J Biol Chem, Vol. 274, Issue 3, 1667-1676, January 15, 1999
The Expression of Plasma Membrane Ca2+ Pump Isoforms
in Cerebellar Granule Neurons Is Modulated by Ca2+*
Danilo
Guerini
,
Elena
García-Martin
§,
Andreas
Gerber,
Christiane
Volbracht¶,
Marcel
Leist¶,
Carlos
Gutiérrez
Merino
, and
Ernesto
Carafoli**
From the Institute of Biochemistry, Swiss Federal Institute of
Technology, Biochemie III, Universitätstrasse 16, CH-8092 Zürich, Switzerland, the
Departamento de
Bioquimica y Biologia Molecular, Universidad de Extremadura,
E-06080 Badajoz, Spain, and the ¶ Department of Toxicology,
University of Konstanz, D-78465 Konstanz, Germany
 |
ABSTRACT |
Plasma membrane Ca2+ ATPase
(PMCA) pump isoforms 2, 3, and 1CII are expressed in large amounts in
the cerebellum of adult rats but only minimally in neonatal cerebellum.
These isoforms were almost undetectable in rat neonatal cerebellar
granule cells 1-3 days after plating, but they became highly expressed
after 7-9 days of culturing under membrane depolarizing conditions (25 mM KCl). The behavior of isoform 4 was different: it was
clearly detectable in adult cerebellum but was down-regulated by the
depolarizing conditions in cultured cells. 25 mM
KCl-activated L-type Ca2+ channels,
significantly increasing cytosolic Ca2+. Changes in the
concentration of Ca2+ in the culturing medium affected the
expression of the pumps. L-type Ca2+ channel
blockers abolished both the up-regulation of the PMCA1CII, 2, and 3 isoforms and the down-regulation of PMCA4 isoform. When granule cells
were cultured in high concentrations of
N-methyl-D-aspartic acid, a condition that
increased cytosolic Ca2+ through the activation of
glutamate-operated Ca2+ channels, up-regulation of
PMCA1CII, 2, and 3 and down-regulation of PMCA4 was also observed. The
activity of the isoforms was estimated by measuring the phosphoenzyme
intermediate of their reaction cycle: the up-regulated isoforms, the
activity of which was barely detectable at plating time, accounted for
a large portion of the total PMCA activity of the cells. No
up-regulation of the sarcoplasmic/endoplasmic reticulum calcium pump
was induced by the depolarizing conditions.
 |
INTRODUCTION |
The messenger function of calcium is of particular interest in
neuronal cells: processes as important and as diverse as gene expression (1), synaptic plasticity (2), the release of neurotransmitters (3), and the survival of neurons (4) are modulated by
Ca2+. These aspects of neuronal regulation are conveniently
studied on cultured neuronal cells (4-6), the survival of which may be increased by the depolarization of the plasma membrane (1, 4). The
procedure increases the influx of Ca2+ and thus raises its
cytosolic concentration (4).
Cerebellar granule cells are frequently used to study physiological
(e.g. development (7, 8)) and pathological (e.g. ischemic damage (9) and apoptosis (10)) aspects of nervous cell
function. When isolated from the cerebella of newborn rats, they
develop to mature neurons upon exposure to depolarizing concentrations of KCl (25 mM) or to the agonist of the glutamate receptor
NMDA1 (11). The expression of
a number of genes is stimulated during the maturation process
(12-16), and a complex switch in the expression of the NMDA receptor
isoforms has been documented (14, 15).
Both the NMDA receptor and voltage-activated Ca2+ channels
mediate the entry of Ca2+ that is necessary to the survival
of cultured granule cells (7). It has been proposed that
Ca2+ entering through the voltage-activated
Ca2+ channels may modulate the expression of genes
different from those controlled by Ca2+ penetrating through
the NMDA receptor (1) The sustained increased influx of
Ca2+ during the maturation demands the increased capacity
of the cells to extrude it. The two classical plasma membrane
Ca2+ extruding systems, the Ca2+-ATPase (PMCA)
and the Na+-Ca2+-exchanger, have been
documented in neurons (17-20) Two of the four PMCA basic gene
products, PMCA2 and PMCA3, have in fact only been detected in
significant amounts in neurons (19), although their transcripts have
been detected in other tissues as well (17, 21). Induction of PMCA pump
transcription as well as a switching of its isoforms is induced by the
addition of NGF to PC-12 cells, which are also widely used as a
neuronal cell model (22). A short incubation of IMR32 neuroblastoma
cells with 56 mM KCl also induces the transcription of one
of the PMCA2 alternatively spliced isoforms (PMCA2AII) (23).
Pilot experiments performed at the outset of this work had revealed
that the PMCA2, PMCA3, and, to a lesser extent, PMCA4 pumps became
up-regulated during the development of the cerebellum. It was thus
interesting to investigate whether these isoforms also underwent
regulation during the in vitro development of granule cells.
The work presented here shows that the expression of the PMCA3 and of
the PMCA2 genes increased markedly during the maturation process and
was accompanied by the marked up-regulation of the expression of one of
the alternatively spliced PMCA1 isoforms. At variance with the findings
in intact cerebellum, the maturation process in granule cells induced
instead an evident down-regulation of the PMCA4 pump. Both the up- and
the down-regulation of the isoforms depended on the sustained increase
of intracellular Ca2+.
 |
MATERIALS AND METHODS |
Chemicals--
Poly-D-lysine, 3-(4,5-dimethyl
thiazol-2-yl)-2,5-diphenyl tetrazolium bromide, Dulbecco's modified
Eagle's medium, Dulbecco's modified Eagle's medium/Ham's F-12
nutrient mixture, and other tissue culture supplements were form Sigma
or Life Technologies, Inc. Ditocilpine (MK-801) was from Research
Biochemicals, Inc. (Natick, MA). NMDA, nifedipine, and calcicludine
were from Calbiochem. Oligonucleotides were purchased from MGW-Biotech,
(Ebersberg, Germany). Ampli-Taq Gold polymerase was from
Perkin-Elmer. All other reagents were of the highest purity grade
commercially available.
Cell Cultures--
Granule cells were dissociated from the
cerebella of 7-day old Wistar rats as described (7, 10). They were
plated in Dulbecco's modified Eagle's medium (Hepes modification
(Sigma), containing 1.8 mM CaCl2) supplemented
with heat-inactivated 10% fetal calf serum (Life Technologies or
Sigma), 100 µg/ml gentamicin, 7 µM
p-aminobenzoic acid, 100 µg/ml pyruvate, 100 microunit/ml insulin, on poly-D-lysine-treated plates at a density of
2-3 × 105 cells/cm2, in the presence of
5.3, or 25 mM KCl. After 48 h, 10 µM
cytosine arabinofuranoside was added to the culture to inhibit mitotic active cell growth. After 3 additional days, the medium was replaced with serum-free Dulbecco's modified Eagle's medium/Ham's F-12 nutrient mixture (Sigma), containing 100 µg/ml transferrin, 20 nM progesterone, 50 units/ml penicillin, 50 µg/ml
streptomycin, 5 µg/ml insulin, and 0.11 mg/ml pyruvate in the
presence of 5.3 or 25 mM KCl. Neuronal survival was
estimated by measuring the amount of colored formazan by the reduction
of 3-(4,5-dimethyl thiazol-2-yl)-2,5-diphenyl tetrazolium bromide (24).
To this aim, the culture medium was replaced by Locke solution (134 mM NaCl, 4 mM NaHCO3, 2.3 mM CaCl2, 1 mM MgCl2, 5 mM glucose, 10 mM Hepes, pH 7.5) 150 µg/ml
3-(4,5-dimethyl thiazol-2-yl)-2,5-diphenyl tetrazolium bromide,
containing either 5.3 or 25 mM KCl and incubated for 15 min
at 37 °C. The extent of contaminating astrocytes was estimated by
immunocytochemistry using a glial fibrillary acidic protein-specific
monoclonal antibody (Boehringer Mannheim). Immunocytochemistry has been
performed as described earlier (25). The cells were in some cases
incubated with 1 µg of calcein-AM/ml and 5 µg propidium jodide/ml
(both from Molecular Probes, Eugene, OR) for 10-15 min at 37 °C and
viewed with a fluorescence microscope. Dead cells were stained by
propidium iodide and showed a strong emission at 617 nm. Living cells
were stained by calcein, resulting in a green fluorescent emission (517 nm).
