|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 274, Issue 3, 1698-1707, January 15, 1999
From the Computer-assisted analyses indicate that
Bacillus subtilis contains approximately 300 genes for
exported proteins with an amino-terminal signal peptide. About 114 of
these are lipoproteins, which are retained in the cytoplasmic membrane.
We have investigated the importance of lipoprotein processing by signal
peptidase II (SPase II) for cellular homeostasis, using cells lacking
SPase II. The results show that lipoprotein processing is important for
cell viability at low and high temperatures, suggesting that lipoproteins are essential for growth under these conditions. Although
certain lipoproteins are required for the development of genetic
competence, sporulation, and germination, these developmental processes
were not affected in the absence of SPase II. Cells lacking SPase II
accumulated lipid-modified precursor and mature-like forms of PrsA, a
folding catalyst for secreted proteins. These forms of PrsA seem to
have a reduced activity, as the secretion of One of the most commonly used eubacterial sorting (retention)
signals for proteins that are exported from the cytoplasm is an
amino-terminal lipid-modified cysteine residue (see Refs. 1 and 2). In
Gram-positive eubacteria, such as Bacillus subtilis, lipid-modified proteins (lipoproteins) are retained in the cytoplasmic membrane. In Gram-negative eubacteria, such as Escherichia
coli, these proteins are retained in the cytoplasmic or the outer
membrane; retention in the cytoplasmic membrane depends on the presence of an additional sorting signal in the form of an aspartic acid residue
at the +2 position relative to the amino-terminal cysteine residue (see
Refs. 3-6). Even the organism with the smallest known genome,
Mycoplasma genitalium, seems to make use of lipid modification to retain proteins in the cytoplasmic membrane (7). The
number of putative lipoprotein-encoding genes per eubacterial genome
seems to range from approximately 18 in M. genitalium
(http://www.tigr.org/tdb/mdb/mgdb) to approximately 89 in E. coli1 and 114 in
B. subtilis (Table I). Thus, lipoproteins appear to
represent about 1-3.5% of the proteome of eubacteria.
Lipoproteins are directed into the general (Sec) pathway for protein
secretion by their signal peptides, which show similar structural
characteristics as the signal peptides of secretory proteins: a
positively charged amino terminus, a hydrophobic core region, and a
carboxyl-terminal region containing the cleavage site for signal
peptidase (SPase).2 The major
difference between signal peptides of lipoproteins and secretory
proteins is the presence of a well conserved "lipobox" of four
residues in the former signal peptides, which constitutes the cleavage
site for the lipoprotein-specific SPase, also known as SPase II.
Invariably, the carboxyl-terminal residue of the lipobox is cysteine,
which, upon lipid modification, forms the retention signal of the
mature lipoprotein (for details, see Refs. 1 and 8). Modification of
this cysteine residue by the diacylglyceryl transferase is a
prerequisite for processing of the lipoprotein precursor by SPase II.
Processing by SPase II can be inhibited with globomycin, a reversible
and noncompetitive peptide inhibitor (2, 9, 10). In E. coli,
the processed lipoprotein is further modified by aminoacylation of the
diacylglycerylcysteine amino group (11, 12). It is presently not
known whether the latter lipid modification step is conserved in all
eubacteria. For example, B. subtilis and M. genitalium lack an lnt gene for the lipoprotein aminoacyltransferase.1
In Gram-negative eubacteria, the outer membrane confines numerous
proteins to the periplasm. In Gram-positive eubacteria, which lack an
outer membrane, lipid modification of exported proteins prevents their
loss into the environment, as these proteins remain anchored to the
cytoplasmic membrane. This may explain why B. subtilis
contains more putative lipoproteins than E. coli and why,
for example, 32 lipoproteins of B. subtilis are homologues of periplasmic high affinity substrate-binding proteins from
Gram-negative eubacteria (Table I). Lipoproteins of Gram-positive
eubacteria with a known function are involved in a variety of
processes, such as the uptake of nutrients, resistance to antibiotics,
protein secretion, competence for DNA binding and uptake, sporulation, germination, and bacterial targeting to different substrates, bacteria,
and host tissues (see Ref. 13). In addition, a close examination of the
putative lipoproteins of B. subtilis, which were identified
on the basis of the conserved lipobox, suggests that certain
lipoproteins are also involved in oxidative phosphorylation, cell wall
biogenesis, and autolysis. The importance of lipoproteins for the
homeostasis of Gram-positive eubacteria is underscored by the
observation that the most abundant lipoprotein of B. subtilis, PrsA, is essential for the efficient secretion of
various proteins and cell viability (14-17). Notably, no specific
function can presently be assigned to the majority of putative
lipoproteins of B. subtilis (about 75%; Table
I) and other Gram-positive
eubacteria.
The present studies were aimed at the evaluation of the importance of
B. subtilis lipoproteins for cellular homeostasis in general, and their processing by SPase II in particular. For this purpose, SPase II-depleted cells were used. Unexpectedly, the results
show that lipoprotein processing is required for growth at low and high
temperatures and the efficient secretion of the Plasmids, Bacterial Strains, and Media--
Table
II lists the plasmids and bacterial
strains used. TY medium (tryptone/yeast extract) contained Bacto
tryptone (1%), Bacto yeast extract (0.5%), and NaCl (1%). S7 media 1 and 3, used for labeling of B. subtilis proteins with
[35S]methionine (Amersham Pharmacia Biotech), were
prepared as described in Refs. 21 and 22. When required, media for
E. coli were supplemented with ampicillin (50 µg/ml),
erythromycin (100 µg/ml), or kanamycin (40 µg/ml); media for
B. subtilis were supplemented with chloramphenicol (5 µg/ml), erythromycin (1 µg/ml), kanamycin (10 µg/ml), tetracyclin
(6 µg/ml), spectinomycin (100 µg/ml), globomycin (80 µg/ml),
and/or IPTG (1 mM).
DNA Techniques--
Procedures for DNA purification,
restriction, ligation, agarose gel electrophoresis, and transformation
of E. coli were carried out as described in Ref. 30. Enzymes
were from Boehringer Mannheim. B. subtilis was transformed
as described in Ref. 25. Correct integration of plasmids into the
chromosome of B. subtilis was verified by Southern blotting.
PCR was carried out with Vent DNA polymerase (New England Biolabs) as
described in Ref. 31. pMutin2-MIL (see "Results" for explanation)
was constructed by PCR amplification of the 5' region of the
lsp gene with the primers
lsp-m1(5'-ATAAGCTTAACCGTAAACTGGAGG-3') and lsp-m2
(5'-GCGGATCCAAGAAGCCTTTGTCCC-3') and subsequent cloning in pMutin2.
pMutin2-M Competence and Sporulation--
Competence for DNA binding and
uptake was determined by transformation with plasmid or chromosomal DNA
(28). The efficiency of sporulation was determined by overnight growth
in Schaeffer's medium (32), killing of cells with 0.1 volume of
chloroform, and subsequent plating.
Protein Labeling, Immunoprecipitation, SDS-PAGE, and
Fluorography--
Pulse-chase labeling of B. subtilis,
immunoprecipitation, SDS-polyacrylamide gel electrophoresis (SDS-PAGE),
and fluorography were performed as described previously in Refs. 21 and
22. Palmitic acid labeling of (pre-)PrsA was performed as described in
Ref. 16.
Western Blot Analysis--
Western blotting was performed as
described in Ref. 34. After separation by SDS-PAGE, proteins were
transferred to Immobilon-PVDF membranes (Millipore Corporation). To
detect PrsA or the Trypsin Accessibility Assay--
The preparation of protoplasts
from exponentially growing cells of B. subtilis and the
testing of the protease accessibility of membrane proteins was
performed as described in Ref. 29.
