNA encoding p100, was reconstructed using the isolated
cDNAs REB2, 3A1, LC1, and the genomic region encoding the missing
5'-coding region (5TER). B, the deduced amino acid sequence
of the full-length cDNA encoding p100 is given. The regions of the
deduced amino acid sequence corresponding to the sequence of peptides
(numbered 1-8) obtained from the purified
natural p100 are underlined.
|
|
Reconstruction of the full-length cDNA encoding p100 was performed
in pBS(SK) by assembling overlapping clones. The full-length cDNA
encoding p100 is 6276 nucleotides in size. Sequence analysis of this
cDNA revealed an open reading frame of 3261 nucleotides encoding a
putative protein of 1087 amino acids with a predicted molecular mass of
121 kDa (Fig. 1B). The first ATG at nucleotide 35 is likely
to be the initiation site for translation, since the nucleotide
sequence flanking this start codon is in agreement with the Kozak's
consensus sequence of initiation (47). Consequently, the first 34 nucleotides represent a 5'-noncoding region. The stop codon is at
nucleotide position 3296. The 3'-noncoding region spreads over 2980 nucleotides and contains a polyadenylation signal sequence (ATTAAA) at
nucleotide position 5934. .
The Tripartite Nature of p100--
Amino acids sequence comparison
of p100 with protein data base revealed a strong identity with the
2',5'-OASs previously cloned. Structural analysis revealed that p100 is
composed of three contiguous 2-5A synthetase-like domains (Fig.
2), each homologous to the domain
previously described in one copy in p40/p46 and in two copies in
p69/p71 (28). In p100, domain I is composed of 362 residues (aa
1-362), domain II consists of 339 residues (aa 404-742), and domain
III comprises 345 residues (aa 743-1087). These domains share a strong
identity with one another: domain I shares 60% identity with domain II
and 44% identity with domain III, whereas domain II shares 49%
identity with domain III. Domains II and III are strictly adjacent,
whereas domains I and II are linked by a peptide of 42 amino acids
(Fig. 2). As is the case for the linker peptide between the two domains
in p69/p71 (28), the sequence of the linker peptide in p100 does not
share homology with the 2',5'-OAS unit.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 2.
The tripartite nature of p100. The
diagram shows the structure of p100 protein. p100 is composed of three
homologous domains: I (aa 1-362), II (aa 404-742), and III (aa
742-1087). Domains I and II are linked by a linker peptide of 42 amino
acids (white box). The percentage of amino acid
identity and conservative amino acid homology (in brackets)
between each domains is given. The homology of each domain with the
first 364 amino acid residues conserved in p40/p46 is also
presented.
|
|
Comparison of the amino acid sequence of domain I, II, and III of p100
with that of the first 364 residues conserved in human p40/p46 revealed
the presence of highly conserved domains, which could be considered as
specific 2',5'-OAS signatures (Fig. 3). These sequences are represented by a stretch of conserved 15-20 amino
acids, most probably corresponding to functional microdomains implicated in the catalytic activity of 2',5'-OASs and in the binding
capacity to the activator dsRNA (Fig. 3). The glycine-rich subdomain
with the motif
Lys/Arg-Gly-Gly-Ser-X-Gly/Ala-Lys/Arg-Gly-Thr-X-Leu-Lys/Arg at amino acid 60 in p40/p46 and 343 in p69/p71, and at amino acids 59, 458, and 801 in p100 (Fig. 3 and Ref. 28), could be part of the
substrate ATP/GTP binding domain as we had suggested previously (28).

View larger version (68K):
[in this window]
[in a new window]
|
Fig. 3.
Comparison of the amino acid sequence of each
domain in p100 with that of p40. Multiple alignment of the deduced
amino acid sequence of domains I (aa 1-403), II (aa 404-742), and III
(aa 743-1087) with that of p40 is shown. The gray
letters show the strict amino acid sequence identity, and
boxes indicate regions with conservative amino acid
sequences.
|
|
In vitro expression of the cDNA encoding p100, using the
coupled transcription/translation system in rabbit reticulocyte
lysates, generated a major product of 100 kDa (data not shown), as is
the case for the natural p100 from interferon-treated human cells. This
apparent molecular mass is in agreement with the theoretical molecular
mass deduced from the predicted open reading frame encoded by the
full-length cDNA encoding p100.
Expression of mRNA Encoding p100--
In Northern blot
analysis, cDNA REB2 hybridized to an unique interferon
-induced
transcript of 7 kb. This transcript is almost nondetectable in control
untreated Daudi cells, but its steady state level is increased
significantly upon interferon
treatment (Fig.