PC-12 cells were cultured in RPMI 1640 (Life Technologies) supplemented
with 10% heat-inactivated horse serum and 5% fetal bovine serum (both
from Life Technologies). They were seeded on laminin coated plates
(Collaborative Biomedical Products and Becton Dickinson, Bedford, MA),
before induction of differentiation with nerve growth factor (20 ng/ml). Three days later neurite outgrowth was observed in at least
30% of the cells, which could be maintained in culture for up to 21 days.
P-19 cells were routinely cultured in
-MEM (Life Technologies)
supplemented with 2.5% fetal calf serum and 7.5% calf serum (both
from Life Technologies). They were exposed to 0.3 µM
retinoic acid (26) at a density of 105cells/ml and
transferred to uncoated Petri dishes. After 2 days, cell aggregates
were collected, reexposed to retinoic acid for 2 additional days,
sedimented, and plated in medium without retinoic acid. After 2 days,
20-40% of the cells extended long neurites and could be kept in
culture for up to 9 additional days.
Preparation of Membranes from Cerebellum--
Cerebella were
dissected from rat brains and homogenized in 5 mM Tris-HCl,
pH 7.5, 320 mM sucrose, 5 µg/ml pepstatin, antipain, and
leupeptin with a loose Potter homogenizer. A crude synaptosomal membrane fraction was obtained after centrifuging the postnuclear supernatant at 12,000 × g for 10 min at 4 °C. The
supernatant was again centrifuged at 100,000 × g for
1 h at 4 °C. The 100,000 × g precipitated
material was defined as the microsomal fraction.
Preparation of Membrane Proteins--
Cells were resuspended at
5-10 × 106 cells/ml in 10 mM Tris-HCl,
pH 8.0, 1 mM EDTA, 5 µg/ml leupeptin, 5 µg/ml
aprotinin, 5 µg/ml pepstatin, 75 µg/ml phenylmethylsulfonyl
fluoride and 1 mM dithiothreitol and subjected to three
cycles of freezing and thawing. The particulate fraction was sedimented
at 15,000 × g for 15 min. The resulting protein pellet
was resuspended in 4 mM Tris-HCl, pH 8.0, 10% sucrose and
frozen at
70 °C.
Western Blotting--
Proteins were separated by
SDS-polyacrylamide gel electrophoresis (SDS-PAGE) (27) and transferred
to nitrocellulose or polyvinyldene difluoride membranes (28). The
membranes were incubated with affinity-purified isoform-specific
polyclonal antibodies against the PMCA pump produced and used
essentially as described by Stauffer et al. (19) Polyclonal
sera (donated by Dr. F. Wuytack, Leuven, Belgium) were used at a
dilution to detect the SERCA2b protein (29). The JA9
monoclonal antibody specific for the PMCA4 isoforms was provided by Dr.
J. Penniston (Mayo Clinic, Rochester, MN). The monoclonal antibody
directed to the NMDA receptor NR1 protein (Pharmigen, San Diego, CA)
was used at a dilution ranging from
to
. The
blots were developed with 5-bromo-4-chloro-3-indolyl phosphate (BCIP)
and nitro blue tetrazolium (NBT). The reaction was stopped after 2-3
min for the SERCA2b antibody, after 5 min for the affinity-purified serum against the PMCA1, after 10 min for the affinity-purified antibodies for PMCA2 and PMCA3 and for the monoclonal 5F10 antibody, and after 15-25 min for the monoclonal antibody JA9. When the blots
were incubated with CDP-StarTM (Tropix, Bedford, MA), they were exposed
to the a chemiluminescence-sensitive photographic film. The times were
10-20 s for the SERCA2b antibody, 30-60 s for the affinity-purified
serum against the PMCA1, 30-120 s for the affinity-purified antibodies
for PMCA2 and PMCA3 and for the 5F10 monoclonal antibody, 60-120 s for
the monoclonal antibody JA9. If needed, Western blots were scanned with
Photoshop (Adobe Systems Inc.) and quantified with the help of the
National Institutes of Health NIH Image program, Version 1.59.
Formation of the Phosphoenzyme Intermediate--
Membrane
proteins were resuspended in 20 mM MOPS-KOH, pH 6.8, and
100 mM KCl in the presence of 100 µM
Ca2+ plus 100 µM La3+.
La3+ was included to stabilize the phosphointermediate of
the PMCA protein (30). The reaction was started with 0.3 µM [
-32P]ATP (300 Ci/mmol) on ice and
stopped 30 s later by the addition of 7% trichloroacetic acid.
The proteins in the washed pellet were separated on acidic gels (31)
stained with Coomassie Brilliant Blue, dried, and exposed for 1-5 days
at
70 °C.
Immunoprecipitation of the Phosphorylated Proteins--
160 µg
of membrane proteins were phosphorylated with ATP as described above.
After precipitation with trichloroacetic acid, the pellet was washed
with 200 µl of cold H2O and 0.5% SDS, 8 M
urea, 150 mM NaCl, 50 mM MES-NaOH, pH 6.4. The
resuspended proteins were diluted to 1000 µl with MEM buffer (50 mM MES-NaOH, pH 6.3, 150 mM NaCl, 1 mM EDTA) supplemented with 0.2% gelatin, 0.1% Nonidet P-40, 0.1% SDS and centrifuged at 10,000 × g for 30 min. The supernatant was divided in four 250-µl aliquots. One was
mixed with 2-3 µg of 5F10 monoclonal antibody (32) and the others
with 3-6 µg of 1N, 2N, or 3N affinity-purified isoform-specific
antibodies. The samples were incubated overnight at 4 °C under
gentle rocking prior to the addition of 15 µl of packed protein
A-Sepharose CL-4B, (Amersham Pharmacia Biotech, Uppsala, Sweden). After
an additional 2 h of incubation at 4 °C, the immunocomplexes
bound to protein A-Sepharose were recovered by centrifugation. The
pellet was washed four times with MEM buffer supplemented with 0.2%
gelatin, 0.1% Nonidet P-40, 0.1% SDS; twice with MEM buffer
supplemented with 0.1% Nonidet P-40; and finally, twice with MEM
buffer alone. The pellet was resuspended at room temperature and
incubated for 30 min in 30-40 µl of 70 mM
Tris-PO4, pH 6.4, 5% SDS, 5% dithiothreitol, and 8 M urea, separated on acidic gels (31), stained with
Coomassie Brilliant Blue, and dried prior the exposure to x-ray films
(
70 °C for 2-5 days). The films were scanned with Adobe Photoshop and quantified with the help of NIH Image, Version 1.59. In some cases,
they were scanned densitometrically.
Isolation of RNA and Reverse Transcription PCR--
Total RNA
was prepared form granule cells according to the method of Chomczynski
and Sacchi (33). If required, the cells were depolarized with 75 mM KCl for 30 min at 37 °C by the addition of 10 mM Hepes-KOH (pH 7.2), 170 mM KCl, 1.3 mM MgCl2, 0.9 mM CaCl2.