The lsp Gene for SPase II Is Not Essential for Cell
Viability--
To determine whether the lsp gene for the
SPase II of B. subtilis (35) is essential for growth and
cell viability, two lsp mutant strains were constructed,
using derivatives of the integration vector pMutin2. B. subtilis M Maximal lsp Transcription in the Exponential Growth
Phase--
Both in B. subtilis M Alternative Amino-terminal Processing of Pre-PrsA in Cells
Lacking SPase II--
To examine the effects of the absence of SPase
II, the processing of (pre-)PrsA, the major lipoprotein of B. subtilis (15, 16) was studied by pulse-chase labeling experiments
with B. subtilis M
It has been shown previously that lipoprotein precursors from which the
cleavage site for SPase II was removed by site-directed mutagenesis can
be cleaved at alternative sites (for review, see Ref. 45). Type I
SPases, which are required for the processing of secretory precursor
proteins (for review, see Ref. 46) have been invoked in this
alternative processing. To investigate whether the five type I SPases
of B. subtilis (i.e. SipS, SipT, SipU, SipV, and
SipW) (25, 47) might be involved in the amino-terminal cleavage of
pre-PrsA in the absence of SPase II, multiple sip mutants
were used. First, the lsp gene of the B. subtilis
strains Membrane Topology and Lipid Modification of PrsA Are Not
Affected in the Absence of SPase II--
As PrsA is an essential
protein for growth and viability of B. subtilis
(16),3 pre-PrsA and/or the
mature-like forms of PrsA that are observed in cells lacking SPase II
must be (partially) active. This implies that at least one of the
latter forms of PrsA is correctly localized at the external surface of
the membrane. To determine the topology of pre-PrsA and the mature-like
forms of PrsA in the absence of SPase II, protoplasts of B. subtilis 8G5 M Lsp Is Required for the Efficient Processing and Secretion of the
Non-lipoprotein Pre-AmyQ--
It was previously shown that PrsA sets a
limit for high level secretion of the Bacillus
amyloliquefaciens
To determine whether the accumulation of pre-AmyQ in SPase II-depleted
cells reflects a reduced rate of translocation of pre-AmyQ, which might
be caused by the accumulation of lipoprotein precursors, we made use of
an AmyQ variant (AmyQ-PSBT) (25) containing the biotinylation domain of
the pyruvate decarboxylase of Propionibacterium shermanii
(48). The rationale of this experiment is that pre-AmyQ-PSBT can only
be biotinylated by the cytoplasmic biotin-ligase if the PSBT domain
folds into its native three-dimensional structure in the cytoplasm.
This will only happen if the rate of translocation of pre-AmyQ-PSBT
across the membrane is significantly reduced. As shown in Fig.
6, cells lacking SPase
II( We have previously shown that five paralogous type I SPases are
involved in the processing of secretory precursor proteins in B. subtilis (25, 47, 49, 50). Two of these, designated SipS and SipT,
are of major importance for protein secretion, and cells depleted of
both SipS and SipT stop growing and lyse. The other type I SPases
(SipU, SipV, and SipW) are of minor importance for protein secretion
and viability. Thus, B. subtilis is representative for
Gram-positive eubacteria, archaea, and eukaryotes, many of which
contain paralogous type I SPases (25). In contrast to the type I
SPases, B. subtilis (35, 51) and other eubacteria seem to
contain only one gene for SPase
II,5 whereas type II SPases
appear to be absent from archaea and eukaryotes.1 Here, we
document four unexpected observations with respect to SPase II function
in B. subtilis. First, unlike the SPase II of E. coli, the SPase II of B. subtilis is not essential for
growth and viability. Second, the absence of SPase II resulted in cold and heat sensitivity. Third, SPase II is not required for the development of genetic competence, sporulation, and spore germination although at least eight known lipoproteins are important for these processes. Fourth, the secretion of the non-lipoprotein AmyQ was severely reduced in the absence of SPase II.
Lipoprotein processing by SPase II in E. coli can be
inhibited by globomycin. Consistent with the observation that SPase II is essential for cell viability of E. coli (52), globomycin can serve as an antibiotic for E. coli and other
Gram-negative eubacteria (9). Despite the fact that globomycin can
inhibit the processing of certain lipoprotein precursors in B. subtilis (Ref. 53 and this paper), this antibiotic displays no
cytotoxic activity against B. subtilis and other
Gram-positive eubacteria (9). The present results show that this is
most likely due to the fact that the SPase II is not essential for cell
viability of B. subtilis and not to degradation or
modification of globomycin. One reason why SPase II is more important
for cell viability of E. coli than for cell viability of
B. subtilis may be that most lipoproteins of E. coli are sorted to the outer membrane. Of the 89 (putative)
lipoproteins of E. coli, which we have recently identified
by computer-assisted analyses, only 8 have an aspartic acid residue at
the +2 position for retention in the cytoplasmic membrane (data not
shown), suggesting that the other 81 lipoproteins are sorted to the
outer membrane. Thus, the lethality of lsp mutations in
E. coli may be attributed to the depletion of lipoproteins from the outer membrane. Furthermore, even though B. subtilis has more lipoprotein-encoding genes than E. coli, the latter organism may produce more lipoprotein molecules
per cell, and therefore, the lethality of lsp mutations in
E. coli could also be due to the accumulation of lipoprotein
precursors in the cytoplasmic membrane.
Notably, the lipoproteins of B. subtilis (Table I) and
other Gram-positive eubacteria (13) seem to lack aspartic acid residues at the +2 position. The latter observation suggests that this aspartic
acid residue has specifically evolved as a retention signal for
lipoproteins of Gram-negative eubacteria. Furthermore, the lack of
lnt genes from B. subtilis and M. genitalium suggests that the lipoproteins of these organisms are
not aminoacylated. Consistent with the latter hypothesis, a
macrophage-stimulating lipoprotein with a non-acylated amino terminus
has been isolated from Mycoplasma fermentans (54). The
latter observations raise the intriguing question of whether
aminoacylation has a particular function in Gram-negative eubacteria;
for example, in the sorting of lipoproteins.
Cold sensitivity seems to be a general property of E. coli (55) and B. subtilis (29) strains, which are
defective in protein translocation via the Sec-machinery.
Thus, the cold sensitivity of B. subtilis lsp mutants might
reflect a general defect in protein translocation, which could be
caused primarily by the accumulation of lipoprotein precursors.
However, this possibility is unlikely, as SPase II-depleted cells did
not show a translocation defect for AmyQ-PSBT, irrespective of the
growth temperature. Instead, our results indicate that the observed
cold and heat sensitivity of B. subtilis mutants lacking
SPase II is caused by the malfunction of certain lipoproteins, which
are required for cell viability at low and high temperatures.
The observation that the development of competence, sporulation,
and germination are not affected by the absence of SPase II shows that
the precursors, or (putative) alternatively processed forms of the
lipoproteins required for these primitive developmental processes are
active. Similarly, the fact that the strain lacking SPase II is viable
at 37 °C shows that pre-PrsA and/or the mature-like forms of PrsA
are active, because PrsA is essential for cell viability (16).
Nevertheless, as indicated by the reduced secretion of AmyQ in
lsp mutants B. subtilis, lipoprotein processing
is important for the full functionality of lipoproteins, such as PrsA.
Our current working model for the effects of SPase II limitation on the
processing of pre-PrsA and the secretion of AmyQ is shown in Fig.
7. Although SPase II-depleted cells
contain similar amounts of PrsA protein as wild-type cells, processing
by SPase II seems to be important for the stable maintenance of certain
other lipoproteins,6
suggesting that processing by SPase II is required to protect these
proteins against proteolytic degradation at the membrane-cell wall
interface.
The Role of Lipoprotein Processing by Signal Peptidase II in the
Gram-positive Eubacterium Bacillus subtilis
SIGNAL PEPTIDASE II IS REQUIRED FOR THE EFFICIENT SECRETION OF
-AMYLASE, A NON-LIPOPROTEIN*
§,
,
,,,,,, and§§¶¶
Department of Genetics, Groningen
Biomolecular Sciences and Biotechnology Institute, Kerklaan 30, 9751 NN Haren, The Netherlands, the ¶ Vaccine Development
Laboratory, National Public Health Institute, Mannerheimintie 166, SF-00300 Helsinki, Finland, the ** Department of Microbiology, The
Medical School, University of Newcastle upon Tyne, Framlington Place,
Newcastle upon Tyne NE2 4HH, United Kingdom, and the
§§ Department of Pharmaceutical Biology,
University of Groningen, Antonius Deusinglaan 1, 9713 AV Groningen, The Netherlands
ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References
-amylase was strongly
impaired. Unexpectedly, type I signal peptidases, which process
secretory preproteins, were not involved in alternative amino-terminal
processing of pre-PrsA in the absence of SPase II. In conclusion,
processing of lipoproteins by SPase II in B. subtilis is
not strictly required for lipoprotein function, which is surprising as
lipoproteins and type II SPases seem to be conserved in all eubacteria.