4). Similarly, the induction of this
transcript was observed following treatment of cells with
interferon; however, the level of induction was lower with
interferon (Fig. 4). It should be noted that this 7-kb transcript was
detectable by the different cDNA fragments corresponding to the
full-length of p100: cDNA REB2, 3A1, and LC1 (data not shown).

View larger version (71K):
[in this window]
[in a new window]
|
Fig. 4.
Interferon-induced mRNA recognized by the
p100 cDNA. Polyadenylated RNA (3 µg) extracted from
untreated (lane C) or from interferon-treated
(lane IFN , , or ) Daudi cells were
resolved on a 1.2% formaldehyde-agarose gel, transferred to a nylon
membrane, and hybridized successively with p100 cDNA (cDNA
REB2) and glyceraldehyde-3-phosphate dehydrogenase cDNA as
32P-labeled probe. Treatment of Daudi cells was at 1000 units/ml for each type of interferon for 8 h. The molecular size
profile of RNA markers (in kb) is shown on the left.
|
|
In HeLa cells treated with interferon
, the steady state level of
the 7-kb transcript was clearly detectable at 4 h and reached to a
maximum level at 8 h, but a significant reduction was observed at
24 h. Moreover, actinomycin D blocked the interferon-mediated induction of the 7-kb transcript, whereas cycloheximide had no effect
(data not shown), suggesting that the increase of the p100 transcript
is probably a transcriptional event.
Expression of p100 in Transfected Cells--
An expression plasmid
was constructed containing the complete cDNA encoding p100. We
epitope-tagged the recombinant p100 at its COOH terminus using the V5
epitope in order to be able to detect the expression of the recombinant
protein using an anti-V5 specific monoclonal antibody. Subcellular
distribution of the transiently expressed p100-V5 in HeLa cells was
then examined by confocal immunofluorescence using such a V5 specific
antibody. The recombinant p100 was found to be well distributed
throughout the cytoplasm (Fig. 5).
Experiments by confocal immunofluorescence using interferon
-treated
HeLa cells and specific monoclonal antibody against p100 showed a
similar subcellular localization as the recombinant p100 (Fig. 5). In
order to recover p100-V5, the transfected cells were lysed using
non-ionic detergents Triton X-100 or Nonidet P-40. Consistently, we
were able to recover high amounts of recombinant p100-V5, which was
identified by immunoblotting using either the monoclonal antibody
against the V5 epitope or by the polyclonal antibody raised against the
natural p100 (Fig. 6). These results
confirm that recombinant p100 has structural features that are similar
to the natural protein. The detection of p100 in HeLa cells transfected
with the control pcDNA3.1 (without insert) by the monoclonal
antibody against the natural p100 demonstrates the constitutive
expression of low levels of this protein in cultured cells. The
endogenous natural p100 and the recombinant p100 showed a similar
mobility in polyacrylamide gel.

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 5.
Subcellular localization of recombinant
p100-V5 and natural p100 in HeLa cells. Plasmid expressing p100
fused to the V5 epitope was transfected into HeLa cells. At 48 h
after transfection, the subcellular localization of the transiently
expressed p100-V5 was determined by confocal immunofluorescence using
monoclonal antibody specific for the V5 epitope (panel
B). As a control, HeLa cells were induced by interferon (500 units/ml) during 24 h and the subcellular localization of the
induced natural p100 was monitored by confocal immunofluorescence using
the monoclonal antibody 25/11 specific for p100 (panel
A). In each case, the second antibody was fluorescein
isothiocyanate-labeled anti-mouse IgG (Sanofi Diagnostics Pasteur,
France).
|
|

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 6.
Expression of recombinant p100 in HeLa
cells. HeLa cells were transfected with plasmid pcDNA3.1
expressing p100-V5 (lane p100) or plasmid
pcDNA3.1 without insert (lane C). Cells
extracts (about 5 × 105 cells) were prepared at
48 h after transfection (see "Materials and Methods"). The
expression of p100-V5 was analyzed by immunoblotting with monoclonal
antibody against V5 epitope (panel A) or with
murine polyclonal antibodies against p100 (panel
B). Note: the endogenous natural p100 in HeLa cells
transfected with the plasmid pcDNA3.1 without insert
(panel B, lane C) is
detectable only with murine polyclonal antibodies against p100.
|
|
Recombinant p100 Preferentially Synthesizes Dimeric Forms of 2-5A
Like the Natural Protein--
Using specific monoclonal antibodies to
purify p69 and p100 from interferon-treated cells, we demonstrated
previously that p100 preferentially synthesizes dimeric forms of 2-5A,
whereas p69 synthesizes higher oligomers (34). Here we confirm that p100 indeed synthesizes preferentially dimeric molecules of 2-5A.