Control cells were incubated with 75 mM NaCl. cDNA was synthesized using a random octamer primer (First Strand cDNA
synthesis kit, Amersham Pharmacia Biotech) according to the
manufacturer's protocol. PCR was performed using the oligonucleotides
described by Keeton et al. (17) for alternative splicing
site C. To study splicing site A, the oligonucleotides described by
Adamo and Penniston (34) were used for PMCA2, and those described by
Keeton et al. (35) were used for PMCA4. For PMCA3, the
following oligonucleotides were used: 5'-GCGCAAATCAGCAGACAAAG (nt
1448-1467, rat PMCA3) and 5'-TGCAGGACTGACTTCTCCTTC (nt 1715-1735, rat
PMCA3). The glyceraldehyde-3-phosphate-dehydrogenase (G3PDH) cDNA
was amplified from rat tissue with the following oligonucleotides: 5'
CCAAAAGGGTCATCATCTCC (nt 371-391) and 5' GTAGGCCATGAGGTCCACCAC (nt
994-1015). The oligonucleotides for c-fos were derived from
the rat sequence (36) and were as follows: Fos-1, AAGTCTGCGTTGCAGACCGAG
(nt 660-680); Fos-2, GTCTGCTGCATAGAAGGAACC (nt 1040-1020).
The conditions for the PCR were as suggested by Perkin-Elmer for the
Taq Gold polymerase. The PCRs were performed under none saturation conditions, as described by Stauffer et al. (21) PCR standard conditions were as follows: 12 min at 95 °C, 33 cycles of 1 min at 50-53 °C, 2 min at 72 °C, 30 s at 93 °C. The
PCR products were separated on 1.5% agarose or by 8% PAGE. The
identity of the PCR-generated fragments was verified by Southern
blotting using oligonucleotides specific for the rat PMCA pump isoforms and by partially sequencing the PCR fragments cloned in the pGEM-T vector (Promega). Northern blotting was performed as described by
Sambrook et al. (37). The following cDNA fragments were
random primed labeled with 32P-dCTP: PMCA1CI, 3546-3805
(17); PMCA2CI, 3663-3987 (38); PMCA3CI, 3813-4024 (17); PMCA4CI,
3456-3727 (17, 35); G3PDH, 371-1015 (39); and c-fos,
660-1040 (36). Competitive PCR experiments with PMCA2-, PMCA4-, and
PMCA1-specific oligonucleotides were performed according to Siebert and
Larrick (40): they essentially confirmed the Northern blotting
experiments. The Northern and Southern blots were scanned with Adobe
Photoshop and quantified with the help of NIH Image, Version 1.59. In
some cases, the images were scanned densitometrically directly from
autoradiographic films.
Measurement of Intracellular Free Ca2+ in Granule
Cells--
[Ca2+]i was measured by videoimaging
as described in Ref. 41. Briefly, granule cells grown on coverslips
were loaded for 30 min with 2.5 µM Fura-2-AM (Molecular
Probes). Before the analysis the cells were washed twice for 10 min
with a buffer of the same ionic composition as the original growth
medium and then left to equilibrate at room temperature on the stage of
a Leica DM-IRB microscope (Leica AG, Benzheim, Germany) equipped with a
Dage-72 CCD camera (Dage-MTI, Michigan City, MI), a videoscope GEN-III
image intensifier, and a computer-controlled filter wheel (Sutter,
Novato, CA). Images were acquired at
ex 340 or 380 nm and
em 505 nm and handled for further processing by an
imaging system (Imaging Corp., St. Catherines, Ontario, Canada). For
the determination of steady state [Ca2+]i 30 ratio images were recorded during 90 s. The
[Ca2+]i was calculated by in situ
calibration using the equation [Ca2+]i = Kd × (R
Rmin)/(Rmax
R) × Sf2/Sb2, with Kd (25 °C) = 264 nM as described
(42). For the determination of Rmin, cells were
washed twice with calibration buffer (120 mM NaCl, 25 mM Hepes, 15 mM glucose, 25 mM KCl,
2 mM MgCl2, 2 mM EGTA) and
equilibrated for 10 min in calibration buffer supplemented with 5 µM ionomycin. For the calculation of Rmax 5 mM Ca2+ and 10 µM ionomycin were
added. Autofluorescence was measured after the addition of 10 mM MnCl2.
The measurements with Fluo3 were performed as follows. Granule cells
grown on glass coverslips were incubated in the original culture medium
supplemented with 1 µM Fluo-3-AM for 10 min at 37 °C.
They were washed for 5 min at 37 °C in a solution of the same ionic
composition as the culture medium and then equilibrated in the same
medium without Mg2+ and supplemented with 500 µM tetradotoxin, 20 µM glycine for 10 min
at room temperature. Cells were stimulated with 50 µM
glutamate, and images were collected using 488 nm excitation and 520 nm
emission. Data from 20 neurons were recorded at 2-s intervals with the
system described above.
 |
RESULTS |
Expression of the PMCA Pump in Cerebellum--
The amounts of
PMCA1CII, PMCA2, PMCA3, and PMCA 4 proteins varied markedly in
synaptosomal preparations from the cerebella of 3-day-old as opposed to
3-week-old rats. The Western blots of Fig.
1 show that PMCA proteins were very
poorly detectable 3 days after birth (Fig. 1, 3d lanes) but
become very prominent after 3 weeks (Fig. 1, 3w lanes). In
the case of PMCA1, the increase was particularly marked in the faster
migrating band, corresponding to the PMCA1CII isoform (Fig. 1,
1N, CII). The overall extent of the up-regulation was
particularly evident when synaptosomal membrane proteins were incubated
with an antibody that recognized all four PMCA isoforms (Fig. 1,
5F10): the increased intensity of the 130-kDa PMCA band
evidently reflected the increased expression of the PMCA1CII, PMCA2,
PMCA3 and to a lower extent PMCA4 proteins. At the same time a
reproducible, if less dramatic, increase of the SERCA pump was observed
(Fig. 1, ER2b).

View larger version (46K):
[in this window]
[in a new window]
|
Fig. 1.
Expression of PMCA pump isoforms in
cerebellum. 15-20 µg of proteins from crude synaptosomal
membranes prepared from the cerebella of 3-day-old (3d) or
3-week-old (3w) rats were separated by SDS-PAGE. The portion
of the gel containing the markers was stained with Coomassie Brilliant
Blue, and the remainder of the gel was transferred to nitrocellulose
and probed with a polyclonal serum against the SERCA2b pump
(ER2b); with affinity-purified polyclonal antibodies against
the PMCA1 (1N), the PMCA2 (2N), and the PMCA3
pumps (3N), with a monoclonal antibody that recognizes rat
PMCA4 pumps (JA9) (43); and with a monoclonal antibody (32)
that recognizes all PMCA pump isoforms (5F10). The molecular
mass of the protein markers is indicated on the left. The position of
SERCA2b is indicated by an asterisk and that of PMCA1CI and
PMCA1CII by arrows at the left, and the positions
of of PMCA2CII, 3, and 4 are indicated by the thick arrow at
the right. PMCA2CI comigrated with PMCA1CII. The blots were developed
with NBT/BCIP as described under "Materials and Methods."
|
|
Time-dependent Expression of the PMCA Pump Isoforms in
Granule Cells--
Granule cells routinely prepared from the cerebella
of 6-8-day-old rats mature in vitro if they were cultured
in the presence of depolarizing concentrations of KCl (25 mM). They begin to develop long and widespread processes
shortly after plating (1-2 days), and become fully mature after 7-9
days of culturing under optimal conditions. Granule cells cultured in
nondepolarizing concentrations of KCl survive for some days (8),
particularly if growth factors are present, but in the experiments
described here, the sustained depolarization of the plasma membrane was
definitively found to be necessary for their complete maturation, and
especially for their long term survival thereafter. As soon as after 5 days of culturing in low potassium, the total number of cells was lower than in high potassium (Fig.
2A), as confirmed by
experiments in which the amount of living cells was determined by the
3-(4,5-dimethyl thiazol-2-yl)-2,5-diphenyl tetrazolium bromide method
(not shown). Nevertheless, the morphology of the neurons in high KCl
was indistinguishable from that of those surviving in the low potassium
culture (see the higher magnification field, in Fig. 2B).