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
Putative lipoproteins of B. subtilis
3 and the strictly conserved cysteine at
position +1 relative to the cleavage site for SPase II, are indicated
in boldface. Note that aspartic acid residues are absent from position
+2. KapB, which seems to be a lipoprotein (20), is not listed in this
table because its amino terminus is atypical for signal peptides of
lipoproteins due to the presence of two lysine residues in the
hydrophobic core region. No other putative lipoproteins of this type
were identified.
-amylase AmyQ (a
non-lipoprotein) but not for growth and cell viability at 37 °C,
development of competence for DNA binding and uptake, sporulation, or
spore germination.
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
Plasmids and bacterial strains
L was constructed by PCR amplification of an internal
fragment of the lsp gene with the primers lsp-m5
(5'-ATGTCGACGCATGGGGGATATTAG-3') and lsp-m2 and subsequent cloning in
pMutin2. To construct pKTH3409, the prsA gene was amplified
by PCR with a primer containing a ClaI site and 5' sequences
of prsA (starting at position 27 relative to the start
codon) and a primer, which adds the sequence
CACCATCACCATCACCATTAAGTCGAC to the 3'-end of prsA,
specifying a hexahistidine tag, stop codon, and SalI
cleavage site. The tagged prsA gene was placed under the
control of the xylose-inducible xylA promoter of plasmid
pSX50, using the ClaI and SalI restriction sites.
The resulting plasmid was designated pKTH3409.
-Galactosidase Activity Assay--
Overnight cultures were
diluted 100-fold in fresh medium, and samples were taken at hourly
intervals for A600 readings and -galactosidase activity determinations. The assay and the
calculation of -galactosidase units (expressed as units per
A600) were carried out as described in Ref.
33.
-amylase AmyQ, B. subtilis cells were
separated from the growth medium by centrifugation (5 min, 12.000 rpm,
room temperature), and samples for SDS-PAGE were prepared as described
in Ref. 22. (Pre-)PrsA and (pre-)AmyQ were visualized with specific
antibodies and horseradish peroxidase-anti-rabbit-IgG conjugates
(Amersham Pharmacia Biotech). Hexahistidine-tagged (pre-)PrsA was
visualized with hexahistidine-specific monoclonal antibodies (Amersham
Pharmacia Biotech), and biotinylated (pre-)AmyQ-PSBT was visualized
with streptavidine-horseradish peroxidase conjugates (Amersham
Pharmacia Biotech).
RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References
L was constructed by integration of pMutin2-ML
within the structural lsp gene, resulting in the disruption
of this gene. B. subtilis MIL was constructed by integration of pMutin2-MIL at the 5'-end of lsp in such a way that the
original lsp promoter region was replaced by the
IPTG-inducible Pspac promoter (Fig.
1A). The fact that B. subtilis ML could be obtained shows that SPase II is not
essential for cell viability, at least when cells are grown in TY or
minimal medium at 37 °C. Under these conditions, the growth of
B. subtilis ML was only slightly reduced, compared with
the parental strain 8G5. Similarly, the growth rate of B. subtilis MIL was slightly reduced in the absence of IPTG, as
compared with that of B. subtilis MIL in the presence of
IPTG, or the parental strain. Unexpectedly, the disruption of the
lsp gene did not inhibit the development of competence for
DNA binding and uptake, sporulation, and subsequent spore germination
(data not shown), although at least one lipoprotein is required both for competence development and sporulation (OppA) (36), three for
sporulation (DppE, also known as DciA, SpoIIIJ, and SpoIVB) (37-39),
and five for germination (GerAC, GerBC, GerKC, GerM, and GerD) (40-44). Interestingly, SPase II appeared to be essential for
growth at 15 °C (data not shown) and 48 °C. Upon a temperature shift from 37 to 48 °C, cells lacking SPase II stopped growing and
lysed (Fig. 1B, lsp). These findings imply
that some as yet unidentified lipoproteins of B. subtilis
are required for growth at low and high temperatures or that the
accumulation of lipoprotein precursors causes cold and heat
sensitivity. In what follows, we show that the cold and heat
sensitivity of cells lacking SPase II must be due to the malfunction of
certain lipoproteins.
View larger version (24K):
[in a new window]
Fig. 1.
Construction and properties of lsp
mutant strains of B. subtilis. A, schematic
presentation of the construction of lsp mutant strains of
B. subtilis. B. subtilis MIL (Ilsp) was
constructed by Campbell-type integration of pMutin2-MIL in the
ileS-pyrR locus of B. subtilis 8G5 in
such a way that the lsp promoter region was replaced by the
IPTG-dependent Pspac promoter. B. subtilis M L (lsp) was constructed by
Campbell-type integration of pMutin2-ML in the
ileS-pyrR locus of B. subtilis 8G5 in
such a way that the lsp gene was disrupted, and downstream
genes were placed under the control of the Pspac promoter.
Due to the integration of pMutin2-MIL and pMutin2-ML, B. subtilis MIL and ML both contain the
spoVG-lacZ reporter gene of pMutin2 under the
transcriptional control of the lsp promoter region. The
relative positions of open reading frames in the
ileS-pyrR locus are shown. Restriction sites
relevant for the construction are indicated: Ba,
BamHI; Bc, BclI; Bg,
BglII; Nd, NdeI; Hi,
HindIII. Ori pBR322, replication functions of pBR322;
Apr, ampicillin resistance marker;
Emr, erythromycin resistance marker;
lsp', 3' truncated lsp gene;
T1T2, transcriptional terminators on pMutin2;
'lsp, 5' truncated lsp gene. B,
temperature-sensitive growth of B. subtilis lacking SPase
II. Overnight cultures of B. subtilis ML
(lsp) (
) and the parental strain 8G5 (
) grown in TY
medium at 37 °C were diluted 100-fold in fresh TY medium and
incubated at 37 °C. When the cells reached an
A600 of about 1.2, the temperature was shifted
to 48 °C. Zero time (t = 0) indicates the transition
point between the exponential and postexponential growth phases.
C, time courses of the transcription of the
lsp-lacZ gene fusion in B. subtilis MIL were
determined in cells growing at 37 °C in TY (
) or minimal ()
medium, both supplemented with 1 mM IPTG. -Galactosidase
activities were determined in units per A600.
Zero time (t = 0) indicates the transition point
between the exponential and postexponential growth phases.
L and B. subtilis MIL, the transcription of the lacZ gene,
present on pMutin2, is directed by the lsp promoter region
(Fig. 1A). To study the transcription of the lsp gene, B. subtilis MIL was grown in the presence or absence
of IPTG, and samples withdrawn at hourly intervals were assayed for -galactosidase activity. The results showed that the
-galactosidase levels increased during exponential growth, reaching
a maximum in the transition phase between exponential and
postexponential growth. In contrast, the -galactosidase levels were
strongly decreased in the postexponential growth phase. This pattern of lsp-lacZ expression was observed when cells were grown in TY
or minimal medium, irrespective of the presence of IPTG. However, compared with minimal medium, higher expression levels were detected in
TY medium, where, in the postexponential growth phase,
-galactosidase activity was close to background (Fig.
1C). In summary, these observations indicate that the
transcription of lsp is highest in the exponential growth
phase and decreases to lower levels in the postexponential growth
phase. Thus, it seems that exponentially growing cells produce
sufficient SPase II for lipoprotein processing in the transition and
postexponential growth phases.