The recombinant p69-FLAG and p100-V5 proteins were purified by
immunoprecipitation using anti-FLAG and V5 monoclonal antibodies, respectively. The immune complexes recovered with protein A-agarose were assayed for the synthesis of 2-5A. As controls, we assayed the
activity of immunoprecipitated natural p69 and p100 from
interferon-treated HeLa cells. In the absence of dsRNA activator, no
detectable 2-5A was observed in p100-V5 and p69-FLAG samples as with
the corresponding natural proteins. However, in the presence of dsRNA,
2-5A molecules were synthesized. Interestingly, the recombinant p100
preferentially synthesized dimeric molecules of 2-5A compared with the
recombinant p69. Furthermore, the profiles of 2-5A molecules generated
by the recombinant proteins were similar to their respective natural counterpart (Fig. 7).

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 7.
2',5'-OAS activity of recombinant p100 and
p69 compared with the corresponding natural proteins. The
recombinant p69-FLAG (panel 1) and p100-V5
(panel 2) preparations obtained from transfected
HeLa cells were immunoprecipitated using monoclonal antibodies specific
to the FLAG and V5 epitope, respectively. The natural p69
(panel 3) and p100 (panel
4) from interferon -treated HeLa cells were
immunoprecipitated using monoclonal antibodies 56/3 and 25/11,
respectively. The immune complexes bound to protein A-agarose were
incubated during 8 h in the 2',5'-OAS reaction mixture containing
[ -32P]ATP in the absence (lanes ) or
presence (lanes +) of 100 µg/ml poly(I)·poly(C). The
32P-labeled 2-5A products were then analyzed by 20%
polyacrylamide gel electrophoresis containing 7 M urea. The
position of different 2-5A molecules is given on the right
(34).
|
|
In the presence of increasing concentration of poly(I)·poly(C),
maximum activation of p69-FLAG occurred at 100 µg/ml, whereas maximum
activation of p100-V5 was obtained at 10 µg/ml poly(I)·poly(C), in
accord with our previous reports using natural proteins (34). At such
optimum activation of each enzyme, the proportion of 2-5A dimers per
total oligomers of 2-5A molecules synthesized by the recombinant p100
and p69 was 70% and 5%, respectively (Fig.
8). It should be noted that p100
manifested a preference for the synthesis of 2-5A dimer molecules at
any concentration of dsRNA, concentrations ranging from 1 to 100 µg/ml. On the other hand, the proportion of 2-5A dimers synthesized
by p69 was significantly reduced at higher concentrations of dsRNA,
i.e. at optimum activation of the enzyme (Fig. 8). Thus,
upon maximum activation of p69, higher oligomers of 2-5A become
generated at the expense of the dimeric forms.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 8.
p100 synthesizes preferentially dimeric
molecules of 2-5A when activated by dsRNA. Immunoprecipitated
p100-V5 (panel p100) and p69-FLAG
(panel p69) preparations from HeLa transfected
cells were incubated during 8 h in the 2',5'-OAS reaction mixture
containing [ -32P]ATP and increasing concentrations of
poly(I)·poly(C) at 0, 1, and 10 µg/ml. The 32P-labeled
2-5A products were then analyzed as described previously (34). Spots
corresponding to the dimer and higher oligomers of 2-5A produced by
p100 or p69 were quantified using a PhosphorImager. The values are
expressed as the percentage of the dimer molecules to total 2-5A
products.
|
|
Kinetic experiments, carried out at optimal pH and dsRNA concentrations
for p69 and p100, confirmed once again that the recombinant proteins
behave as the natural proteins (data not shown). These findings
illustrate that the full-length cDNA encoding the large form of
2',5'-OAS generates a recombinant protein with enzymatic parameters
similar to that of the natural p100 (34).
 |
DISCUSSION |
Here we describe the cloning and characterization of the
full-length cDNA encoding the 100-kDa form of human 2',5'-OAS
(p100). This cDNA hybridizes to an interferon-induced 7-kb mRNA
and encodes a protein that has an electrophoretic mobility similar to
the natural p100 present in interferon-treated human cells. The deduced amino acid sequence of this cDNA contains the sequence of the seven
peptides that were microsequenced from the purified p100, thus
confirming the identity of the isolated cDNA. The identity between
p100 and the recombinant protein produced by the expression of this
cDNA was further demonstrated by positive reactivity with specific
monoclonal and polyclonal antibodies raised against the 100-kDa form of
2',5'-OAS. Furthermore, the recombinant protein manifested catalytic
2',5'-OAS activity typical of the natural p100, i.e.
catalyzing preferentially the synthesis of dimeric molecules of 2-5A.