After 5 days in culture, the ratio between viable and nonviable neurons
was similar, as indicated by the staining with calcein and propidium
iodide (Fig. 2, C and D). In addition, the cells
surviving in low KCl were still able to produce Ca2+
transients (see below) and to up-regulate the c-fos mRNA
when depolarized by the higher potassium concentration (not shown).

View larger version (59K):
[in this window]
[in a new window]
|
Fig. 2.
Viability of granule cells cultured in the
presence of 5.3 or 25 mM KCl. A, phase
contrast microphotographs of cells cultured for 3, 5, and 7 days in 5.3 or 25 mM KCl. Bar, 10 µM.
B, enlarged details of cells cultured for 5 days in 5.3 or
25 mM KCl. Notice the large numbers of dendrites
surrounding the cells. Bar, 10 µM.
C, cells cultured for 5 days in 5.3 (a and
b) or 25 (c and d) mM KCl
were incubated with propidium iodide (a and c) or
calcein-AM (b and d) as described under
"Materials and Methods." The images show the fluorescence at 617 nm
(a and c, propidium bromide) and 517 nm
(b and d, calcein). D, quantitation of
images similar to those shown in C. 3000 cells were
analyzed. The dark gray columns represent the percentage of
living cells (stained by calcein), and the light gray
columns represent the percentage of dead cells (stained by
propidium iodide).
|
|
It was thus decided to study whether the changes in the expression of
the genes of the PMCA pumps observed in whole cerebellum during
development also occurred during the maturation of granule cells. A
marked and steady increase of the total PMCA pump protein (Fig.
3, 5F10) was indeed detected
in cells cultured for 2-9 days in 25 mM KCl. The membrane
proteins were then analyzed using PMCA isoform-specific polyclonal and
monoclonal antibodies (19, 43). In agreement with the findings on the
intact tissue, the antibodies against the PMCA1 pump revealed that the
intensity of the band at 135 kDa (Fig. 3), corresponding to the CI
splice variant, remained approximately constant during the 5-9 days of
the maturation process, whereas that of the CII variant, which was only
faint at plating time, increased very significantly (129 kDa; Fig. 3,
1N). The expression of the PMCA2 (bands at 127-132 kDa;
Fig. 3, 2N) and PMCA3 (bands at 127-127 kDa; Fig. 3,
3N) proteins, which was insignificant at the time of
plating, also increased markedly during the same time. A weak band of
higher mobility that was likely to be the 127-kDa PMCA2CII splice
variant always accompanied the more prominent PMCA2 band at 132 kDa.
(Fig. 3, 2N). A rather weak band corresponding to the PMCA4
protein was visible 2 days after plating (i.e. after 2 days
in high KCl), the intensity of which, in contrast to the finding on the
intact tissue, did not change during the KCl-induced maturation process
(Fig. 3, JA9).

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 3.
Expression of PMCA pump isoforms in granule
cells. 15-20 µg of crude membrane proteins from cells cultured
in the presence of 25 mM KCl for 2, 3, 5, 7, and 9 days
were separated by SDS-PAGE, transferred to nitrocellulose and incubated
with the 5F10 monoclonal antibody, with affinity-purified
PMCA1-specific (1N), PMCA2-specific (2N), or PMCA
3-specific (3N) antibodies, or with the monoclonal,
PMCA4-specific JA9 antibody (43). An antibody specific for albumin was
used as a control for the loading (C). The Western blots
were developed with NBT/BCIP as described under "Materials and
Methods." The predicted positions for the PMCA1CI and the 1CII
proteins are indicated in the 1N panel and those for the
PMCA2CI and 2CII proteins in the 2N panel.
|
|
Granule cells that had survived for up to 5 days in low KCl contained
minor amounts of PMCA2 and PMCA3 proteins (Fig.
4, lanes 1 and 2)
and relatively high amounts of the PMCA1 and the PMCA4 proteins (Fig.
4, lanes 1 and 2, panels 1N and JA9),
even if the amount of the latter tended to decrease somehow if
culturing under low KCl was protruded for 5 days. The amounts of the
PMCA2 and PMCA3 proteins became significantly higher in cells cultured
for 5 days in 25 mM KCl (Fig. 4, 2N and
3N, lane 3). Under the same conditions, an increase was also
observed for the PMCA1CII protein (Fig. 4, 1N, lane 3),
whereas the amount of PMCA4 decreased (Fig. 4, lane 3, JA9).
If cells cultured in high potassium for 5 or 6 days were switched to
the low KCl medium for 2 or 1 extra day, respectively, an evident
decrease of the previously up-regulated PMCA2, PMCA3, and PMCA1CII
proteins occurred (Fig. 4, lanes 4-6). In the case of
PMCA1, 2, and 3 an accumulation of PMCA-specific proteolytic products
was observed (Fig. 4, bands indicated by the asterisks). As
for the PMCA4 protein, once down-regulated for 5 days in high KCl, it
did not come back if the cells were switched to the low KCl medium for
1 or 2 days (Fig. 4, JA9, lanes 4 and 5). Longer
times after the switching were not tested because the neurons did not
survive. No changes in the amount of the SERCA pump were observed in
cells cultured in low or high KCl or switched to a low KCl medium after
culturing (Fig. 4, SERCA, lanes 1-5).

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 4.
KCl concentration dependence of the
expression of the PMCA pumps. 15-20 µg of crude membrane
proteins from cells cultured in 5.3 mM KCl for 3 (lane 1) or 5 (lane 2) days are compared with
15-20 µg of crude membrane proteins from cells cultured for 5 days
in 25 mM KCl (lane 3). 15-20 µg of crude
membrane proteins from parallel cultures of neurons kept for 5 days in
the presence of 25 mM KCl and then switched to the low KCl
medium (5.3 mM KCl) for 48 h (lane 4) or
kept for 6 days in 25 mM KCl and then switched to the low
KCl medium (5.3 mM KCl) for 24 h (lane
5).Gels of 15-20 µg of crude membrane proteins from cells
cultured for 7 days in the presence of 25 mM KCl
(lane 6) are also presented. Proteins were transferred to
nitrocellulose after SDS-PAGE and analyzed with the PMCAspecific
antibodies as described in Fig. 3. The panel labeled SERCA was
incubated with a serum specific for the SERCA2b pump. The
immunocomplexes were visualized with CDP-StarTM as described under
"Materials and Methods."
|
|
Additional details on the pump isoforms, in particular on the
alternatively spliced variants, were sought by performing PCR runs.
Cells were cultured in the presence of 25 mM KCl for 5 days, i.e. until the isoform changes had become evident in
the Western blots (Fig. 3). Total RNA was prepared from the cells,
reverse transcribed and analyzed for alternative splicing at sites C
and A (see Fig. 5C for a
summary of the size of the expected products). In the case of splice
site C, three PMCA1 bands were detected (Fig. 5A, lane 1) at
260, 350, and 410 bp, corresponding to the C-terminally spliced
PMCA1CI, 1CIII (or CIV), and 1CII variants (17). In agreement with
observations at the protein level (Fig. 3), 1CII, which corresponds to
the shorter version of the PMCA1 pump, was the most prominent PMCA1
transcript (17, 21). The PMCA2 band at 320 bp was the PMCA2CI isoform,
whereas the weak band at 550 bp corresponded to the PMCA2CII variant
(Fig. 5A, lane 2). The two PMCA3 bands were the 3CI (210 bp)
and 3CII (360 bp) products (Fig. 5A, lane 3). As for PMCA4,
only the 270-bp CI isoform band (Fig. 5A, lane 4) was
visible. A very weak band at 530 bp, corresponding to the 4CII
isoforms, was only detected in Southern blots (not shown, but see Fig.
6B). The band of the AI
isoform of PMCA2 was observed at 238 bp (Fig. 5B, lane 1), the two bands of the AI and AII isoforms of PMCA3 were detected at 288 and 330 bp (Fig. 5B, lane 2) and one band, corresponding to
the AI isoform of PMCA4 at 385 bp (Fig. 5B, lane 3). These findings agree with previous observations in brain cells (21, 34, 35,
44). The identity of these isoforms was verified by Southern blotting
and sequencing (not shown).