L. As shown in Fig.
2A (lsp),
pre-PrsA processing was strongly impaired in the absence of SPase II,
and even after a long chase period of 15 min, no mature PrsA was
detectable. In contrast, pre-PrsA was rapidly processed to the mature
form in the parental strain. As expected, Western blotting experiments showed that B. subtilis ML accumulated pre-PrsA, but
surprisingly, this concerned only about 50% of the total PrsA present
in the cells. In addition to pre-PrsA, cells of B. subtilis
ML also contained mature-like forms of PrsA, which, compared with
mature PrsA, had a slightly lower mobility on SDS-PAGE (Fig.
2B, lsp). This difference in mobility could
only be visualized clearly when proteins were separated on long gels
(40 cm). In what follows, standard gel systems (15 cm) were used,
resulting in a less pronounced separation of mature PrsA (strains
containing SPase II) and mature-like forms of PrsA (strains lacking
SPase II). As shown in Fig. 2C, the mature-like forms of
PrsA were also detected when cells of B. subtilis ML
(lsp) or the parental strain (8G5) were grown in the
presence of globomycin. Western blotting experiments with a
xylose-inducible mutant form of PrsA, containing a carboxyl-terminal hexahistidine tag, showed that at least one of the mature-like forms of
PrsA was cleaved at the amino terminus (Fig. 2D). Taken together, these findings show that in the absence of SPase II, pre-PrsA
is subject to alternative amino-terminal processing at a low rate.
View larger version (24K):
[in a new window]
Fig. 2.
Processing of PrsA in lsp mutant
strains. A, processing of pre-PrsA in cells of B. subtilis M L (lsp) and the parental strain 8G5 was
analyzed by pulse-chase labeling at 37 °C and subsequent
immunoprecipitation, SDS-PAGE, and fluorography. Cells were labeled
with [35S]methionine for 1 min prior to chase with excess
nonradioactive methionine. Samples were withdrawn at 0, 1, and 15 min
after the chase. The positions of pre-PrsA and mature PrsA are
indicated. B, accumulation of pre-PrsA in cells of B. subtilis ML (lsp) and the parental strain 8G5.
Samples were withdrawn after overnight growth and analyzed by SDS-PAGE
(long gels of 40 cm) and Western blotting. The positions of PrsA,
pre-PrsA, and two mature-like forms of PrsA (PrsA*) are
indicated. C, effects of globomycin on the accumulation of
pre-PrsA in cells of B. subtilis 8G5 and ML
(lsp). Cells were grown in TY medium at 37 °C in the
presence (+) or absence () of 80 µM globomycin, and
samples for SDS-PAGE and Western blotting were withdrawn after
overnight growth. The positions of PrsA, pre-PrsA, and mature-like
forms of PrsA* are indicated. D, alternative amino-terminal
processing of pre-PrsA in B. subtilis ML was demonstrated
by SDS-PAGE and Western blotting using the xylose-inducible,
carboxyl-terminally hexahistidine-tagged PrsA protein (PrsA-His)
specified by pKTH3409. Cells of B. subtilis ML
(lsp) and the parental strain 8G5 containing pKTH3409
were grown overnight in the presence (+) or absence () of 1% xylose.
The positions of PrsA-His, pre-PrsA-His, and mature-like forms of
PrsA-His* are indicated. E and F, accumulation of
pre-PrsA in cells lacking SPase II and various type I SPases.
E, accu mulation of pre-PrsA in cells of B. subtilis ML
(lsp), B. subtilis SUVW ML (SUVW
lsp), and B. subtilis TUVW ML (TUVW
lsp). Samples were withdrawn after overnight growth and
analyzed by SDS-PAGE and Western blotting. The positions of pre-PrsA
and mature-like forms of PrsA* are indicated. F,
exponentially growing cells of B. subtilis STxS-D146A MIL
in TY medium with 1 mM IPTG (37 °C) were washed and
resuspended in fresh TY medium. Upon incubation for 1 h in the
presence (+) or absence () of 1 mM IPTG and/or 1% xylose
at 37 °C or 48 °C, samples were taken for SDS-PAGE and Western
blotting. The positions of PrsA, pre-PrsA, and the mature-like forms of
PrsA* are indicated.
SUVW (lacks SipS, SipU, SipV, and SipW) and TUVW (lacks
SipT, SipU, SipV, and SipW) was disrupted through transformation with chromosomal DNA of B. subtilis ML. As shown by Western
blotting, mature-like forms of PrsA were detected in both resulting
strains (Fig. 2E). As the sipS and
sipT genes can not be disrupted simultaneously (25), the
involvement of SipS and SipT was investigated with the B. subtilis strain STxS-D146A, which lacks wild-type copies of
sipS and sipT but contains a mutant
sipS gene specifying the temperature-sensitive SipS-D146A
protein. The transcription of the latter gene is controlled by the
xylose-inducible xylA promoter. B. subtilis
STxS-D146A was transformed with chromosomal DNA of B. subtilis MIL, resulting in B. subtilis STxS-D146A
MIL, in which the synthesis of SPase II depends on the presence of
IPTG. As shown in Fig. 2F, alternative processing of
pre-PrsA was barely affected in cells depleted of SipS, SipT and SPase
II by incubation at 48 °C in the absence of xylose (no activity of
SipS-D146A) and IPTG. Taken together, these findings indicate that type
I SPases are not involved in the alternative processing of pre-PrsA in
the absence of SPase II.
L were incubated with trypsin. Like the mature
PrsA of B. subtilis 8G5, pre-PrsA and the mature-like forms
of PrsA of B. subtilis 8G5 ML were associated with
protoplasts and accessible to trypsin (Fig.
3A, lsp). In contrast, the cytosolic protein GroEL was only accessible to trypsin when the protoplasts were lysed with Triton X-100 (Fig. 3B).
Because the latter findings show that pre-PrsA and the mature-like
forms of PrsA are correctly localized in cells lacking SPase II, we also addressed the question whether these forms are lipid-modified. To
this purpose, palmitic acid labeling experiments were performed with
strains lacking SPase II or, as a control, the diacylglyceryl transferase, specified by the lgt gene (i.e.
prs-11) (14).4 Cells of
the latter strain (lgt) accumulated non-lipomodified pre-PrsA, whereas the strain lacking SPase II (lsp)
accumulated lipomodified pre-PrsA and mature-like PrsA (Fig.
4, A and B). In
conclusion, these data show that, in the absence of SPase II, the
precursor and mature-like forms of PrsA are lipid-modified, displaying
a similar membrane topology as the mature PrsA in SPase II-proficient
cells. Thus, all of these forms might, in principle, be active and
responsible for the viability of cells lacking SPase II.
View larger version (31K):
[in a new window]
Fig. 3.
Localization of PrsA. To determine the
localization of precursor, mature, and mature-like foms of PrsA, cells
of B. subtilis 8G5 and M L (lsp) were
protoplasted and incubated for 30 min without further additions in the
presence of trypsin (1 mg/ml) or trypsin and Triton X-100 (1%).
Samples were used for SDS-PAGE, Western blotting, and immunodetection
with PrsA-specific antibodies (A) or GroEL-specific
antibodies (B, cytoplasmic control). The positions of
pre-PrsA, mature PrsA (PrsA), mature-like forms of PrsA
(PrsA*), and GroEL are indicated.
View larger version (44K):
[in a new window]
Fig. 4.
Lipid modification of PrsA. B. subtilis IH6538 (parental strain), IH6538 with an integrated copy
of pMutin2-M L, disrupting the lsp gene
(lsp), and IH6538 with the prs-11 mutation,
inactivating the lgt gene (lgt), were grown in
TY medium at 37 °C. Exponentially growing cells were labeled with 50 µCi of [3H]palmitic acid for about 45 min. Membranes
were isolated and used for SDS-PAGE, Western blotting, and
immunodetection with PrsA-specific antibodies (A) or for
SDS-PAGE and fluorography (B). B. subtilis IH6538
and derivatives of this strain were used in this experiment because
they incorporate higher levels of [3H]palmitic acid than
B. subtilis 8G5. The positions of nonmodified pre-PrsA
(pre-PrsAnm), lipid-modified pre-PrsA
(pre-PrsAm), lipid-modified mature PrsA
(PrsA), and mature-like forms of PrsA (PrsA*) are
indicated.