The recombinant protein also displayed parameters for maximum enzyme
activity, such as pH optimum and activation by lower concentrations of
dsRNA, similar to the natural p100.
Comparison of the deduced amino acid sequence of the three known human
2',5'-OASs, p40/p46, p69/p71, and p100, reveals the presence of a
conserved domain of about 350 amino acid residues (see Refs. 25-28,
and the results herein). The two isoforms of the middle-sized 2',5'-OAS
(p69/p71) share a common amino terminus of 683 residues composed of two
highly homologous domains I and II, and which share 41 and 53%
identity in amino acid sequence, respectively, with the first 346 amino
acids common between the two isoforms of the small 2',5'-OAS (p40/p46).
The results presented here have demonstrated that p100 is composed of
three adjacent domains that share 44-60% sequence similarity with
each other, and each domain is homologous to the first 346 amino acids
in p40/p46 (Figs. 2-4). In view of the observation that the human OAS forms p40/p46, p69/p71, and p100 contain 1, 2, and 3 conserved OAS
domains or units, respectively, we have proposed designating these
three forms of related enzymes as OAS1 for p40/p46, OAS2 for p69/p71,
and OAS3 for p100. Recently, we showed that the genes encoding the
three forms of 2',5'-OASs are clustered on chromosome 12q24.2 within a
region of 130 kb, which represents the 2',5'-OAS locus. They share the
same orientation of transcription and are arranged in the order
centromere-5'-OAS1-OAS3-OAS2-3'-telomere (41). The clustering of
these genes, and the demonstration that the small, middle and large
forms of 2',5'-OAS contain increased numbers of the 2-5A functional
unit, suggest their evolutionary relationship, possibly through the
duplication of the conserved functional domain, i.e. the
conserved OAS unit. The characterization of the events leading to the
emergence of the 2',5'-OAS family requires detailed studies on the
exon-intron organization of these genes, with the aim to better
understand their evolutionary relationship.
Comparison of the sequence of p100 with international data banks like
Swissprot revealed that this protein is homologous only to the
previously cloned 2',5'-OASs: human p40/p46 and p69/p71 and murine,
rat, and chicken homologues of the small human 2',5'-OAS (25-28).
Recently, we and others have described the cloning of a cDNA
encoding a 56-kDa protein (p56), which is highly homologous to the
sequence of known 2',5'-OASs (46, 48). This interferon-induced p56
binds DNA and dsRNA, but is devoid of catalytic activity typical of the
2',5'-OAS activity of p40/p46, p69/p71, and p100. Accordingly, this p56
was referred to as OAS-related protein, which might have as yet
unidentified function(s) (46). Interestingly, although the gene of this
OAS-related protein maps on chromosome 12q24.2, it is localized outside
the 2',5'-OAS locus containing p40/p46, p69/p71, and
p100.2
The homology between the different domains of p69/p71 and p100, with
the first 346 amino acids common in p40/p46, is discontinuous and is
characterized by the presence of highly conserved stretches containing
7-14 amino acids (Fig. 3). These conserved motifs probably represent
structural motifs essential for the 2',5'-OAS catalytic activity of
these proteins, such as the capacity to bind substrates ATP/GTP and to
become activated by dsRNA. The conservation of these motifs in the two
domains of p69/p71, and in the three domains of p100, is consistent
with their implication as specific signatures of 2',5'-OAS. The
pentapeptide DFLK199Q in p40 has been reported to represent
a part of the ATP binding site, lysine 199 inside this pentapeptide
being essential for catalytic activity (50). The sequences
corresponding to the position of this pentapeptide in domains I, II,
and III of p100 are NFVNI, NFMNI, and NFIII, respectively (Fig.