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 5.
The alternative splicing variants of the PMCA
pumps present in granule cells. A and B,
total RNA from cells cultured for 5 days in 25 mM KCl was
reverse transcribed and subjected to PCR with oligonucleotides specific
for the PMCA isoforms. In the case of PMCA4, a longer (36 cycle) PCR
had to be performed. Aliquots corresponding to 100-150 ng of DNA were
then separated by PAGE and visualized by ethidium bromide. Panel
A shows the PCR products obtained with oligonucleotides specific
for splice site C of rat PMCA1 (lane 1), PMCA2 (lane
2), PMCA3 (lane 3), and PMCA4 (lane 4)
pumps. The splice variants are indicated by arrows.
Panel B shows the PCR products obtained with
oligonucleotides specific for splice site A of rat PMCA2 (lane
1), PMCA3 (lane 2), and PMCA4 (lane 3)
pumps. DNA molecular mass markers are given on the left. The
splice variants of PMCA3 are indicated by arrows.
C, the splice variants of the PMCA pumps found in granule
cells. For sake of clarity, a topographical model of the pump is given
at the top of the panel. Transmembrane domains are shown in
gray. PL, acidic phospholipid binding domain;
CaM, calmodulin binding domain. Splice sites A and C are
indicated by the black boxes; note that a portion of the
calmodulin binding domain overlaps splice site C. Details on the PMCA
isoform nomenclature can be found elsewhere (55).
|
|

View larger version (51K):
[in this window]
[in a new window]
|
Fig. 6.
KCl dependence of the transcription of the
PMCA pumps. A, 2 µg (lanes 1 and
2) or 17 µg (other lanes) of total RNA from
cells incubated for 5 days in the presence of 5.3 ( ) or 25 (+)
mM KCl were separated on formaldehyde agarose gels. A
portion of the gel was stained with ethidium bromide (lanes
1 and 2). The size of ribosomal RNA is indicated on the
left. The remainder of the gel was transferred to Nytran and
hybridized with 32P-random-primed labeled cDNA probes
specific for the pump isoforms (indicated at the bottom).
The upper portion of the blots containing the signal for the PMCA
isoforms (the mRNAs for the pumps migrated between 5000 and 8000 nt) was exposed at 70 °C for 6 days (PMCA2 and PMCA3) or for 10 days (PMCA1 and PMCA4). As a control for the loading and integrity of
the mRNA, the blots were hybridized with G3PDH (signal at 1800 nt)
cDNA and exposed for 2 days. Only the lower portions of the
Northern blots are shown for G3PDH. For PMCA1 and PMCA4, the blots that
are shown were incubated with the specific probes for G3PDH and PMCA1
or for G3PDH and PMCA4 together. In the case of PMCA2 and PMCA3, the
blots were incubated with the PMCA probe, stripped, and then incubated
with the probe for G3PDH. Performing the hybridization with the probes
together or sequentially did not influence the results. B,
reverse transcription PCR of total cell RNA from cells performed as
described under "Materials and Methods" and in the legend for Fig.
5 with oligonucleotides specific for the PMCA1 (lanes 1-5)
or PMCA4 (lanes 6-9) pumps. The cells were cultured in the presence of
5.3 mM (lanes 1, 2, 4, 6, and 8) or
25 mM KCl (lanes 3, 5, 7, and 9) for
0 (lane 1), 3 (lanes 2 and 3), or 5 (lanes 4-9) days. PCR products were separated on PAGE gels
and stained with ethidium bromide. DNA molecular mass markers are given
on the left side of the gels. The splicing variants are
indicated by arrows. The identity of the bands was confirmed
by Southern blotting and DNA sequencing. C, reverse
transcription PCR of total RNA obtained from cells cultured for 5 days
in 5.3 mM KCl. The plasma membrane of the cells was
depolarized for 30-40 min with 75 mM KCl (lanes 2, 4, and 6) or incubated with 75 mM NaCl
(lanes 1, 3, and 5). The PCR samples were
processed as described under "Materials and Methods" and in the
legend for Fig. 5. Oligonucleotides specific for c-fos,
lanes 1 and 2; for PMCA4, lanes 3 and
4; and for PMCA1, lanes 5 and 6. The
c-Fos was used as positive control for effect of the KCl mediated of
gene expression (1).
|
|
Effect of Depolarization on the PMCA Transcripts--
Northern
blotting analysis indicated that after 5 days, a
KCl-dependent increase in the level of transcripts for
isoforms 2 and 3 occurred (Fig. 6A). Competitive PCR
experiments confirmed this observation (results not shown). In the case
of PMCA1, cells cultured in high KCl showed a lower amount of the
shorter (5000 nt) transcript (Fig. 6A), whereas no changes
were visible for the longer (7000 nt) transcript. Two distinct PMCA1
mRNAs had been previously observed in rat tissues (45). A signal
specific for PMCA4 could only be detected after longer exposure of the autoradiogram. It showed a small but reproducible decrease in cells
cultured for 5 days in the presence of high KCl.
The effect of KCl on alternative splicing was analyzed by using the
oligonucleotides described above (Fig. 5). The 1CI was the most
prominent PMCA1 transcript at plating time or in cells growth in 5.3 mM KCl for 3 or 5 days (Fig. 6B, lanes 1, 2, and 4), whereas the high KCl medium induced an evident
up-regulation of the 1CII transcript (Fig. 6B, lanes 3 and
5). Although the overall level of the PMCA4 transcripts was
low and thus demanded a prolonged PCR, an additional splicing product
(PMCA4CII) could be clearly seen in low potassium (Fig. 6B, lane
6); much lower amounts of the PMCA4 transcripts were detected in
cells cultured in high potassium (Fig. 6B, lane 7). The KCl
depolarization-mediated decrease of the PMCA4 transcript was confirmed
by the A-splice-specific oligonucleotide (Fig. 6B). A higher
amount of the PMCA4-specific product was observed when cells were
cultured in low KCl (Fig. 6B, lane 8) than in high KCl (Fig.
6B, lane 9).
Short exposures of IMR32 cells to KCl had been shown to produce changes
in the splicing variants of the PMCA2 isoforms (46). Similar reverse
transcription PCR experiments on granule cells have failed to show
changes in the PMCA2 and PMCA3 splicing pattern at sites A and C
(results not shown). The isoform switch of PMCA1 was only observed
after 2-3 days in high KCl: no changes were induced by short time
depolarization (Fig. 6C lanes 5 and 6). However,
the RNA of isoform PMCA4CII started to be down-regulated by a short
treatment (30-40 min) with high KCl (Fig. 6C, lanes 3 and
4).
The Expression of the Pump Isoforms Is Dependent on
Ca2+ Influx--
25 mM KCl causes partial
depolarization of the plasma membrane, promoting the influx of
Ca2+ into granule cells (4). The free Ca2+
concentration in cells cultured in 25 mM KCl was indeed
significantly higher than in cells cultured in 5.3 mM
(149 ± 30 versus 58 ± 7 nM, see also
Fig. 7A, upper panel). Both
cell types showed typical and very large Ca2+ transients
upon further depolarization with 75 mM KCl, although the
effect was smaller in cells that had already been partially depolarized
by 25 mM KCl (Fig. 7A, upper panel). Nifedipine
abolished both the increase of [Ca2+]i induced by
25 mM KCl and the much larger Ca2+ transient
induced by 75 mM KCl: the number of viable cells after 5 days of culturing with nifedipine was similar to that of cells incubated with low KCl, i.e. about 60-70%. The treatment
with nifedipine (Fig. 7A, lower panel) abolished the 25 mM KCl-dependent up-regulation of the PMCA2,
PMCA3, and PMCA1CII pumps and the down-regulation of the PMCA4 pump
(not shown). Calcicludine (another L-type Ca2+
channel inhibitor (47)) behaved essentially like nifedipine (not
shown). Under these conditions, the glutamate-operated Ca2+
channel was probably inactive, because the NMDA channel inhibitor MK801
did not affect the expression of the pumps (Fig. 7A, lower panel, lane 4). It did, however, completely inhibit
Ca2+ transients induced by the addition of the excess
glutamate (not shown).