-amylase AmyQ and that it is required for the
folding of AmyQ into a protease-resistant conformation (16). To examine
the effect of SPase II depletion on PrsA activity, AmyQ secretion was
monitored in B. subtilis 8G5 ML (Fig.
5, lsp) and 8G5 MIL (Fig.
5, Ilsp). To this purpose, both strains were transformed
with pKTH10, which contains the amyQ gene (24). Next, the
secretion of AmyQ was analyzed by Western blotting. As shown in Fig. 5,
the accumulation of pre-PrsA and mature-like forms of PrsA in cells
depleted of SPase II (Fig. 5A, lsp and
Ilsp in the absence of IPTG) was paralleled by the secretion
of about 5-fold reduced amounts of mature AmyQ into the growth medium
(Fig. 5C). The latter observation is diagnostic for reduced
levels of PrsA activity. In addition, SPase II-depleted cells
accumulated increased levels of pre-AmyQ (Fig. 5B), which is
atypical for PrsA mutants (14). As shown by pulse-chase labeling experiments, the rate of pre-AmyQ processing by type I SPase(s) was
slightly (but reproducibly) reduced in cells lacking SPase II (Fig.
5D). As mutations in PrsA do not cause the accumulation of
pre-AmyQ, this effect of the absence of SPase II must be attributed to
the accumulation of lipoprotein precursors or the malfunction of an as
yet unidentified lipoprotein. The reason why the kinetic effects of the
absence of SPase II on pre-AmyQ processing (Fig. 5D) are
mild in comparison to the strong accumulation of pre-AmyQ at steady
state (Fig. 5B) is not clear. One explanation could be that
the growth conditions in both types of experiments are not
identical.
View larger version (51K):
[in a new window]
Fig. 5.
Impaired secretion of AmyQ in the absence of
SPase II. Cells of B. subtilis MIL (Ilsp),
M L (lsp), and the parental strain 8G5 were grown in TY
medium at 37 °C in the presence (+) or absence () of 1 mM IPTG. Samples for SDS-PAGE and Western blotting were
prepared from cells and their growth medium. Cells were harvested
2 h after the transition between exponential and postexponential
growth (t = 2) (Fig. 1B). Specific
antibodies were used to detect the cellular levels of PrsA
(A) and AmyQ (B) and the levels of secreted AmyQ
in the growth medium (C). The positions of pre-PrsA, the
mature form of PrsA, the mature-like form of PrsA
(PrsA(*)), AmyQ, and pre-AmyQ are indicated.
D, processing of pre-AmyQ in B. subtilis ML
(lsp) and the parental strain 8G5, was analyzed by
pulse-chase labeling at 37 °C and subsequent immunoprecipitation,
SDS-PAGE, and fluorography. Cells were labeled with
[35S]methionine for 1 min prior to chase with excess
nonradioactive methionine. Samples were withdrawn after the chase at
the times indicated. The positions of pre-AmyQ and mature AmyQ are
indicated.
lsp) did not accumulate biotinylated pre-AmyQ-PSBT,
irrespective of the growth temperature (15, 37, or 48 °C), although
AmyQ-PSBT was produced under these conditions (data not shown). In
contrast, B. subtilis cells with a disrupted
secDF gene (B. subtlis MIF) (29) accumulated
biotinylated forms of AmyQ-PSBT at all growth temperatures tested (Fig.
6, secDF), whereas cells lacking SipS and SipT but
expressing the temperature-sensitive SipS-D146A protein (Fig. 6,
STxS-D146A) (25) accumulated biotinylated forms of AmyQ-PSBT only at
48 °C. These observations indicate that the accumulation of pre-AmyQ in SPase II-depleted cells is not due to impaired translocation across
the membrane and that the cold sensitivity of these cells is not
related to protein translocation defects. Instead, the accumulation of
pre-AmyQ must be attributed to the malfunction of certain lipoproteins
in the absence of SPase II.
View larger version (64K):
[in a new window]
Fig. 6.
Translocation of pre-AmyQ-PSBT in the absence
of SPase II. To investigate the translocation of AmyQ in SPase
II-depleted cells, B. subtilis M L (lsp) was
transformed with plasmid pKTH10-BT, which specifies AmyQ-PSBT (see
under "Results" for explanation). Control strains, also transformed
with pKTH10-BT, were as follows: B. subtilis 8G5 (negative
control), B. subtilis MIF (secDF) (positive
control) (29), and B. subtilis STxS-D146A (depletion of
SipS and SipT) (positive control at 48 °C) (25). Cells were grown
overnight in TY medium, 100-fold diluted in fresh TY medium, and grown
until the transition phase between exponential and postexponential
growth at 37 °C. Next, aliquots were incubated for 3 h at 15, 37, or 48 °C. Cells were collected by centrifugation, and
biotinylated (pre-)AmyQ-PSBT was visualized by SDS-PAGE and Western
blotting using a streptavidin-horseradish peroxidase. p,
pre-AmyQ-PSBT; m, mature AmyQ-PSBT.
DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
View larger version (37K):
[in a new window]
Fig. 7.
Model for AmyQ secretion in the absence of
SPase II. Pre-AmyQ is synthesized with an amino-terminal signal
peptide (SP). Cytoplasmatic chaperones (C) and
targeting factors (T) keep the precursor in a
translocation-competent conformation and facilitate its targeting to
the preprotein translocase in the membrane. Known components of the
B. subtilis translocase are SecA (A), SecY
(Y), SecE (E), and SecDF (DF) (see
Ref. 29). SecA acts as a force generator (motor) for protein
translocation through cycles of preprotein binding, membrane insertion,
preprotein release, and deinsertion from the membrane. The cycling of
SecA is regulated by ATP binding and hydrolysis (see Ref. 56). During
or shortly after the translocation, pre-AmyQ is processed by one of the
type I SPases, SipS, SipT, SipU, SipV, or SipW (25). Folding of the
mature AmyQ into its protease-resistant conformation depends on the
activity of PrsA, which, in the absence of SPase II, is present in the
precursor form (pre-PrsA) and at least two mature-like forms
(PrsA*), all of which are lipid-modified and localized to
the outer surface of the membrane. Alternative processing of pre-PrsA
and degradation of AmyQ in the absence of SPase II is catalyzed by
unknown proteases (Prot. X and Prot. Y) at the
membrane-cell wall interface. Upon passage through the wall, mature
AmyQ is released into the growth medium.
The fact that pre-PrsA is subject to alternative processing in the absence of SPase II is reminiscent of the previously reported observation that mutants of the penicillinase PenP of Bacillus licheniformis, which lack the cysteine residue at the +1 position, are subject to alternative processing. As these mutant proteins are not lipid-modified and contain putative SPase I cleavage sites, type I SPases have been invoked in their processing (57, 58). In contrast, our results indicate that type I SPases are not involved in the alternative amino-terminal processing of pre-PrsA, which is consistent with the fact that this precursor is lipid-modified. Surprisingly, the nonmodified pre-PrsA produced by the lgt mutant is not processed, even though putative SPase I cleavage sites are present in this precursor,1 suggesting that it contains an as yet unidentified "SPase I avoidance signal." Important challenges for future research are the identification of the protease(s) involved in the alternative processing of pre-PrsA and the SPase I avoidance signal in this precursor.
Finally, the reason why SPase II-depleted cells accumulate pre-AmyQ is
presently not completely clear. First, as shown with AmyQ-PSBT, the
rate of AmyQ translocation in these cells is not detectably affected.