1B), and in domains I and II of p69/p71 are KFFDN and NFIRS,
respectively (28). Therefore, apart from the phenylalanine residues, no
other amino acid residue is conserved in comparison with the DFLKD
sequence of the potential ATP binding site. Consequently, the role of
this sequence as an ATP binding domain is questionable. Indeed, recent evidence indicates that mutation of lysine 199 in the pentapeptide DFLK199Q in p40 generates an active enzyme when the mutant
protein is expressed in insect cells but not when it is expressed in
Escherichia coli (51). Thus, the mutant protein is generated
as an active enzyme in higher eukaryotic cells, probably due to
appropriate modifications or folding of p40.
A critical characteristic of human 2',5'-OAS is oligomerization. By gel
filtration experiments, we have previously demonstrated that p40/p46
exist as tetramers, p69/p71 as dimers, and p100 as monomers. Recently,
mutations in the tripeptide CFK in the murine analog of p40 have been
reported to abolish the capacity of the enzyme to tetramerize along
with loss of catalytic activity (52), thus pointing out that
oligomerization of p40 OAS is essential for its enzymatic activity. In
the p69/p71 sequence, such a tripeptide is conserved in domain II
(position 668-671) but not in domain I (28), a situation that could be
sufficient for the dimerization of p69/p71 OAS. Indeed, deletion of
this conserved CFK motif in domain II of p69 results in enzyme
inactivation and lack of dimerization (53). Search for the CFK motif in
p100 revealed that the amino acid sequences at the corresponding
position in domains I, II, and III are CFL, CFL, and CCM, respectively
(Fig. 1). Thus, the CFK motif is not conserved in p100, and
consequently this difference could account for its lack of
oligomerization. As p40/p46 and p69/p71 exist as tetramers and dimers
and manifest common catalytic parameters, we have postulated that the
2',5'-OAS activity requires the presence of four catalytic domains,
which can be provided by four molecules of p40/p46 and two molecules of
p69/p71. The presence of only three 2-5A domains in p100 and its lack
of oligomerization could account for the differences observed when
compared with the other two 2',5'-OASs. Indeed, unlike p40/p46 and
p69/p71, which synthesize preferentially higher oligomers of 2-5A,
p100 preferentially catalyzes the synthesis of 2-5A dimers. Moreover, p100 is activated at lower concentrations of dsRNA compared with p40/p46 and p69/p71. Furthermore, pH optimum for the activation of p100
is 7.5, whereas that for the other forms is 6.5 (34).
Besides a possible role in mediating resistance to virus infection (19,
20, 54-58), the 2-5A system (the OASs, 2-5A, and RNase L) has also
been implicated in the control of cell growth, differentiation, and
apoptosis (17, 20, 59-61). The dimeric forms of 2-5A have a low
affinity to bind and thus activate the RNase L. Consequently, dimeric
forms of 2-5A, if functional, must have another mode of action
compared with the oligomeric molecules. Interestingly, analogs of
dimeric forms of 2-5A have been demonstrated to exert a negative
impact on the transcription profile in breast carcinoma cells (62), a
result that is consistent with earlier reports showing that low
concentrations of 2-5A can regulate gene expression and DNA
replication by virtue of a direct inhibition of DNA topoisomerase I
(49). Here we have confirmed that p100 synthesizes preferentially
dimeric forms of 2-5A. This latter result and the induction of p100 by
interferon raise the possibility of the implication of p100 in the
overall mechanism of action of interferon, i.e. in functions
outside the scope of the RNase L. The availability of the full-length
cDNA encoding p100 will be invaluable in the further analysis of
the role of this distinct 2',5'-OAS.
 |
ACKNOWLEDGEMENT |
We are grateful to Prof. Anthony P. Monaco for
help in the cloning of the cDNA for p100.
 |
FOOTNOTES |
*
This work was supported by Institut Pasteur and CNRS, by
grants from the Association pour la Recherche sur le Cancer
(Villejuif/France), and by Wellcome Trust and European Community
research fellowships (to A. H.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF063613.
¶
A member of the CNRS. To whom correspondence should be
addressed: Unité de Virologie et Immunologie Cellulaire, Institut Pasteur, 28, rue du Dr. Roux, 75724 Paris Cédex 15, France. Tel.: 33-1-4568-8776; Fax: 33-1-4061-3012; E-mail:
arahovan{at}pasteur.fr.