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 7.
Effect of Ca2+ influx on the
expression of the PMCA pump isoforms. A, upper panel,
measurement of the intracellular Ca2+ concentration in
granule cells cultured for 5 days in 5.3 or 25 mM KCl or in
25 mM KCl and 10 µM nifedipine (25 nif). Open columns, resting Ca2+
concentration; closed columns, peak cytosolic
Ca2+ concen tration after the addition of 75 mM KCl. The
Ca2+ concentrations (in nM) are given under the
columns. Lower panel, 25 µg of crude membrane
proteins from granule cells cultured for 5 days in the presence of 5.3 mM KCl (lane 1), of 25 mM KCl
(lane 2), of 25 mM KCl plus 10 µM
nifedipine (lane 3), or of 25 mM KCl plus 1 µM MK801 (lane 4) were separated by SDS-PAGE,
transferred to nitrocellulose membranes, and incubated with PMCA
isoform-specific antibodies. The immunocomplexes were visualized with
NBT/BCIP. The 0.1% dimethyl sulfoxide used as the solvent for
nifedipine did not affect either the viability of the cells or the
expression of the pumps. B, Western blot analysis of the
expression of PMCA pump isoforms in cells cultured in different
concentrations of KCl in the absence or presence of 140 µM NMDA. The gel shows PMCA1, PMCA2, PMCA3,
and SERCA2b proteins in 20 µg of crude membrane proteins from granule
cells cultured for 5 days in the presence of 5.3 (lane 1),
10 (lane 2), 15 (lane 3) 25 (lane 4),
and 50 mM KCl (lane 5). Lanes 6-10
are like lanes 1-5, except that 140 µM NMDA
was present in the culture medium. The immunocomplexes were visualized
by CDP-StarTM as described under "Materials and Methods." The
asterisk indicates a nonspecific reaction of the SERCA
antibody. C, nifedipine suppresses the effect of NMDA on
PMCA pump expression. 20 µg of proteins from crude membranes of
granule cells were used. Cells cultured in 10 mM KCl
(lane 1), 10 mM KCl/140 µM NMDA
(lane 2), and 10 mM KCl/140 µM
NMDA/10 µM nifedipine (lane 3) were separated
by SDS-PAGE and transferred to polyvinyldene difluoride filters. The
immunocomplexes were visualized by NBT/BCIP. D, influence of
extracellular Ca2+ on the expression of the PMCA2 and PMCA3
isoforms. 20 µg of crude membrane proteins from granule cells were
separated by SDS-PAGE and transferred to nitrocellulose. They came from
cells cultured for 5 days in 25 mM KCl in the presence of
an extracellular concentration of 0.5 (lane 1), 1.8 (lane 2), 3.6 (lane 3), 5 (lane 4), or 10 (lane
5) mM Ca2+ or for 3 days in 25 mM KCl in the presence of 1.8 mM
Ca2+ followed by 2 days in 25 mM KCl, 2 mM EGTA (lane 6). The immunocomplexes were
visualized by CDP-starTM as described under "Materials and
Methods." The asterisk indicates a nonspecific reaction of
the SERCA antibody.
|
|
Ca2+ may also enters into granule cells through
glutamate-activated NMDA channels if high concentrations of NMDA are
present in the culture medium. 140 µM NMDA in the
presence of only 10 mM KCl have been found to support the
survival of granule cells (11). Culturing the granule cells in 140 µM NMDA and 10 mM KCl increased the
intracellular Ca2+ over the levels found in cells cultured
in 10 mM KCl alone (110 ± 14 nM
versus 41 ± 6 nM). Consistently, 140 µM NMDA decreased the concentration of KCl needed to
up-regulate the expression of PMCA1CII, PMCA2, and PMCA3 pumps (Fig.
7B, compare lanes 1-5 with lanes
6-10). At the same time, NMDA down-regulated the expression of
the PMCA4 pump (Fig. 7C). These effects, however, were
partially inhibited by nifedipine (Fig. 7C, lane 3),
indicating that the 10 mM KCl, which was included to remove
the Mg2+ block on the NMDA receptor (15), promoted a
(limited) entry of Ca2+ through L-type
channels. The up-regulation of the PMCA pump isoforms in the presence
of 140 µM NMDA and 10 mM KCl thus resulted
from the entry of Ca2+ through NMDA receptors and
L-type channels. In agreement with these observations,
stepwise increases in the concentration of KCl up-regulated the
expression of the PMCA1CII, PMCA2 and 3 pumps in a
concentration-dependent way (Fig. 7B). The use
of potassium concentrations higher than 50-75 mM resulted
in a marked reduction of the number of cells (15 ± 5% at 100 mM KCl) and in the disappearance of the PMCA2 and 3 pumps
(not shown). In contrast to the PMCA pumps, the SERCA2b pump was
practically insensitive to the changes in the cellular Ca2+
free concentration.
Effect of Extracellular Ca2+ on the Expression of the
Pump--
The results in the preceding section had shown that the
increased penetration of Ca2+ induced by the partial
depolarization was responsible for the changed pattern of PMCA pump
expression. The experiments, however, were all performed on cells
incubated with the standard external concentration of 1.8 mM Ca2+: Fig. 7D shows that after 5 days in culture, the two isoforms chosen as example, PMCA2 and 3, indeed became optimally overexpressed at 1.8 mM
Ca2+. 0.5 mM Ca2+, however, was
insufficient for optimal overexpression. Because the attachment of the
cells to the culture dish required Ca2+, it proved
impossible to carry out a control in the total absence of
Ca2+. Fig. 7, however, shows that no PMCA pump was detected
when cells exposed to 1.8 mM Ca2+ for 3 days
were switched for 2 days to a medium in which the concentration of
external Ca2+ was decreased to the nanomolar range with
EGTA. The expression of the SERCA2b pump, which was run as a control,
only became affected at very high (10 mM) Ca2+
concentrations or when the cells were switched to the EGTA medium.
Pattern of PMCA Protein Expression in P-19 and PC-12 Cells Cultured
in High KCl--
Experiments were performed on P-19 and PC-12 cells,
which also differentiate into neurons in culture, to test the effect of KCl on the expression of PMCA pumps. PC-12 cells up-regulate the expression of c-Fos when their plasma membrane is depolarized (1).
Transcripts for the PMCA1 and PMCA2 pumps were present in P-19 and
PC-12 cells. In both lines, however, only isoform PMCA1CI could be
detected as a protein before and after differentiation: the amounts of
the PMCA2 and the PMCA3 proteins were below detection level. Addition
of 25 mM KCl had no evident changes in the pattern of pump expression.
Activity of the PMCA Pump: the Phosphoenzyme Intermediate--
The
formation of the phosphoenzyme intermediate is routinely used as a
reliable indication of the PMCA and SERCA pump activity. The activity
of the Ca2+ pumps was thus explored in experiments on the
formation of their phosphorylated intermediates. Two strongly
radioactive bands at 100 and 135 kDa, corresponding to the SERCA and
PMCA pumps (30), were detected in the membranes of granule cells (Fig.
8, lanes 1 and 2).