Second, as PrsA mutants do not accumulate pre-AmyQ (14), this effect
can not be attributed to PrsA malfunction. Consequently, the
accumulation of pre-AmyQ must be due to the malfunction of at least one
as yet unknown lipoprotein, which affects the stability or processing
of pre-AmyQ. This hypothesis is supported by our observation that the
half-life of pre-AmyQ and at least one other precursor,
pre(A13i)--lactamase (50) (data not shown) is slightly increased in
the absence of SPase II. We are presently investigating which of the
putative lipoproteins of B. subtilis could be responsible
for this effect.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. M. Inukai from Sankyo Co., Ltd., Tokyo, Japan for generously providing globomycin; Drs. T. Wiegert and W. Schumann for providing pKTH10-BT; and Drs. A. Bolhuis, M. L. van Roosmalen, J. D. H. Jongbloed, and K. Yoshida for useful discussions.
| |
FOOTNOTES |
|---|
* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ Supported by Genencor International (Rijswijk, The Netherlands) and Gist-brocades B.V. (Delft, The Netherlands).
Supported by Biotechnology Grants Bio2-CT93-0254,
Bio4-CT95-0278, and Bio4-CT96-0097 from the European Union.
Supported by a Hungarian State Eötvös Fellowship
from the National Scholarships Board (Hungary).
¶¶ To whom correspondence should be addressed. Tel.: 31-50-3633079; Fax: 31-50-3632348; E-mail: j.m.van.dijl{at}farm.rug.nl.
The abbreviations used are:
SPase, signal
peptidase; IPTG, isopropyl--D-thiogalactopyranoside; PAGE, polyacrylamide gel electrophoresis; PCR, polymerase chain
reaction; TY, tryptone/yeast extract.
1 H.Tjalsma and J. M. van Dijl, unpublished observations.
3 V. P. Kontinen and M. Sarvas, unpublished results.
4 V. P. Kontinen and M. Sarvas, manuscript in preparation.
5 The product of the yaaT gene, which has been annotated as a putative SPase II-encoding gene of B. subtilis (51), does not show sequence similarity to known type II SPases, and, moreover, is predicted to be a soluble cytoplasmic protein (see Footnote 1). This makes a role of the YaaT protein in lipoprotein processing highly unlikely.
6 J. Bengtsson and L. Hederstedt, personal communication.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Procedures
Results
Discussion
References
|
|---|
-
Pugsley, A. P.
(1993)
Microbiol. Rev.
57,
50-108
[Abstract/Free Full Text] - Sankaran, K., and Wu, H. C. (1994) in Signal Peptidases (von Heijne, G., ed), pp. 17-29, R. G. Landes Company, Austin, TX
- Yamaguchi, K., Yu, F., and Inouye, M. (1988) Cell 6, 423-432
- Poquet, I., Kornacker, M. G., and Pugsley, A. P. (1993) Mol. Microbiol. 9, 1061-1069[CrossRef][Medline] [Order article via Infotrieve]
- Matsuyama, S., Tajima, T., and Tokuda, H. (1995) EMBO J. 14, 3365-3372[Medline] [Order article via Infotrieve]
- Matsuyama, S., Yokota, N., and Tokuda, H. (1997) EMBO J. 16, 6947-6955[CrossRef][Medline] [Order article via Infotrieve]
-
Fraser, C. M.,
Gocayne, J. D.,
White, O.,
Adams, M. D.,
Clayton, R. A.,
Fleischmann, R. D.,
Bult, C. J.,
Kerlavage, A. R.,
Sutton, G.,
Kelley, J. M.,
Fritchman, J. L.,
Weidman, J. F.,
Small, K. V.,
Sandusky, M.,
Fuhrmann, J.,
Nguyen, D.,
Utterback, T. R.,
Saudek, D. M.,
Phillips, C. A.,
Merrick, J. M.,
Tomb, J-F.,
Dougherty, B. A.,
Bott, K. F.,
Hu, P-C.,
and Lucier, T. S.
(1995)
Science
270,
397-403
[Abstract/Free Full Text] -
von Heijne, G.
(1989)
Protein Eng.
2,
531-534
[Abstract/Free Full Text] - Inukai, M., Takeuchi, M., Shimizu, K., and Arai, M. (1978) J. Antibiot. 31, 1203-1205[Medline] [Order article via Infotrieve]
- Giam, C. Z., Chai, T., Hayashi, S., and Wu, H. C. (1984) Eur. J. Biochem. 141, 331-337[Medline] [Order article via Infotrieve]
- Tokunaga, M., Tokunaga, H., and Wu, H. C. (1982) Proc. Natl. Acad. Sci. U. S. A. 79, 2253-2259
-
Sankaran, K.,
and Wu, H. C.
(1994)
J. Biol. Chem.
269,
19701-19706
[Abstract/Free Full Text] -
Sutcliffe, I. C.,
and Russell, R. R. B.
(1995)
J. Bacteriol.
177,
1123-1128
[Free Full Text] -
Kontinen, V. P.,
and Sarvas, M.
(1988)
J. Gen. Microbiol.
134,
2333-2344
[Abstract/Free Full Text] - Kontinen, V. P., Saris, P., and Sarvas, M. (1991) Mol. Microbiol. 5, 1273-1283[Medline] [Order article via Infotrieve]
- Kontinen, V. P., and Sarvas, M. (1993) Mol. Microbiol. 8, 727-737[Medline] [Order article via Infotrieve]
- Jacobs, M., Andersen, J. B., Kontinen, V. P., and Sarvas, M. (1993) Mol. Microbiol. 8, 957-966[Medline] [Order article via Infotrieve]
-
Nielsen, H.,
Engelbrecht, J.,
Brunak, S.,
and von Heijne, G.
(1997)
Protein Eng.
10,
1-6
[Abstract/Free Full Text] -
Altschul, S. F.,
Madden, T. L.,
Schaffer, A. A.,
Zhang, J.,
Zhang, Z.,
Miller, W.,
and Lipman, D. J.
(1997)
Nucleic Acids Res.
25,
3389-3402
[Abstract/Free Full Text] - Dartois, V., Djavakhishvili, T., and Hoch, J. A. (1997) Mol. Microbiol. 26, 1097-1108[CrossRef][Medline] [Order article via Infotrieve]
- van Dijl, J. M., de Jong, A., Smith, H., Bron, S., and Venema, G. (1991) Mol. Gen. Genet. 227, 40-48[CrossRef][Medline] [Order article via Infotrieve]
-
van Dijl, J. M.,
de Jong, A.,
Smith, H.,
Bron, S.,
and Venema, G.
(1991)
J. Gen. Microbiol.
137,
2073-2083
[Abstract/Free Full Text] - Yansura, D. G., and Henner, D. J. (1984) in Genetics and Biochemistry of Bacilli (Ganesan, A. T., and Hoch, J. A., eds), pp. 249-263, Academic Press, Orlando, FL
- Palva, I. (1982) Gene 19, 81-87[CrossRef][Medline] [Order article via Infotrieve]
-
Tjalsma, H.,
Bolhuis, A.,
van Roosmalen, M. L.,
Wiegert, T.,
Schumann, W.,
Broekhuizen, C. P.,
Quax, W. J.,
Venema, G.,
Bron, S.,
and van Dijl, J. M.
(1998)
Genes Dev.
12,
2318-2331
[Abstract/Free Full Text] - Hastrup, S., and Jacobs, M. F. (1990) in Genetics and Bio/Technology of Bacilli (Zukowski, M. M., Ganesan, A. T., and Hoch, J. A., eds), pp. 33-41, Academic Press, San Diego, CA
- Wertman, K. F., Wyman, A. R., and Botstein, D. (1986) Gene 49, 253-262[CrossRef][Medline] [Order article via Infotrieve]
- Bron, S., and Venema, G. (1972) Mutat. Res. 15, 1-10[Medline] [Order article via Infotrieve]
-
Bolhuis, A.,
Broekhuizen, C. P.,
Sorokin, A.,
van Roosmalen, M. L.,
Venema, G.,
Bron, S.,
Quax, W. J.,
and van Dijl, J. M.
(1998)
J. Biol. Chem.
273,
21217-21224
[Abstract/Free Full Text] - Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
-
van Dijl, J. M.,
de Jong, A.,
Venema, G.,
and Bron, S.
(1995)
J. Biol. Chem.
270,
3611-3618
[Abstract/Free Full Text] -
Schaeffer, P.,
Millet, J.,
and Aubert, P.-J.
(1965)
Proc. Natl. Acad. Sci. U. S. A.