The abbreviations used are:
2-5A synthetase, 2',5'-oligoadenylate synthetase; 2', 5'-OAS, 2',5'-oligoadenylate
synthetase; 2-5A, 2',5'-oligoadenylate-triphosphate molecules with the
general formula pppA(2'p5'A)n, where
n > 1; OAS, oligoadenylate synthetase; ds, double-stranded; p40/p46, 40- and 46-kDa isoforms of the small
2',5'-oligoadenylate synthetase; p69/p71, 69- and 71-kDa isoforms of
the medium-sized 2',5'-oligoadenylate synthetase; p100, the 100-kDa
form of 2',5'-oligoadenylate synthetase; PAC, P1 artificial chromosome; Ap4A, di(adenosine-5')tetraphosphate; tRNA, transfer RNA; kb, kilobase(s); aa, amino acid(s); RT, reverse transcriptase; PCR, polymerase chain reaction; PIPES, 1,4-piperazinediethanesulfonic acid.
2
A. Hovnanian, D. Rebouillat, E. R. Levy,
M.-G. Mattéi, and A. G. Hovanessian, submitted for publication.
 |
REFERENCES |
-
Hovanessian, A. G.,
Brown, R. E.,
and Kerr, I. M.
(1977)
Nature
268,
537-540[CrossRef][Medline]
[Order article via Infotrieve]
-
Kerr, I. M.,
and Brown, R. E.
(1978)
Proc. Natl. Acad. Sci. U. S. A.
75,
256-260[Abstract/Free Full Text]
-
Hovanessian, A. G.
(1991)
J. Interferon Res.
11,
199-205[Medline]
[Order article via Infotrieve]
-
Clemens, M. J.,
and Williams, B. R.
(1978)
Cell
13,
565-572[CrossRef][Medline]
[Order article via Infotrieve]
-
Zhou, A.,
Hassel, B. A.,
and Silverman, R. H.
(1993)
Cell
72,
753-765[CrossRef][Medline]
[Order article via Infotrieve]
-
Lengyel, P.
(1982)
Annu. Rev. Biochem.
51,
251-282[CrossRef][Medline]
[Order article via Infotrieve]
-
Kerr, I. M.
(1987)
J. Interferon Res.
7,
505-510[Medline]
[Order article via Infotrieve]
-
Samuel, C. E.
(1991)
Virology
183,
1-11[CrossRef][Medline]
[Order article via Infotrieve]
-
Hovanessian, A. G.,
Wood, J.,
Meurs, E.,
and Montagnier, L.
(1979)
Proc. Natl. Acad. Sci. U. S. A.
76,
3261-3265[Abstract/Free Full Text]
-
Schmidt, A.,
Chernajovsky, Y.,
Shulman, L.,
Federman, P.,
Berissi, H.,
and Revel, M.
(1979)
Proc. Natl. Acad. Sci. U. S. A.
76,
4788-4792[Abstract/Free Full Text]
-
Marie, I.,
Svab, J.,
and Hovanessian, A. G.
(1990)
J. Interferon Res.
10,
571-578[Medline]
[Order article via Infotrieve]
-
Sen Gupta, D. N.,
and Silverman, R. H.
(1989)
Nucleic Acids Res.
17,
969-978[Abstract/Free Full Text]
-
Williams, B. R.,
Golgher, R. R.,
Brown, R. E.,
Gilbert, C. S.,
and Kerr, I. M.
(1979)
Nature
282,
582-586[CrossRef][Medline]
[Order article via Infotrieve]
-
Nilsen, T. W.,
Maroney, P. A.,
and Baglioni, C.
(1982)
J. Biol. Chem.
257,
14593-14596[Abstract/Free Full Text]
-
Stark, G. R.,
Dower, W. J.,
Schimke, R. T.,
Brown, R. E.,
and Kerr, I. M.
(1979)
Nature
278,
471-473[CrossRef][Medline]
[Order article via Infotrieve]
-
Krust, B.,
Riviere, Y.,
and Hovanessian, A. G.
(1982)
Virology
120,
240-246[CrossRef][Medline]
[Order article via Infotrieve]
-
Williams, B. R. G.,
and Silverman, R. H.
(1985)
The 2-5A System, Alan R. Liss, Inc., New York
-
Sen, G. C.,
and Lengyel, P.
(1992)
J. Biol. Chem.
267,
5017-5020[Free Full Text]
-
Coccia, E. M.,
Romeo, G.,
Nissim, A.,
Marziali, G.,
Albertini, R.,
Affabris, E.,
Battistini, A.,
Fiorucci, G.,
Orsatti, R.,
Rossi, G. B.,
et al..
(1990)
Virology
179,
228-233[CrossRef][Medline]
[Order article via Infotrieve]
-
Hassel, B. A.,
Zhou, A.,
Sotomayor, C.,
Maran, A.,
and Silverman, R. H.
(1993)
EMBO J.
12,
3297-3304[Medline]
[Order article via Infotrieve]
-
Hovanessian, A. G.,
Laurent, A. G.,
Chebath, J.,
Galabru, J.,
Robert, N.,
and Svab, J.
(1987)
EMBO J
6,
1273-1280[Medline]
[Order article via Infotrieve]
-
Chebath, J.,
Benech, P.,
Hovanessian, A.,
Galabru, J.,
and Revel, M.
(1987)
J. Biol. Chem.
262,
3852-3857[Abstract/Free Full Text]
-
Hovanessian, A. G.,
Svab, J.,
Marie, I.,
Robert, N.,
Chamaret, S.,
and Laurent, A. G.
(1988)
J. Biol. Chem.
263,
4959-4969
-
Yang, K.,
Samanta, H.,
Dougherty, J.,
Jayaram, B.,
Broeze, R.,
and Lengyel, P.
(1981)
J. Biol. Chem.
256,
9324-9328[Abstract/Free Full Text]
-
Benech, P.,
Mory, Y.,
Revel, M.,
and Chebath, J.
(1985)
EMBO J.
4,
2249-2256[Medline]
[Order article via Infotrieve]
-
Benech, P.,
Merlin, G.,
Revel, M.,
and Chebath, J.
(1985)
Nucleic Acids Res.
13,
1267-1281[Abstract/Free Full Text]
-
Saunders, M. E.,
Gewert, D. R.,
Tugwell, M. E.,
McMahon, M.,
and Williams, B. R.
(1985)
EMBO J.
4,
1761-1768[Medline]
[Order article via Infotrieve]
-
Marie, I.,
and Hovanessian, A. G.
(1992)
J. Biol. Chem.
267,
9933-9939[Abstract/Free Full Text]
-
Marie, I.,
Svab, J.,
Robert, N.,
Galabru, J.,
and Hovanessian, A. G.
(1990)
J. Biol. Chem.
265,
18601-18607[Abstract/Free Full Text]
-
Witt, P. L.,
Marie, I.,
Robert, N.,
Irizarry, A.,
Borden, E. C.,
and Hovanessian, A. G.
(1993)
J. Interferon Res.
13,
17-23[Medline]
[Order article via Infotrieve]
-
Marie, I.,
Galabru, J.,
Svab, J.,
and Hovanessian, A. G.
(1989)
Biochem. Biophys. Res. Commun.
160,
580-587[CrossRef][Medline]
[Order article via Infotrieve]
-
Dubois, M. F.,
and Hovanessian, A. G.
(1990)
Virology
179,
591-598[CrossRef][Medline]
[Order article via Infotrieve]
-
Besse, S.,
Rebouillat, D.,
Marié, I.,
Puvion-Dutilleul, F.,
and Hovanessian, A. G.
(1998)
Exp. Cell Res.
239,
379-392[CrossRef][Medline]
[Order article via Infotrieve]
-
Marie, I.,
Blanco, J.,
Rebouillat, D.,
and Hovanessian, A. G.
(1997)
Eur. J. Biochem.
248,
558-566[Medline]
[Order article via Infotrieve]
-
Ball, L.,
and White, C. N.
(1979)
in
Regulation Macromolecular Synthesis by Low Molecular Weight Mediators (Koch, H., and Richter, D., eds), pp. 303-318, Academic Press, New York
-
Justesen, J.,
Ferbus, D.,
and Thang, M. N.
(1980)
Proc. Natl. Acad. Sci. U. S. A.
77,
4618-4622[Abstract/Free Full Text]
-
Cayley, P. J.,
and Kerr, I. M.
(1982)
Eur. J. Biochem.
122,
601-608[Medline]
[Order article via Infotrieve]
-
Justesen, J.,
Worm-Leonhard, H.,
Ferbus, D.,
and Petersen, H. U.
(1985)
Biochimie
67,
651-655[Medline]
[Order article via Infotrieve]
-
Sperling, J.,
Chebath, J.,
Arad-Dann, H.,
Offen, D.,
Spann, P.,
Lehrer, R.,
Goldblatt, D.,
Jolles, B.,
and Sperling, R.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
10377-10381[Abstract/Free Full Text]
-
Meurs, E.,
Chong, K.,
Galabru, J.,
Thomas, N. S.,
Kerr, I. M.,
Williams, B. R.,
and Hovanessian, A. G.
(1990)
Cell
62,
379-390[CrossRef][Medline]
[Order article via Infotrieve]
-
Hovnanian, A.,
Rebouillat, D.,
Mattei, M. G.,
Levy, E. R.,
Marié, I.,
Monaco, A. P.,
and Hovanessian, A. G.
(1998)
Genomics
52,
267-277[CrossRef][Medline]
[Order article via Infotrieve]
-
Marchuk, D.,
Drumm, M.,
Saulino, A.,
and Collins, F. S.
(1991)
Nucleic Acids Res.
19,
1154[Free Full Text]
-
Miele, M. B.,
Liu, D. K.,
and Kan, N. C.
(1991)
J. Interferon Res.
11,
33-40[Medline]
[Order article via Infotrieve]
-
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
-
Carmo-Fonseca, M.,
Pepperkok, R.,
Carvalho, M. T.,
and Lamond, A. I.
(1992)
J. Cell Biol.
117,
1-14[Abstract/Free Full Text]
-
Rebouillat, D.,
Marié, I.,
and Hovanessian, A. G.
(1998)
Eur. J. Biochem.
257,
319-330[Medline]
[Order article via Infotrieve]
-
Kozak, M.
(1989)
J. Cell Biol.
108,
229-241[Abstract/Free Full Text]
-
Hartmann, R.,
Stee Olsen, H.,
Widder, S.,
Jorgensen, R.,
and Justesen, J.
(1998)
Nucleic Acids Res.
26,
4121-4127[Abstract/Free Full Text]
-
Castora, F. J.,
Erickson, C. E.,
Kovacs, T.,
Lesiak, K.,
and Torrence, P. F.
(1991)
J. Interferon Res.
11,
143-149[Medline]
[Order article via Infotrieve]
-
Kon, N.,
and Suhadolnik, R. J.
(1996)
J. Biol. Chem.
271,
19983-19990[Abstract/Free Full Text]
-
Bandyopadhyay, S.,
Ghosh, A.,
Sarkar, S. N.,
and Sen, G. C.
(1998)
Biochemistry
37,
3824-3830[CrossRef][Medline]
[Order article via Infotrieve]
-
Ghosh, A.,
Sarkar, S. N.,
Guo, W. D.,
Bandyopadhyay, S.,
and Sen, G. C.
(1997)
J. Biol. Chem.
272,
33220-33226[Abstract/Free Full Text]
-
Ghosh, A.,
Sarkar, S. N.,
Bandyopadhyay, S.,
and Sen, G. C.
(1997)
J. Interferon Cytokine Res.
17 Suppl. 2,
s51
-
Williams, B. R.,
and Kerr, I. M.
(1978)
Nature
276,
88-90[CrossRef][Medline]
[Order article via Infotrieve]
-
Hovanessian, A. G.,
and Wood, J. N.
(1980)
Virology
101,
81-90[CrossRef][Medline]
[Order article via Infotrieve]
-
Chebath, J.,
Benech, P.,
Revel, M.,
and Vigneron, M.
(1987)
Nature
330,
587-588[CrossRef][Medline]
[Order article via Infotrieve]
-
Maitra, R. K.,
and Silverman, R. H.
(1998)
J. Virol.
72,
1146-1152[Abstract/Free Full Text]
-
Li, X. L.,
Blackford, J. A.,
and Hassel, B. A.
(1998)
J. Virol.
72,
2752-2759[Abstract/Free Full Text]
-
Rysiecki, G.,
Gewert, D. R.,
and Williams, B. R.
(1989)
J. Interferon Res.
9,
649-657[Medline]
[Order article via Infotrieve]
-
Kimchi, A.,
Shure, H.,
and Revel, M.
(1981)
Eur. J. Biochem.
114,
5-10[Medline]
[Order article via Infotrieve]
-
Kimchi, A.,
Shure, H.,
Lapidot, Y.,
Rapoport, S.,
Panet, A.,
and Revel, M.
(1981)
FEBS Lett.
134,
212-216[CrossRef][Medline]
[Order article via Infotrieve]
-
Latham, K. E.,
Cosenza, S.,
Reichenbach, N. L.,
Mordechai, E.,
Adelson, M. E.,
Kon, N.,
Horvath, S. E.,
Charubala, R.,
Mikhailov, S. N.,
Pfeiderer, W.,
and Suhadolnik, R. J.
(1996)
Oncogene
12,
827-837[Medline]
[Order article via Infotrieve]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike
Complore
Connotea
Del.icio.us