As expected, the incubation of cells in 25 mM KCl for 5 days significantly increased the amount of the 135 kDa band (PMCA). In
contrast, the band at 100 kDa (SERCA) remained unchanged (Fig. 8,
lanes 1 and 2). Aliquots of the same membranes
were immunoprecipitated with isoform-specific antibodies and with a
monoclonal antibody able to recognize all four isoforms under
conditions that prevented its degradation (30). All antibodies
precipitated proteins of 130-140 kDa (Fig. 8). Because the acidic gel
conditions required to preserve the phosphorylated intermediate failed
to resolve the alternatively spliced isoforms, no conclusions on the
alternatively spliced variants of PMCA1 were possible. The increase of
the phosphoenzyme of the PMCA2 pump was the most evident, whereas that
of PMCA3 was minor but also clear (Fig. 8). Quantification from these
and similar data has indicated that the phosphoenzyme intermediate of
the PMCA2 pump, which was only 2-6% of the total at plating time,
represented as much as 40% of it after 5 days of culturing in 25 mM KCl.

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 8.
The phosphoenzyme intermediate of the PMCA
pump isoforms in cultured granule cells. 200 µg of crude
membrane proteins from cells cultured for 5 days in 25 (+) or 5.3 ( )
mM KCl were phosphorylated with 0.3-0.4 µM
[ -32P]ATP (300 Ci/mmol) in the presence of
Ca2+ and La3+ (see under "Materials and
Methods"). of the reaction volume was used to analyze the
sample before immunoprecipitation (lanes 1 and
2); the remainder of the suspension was divided into four
aliquots and incubated with 2 µl of antibody 5F10 (1-2 µg/µl)
(lanes 3 and 4) or with 3-6 µg of the
affinity-purified antibodies specific for the PMCA isoforms: PMCA1
antibody, 1N, lanes 5 and 6; PMCA2 antibody,
2N, lanes 7 and 8; PMCA3 antibody, 3N,
lanes 9 and 10. The immunocomplexes were bound to
protein A-Sepharose; released by treatment with 6 M urea,
0.5 M dithiothreitol, and 5% SDS; and separated on acidic
gels. After staining with Coomassie Brilliant Blue, the gels were dried
and exposed for autoradiography for 24-72 h at 70 °C.
|
|
 |
DISCUSSION |
PMCA pump isoforms 1CII, 2, and 3 are expressed in a limited
number of rat tissues, and PMCA2 and PMCA3 have only been detected in
significant amounts in brain (19, 48). The present work has shown that
these isoforms became strongly up-regulated in cerebellum during the
first weeks of life. PMCA4, which is present in cerebellum at birth,
also became up-regulated during the first weeks of life. The work
described here has used cerebellar granule cells as a model and has
shown that during maturation in vitro, the pattern of
expression of the PMCA 2, 3 and 1CII pump isoforms underwent changes
identical to those observed in postnatal cerebellum. In contrast,
however, isoform 4 became rapidly down-regulated. These changes were
only observed in the presence of depolarizing concentrations of KCl.
Granule cells survive for some days in the presence of low
concentrations of KCl (about 5 mM), acquiring some of the
phenotypic properties of neurons (7, 8). When cultured in the presence of high concentrations of KCl, they exhibit the typical morphological changes of the fully mature granule neurons (e.g. formation
of synapses and migration to form aggregates). The development of active synapses has been suggested to be critical to the survival of
the cells in vivo because the synaptic connections would
provide cells with the continuous extra-depolarization that is mimicked by the incubation with high KCl in vitro (7, 14) It may also be speculated that this low level of depolarization would keep the
enzymes responsible for apoptosis repressed. Indeed, once committed to
full maturation by high KCl the cells cannot be switched back to low
KCl without undergoing fast apoptotic death.
The up-regulated pump isoforms (PMCA2, PMCA3, and PMCA1CII) that have
been detected in granule cells are those typical of adult brain (17,
19, 21, 49). The most significant increase was that of PMCA2, the
increase of which reached a plateau of at least 30% of the total pump
protein after 7 days in high KCl. The up-regulation was a relatively
slow process: short term (1-2 h) exposures to KCl concentrations of up
to 75 mM failed to induce it. This, however, was not true
of PMCA4 (the CII variant), the down-regulation of which by high
potassium followed in a reverse fashion the kinetics of up-regulation
of c-fos. The lower amounts of total PMCA4 protein in cells
cultured in high potassium was consistent with the recent finding of
the virtual absence of one of its major splicing isoforms, PMCA4CII,
from adult rat cerebellum (43).
The finding that the changes in the expression of the PMCA pumps during
maturation induced by 25 mM KCl were abolished by nifedipine clearly indicated that the effects were linked to the entry
of Ca2+ through L-type channels. The
Ca2+ imaging experiments have provided direct demonstration
of this: after 5 days in 25 mM KCl, cells contained up to 3 times more Ca2+ than those grown in 5.3 mM KCl.
Although the essential process controlled by Ca2+ evidently
was the transcription of the PMCA genes, other yet unidentified
posttranscriptional and/or posttranslational Ca2+ sensitive
mechanisms may also have played a role in the effects described. For
instance, the stability of the pump mRNA and/or its translation
efficiency could also be specifically affected by a
Ca2+-dependent mechanism. The stability of the
translated protein could also become modified during the cell
maturation process. Although these considerations may be valid for the
three up-regulated isoforms, the much faster kinetics of the response
of PMCA4 is very likely to reflect a different mechanism of regulation
by Ca2+.
At the end of the maturation process, the total amount of PMCA protein,
despite the down-regulation of isoform 4, was markedly increased.
Because both 25 mM KCl and the NMDA-glutamate receptor raise [Ca2+]i, it would be logical to imagine
that the increase reflects the need of the cells to deal with the
augmented level of cytosolic Ca2+. Despite the PMCA
up-regulation, cell Ca2+ nevertheless increased during the
maturation process: evidently, the increased influx of Ca2+
into the cells offset their increased exporting ability. This apparent
paradox could be rationalized by assuming that the maturation process
could demand the increase of intracellular Ca2+ (perhaps to
regulate the transcription of the genes). The up-regulation of the
pumps, considering that their pumping ability only becomes optimal at
200-300 nM Ca2+, would be a safety device to
prevent Ca2+ from rising to levels incompatible with the
normal life of the cells.
Observations on Ca2+-mediated gene expression have so far
mostly concerned immediate early genes, the induction of which can be
detected minutes to hours after stimulation. In the case of the
c-fos gene, the increase in transcription has been detected minutes after the initiation of depolarization; the effect disappears after 1-2 h (50). As mentioned above, an effect of this type may have
prevailed in the down-regulation of the expression of PMCA4CII. In the
case of the PMCA2 pump isoform, an effect of the early gene type was
observed in a neuroblastoma cell line (46): depolarization by KCl
induced a witch in the isoform pattern, linked to an alternative
splicing change at splice site A. Because no isoform switch of this
type was observed in granule cells, some of these gene induction
processes may be cell-specific. This would be consistent with the
observation that in the neuroblastoma cell line mentioned above no
changes were observed at the more commonly used C splice site (46). It
is also consistent with the finding that PMCA4 was rapidly
down-regulated in maturing granule cells but not in intact cerebellum.
In the latter, PMCA4 in other cell types evidently obscured the
down-regulation in the granules. The up-regulation of the PMCA pump
isoforms was not an unspecific effect of the increased concentration of
KCl in the medium, because PC-12 and P-19 neurons treated under similar conditions failed to show changes in the pattern of PMCA pump expression.