54,
704-711
[Free Full Text] - Miller, J. H. (1982) Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
- Kyhse-Andersen, J. (1984) J. Biochem. Biophys. Methods 10, 203-209[CrossRef][Medline] [Order article via Infotrieve]
-
Prágai, Z.,
Tjalsma, H.,
Bolhuis, A.,
van Dijl, J. M.,
Venema, G.,
and Bron, S.
(1997)
Microbiology
143,
1327-1333
[Abstract/Free Full Text] - Koide, A., and Hoch, J. A. (1994) Mol. Microbiol. 13, 417-426[CrossRef][Medline] [Order article via Infotrieve]
- Mathiopoulos, C., Mueller, J. P., Slack, F. J., Murphy, C. G., Patankar, S., Bukusoglu, G., and Sonenshein, A. L. (1991) Mol. Microbiol 5, 1903-1913[CrossRef][Medline] [Order article via Infotrieve]
-
Errington, J.,
Appleby, L.,
Daniel, R. A.,
Goodfellow, H.,
Partridge, S. R.,
and Yudkin, M. D.
(1992)
J. Gen. Microbiol.
138,
2609-2618
[Abstract/Free Full Text] -
van Hoy, B. E.,
and Hoch, J. A.
(1990)
J. Bacteriol.
172,
1306-1311
[Abstract/Free Full Text] - Zuberi, A. R., Moir, A., and Feavers, I. M. (1987) Gene 51, 1-11[CrossRef][Medline] [Order article via Infotrieve]
-
Kemp, E. H.,
Sammons, R. L.,
Moir, A.,
Sun, D.,
and Setlow, P.
(1991)
J. Bacteriol.
173,
4646-4652
[Abstract/Free Full Text] -
Corfe, B. M.,
Sammons, R. L.,
Smith, D. A.,
and Mauel, C.
(1994)
Microbiology
140,
471-478
[Abstract/Free Full Text] - Slynn, G. M., Sammons, R. L., Smith, D. A., Moir, A., and Corfe, B. M. (1994) FEMS Microbiol. Lett. 121, 315-320[CrossRef][Medline] [Order article via Infotrieve]
-
Yamane, K.,
Kumano, M.,
and Kurita, K.
(1996)
Microbiology
142,
3047-3056
[Abstract/Free Full Text] - Wu, H. C., and Tokunaga, M. (1986) Curr. Top. Microbiol. Immunol. 125, 127-157[Medline] [Order article via Infotrieve]
- Dalbey, R. E., Lively, M. O., Bron, S., and van Dijl, J. M. (1997) Protein Sci. 6, 1129-1138[Medline] [Order article via Infotrieve]
-
Tjalsma, H.,
Noback, M. A.,
Bron, S.,
Venema, G.,
Yamane, K.,
and van Dijl, J. M.
(1997)
J. Biol. Chem.
272,
25983-25992
[Abstract/Free Full Text] -
Cronan, J. E., Jr.
(1990)
J. Biol. Chem.
265,
10327-10333
[Abstract/Free Full Text] - Bolhuis, A., Sorokin, A., Azevedo, V., Ehrlich, S. D., Braun, P. G., de Jong, A., Venema, G., Bron, S., and van Dijl, J. M. (1996) Mol. Microbiol. 22, 605-618[CrossRef][Medline] [Order article via Infotrieve]
- van Dijl, J. M., de Jong, A., Vehmaanperä, J., Venema, G., and Bron, S. (1992) EMBO J. 11, 2819-2828[Medline] [Order article via Infotrieve]
- Kunst, F., Ogasawara, N., Moszer, I., Albertini, A. M., Alloni, G., Azevedo, V., Bertero, M. G., Bessieres, P., Bolotin, A., Borchert, S., et al.. (1997) Nature 390, 249-256[CrossRef][Medline] [Order article via Infotrieve]
-
Yamagata, H.,
Ippolito, C.,
Inukai, M.,
and Inouye, M.
(1982)
J. Bacteriol.
152,
1163-1168
[Abstract/Free Full Text] -
Hayashi, S.,
and Wu, H. C.
(1983)
J. Bacteriol.
156,
773-777
[Abstract/Free Full Text] -
Muhlradt, P. F.,
Kiess, M.,
Meyer, H.,
Sussmuth, R.,
and Jung, G.
(1997)
J. Exp. Med.
185,
1951-1958
[Abstract/Free Full Text] - Pogliano, K. J., and Beckwith, J. (1993) Genetics 133, 763-773[Abstract]
- Duong, F., Eichler, J., Price, A., Leonard, M. R., and Wickner, W. (1997) Cell 91, 567-573[CrossRef][Medline] [Order article via Infotrieve]
-
Hayashi, S.,
Chang, S. Y.,
Chang, S.,
and Wu, H. C.
(1984)
J. Biol. Chem.
259,
10448-10454
[Abstract/Free Full Text] -
Hayashi, S.,
Chang, S. Y.,
Chang, S.,
and Wu, H. C.
(1986)
J. Bacteriol.
165,
678-681
[Abstract/Free Full Text] -
Vagner, V.,
Dervyn, E.,
and Ehrlich, S. D.
(1998)
Microbiology
144,
3097-3104
[Abstract/Free Full Text]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  M. Schmaler, N. J. Jann, F. Ferracin, L. Z. Landolt, L. Biswas, F. Gotz, and R. Landmann Lipoproteins in Staphylococcus aureus Mediate Inflammation by TLR2 and Iron-Dependent Growth In Vivo J. Immunol., June 1, 2009; 182(11): 7110 - 7118. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. L. Denham, P. N. Ward, and J. A. Leigh In the absence of Lgt, lipoproteins are shed from Streptococcus uberis independently of Lsp Microbiology, January 1, 2009; 155(1): 134 - 141. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. L. Pelczar and P. Setlow Localization of the Germination Protein GerD to the Inner Membrane in Bacillus subtilis Spores J. Bacteriol., August 15, 2008; 190(16): 5635 - 5641. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. L. Denham, P. N. Ward, and J. A. Leigh Lipoprotein Signal Peptides Are Processed by Lsp and Eep of Streptococcus uberis J. Bacteriol., July 1, 2008; 190(13): 4641 - 4647. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Baumgartner, U. Karst, B. Gerstel, M. Loessner, J. Wehland, and L. Jansch Inactivation of Lgt Allows Systematic Characterization of Lipoproteins from Listeria monocytogenes J. Bacteriol., January 15, 2007; 189(2): 313 - 324. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Hamilton, C. Robinson, I. C. Sutcliffe, J. Slater, D. J. Maskell, N. Davis-Poynter, K. Smith, A. Waller, and D. J. Harrington Mutation of the Maturase Lipoprotein Attenuates the Virulence of Streptococcus equi to a Greater Extent than Does Loss of General Lipoprotein Lipidation Infect. Immun., December 1, 2006; 74(12): 6907 - 6919. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. I. Hutchings, H.-J. Hong, E. Leibovitz, I. C. Sutcliffe, and M. J. Buttner The {sigma}E Cell Envelope Stress Response of Streptomyces coelicolor Is Influenced by a Novel Lipoprotein, CseA. J. Bacteriol., October 1, 2006; 188(20): 7222 - 7229. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. J. B. Sibbald, A. K. Ziebandt, S. Engelmann, M. Hecker, A. de Jong, H. J. M. Harmsen, G. C. Raangs, I. Stokroos, J. P. Arends, J. Y. F. Dubois, et al. Mapping the Pathways to Staphylococcal Pathogenesis by Comparative Secretomics Microbiol. Mol. Biol. Rev., September 1, 2006; 70(3): 755 - 788. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. P. Bhavsar, R. Truant, and E. D. Brown The TagB Protein in Bacillus subtilis 168 Is an Intracellular Peripheral Membrane Protein That Can Incorporate Glycerol Phosphate onto a Membrane-bound Acceptor in Vitro J. Biol. Chem., November 4, 2005; 280(44): 36691 - 36700. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Igarashi and P. Setlow Interaction between Individual Protein Components of the GerA and GerB Nutrient Receptors That Trigger Germination of Bacillus subtilis Spores J. Bacteriol., April 1, 2005; 187(7): 2513 - 2518. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Stein, S. Heinzmann, S. Dusterhus, S. Borchert, and K.-D. Entian Expression and Functional Analysis of the Subtilin Immunity Genes spaIFEG in the Subtilin-Sensitive Host Bacillus subtilis MO1099 J. Bacteriol., February 1, 2005; 187(3): 822 - 828. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Robichon, D. Vidal-Ingigliardi, and A. P. Pugsley Depletion of Apolipoprotein N-Acyltransferase Causes Mislocalization of Outer Membrane Lipoproteins in Escherichia coli J. Biol. Chem., January 14, 2005; 280(2): 974 - 983. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Tjalsma, H. Antelmann, J. D.H. Jongbloed, P. G. Braun, E. Darmon, R. Dorenbos, J.-Y. F. Dubois, H. Westers, G. Zanen, W. J. Quax, et al. Proteomics of Protein Secretion by Bacillus subtilis: Separating the "Secrets" of the Secretome Microbiol. Mol. Biol. Rev., June 1, 2004; 68(2): 207 - 233. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Igarashi, B. Setlow, M. Paidhungat, and P. Setlow Effects of a gerF (lgt) Mutation on the Germination of Spores of Bacillus subtilis J. Bacteriol., May 15, 2004; 186(10): 2984 - 2991. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Reglier-Poupet, C. Frehel, I. Dubail, J.-L. Beretti, P. Berche, A. Charbit, and C. Raynaud Maturation of Lipoproteins by Type II Signal Peptidase Is Required for Phagosomal Escape of Listeria monocytogenes J. Biol. Chem., December 5, 2003; 278(49): 49469 - 49477. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Y. M. Ng and K. F. Jarrell Cloning and Characterization of Archaeal Type I Signal Peptidase from Methanococcus voltae J. Bacteriol., October 15, 2003; 185(20): 5936 - 5942. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. de Greeff, A. Hamilton, I. C. Sutcliffe, H. Buys, L. van Alphen, and H. E. Smith Lipoprotein signal peptidase of Streptococcus suis serotype 2 Microbiology, June 1, 2003; 149(6): 1399 - 1407. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Tjalsma, S. Bron, and J. M. van Dijl Complementary Impact of Paralogous Oxa1-like Proteins of Bacillus subtilis on Post-translocational Stages in Protein Secretion J. Biol. Chem., April 25, 2003; 278(18): 15622 - 15632. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Venema, H. Tjalsma, J. M. van Dijl, A. de Jong, K. Leenhouts, G. Buist, and G. Venema Active Lipoprotein Precursors in the Gram-positive Eubacterium Lactococcus lactis J. Biol. Chem., April 18, 2003; 278(17): 14739 - 14746. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. K. Dunn, A. K. Klimowicz, and J. Handelsman Use of a Promoter Trap To Identify Bacillus cereus Genes Regulated by Tomato Seed Exudate and a Rhizosphere Resident, Pseudomonas aureofaciens Appl. Envir. Microbiol., February 1, 2003; 69(2): 1197 - 1205. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Stein, S. Heinzmann, I. Solovieva, and K.-D. Entian Function of Lactococcus lactis Nisin Immunity Genes nisI and nisFEG after Coordinated Expression in the Surrogate Host Bacillus subtilis J. Biol. Chem., January 3, 2003; 278(1): 89 - 94. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. D. H. Jongbloed, H. Antelmann, M. Hecker, R. Nijland, S. Bron, U. Airaksinen, F. Pries, W. J. Quax, J. M. van Dijl, and P. G. Braun Selective Contribution of the Twin-Arginine Translocation Pathway to Protein Secretion in Bacillus subtilis J. Biol. Chem., November 8, 2002; 277(46): 44068 - 44078. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. C. Sutcliffe and D. J. Harrington Pattern searches for the identification of putative lipoprotein genes in Gram-positive bacterial genomes Microbiology, July 1, 2002; 148(7): 2065 - 2077. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Masuda, S.-i. Matsuyama, and H. Tokuda Elucidation of the function of lipoprotein-sorting signals that determine membrane localization PNAS, May 28, 2002; 99(11): 7390 - 7395. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. J. Sakamoto, M. Sasaki, and T. Tsuchido Purification and Characterization of a Bacillus subtilis 168 Nuclease, YokF, Involved in Chromosomal DNA Degradation and Cell Death Caused by Thermal Shock Treatments J. Biol. Chem., December 7, 2001; 276(50): 47046 - 47051. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Antelmann, H. Tjalsma, B. Voigt, S. Ohlmeier, S. Bron, J. M. van Dijl, and M. Hecker A Proteomic View on Genome-Based Signal Peptide Predictions Genome Res., September 1, 2001; 11(9): 1484 - 1502. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Vitikainen, T. Pummi, U. Airaksinen, E. Wahlström, H. Wu, M. Sarvas, and V. P. Kontinen Quantitation of the Capacity of the Secretion Apparatus and Requirement for PrsA in Growth and Secretion of {alpha}-Amylase in Bacillus subtilis J. Bacteriol., March 15, 2001; 183(6): 1881 - 1890. [Abstract] [Full Text]
|
|
|
|
|
|
M. Nishiguchi, M. Matsumoto, T. Takao, M. Hoshino, Y. Shimonishi, S. Tsuji, N. A. Begum, O. Takeuchi, S. Akira, K. Toyoshima, et al. Mycoplasma fermentans Lipoprotein M161Ag-Induced Cell Activation Is Mediated by Toll-Like Receptor 2: Role of N-Terminal Hydrophobic Portion in its Multiple Functions J. Immunol., February 15, 2001; 166(4): 2610 - 2616. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K.-I. Yoshida, Y. Fujita, and S. D. Ehrlich An Operon for a Putative ATP-Binding Cassette Transport System Involved in Acetoin Utilization of Bacillus subtilis J. Bacteriol., October 1, 2000; 182(19): 5454 - 5461. [Abstract] [Full Text]
|
|
|
|
|
|
H. Tjalsma, A. Bolhuis, J. D. H. Jongbloed, S. Bron, and J. M. van Dijl Signal Peptide-Dependent Protein Transport in Bacillus subtilis: a Genome-Based Survey of the Secretome Microbiol. Mol. Biol. Rev., September 1, 2000; 64(3): 515 - 547. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Hirose, K. Sano, I. Shioda, M. Kumano, K. Nakamura, and K. Yamane Proteome analysis of Bacillus subtilis extracellular proteins: a two-dimensional protein electrophoretic study Microbiology, January 1, 2000; 146(1): 65 - 75. [Abstract] [Full Text]
|
|
|
|
|
|
H. Tjalsma, G. Zanen, G. Venema, S. Bron, and J. M. van Dijl The Potential Active Site of the Lipoprotein-specific (Type II) Signal Peptidase of Bacillus subtilis J. Biol. Chem., October 1, 1999; 274(40): 28191 - 28197. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Bolhuis, G. Venema, W. J. Quax, S. Bron, and J. M. van Dijl Functional Analysis of Paralogous Thiol-disulfide Oxidoreductases in Bacillus subtilis J. Biol. Chem., August 27, 1999; 274(35): 24531 - 24538. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Bolhuis, A. Matzen, H.-L. Hyyrylainen, V. P. Kontinen, R. Meima, J. Chapuis, G. Venema, S. Bron, R. Freudl, and J. M. van Dijl Signal Peptide Peptidase- and ClpP-like Proteins of Bacillus subtilis Required for Efficient Translocation and Processing of Secretory Proteins J. Biol. Chem., August 27, 1999; 274(35): 24585 - 24592. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. D. H. Jongbloed, U. Martin, H. Antelmann, M. Hecker, H. Tjalsma, G. Venema, S. Bron, J. M. van Dijl, and J. Muller TatC Is a Specificity Determinant for Protein Secretion via the Twin-arginine Translocation Pathway J. Biol. Chem., December 22, 2000; 275(52): 41350 - 41357. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |