Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tjalsma, H.
Right arrow Articles by van Dijl, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tjalsma, H.
Right arrow Articles by van Dijl, J. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 3, 1698-1707, January 15, 1999


The Role of Lipoprotein Processing by Signal Peptidase II in the Gram-positive Eubacterium Bacillus subtilis
SIGNAL PEPTIDASE II IS REQUIRED FOR THE EFFICIENT SECRETION OF alpha -AMYLASE, A NON-LIPOPROTEIN*

Harold TjalsmaDagger §, Vesa P. Kontinenparallel , Zoltán Prágai**Dagger Dagger , Hongyan Wuparallel , Rob MeimaDagger parallel , Gerard VenemaDagger , Sierd BronDagger parallel , Matti Sarvasparallel , and Jan Maarten van Dijlparallel §§¶¶

From the Dagger  Department of Genetics, Groningen Biomolecular Sciences and Biotechnology Institute, Kerklaan 30, 9751 NN Haren, The Netherlands, the  Vaccine Development Laboratory, National Public Health Institute, Mannerheimintie 166, SF-00300 Helsinki, Finland, the ** Department of Microbiology, The Medical School, University of Newcastle upon Tyne, Framlington Place, Newcastle upon Tyne NE2 4HH, United Kingdom, and the §§ Department of Pharmaceutical Biology, University of Groningen, Antonius Deusinglaan 1, 9713 AV Groningen, The Netherlands

    ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Computer-assisted analyses indicate that Bacillus subtilis contains approximately 300 genes for exported proteins with an amino-terminal signal peptide. About 114 of these are lipoproteins, which are retained in the cytoplasmic membrane. We have investigated the importance of lipoprotein processing by signal peptidase II (SPase II) for cellular homeostasis, using cells lacking SPase II. The results show that lipoprotein processing is important for cell viability at low and high temperatures, suggesting that lipoproteins are essential for growth under these conditions. Although certain lipoproteins are required for the development of genetic competence, sporulation, and germination, these developmental processes were not affected in the absence of SPase II. Cells lacking SPase II accumulated lipid-modified precursor and mature-like forms of PrsA, a folding catalyst for secreted proteins. These forms of PrsA seem to have a reduced activity, as the secretion of alpha -amylase was strongly impaired. Unexpectedly, type I signal peptidases, which process secretory preproteins, were not involved in alternative amino-terminal processing of pre-PrsA in the absence of SPase II. In conclusion, processing of lipoproteins by SPase II in B. subtilis is not strictly required for lipoprotein function, which is surprising as lipoproteins and type II SPases seem to be conserved in all eubacteria.

    INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

One of the most commonly used eubacterial sorting (retention) signals for proteins that are exported from the cytoplasm is an amino-terminal lipid-modified cysteine residue (see Refs. 1 and 2). In Gram-positive eubacteria, such as Bacillus subtilis, lipid-modified proteins (lipoproteins) are retained in the cytoplasmic membrane. In Gram-negative eubacteria, such as Escherichia coli, these proteins are retained in the cytoplasmic or the outer membrane; retention in the cytoplasmic membrane depends on the presence of an additional sorting signal in the form of an aspartic acid residue at the +2 position relative to the amino-terminal cysteine residue (see Refs. 3-6). Even the organism with the smallest known genome, Mycoplasma genitalium, seems to make use of lipid modification to retain proteins in the cytoplasmic membrane (7). The number of putative lipoprotein-encoding genes per eubacterial genome seems to range from approximately 18 in M. genitalium (http://www.tigr.org/tdb/mdb/mgdb) to approximately 89 in E. coli1 and 114 in B. subtilis (Table I). Thus, lipoproteins appear to represent about 1-3.5% of the proteome of eubacteria.

Lipoproteins are directed into the general (Sec) pathway for protein secretion by their signal peptides, which show similar structural characteristics as the signal peptides of secretory proteins: a positively charged amino terminus, a hydrophobic core region, and a carboxyl-terminal region containing the cleavage site for signal peptidase (SPase).2 The major difference between signal peptides of lipoproteins and secretory proteins is the presence of a well conserved "lipobox" of four residues in the former signal peptides, which constitutes the cleavage site for the lipoprotein-specific SPase, also known as SPase II. Invariably, the carboxyl-terminal residue of the lipobox is cysteine, which, upon lipid modification, forms the retention signal of the mature lipoprotein (for details, see Refs. 1 and 8). Modification of this cysteine residue by the diacylglyceryl transferase is a prerequisite for processing of the lipoprotein precursor by SPase II. Processing by SPase II can be inhibited with globomycin, a reversible and noncompetitive peptide inhibitor (2, 9, 10). In E. coli, the processed lipoprotein is further modified by aminoacylation of the diacylglycerylcysteine amino group (11, 12). It is presently not known whether the latter lipid modification step is conserved in all eubacteria. For example, B. subtilis and M. genitalium lack an lnt gene for the lipoprotein aminoacyltransferase.1

In Gram-negative eubacteria, the outer membrane confines numerous proteins to the periplasm. In Gram-positive eubacteria, which lack an outer membrane, lipid modification of exported proteins prevents their loss into the environment, as these proteins remain anchored to the cytoplasmic membrane. This may explain why B. subtilis contains more putative lipoproteins than E. coli and why, for example, 32 lipoproteins of B. subtilis are homologues of periplasmic high affinity substrate-binding proteins from Gram-negative eubacteria (Table I). Lipoproteins of Gram-positive eubacteria with a known function are involved in a variety of processes, such as the uptake of nutrients, resistance to antibiotics, protein secretion, competence for DNA binding and uptake, sporulation, germination, and bacterial targeting to different substrates, bacteria, and host tissues (see Ref. 13). In addition, a close examination of the putative lipoproteins of B. subtilis, which were identified on the basis of the conserved lipobox, suggests that certain lipoproteins are also involved in oxidative phosphorylation, cell wall biogenesis, and autolysis. The importance of lipoproteins for the homeostasis of Gram-positive eubacteria is underscored by the observation that the most abundant lipoprotein of B. subtilis, PrsA, is essential for the efficient secretion of various proteins and cell viability (14-17). Notably, no specific function can presently be assigned to the majority of putative lipoproteins of B. subtilis (about 75%; Table I) and other Gram-positive eubacteria.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Putative lipoproteins of B. subtilis
Putative lipoprotein signal peptides were identified in two ways. First, the presence of a lipobox was determined by a search for cysteinc residues in putative signal peptides of B. subtilis, which were identified with the SignalP algorithm for the prediction of signal peptides from Gram-positive eubacteria (18). To this purpose, the first 60 residues of the annotated proteins of B. subtilis in the SubtiList database (http://www.pasteur.fr/Bio/SubtiList.html) were used. Second, putative lipoprotein signal peptides were identified by performing similarity searches in the SubtiList database with signal peptides of known lipoproteins, using the Blast algorithm (19). The highly conserved leucine residue at position -3 and the strictly conserved cysteine at position +1 relative to the cleavage site for SPase II, are indicated in boldface. Note that aspartic acid residues are absent from position +2. KapB, which seems to be a lipoprotein (20), is not listed in this table because its amino terminus is atypical for signal peptides of lipoproteins due to the presence of two lysine residues in the hydrophobic core region. No other putative lipoproteins of this type were identified.

The present studies were aimed at the evaluation of the importance of B. subtilis lipoproteins for cellular homeostasis in general, and their processing by SPase II in particular. For this purpose, SPase II-depleted cells were used. Unexpectedly, the results show that lipoprotein processing is required for growth at low and high temperatures and the efficient secretion of the alpha -amylase AmyQ (a non-lipoprotein) but not for growth and cell viability at 37 °C, development of competence for DNA binding and uptake, sporulation, or spore germination.

    EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Plasmids, Bacterial Strains, and Media-- Table II lists the plasmids and bacterial strains used. TY medium (tryptone/yeast extract) contained Bacto tryptone (1%), Bacto yeast extract (0.5%), and NaCl (1%). S7 media 1 and 3, used for labeling of B. subtilis proteins with [35S]methionine (Amersham Pharmacia Biotech), were prepared as described in Refs. 21 and 22. When required, media for E. coli were supplemented with ampicillin (50 µg/ml), erythromycin (100 µg/ml), or kanamycin (40 µg/ml); media for B. subtilis were supplemented with chloramphenicol (5 µg/ml), erythromycin (1 µg/ml), kanamycin (10 µg/ml), tetracyclin (6 µg/ml), spectinomycin (100 µg/ml), globomycin (80 µg/ml), and/or IPTG (1 mM).

                              
View this table:
[in this window]
[in a new window]
 
Table II
Plasmids and bacterial strains

DNA Techniques-- Procedures for DNA purification, restriction, ligation, agarose gel electrophoresis, and transformation of E. coli were carried out as described in Ref. 30. Enzymes were from Boehringer Mannheim. B. subtilis was transformed as described in Ref. 25. Correct integration of plasmids into the chromosome of B. subtilis was verified by Southern blotting. PCR was carried out with Vent DNA polymerase (New England Biolabs) as described in Ref. 31. pMutin2-MIL (see "Results" for explanation) was constructed by PCR amplification of the 5' region of the lsp gene with the primers lsp-m1(5'-ATAAGCTTAACCGTAAACTGGAGG-3') and lsp-m2 (5'-GCGGATCCAAGAAGCCTTTGTCCC-3') and subsequent cloning in pMutin2. pMutin2-MDelta L was constructed by PCR amplification of an internal fragment of the lsp gene with the primers lsp-m5 (5'-ATGTCGACGCATGGGGGATATTAG-3') and lsp-m2 and subsequent cloning in pMutin2. To construct pKTH3409, the prsA gene was amplified by PCR with a primer containing a ClaI site and 5' sequences of prsA (starting at position -27 relative to the start codon) and a primer, which adds the sequence CACCATCACCATCACCATTAAGTCGAC to the 3'-end of prsA, specifying a hexahistidine tag, stop codon, and SalI cleavage site. The tagged prsA gene was placed under the control of the xylose-inducible xylA promoter of plasmid pSX50, using the ClaI and SalI restriction sites. The resulting plasmid was designated pKTH3409.

Competence and Sporulation-- Competence for DNA binding and uptake was determined by transformation with plasmid or chromosomal DNA (28). The efficiency of sporulation was determined by overnight growth in Schaeffer's medium (32), killing of cells with 0.1 volume of chloroform, and subsequent plating.

beta -Galactosidase Activity Assay-- Overnight cultures were diluted 100-fold in fresh medium, and samples were taken at hourly intervals for A600 readings and beta -galactosidase activity determinations. The assay and the calculation of beta -galactosidase units (expressed as units per A600) were carried out as described in Ref. 33.

Protein Labeling, Immunoprecipitation, SDS-PAGE, and Fluorography-- Pulse-chase labeling of B. subtilis, immunoprecipitation, SDS-polyacrylamide gel electrophoresis (SDS-PAGE), and fluorography were performed as described previously in Refs. 21 and 22. Palmitic acid labeling of (pre-)PrsA was performed as described in Ref. 16.

Western Blot Analysis-- Western blotting was performed as described in Ref. 34. After separation by SDS-PAGE, proteins were transferred to Immobilon-PVDF membranes (Millipore Corporation). To detect PrsA or the alpha -amylase AmyQ, B. subtilis cells were separated from the growth medium by centrifugation (5 min, 12.000 rpm, room temperature), and samples for SDS-PAGE were prepared as described in Ref. 22. (Pre-)PrsA and (pre-)AmyQ were visualized with specific antibodies and horseradish peroxidase-anti-rabbit-IgG conjugates (Amersham Pharmacia Biotech). Hexahistidine-tagged (pre-)PrsA was visualized with hexahistidine-specific monoclonal antibodies (Amersham Pharmacia Biotech), and biotinylated (pre-)AmyQ-PSBT was visualized with streptavidine-horseradish peroxidase conjugates (Amersham Pharmacia Biotech).

Trypsin Accessibility Assay-- The preparation of protoplasts from exponentially growing cells of B. subtilis and the testing of the protease accessibility of membrane proteins was performed as described in Ref. 29.

    RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References

The lsp Gene for SPase II Is Not Essential for Cell Viability-- To determine whether the lsp gene for the SPase II of B. subtilis (35) is essential for growth and cell viability, two lsp mutant strains were constructed, using derivatives of the integration vector pMutin2. B. subtilis MDelta L was constructed by integration of pMutin2-MDelta L within the structural lsp gene, resulting in the disruption of this gene. B. subtilis MIL was constructed by integration of pMutin2-MIL at the 5'-end of lsp in such a way that the original lsp promoter region was replaced by the IPTG-inducible Pspac promoter (Fig. 1A). The fact that B. subtilis MDelta L could be obtained shows that SPase II is not essential for cell viability, at least when cells are grown in TY or minimal medium at 37 °C. Under these conditions, the growth of B. subtilis MDelta L was only slightly reduced, compared with the parental strain 8G5. Similarly, the growth rate of B. subtilis MIL was slightly reduced in the absence of IPTG, as compared with that of B. subtilis MIL in the presence of IPTG, or the parental strain. Unexpectedly, the disruption of the lsp gene did not inhibit the development of competence for DNA binding and uptake, sporulation, and subsequent spore germination (data not shown), although at least one lipoprotein is required both for competence development and sporulation (OppA) (36), three for sporulation (DppE, also known as DciA, SpoIIIJ, and SpoIVB) (37-39), and five for germination (GerAC, GerBC, GerKC, GerM, and GerD) (40-44). Interestingly, SPase II appeared to be essential for growth at 15 °C (data not shown) and 48 °C. Upon a temperature shift from 37 to 48 °C, cells lacking SPase II stopped growing and lysed (Fig. 1B, Delta lsp). These findings imply that some as yet unidentified lipoproteins of B. subtilis are required for growth at low and high temperatures or that the accumulation of lipoprotein precursors causes cold and heat sensitivity. In what follows, we show that the cold and heat sensitivity of cells lacking SPase II must be due to the malfunction of certain lipoproteins.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 1.   Construction and properties of lsp mutant strains of B. subtilis. A, schematic presentation of the construction of lsp mutant strains of B. subtilis. B. subtilis MIL (Ilsp) was constructed by Campbell-type integration of pMutin2-MIL in the ileS-pyrR locus of B. subtilis 8G5 in such a way that the lsp promoter region was replaced by the IPTG-dependent Pspac promoter. B. subtilis MDelta L (Delta lsp) was constructed by Campbell-type integration of pMutin2-MDelta L in the ileS-pyrR locus of B. subtilis 8G5 in such a way that the lsp gene was disrupted, and downstream genes were placed under the control of the Pspac promoter. Due to the integration of pMutin2-MIL and pMutin2-MDelta L, B. subtilis MIL and MDelta L both contain the spoVG-lacZ reporter gene of pMutin2 under the transcriptional control of the lsp promoter region. The relative positions of open reading frames in the ileS-pyrR locus are shown. Restriction sites relevant for the construction are indicated: Ba, BamHI; Bc, BclI; Bg, BglII; Nd, NdeI; Hi, HindIII. Ori pBR322, replication functions of pBR322; Apr, ampicillin resistance marker; Emr, erythromycin resistance marker; lsp', 3' truncated lsp gene; T1T2, transcriptional terminators on pMutin2; 'lsp, 5' truncated lsp gene. B, temperature-sensitive growth of B. subtilis lacking SPase II. Overnight cultures of B. subtilis MDelta L (Delta lsp) (black-square) and the parental strain 8G5 (open circle ) grown in TY medium at 37 °C were diluted 100-fold in fresh TY medium and incubated at 37 °C. When the cells reached an A600 of about 1.2, the temperature was shifted to 48 °C. Zero time (t = 0) indicates the transition point between the exponential and postexponential growth phases. C, time courses of the transcription of the lsp-lacZ gene fusion in B. subtilis MIL were determined in cells growing at 37 °C in TY () or minimal (black-square) medium, both supplemented with 1 mM IPTG. beta -Galactosidase activities were determined in units per A600. Zero time (t = 0) indicates the transition point between the exponential and postexponential growth phases.

Maximal lsp Transcription in the Exponential Growth Phase-- Both in B. subtilis MDelta L and B. subtilis MIL, the transcription of the lacZ gene, present on pMutin2, is directed by the lsp promoter region (Fig. 1A). To study the transcription of the lsp gene, B. subtilis MIL was grown in the presence or absence of IPTG, and samples withdrawn at hourly intervals were assayed for beta -galactosidase activity. The results showed that the beta -galactosidase levels increased during exponential growth, reaching a maximum in the transition phase between exponential and postexponential growth. In contrast, the beta -galactosidase levels were strongly decreased in the postexponential growth phase. This pattern of lsp-lacZ expression was observed when cells were grown in TY or minimal medium, irrespective of the presence of IPTG. However, compared with minimal medium, higher expression levels were detected in TY medium, where, in the postexponential growth phase, beta -galactosidase activity was close to background (Fig. 1C). In summary, these observations indicate that the transcription of lsp is highest in the exponential growth phase and decreases to lower levels in the postexponential growth phase. Thus, it seems that exponentially growing cells produce sufficient SPase II for lipoprotein processing in the transition and postexponential growth phases.

Alternative Amino-terminal Processing of Pre-PrsA in Cells Lacking SPase II-- To examine the effects of the absence of SPase II, the processing of (pre-)PrsA, the major lipoprotein of B. subtilis (15, 16) was studied by pulse-chase labeling experiments with B. subtilis MDelta L. As shown in Fig. 2A (Delta lsp), pre-PrsA processing was strongly impaired in the absence of SPase II, and even after a long chase period of 15 min, no mature PrsA was detectable. In contrast, pre-PrsA was rapidly processed to the mature form in the parental strain. As expected, Western blotting experiments showed that B. subtilis MDelta L accumulated pre-PrsA, but surprisingly, this concerned only about 50% of the total PrsA present in the cells. In addition to pre-PrsA, cells of B. subtilis MDelta L also contained mature-like forms of PrsA, which, compared with mature PrsA, had a slightly lower mobility on SDS-PAGE (Fig. 2B, Delta lsp). This difference in mobility could only be visualized clearly when proteins were separated on long gels (40 cm). In what follows, standard gel systems (15 cm) were used, resulting in a less pronounced separation of mature PrsA (strains containing SPase II) and mature-like forms of PrsA (strains lacking SPase II). As shown in Fig. 2C, the mature-like forms of PrsA were also detected when cells of B. subtilis MDelta L (Delta lsp) or the parental strain (8G5) were grown in the presence of globomycin. Western blotting experiments with a xylose-inducible mutant form of PrsA, containing a carboxyl-terminal hexahistidine tag, showed that at least one of the mature-like forms of PrsA was cleaved at the amino terminus (Fig. 2D). Taken together, these findings show that in the absence of SPase II, pre-PrsA is subject to alternative amino-terminal processing at a low rate.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2.   Processing of PrsA in lsp mutant strains. A, processing of pre-PrsA in cells of B. subtilis MDelta L (Delta lsp) and the parental strain 8G5 was analyzed by pulse-chase labeling at 37 °C and subsequent immunoprecipitation, SDS-PAGE, and fluorography. Cells were labeled with [35S]methionine for 1 min prior to chase with excess nonradioactive methionine. Samples were withdrawn at 0, 1, and 15 min after the chase. The positions of pre-PrsA and mature PrsA are indicated. B, accumulation of pre-PrsA in cells of B. subtilis MDelta L (Delta lsp) and the parental strain 8G5. Samples were withdrawn after overnight growth and analyzed by SDS-PAGE (long gels of 40 cm) and Western blotting. The positions of PrsA, pre-PrsA, and two mature-like forms of PrsA (PrsA*) are indicated. C, effects of globomycin on the accumulation of pre-PrsA in cells of B. subtilis 8G5 and MDelta L (Delta lsp). Cells were grown in TY medium at 37 °C in the presence (+) or absence (-) of 80 µM globomycin, and samples for SDS-PAGE and Western blotting were withdrawn after overnight growth. The positions of PrsA, pre-PrsA, and mature-like forms of PrsA* are indicated. D, alternative amino-terminal processing of pre-PrsA in B. subtilis MDelta L was demonstrated by SDS-PAGE and Western blotting using the xylose-inducible, carboxyl-terminally hexahistidine-tagged PrsA protein (PrsA-His) specified by pKTH3409. Cells of B. subtilis MDelta L (Delta lsp) and the parental strain 8G5 containing pKTH3409 were grown overnight in the presence (+) or absence (-) of 1% xylose. The positions of PrsA-His, pre-PrsA-His, and mature-like forms of PrsA-His* are indicated. E and F, accumulation of pre-PrsA in cells lacking SPase II and various type I SPases. E, accu mulation of pre-PrsA in cells of B. subtilis MDelta L (Delta lsp), B. subtilis Delta SUVW MDelta L (Delta SUVW lsp), and B. subtilis Delta TUVW MDelta L (Delta TUVW lsp). Samples were withdrawn after overnight growth and analyzed by SDS-PAGE and Western blotting. The positions of pre-PrsA and mature-like forms of PrsA* are indicated. F, exponentially growing cells of B. subtilis Delta STxS-D146A MIL in TY medium with 1 mM IPTG (37 °C) were washed and resuspended in fresh TY medium. Upon incubation for 1 h in the presence (+) or absence (-) of 1 mM IPTG and/or 1% xylose at 37 °C or 48 °C, samples were taken for SDS-PAGE and Western blotting. The positions of PrsA, pre-PrsA, and the mature-like forms of PrsA* are indicated.

It has been shown previously that lipoprotein precursors from which the cleavage site for SPase II was removed by site-directed mutagenesis can be cleaved at alternative sites (for review, see Ref. 45). Type I SPases, which are required for the processing of secretory precursor proteins (for review, see Ref. 46) have been invoked in this alternative processing. To investigate whether the five type I SPases of B. subtilis (i.e. SipS, SipT, SipU, SipV, and SipW) (25, 47) might be involved in the amino-terminal cleavage of pre-PrsA in the absence of SPase II, multiple sip mutants were used. First, the lsp gene of the B. subtilis strains Delta SUVW (lacks SipS, SipU, SipV, and SipW) and Delta TUVW (lacks SipT, SipU, SipV, and SipW) was disrupted through transformation with chromosomal DNA of B. subtilis MDelta L. As shown by Western blotting, mature-like forms of PrsA were detected in both resulting strains (Fig. 2E). As the sipS and sipT genes can not be disrupted simultaneously (25), the involvement of SipS and SipT was investigated with the B. subtilis strain Delta STxS-D146A, which lacks wild-type copies of sipS and sipT but contains a mutant sipS gene specifying the temperature-sensitive SipS-D146A protein. The transcription of the latter gene is controlled by the xylose-inducible xylA promoter. B. subtilis Delta STxS-D146A was transformed with chromosomal DNA of B. subtilis MIL, resulting in B. subtilis Delta STxS-D146A MIL, in which the synthesis of SPase II depends on the presence of IPTG. As shown in Fig. 2F, alternative processing of pre-PrsA was barely affected in cells depleted of SipS, SipT and SPase II by incubation at 48 °C in the absence of xylose (no activity of SipS-D146A) and IPTG. Taken together, these findings indicate that type I SPases are not involved in the alternative processing of pre-PrsA in the absence of SPase II.

Membrane Topology and Lipid Modification of PrsA Are Not Affected in the Absence of SPase II-- As PrsA is an essential protein for growth and viability of B. subtilis (16),3 pre-PrsA and/or the mature-like forms of PrsA that are observed in cells lacking SPase II must be (partially) active. This implies that at least one of the latter forms of PrsA is correctly localized at the external surface of the membrane. To determine the topology of pre-PrsA and the mature-like forms of PrsA in the absence of SPase II, protoplasts of B. subtilis 8G5 MDelta L were incubated with trypsin. Like the mature PrsA of B. subtilis 8G5, pre-PrsA and the mature-like forms of PrsA of B. subtilis 8G5 MDelta L were associated with protoplasts and accessible to trypsin (Fig. 3A, Delta lsp). In contrast, the cytosolic protein GroEL was only accessible to trypsin when the protoplasts were lysed with Triton X-100 (Fig. 3B). Because the latter findings show that pre-PrsA and the mature-like forms of PrsA are correctly localized in cells lacking SPase II, we also addressed the question whether these forms are lipid-modified. To this purpose, palmitic acid labeling experiments were performed with strains lacking SPase II or, as a control, the diacylglyceryl transferase, specified by the lgt gene (i.e. prs-11) (14).4 Cells of the latter strain (Delta lgt) accumulated non-lipomodified pre-PrsA, whereas the strain lacking SPase II (Delta lsp) accumulated lipomodified pre-PrsA and mature-like PrsA (Fig. 4, A and B). In conclusion, these data show that, in the absence of SPase II, the precursor and mature-like forms of PrsA are lipid-modified, displaying a similar membrane topology as the mature PrsA in SPase II-proficient cells. Thus, all of these forms might, in principle, be active and responsible for the viability of cells lacking SPase II.