The changes in the PMCA isoforms pattern are likely to reflect the
demand of cells in terms of specific functional aspects of
Ca2+ pumping. After 7-9 days in culture, a major portion
of the total pump protein in granule cells was represented by the PMCA2
(and PMCA3) proteins. The analysis of the phosphoenzyme intermediate showed that the increase of the PMCA2 protein largely paralleled that
of the total pump activity. Even after 5 days of depolarization, when
the maturation of the cells was still incomplete (7, 8), at least 30%
of the total phosphoenzyme of the PMCA pumps was that of the PMCA2
isoform. Because this isoform has the highest affinity for calmodulin
of all PMCA pumps (51), its increase may be expected to provide the
cells with higher sensitivity to lower concentrations of
Ca2+-calmodulin, which would be useful in situations in
which the latter would become limiting. Because the
Ca2+-calmodulin-PMCA complex is the active state of the
pump, the increased affinity for calmodulin should also result in the
improved response of the pump to lower concentrations of
Ca2+ (51). After 5 days in high KCl, the contribution of
PMCA3 to the total cell phosphoenzyme was quantitatively minor, but
this was expected because the PMCA3 pump only became expressed at
optimal levels at later times, i.e. after 7-9 days in
culture. Unfortunately, the functional consequences of the increase of
the PMCA3 pump cannot be assessed, because this pump isoform has not
yet been functionally characterized. As for isoform 1CII, its
properties could be tentatively derived from those of the well
characterized homologous 4CII isoform. Alternative splicing at the
C-site, generating the 4CII and the 1CII isoforms (52), results in
pumps that have weaker binding affinity to calmodulin (53, 54), but
also higher basal (i.e. calmodulin-independent) ATPase
activity (54). The up-regulation of the PMCA1CII isoform could thus
confer to cells higher calmodulin-independent
Ca2+ pumping capacity (PMCA1CII). A separate problem is
that of the isoform 4, the down-regulation of which during the
maturation process cannot be adequately interpreted along similar
reasoning lines. It could be cautiously speculated that its
down-regulation is the response to a different demand generated
by the exposure to high KCl concentrations.
 |
ACKNOWLEDGEMENTS |
We are indebted to Dr. F. Wuytack (Leuven,
Belgium) for the polyclonal antibody against the SERCA2b pump. We thank
Dr. P. Nicotera (Konstanz, Germany) for numerous stimulating
discussions and Dr. J. T. Penniston (Mayo Clinic, Rochester, MN) for
the JA9 monoclonal antibody.
 |
FOOTNOTES |
*
The work has been made possible by the financial
contributions of the Swiss National Science foundation (Grant
31-30858.91) and of the Spanish Direcion General de Ensenanza Superior
(Grant PB95-1227).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
These authors contributed equally to the work.
§
Supported by a fellowship of the Junta de Extremadura (Spain).
**
To whom correspondence should be addressed. Tel.: 41-1-632-30-11;
Fax: 41-1-632-12-13.
The abbreviations used are:
NMDA, N-methyl-D-aspartic acid; PMCA, plasma membrane
Ca2+ ATPase; SERCA, sarcoplasmic/endoplasmic reticulum
calcium; MOPS, 3-(N-morpholino)propanesulfonic acid; MES, 2-(N-morpholino)ethanesulfonic acid; MEM, minimum Eagle's
medium; bp, base pair(s); PAGE, polyacrylamide gel electrophoresis; nt, nucleotide; PCR, polymerase chain reaction; NBT, nitro blue
tetrazolium; BCIP, 5-bromo-4-chloro-3-indolyl phosphate.
 |
REFERENCES |
-
Gallin, W. J.,
and Greenberg, M. E.
(1995)
Curr. Opin. Neurobiol.
5,
367-373[CrossRef][Medline]
[Order article via Infotrieve]
-
Jessell, T. M.,
and Kandel, E. R.
(1993)
Cell 72/Neuron
10,
1-31[CrossRef][Medline]
[Order article via Infotrieve]
-
Burgoyne, R. D.,
and Morgan, A.
(1995)
Trends Neurosci.
18,
191-196[CrossRef][Medline]
[Order article via Infotrieve]
-
Franklin, J. L.,
and Johnson, E. M.
(1992)
Trends Neurosci.
15,
501-508[CrossRef][Medline]
[Order article via Infotrieve]
-
Silos-Santiago, I.,
Greenlund, L. J. S.,
Johnson, E. M.,
and Snider, W. D.
(1995)
Curr. Opin. Neurobiol.
5,
42-49[CrossRef][Medline]
[Order article via Infotrieve]
-
Henderson, C. E.
(1996)
Curr. Opin. Neurobiol.
6,
64-70[CrossRef][Medline]
[Order article via Infotrieve]
-
Gallo, V.,
Kingsbury, A.,
Balázs, R.,
and Jørgensen, O. S.
(1987)
J. Neurosci.
7,
2203-2213[Abstract]
-
Balázs, R.,
Gallo, V.,
and Kingsbury, A.
(1988)
Dev. Brain Res.
40,
269-276[CrossRef]
-
Ankarcrona, M.,
Dybukt, J. M.,
Bonofoco, E.,
Zhivotovsky, B.,
Orrenius, S.,
Lipton, S. A.,
and Nicotera, P.
(1995)
Neuron
15,
961-973[CrossRef][Medline]
[Order article via Infotrieve]
-
D'Mello, S. R.,
Galli, C.,
Ciotti, T.,
and Calissano, P.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
10989-10993[Abstract/Free Full Text]
-
Balazs, R.,
Jorgensen, O. S.,
and Hack, N.
(1988)
Neuroscience
27,
437-451[CrossRef][Medline]
[Order article via Infotrieve]
-
Bovolin, P.,
Santi, M.-R.,
Memo, M.,
Costa, E.,
and Grayson, D. R.
(1992)
J. Neurochem.
59,
62-72[CrossRef][Medline]
[Order article via Infotrieve]
-
Condorelli, D. F.,
Dell'Albani, P.,
Aronica, E.,
Genazzani, A. A.,
Casabona, G.,
Corsaro, M.,
Balás, R.,
and Nicoletti, F.
(1993)
J. Neurochem.
61,
2133-2139[Medline]
[Order article via Infotrieve]
-
Bessho, Y.,
Nawa, H.,
and Nakanishi, S.
(1994)
Neuron
12,
87-95[CrossRef][Medline]
[Order article via Infotrieve]
-
Resink, A.,
Villa, M.,
Benke, D.,
Mohler, H.,
and Balázs, R.
(1995)
J. Neurochem.
64,
558-565[Medline]
[Order article via Infotrieve]
-
Schultz, J. B.,
Weller, M.,
and Klockgether, T.
(1996)
J. Neurosci.
16,
4696-4706[Abstract/Free Full Text]
-
Keeton, T. P.,
Burk, S. E.,
and Shull, G. E.
(1993)
J. Biol. Chem.
268,
2740-2748[Abstract/Free Full Text]
-
Reuter, H.,
and Porzig, H.
(1995)
Neuron
15,
1077-1084[CrossRef][Medline]
[Order article via Infotrieve]
-
Stauffer, T.,
Guerini, D.,
and Carafoli, E.
(1995)
J. Biol. Chem.
270,
12184-12190[Abstract/Free Full Text]
-
García-Martín, E.,
and Gutièrrez-Merino, C.
(1996)
Biochim. Biophys. Acta
1280,
257-264[Medline]
[Order article via Infotrieve]
-
Stauffer, T.,
Hilfiker, H.,
Carafoli, E.,
and Strehler, E. E.
(1993)
J. Biol. Chem.
268,
25993-25003[Abstract/Free Full Text]
-
Hammes, A.,
Oberdorf, S.,
Strehler, E. E.,
Stauffer, T.,
Carafoli, E.,
Vetter, H.,
and Neyses, L.
(1994)
FASEB J.
8,
428-435[Abstract]
-
Zacharias, D. A.,
Dalrtymple, S. J.,
and Strehler, E. E.
(1995)
Mol. Brain Res.
28,
263-272[Medline]
[Order article via Infotrieve]
-
Carmichael, J.,
DeGraff, W. G.,
Gazdar, A. F.,
Minna, J. D.,
and Mitchell, J. B.
(1987)
Cancer Res.
47,
943-946[Abstract/Free Full Text]
-
Foletti, D.,
Guerini, D.,
and Carafoli, E.
(1995)
FASEB J.
9,
670-680[Abstract]
-
Bain, G.,
Ray, W. J.,
Yao, M.,
and Gottlieb, D. I.
(1994)
BioEssays
16,
343-348[CrossRef][Medline]