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 3.   Localization of PrsA. To determine the localization of precursor, mature, and mature-like foms of PrsA, cells of B. subtilis 8G5 and MDelta L (Delta lsp) were protoplasted and incubated for 30 min without further additions in the presence of trypsin (1 mg/ml) or trypsin and Triton X-100 (1%). Samples were used for SDS-PAGE, Western blotting, and immunodetection with PrsA-specific antibodies (A) or GroEL-specific antibodies (B, cytoplasmic control). The positions of pre-PrsA, mature PrsA (PrsA), mature-like forms of PrsA (PrsA*), and GroEL are indicated.


View larger version (44K):
[in this window]
[in a new window]
 
Fig. 4.   Lipid modification of PrsA. B. subtilis IH6538 (parental strain), IH6538 with an integrated copy of pMutin2-MDelta L, disrupting the lsp gene (Delta lsp), and IH6538 with the prs-11 mutation, inactivating the lgt gene (Delta lgt), were grown in TY medium at 37 °C. Exponentially growing cells were labeled with 50 µCi of [3H]palmitic acid for about 45 min. Membranes were isolated and used for SDS-PAGE, Western blotting, and immunodetection with PrsA-specific antibodies (A) or for SDS-PAGE and fluorography (B). B. subtilis IH6538 and derivatives of this strain were used in this experiment because they incorporate higher levels of [3H]palmitic acid than B. subtilis 8G5. The positions of nonmodified pre-PrsA (pre-PrsAnm), lipid-modified pre-PrsA (pre-PrsAm), lipid-modified mature PrsA (PrsA), and mature-like forms of PrsA (PrsA*) are indicated.

Lsp Is Required for the Efficient Processing and Secretion of the Non-lipoprotein Pre-AmyQ-- It was previously shown that PrsA sets a limit for high level secretion of the Bacillus amyloliquefaciens alpha -amylase AmyQ and that it is required for the folding of AmyQ into a protease-resistant conformation (16). To examine the effect of SPase II depletion on PrsA activity, AmyQ secretion was monitored in B. subtilis 8G5 MDelta L (Fig. 5, Delta lsp) and 8G5 MIL (Fig. 5, Ilsp). To this purpose, both strains were transformed with pKTH10, which contains the amyQ gene (24). Next, the secretion of AmyQ was analyzed by Western blotting. As shown in Fig. 5, the accumulation of pre-PrsA and mature-like forms of PrsA in cells depleted of SPase II (Fig. 5A, Delta lsp and Ilsp in the absence of IPTG) was paralleled by the secretion of about 5-fold reduced amounts of mature AmyQ into the growth medium (Fig. 5C). The latter observation is diagnostic for reduced levels of PrsA activity. In addition, SPase II-depleted cells accumulated increased levels of pre-AmyQ (Fig. 5B), which is atypical for PrsA mutants (14). As shown by pulse-chase labeling experiments, the rate of pre-AmyQ processing by type I SPase(s) was slightly (but reproducibly) reduced in cells lacking SPase II (Fig. 5D). As mutations in PrsA do not cause the accumulation of pre-AmyQ, this effect of the absence of SPase II must be attributed to the accumulation of lipoprotein precursors or the malfunction of an as yet unidentified lipoprotein. The reason why the kinetic effects of the absence of SPase II on pre-AmyQ processing (Fig. 5D) are mild in comparison to the strong accumulation of pre-AmyQ at steady state (Fig. 5B) is not clear. One explanation could be that the growth conditions in both types of experiments are not identical.


View larger version (51K):
[in this window]
[in a new window]
 
Fig. 5.   Impaired secretion of AmyQ in the absence of SPase II. Cells of B. subtilis MIL (Ilsp), MDelta L (Delta lsp), and the parental strain 8G5 were grown in TY medium at 37 °C in the presence (+) or absence (-) of 1 mM IPTG. Samples for SDS-PAGE and Western blotting were prepared from cells and their growth medium. Cells were harvested 2 h after the transition between exponential and postexponential growth (t = 2) (Fig. 1B). Specific antibodies were used to detect the cellular levels of PrsA (A) and AmyQ (B) and the levels of secreted AmyQ in the growth medium (C). The positions of pre-PrsA, the mature form of PrsA, the mature-like form of PrsA (PrsA(*)), AmyQ, and pre-AmyQ are indicated. D, processing of pre-AmyQ in B. subtilis MDelta L (Delta lsp) and the parental strain 8G5, was analyzed by pulse-chase labeling at 37 °C and subsequent immunoprecipitation, SDS-PAGE, and fluorography. Cells were labeled with [35S]methionine for 1 min prior to chase with excess nonradioactive methionine. Samples were withdrawn after the chase at the times indicated. The positions of pre-AmyQ and mature AmyQ are indicated.

To determine whether the accumulation of pre-AmyQ in SPase II-depleted cells reflects a reduced rate of translocation of pre-AmyQ, which might be caused by the accumulation of lipoprotein precursors, we made use of an AmyQ variant (AmyQ-PSBT) (25) containing the biotinylation domain of the pyruvate decarboxylase of Propionibacterium shermanii (48). The rationale of this experiment is that pre-AmyQ-PSBT can only be biotinylated by the cytoplasmic biotin-ligase if the PSBT domain folds into its native three-dimensional structure in the cytoplasm. This will only happen if the rate of translocation of pre-AmyQ-PSBT across the membrane is significantly reduced. As shown in Fig. 6, cells lacking SPase II(Delta lsp) did not accumulate biotinylated pre-AmyQ-PSBT, irrespective of the growth temperature (15, 37, or 48 °C), although AmyQ-PSBT was produced under these conditions (data not shown). In contrast, B. subtilis cells with a disrupted secDF gene (B. subtlis MIF) (29) accumulated biotinylated forms of AmyQ-PSBT at all growth temperatures tested (Fig. 6, Delta secDF), whereas cells lacking SipS and SipT but expressing the temperature-sensitive SipS-D146A protein (Fig. 6, Delta STxS-D146A) (25) accumulated biotinylated forms of AmyQ-PSBT only at 48 °C. These observations indicate that the accumulation of pre-AmyQ in SPase II-depleted cells is not due to impaired translocation across the membrane and that the cold sensitivity of these cells is not related to protein translocation defects. Instead, the accumulation of pre-AmyQ must be attributed to the malfunction of certain lipoproteins in the absence of SPase II.


View larger version (64K):
[in this window]
[in a new window]
 
Fig. 6.   Translocation of pre-AmyQ-PSBT in the absence of SPase II. To investigate the translocation of AmyQ in SPase II-depleted cells, B. subtilis MDelta L (Delta lsp) was transformed with plasmid pKTH10-BT, which specifies AmyQ-PSBT (see under "Results" for explanation). Control strains, also transformed with pKTH10-BT, were as follows: B. subtilis 8G5 (negative control), B. subtilis MIF (Delta secDF) (positive control) (29), and B. subtilis Delta STxS-D146A (depletion of SipS and SipT) (positive control at 48 °C) (25). Cells were grown overnight in TY medium, 100-fold diluted in fresh TY medium, and grown until the transition phase between exponential and postexponential growth at 37 °C. Next, aliquots were incubated for 3 h at 15, 37, or 48 °C. Cells were collected by centrifugation, and biotinylated (pre-)AmyQ-PSBT was visualized by SDS-PAGE and Western blotting using a streptavidin-horseradish peroxidase. p, pre-AmyQ-PSBT; m, mature AmyQ-PSBT.


    DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

We have previously shown that five paralogous type I SPases are involved in the processing of secretory precursor proteins in B. subtilis (25, 47, 49, 50). Two of these, designated SipS and SipT, are of major importance for protein secretion, and cells depleted of both SipS and SipT stop growing and lyse. The other type I SPases (SipU, SipV, and SipW) are of minor importance for protein secretion and viability. Thus, B. subtilis is representative for Gram-positive eubacteria, archaea, and eukaryotes, many of which contain paralogous type I SPases (25). In contrast to the type I SPases, B. subtilis (35, 51) and other eubacteria seem to contain only one gene for SPase II,5 whereas type II SPases appear to be absent from archaea and eukaryotes.1 Here, we document four unexpected observations with respect to SPase II function in B. subtilis. First, unlike the SPase II of E. coli, the SPase II of B. subtilis is not essential for growth and viability. Second, the absence of SPase II resulted in cold and heat sensitivity. Third, SPase II is not required for the development of genetic competence, sporulation, and spore germination although at least eight known lipoproteins are important for these processes. Fourth, the secretion of the non-lipoprotein AmyQ was severely reduced in the absence of SPase II.

Lipoprotein processing by SPase II in E. coli can be inhibited by globomycin. Consistent with the observation that SPase II is essential for cell viability of E. coli (52), globomycin can serve as an antibiotic for E. coli and other Gram-negative eubacteria (9). Despite the fact that globomycin can inhibit the processing of certain lipoprotein precursors in B. subtilis (Ref. 53 and this paper), this antibiotic displays no cytotoxic activity against B. subtilis and other Gram-positive eubacteria (9). The present results show that this is most likely due to the fact that the SPase II is not essential for cell viability of B. subtilis and not to degradation or modification of globomycin. One reason why SPase II is more important for cell viability of E. coli than for cell viability of B. subtilis may be that most lipoproteins of E. coli are sorted to the outer membrane. Of the 89 (putative) lipoproteins of E. coli, which we have recently identified by computer-assisted analyses, only 8 have an aspartic acid residue at the +2 position for retention in the cytoplasmic membrane (data not shown), suggesting that the other 81 lipoproteins are sorted to the outer membrane. Thus, the lethality of lsp mutations in E. coli may be attributed to the depletion of lipoproteins from the outer membrane. Furthermore, even though B. subtilis has more lipoprotein-encoding genes than E. coli, the latter organism may produce more lipoprotein molecules per cell, and therefore, the lethality of lsp mutations in E. coli could also be due to the accumulation of lipoprotein precursors in the cytoplasmic membrane.

Notably, the lipoproteins of B. subtilis (Table I) and other Gram-positive eubacteria (13) seem to lack aspartic acid residues at the +2 position. The latter observation suggests that this aspartic acid residue has specifically evolved as a retention signal for lipoproteins of Gram-negative eubacteria. Furthermore, the lack of lnt genes from B. subtilis and M. genitalium suggests that the lipoproteins of these organisms are not aminoacylated. Consistent with the latter hypothesis, a macrophage-stimulating lipoprotein with a non-acylated amino terminus has been isolated from Mycoplasma fermentans (54). The latter observations raise the intriguing question of whether aminoacylation has a particular function in Gram-negative eubacteria; for example, in the sorting of lipoproteins.

Cold sensitivity seems to be a general property of E. coli (55) and B. subtilis (29) strains, which are defective in protein translocation via the Sec-machinery. Thus, the cold sensitivity of B. subtilis lsp mutants might reflect a general defect in protein translocation, which could be caused primarily by the accumulation of lipoprotein precursors. However, this possibility is unlikely, as SPase II-depleted cells did not show a translocation defect for AmyQ-PSBT, irrespective of the growth temperature. Instead, our results indicate that the observed cold and heat sensitivity of B. subtilis mutants lacking SPase II is caused by the malfunction of certain lipoproteins, which are required for cell viability at low and high temperatures.

The observation that the development of competence, sporulation, and germination are not affected by the absence of SPase II shows that the precursors, or (putative) alternatively processed forms of the lipoproteins required for these primitive developmental processes are active. Similarly, the fact that the strain lacking SPase II is viable at 37 °C shows that pre-PrsA and/or the mature-like forms of PrsA are active, because PrsA is essential for cell viability (16). Nevertheless, as indicated by the reduced secretion of AmyQ in lsp mutants B. subtilis, lipoprotein processing is important for the full functionality of lipoproteins, such as PrsA. Our current working model for the effects of SPase II limitation on the processing of pre-PrsA and the secretion of AmyQ is shown in Fig. 7. Although SPase II-depleted cells contain similar amounts of PrsA protein as wild-type cells, processing by SPase II seems to be important for the stable maintenance of certain other lipoproteins,6 suggesting that processing by SPase II is required to protect these proteins against proteolytic degradation at the membrane-cell wall interface.


View larger version (37K):
[in this window]
[in a new window]
 
Fig. 7.   Model for AmyQ secretion in the absence of SPase II. Pre-AmyQ is synthesized with an amino-terminal signal peptide (SP). Cytoplasmatic chaperones (C) and targeting factors (T) keep the precursor in a translocation-competent conformation and facilitate its targeting to the preprotein translocase in the membrane. Known components of the B. subtilis translocase are SecA (A), SecY (Y), SecE (E), and SecDF (DF) (see Ref. 29). SecA acts as a force generator (motor) for protein translocation through cycles of preprotein binding, membrane insertion, preprotein release, and deinsertion from the membrane. The cycling of SecA is regulated by ATP binding and hydrolysis (see Ref. 56). During or shortly after the translocation, pre-AmyQ is processed by one of the type I SPases, SipS, SipT, SipU, SipV, or SipW (25). Folding of the mature AmyQ into its protease-resistant conformation depends on the activity of PrsA, which, in the absence of SPase II, is present in the precursor form (pre-PrsA) and at least two mature-like forms (PrsA*), all of which are lipid-modified and localized to the outer surface of the membrane. Alternative processing of pre-PrsA and degradation of AmyQ in the absence of SPase II is catalyzed by unknown proteases (Prot. X and Prot. Y) at the membrane-cell wall interface. Upon passage through the wall, mature AmyQ is released into the growth medium.

The fact that pre-PrsA is subject to alternative processing in the absence of SPase II is reminiscent of the previously reported observation that mutants of the penicillinase PenP of Bacillus licheniformis, which lack the cysteine residue at the +1 position, are subject to alternative processing. As these mutant proteins are not lipid-modified and contain putative SPase I cleavage sites, type I SPases have been invoked in their processing (57, 58). In contrast, our results indicate that type I SPases are not involved in the alternative amino-terminal processing of pre-PrsA, which is consistent with the fact that this precursor is lipid-modified. Surprisingly, the nonmodified pre-PrsA produced by the lgt mutant is not processed, even though putative SPase I cleavage sites are present in this precursor,1 suggesting that it contains an as yet unidentified "SPase I avoidance signal." Important challenges for future research are the identification of the protease(s) involved in the alternative processing of pre-PrsA and the SPase I avoidance signal in this precursor.

Finally, the reason why SPase II-depleted cells accumulate pre-AmyQ is presently not completely clear. First, as shown with AmyQ-PSBT, the rate of AmyQ translocation in these cells is not detectably affected. Second, as PrsA mutants do not accumulate pre-AmyQ (14), this effect can not be attributed to PrsA malfunction. Consequently, the accumulation of pre-AmyQ must be due to the malfunction of at least one as yet unknown lipoprotein, which affects the stability or processing of pre-AmyQ. This hypothesis is supported by our observation that the half-life of pre-AmyQ and at least one other precursor, pre(A13i)-beta -lactamase (50) (data not shown) is slightly increased in the absence of SPase II. We are presently investigating which of the putative lipoproteins of B. subtilis could be responsible for this effect.

    ACKNOWLEDGEMENTS

We thank Dr. M. Inukai from Sankyo Co., Ltd., Tokyo, Japan for generously providing globomycin; Drs. T. Wiegert and W. Schumann for providing pKTH10-BT; and Drs. A. Bolhuis, M. L. van Roosmalen, J. D. H. Jongbloed, and K. Yoshida for useful discussions.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ Supported by Genencor International (Rijswijk, The Netherlands) and Gist-brocades B.V. (Delft, The Netherlands).

parallel Supported by Biotechnology Grants Bio2-CT93-0254, Bio4-CT95-0278, and Bio4-CT96-0097 from the European Union.

Dagger Dagger Supported by a Hungarian State Eötvös Fellowship from the National Scholarships Board (Hungary).

¶¶ To whom correspondence should be addressed. Tel.: 31-50-3633079; Fax: 31-50-3632348; E-mail: j.m.van.dijl{at}farm.rug.nl.

The abbreviations used are: SPase, signal peptidase; IPTG, isopropyl-beta -D-thiogalactopyranoside; PAGE, polyacrylamide gel electrophoresis; PCR, polymerase chain reaction; TY, tryptone/yeast extract.

1 H.Tjalsma and J. M. van Dijl, unpublished observations.

3 V. P. Kontinen and M. Sarvas, unpublished results.

4 V. P. Kontinen and M. Sarvas, manuscript in preparation.

5 The product of the yaaT gene, which has been annotated as a putative SPase II-encoding gene of B. subtilis (51), does not show sequence similarity to known type II SPases, and, moreover, is predicted to be a soluble cytoplasmic protein (see Footnote 1). This makes a role of the YaaT protein in lipoprotein processing highly unlikely.

6 J. Bengtsson and L. Hederstedt, personal communication.

    REFERENCES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

  1. Pugsley, A. P. (1993) Microbiol. Rev. 57, 50-108[Abstract/Free Full Text]
  2. Sankaran, K., and Wu, H. C. (1994) in Signal Peptidases (von Heijne, G., ed), pp. 17-29, R. G. Landes Company, Austin, TX
  3. Yamaguchi, K., Yu, F., and Inouye, M. (1988) Cell 6, 423-432
  4. Poquet, I., Kornacker, M. G., and Pugsley, A. P. (1993) Mol. Microbiol. 9, 1061-1069[CrossRef][Medline] [Order article via Infotrieve]
  5. Matsuyama, S., Tajima, T., and Tokuda, H. (1995) EMBO J. 14, 3365-3372[Medline] [Order article via Infotrieve]
  6. Matsuyama, S., Yokota, N., and Tokuda, H. (1997) EMBO J. 16, 6947-6955[CrossRef][Medline] [Order article via Infotrieve]
  7. Fraser, C. M., Gocayne, J. D., White, O., Adams, M. D., Clayton, R. A., Fleischmann, R. D., Bult, C. J., Kerlavage, A. R., Sutton, G., Kelley, J. M., Fritchman, J. L., Weidman, J. F., Small, K. V., Sandusky, M., Fuhrmann, J., Nguyen, D., Utterback, T. R., Saudek, D. M., Phillips, C. A., Merrick, J. M., Tomb, J-F., Dougherty, B. A., Bott, K. F., Hu, P-C., and Lucier, T. S. (1995) Science 270, 397-403[Abstract/Free Full Text]
  8. von Heijne, G. (1989) Protein Eng. 2, 531-534[Abstract/Free Full Text]
  9. Inukai, M., Takeuchi, M., Shimizu, K., and Arai, M. (1978) J. Antibiot. 31, 1203-1205[Medline] [Order article via Infotrieve]
  10. Giam, C. Z., Chai, T., Hayashi, S., and Wu, H. C. (1984) Eur. J. Biochem. 141, 331-337[Medline] [Order article via Infotrieve]
  11. Tokunaga, M., Tokunaga, H., and Wu, H. C. (1982) Proc. Natl. Acad. Sci. U. S. A. 79, 2253-2259
  12. Sankaran, K., and Wu, H. C. (1994) J. Biol. Chem. 269, 19701-19706[Abstract/Free Full Text]
  13. Sutcliffe, I. C., and Russell, R. R. B. (1995) J. Bacteriol. 177, 1123-1128[Free Full Text]
  14. Kontinen, V. P., and Sarvas, M. (1988) J. Gen. Microbiol. 134, 2333-2344[Abstract/Free Full Text]
  15. Kontinen, V. P., Saris, P., and Sarvas, M. (1991) Mol. Microbiol. 5, 1273-1283[Medline] [Order article via Infotrieve]
  16. Kontinen, V. P., and Sarvas, M. (1993) Mol. Microbiol. 8, 727-737[Medline] [Order article via Infotrieve]
  17. Jacobs, M., Andersen, J. B., Kontinen, V. P., and Sarvas, M. (1993) Mol. Microbiol. 8, 957-966[Medline] [Order article via Infotrieve]
  18. Nielsen, H., Engelbrecht, J., Brunak, S., and von Heijne, G. (1997) Protein Eng. 10, 1-6[Abstract/Free Full Text]
  19. Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. (1997) Nucleic Acids Res. 25, 3389-3402[Abstract/Free Full Text]
  20. Dartois, V., Djavakhishvili, T., and Hoch, J. A. (1997) Mol. Microbiol. 26, 1097-1108[CrossRef][Medline] [Order article via Infotrieve]
  21. van Dijl, J. M., de Jong, A., Smith, H., Bron, S., and Venema, G. (1991) Mol. Gen. Genet. 227, 40-48[CrossRef][Medline] [Order article via Infotrieve]
  22. van Dijl, J. M., de Jong, A., Smith, H., Bron, S., and Venema, G. (1991) J. Gen. Microbiol. 137, 2073-2083[Abstract/Free Full Text]
  23. Yansura, D. G., and Henner, D. J. (1984) in Genetics and Biochemistry of Bacilli (Ganesan, A. T., and Hoch, J. A., eds), pp. 249-263, Academic Press, Orlando, FL
  24. Palva, I. (1982) Gene 19, 81-87[CrossRef][Medline] [Order article via Infotrieve]
  25. Tjalsma, H., Bolhuis, A., van Roosmalen, M. L., Wiegert, T., Schumann, W., Broekhuizen, C. P., Quax, W. J., Venema, G., Bron, S., and van Dijl, J. M. (1998) Genes Dev. 12, 2318-2331[Abstract/Free Full Text]
  26. Hastrup, S., and Jacobs, M. F. (1990) in Genetics and Bio/Technology of Bacilli (Zukowski, M. M., Ganesan, A. T., and Hoch, J. A., eds), pp. 33-41, Academic Press, San Diego, CA
  27. Wertman, K. F., Wyman, A. R., and Botstein, D. (1986) Gene 49, 253-262[CrossRef][Medline] [Order article via Infotrieve]
  28. Bron, S., and Venema, G. (1972) Mutat. Res. 15, 1-10[Medline] [Order article via Infotrieve]
  29. Bolhuis, A., Broekhuizen, C. P., Sorokin, A., van Roosmalen, M. L., Venema, G., Bron, S., Quax, W. J., and van Dijl, J. M. (1998) J. Biol. Chem. 273, 21217-21224[Abstract/Free Full Text]
  30. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  31. van Dijl, J. M., de Jong, A., Venema, G., and Bron, S. (1995) J. Biol. Chem. 270, 3611-3618[Abstract/Free Full Text]
  32. Schaeffer, P., Millet, J., and Aubert, P.-J. (1965) Proc. Natl. Acad. Sci. U. S. A. 54, 704-711[Free Full Text]
  33. Miller, J. H. (1982) Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  34. Kyhse-Andersen, J. (1984) J. Biochem. Biophys. Methods 10, 203-209[CrossRef][Medline] [Order article via Infotrieve]
  35. Prágai, Z., Tjalsma, H., Bolhuis, A., van Dijl, J. M., Venema, G., and Bron, S. (1997) Microbiology 143, 1327-1333[Abstract/Free Full Text]
  36. Koide, A., and Hoch, J. A. (1994) Mol. Microbiol. 13, 417-426[CrossRef][Medline] [Order article via Infotrieve]
  37. Mathiopoulos, C., Mueller, J. P., Slack, F. J., Murphy, C. G., Patankar, S., Bukusoglu, G., and Sonenshein, A. L. (1991) Mol. Microbiol 5, 1903-1913[CrossRef][Medline] [Order article via Infotrieve]
  38. Errington, J., Appleby, L., Daniel, R. A., Goodfellow, H., Partridge, S. R., and Yudkin, M. D. (1992) J. Gen. Microbiol. 138, 2609-2618[Abstract/Free Full Text]
  39. van Hoy, B. E., and Hoch, J. A. (1990) J. Bacteriol. 172, 1306-1311[Abstract/Free Full Text]
  40. Zuberi, A. R., Moir, A., and Feavers, I. M. (1987) Gene 51, 1-11[CrossRef][Medline] [Order article via Infotrieve]
  41. Kemp, E. H., Sammons, R. L., Moir, A., Sun, D., and Setlow, P. (1991) J. Bacteriol. 173, 4646-4652[Abstract/Free Full Text]
  42. Corfe, B. M., Sammons, R. L., Smith, D. A., and Mauel, C. (1994) Microbiology 140, 471-478[Abstract/Free Full Text]
  43. Slynn, G. M., Sammons, R. L., Smith, D. A., Moir, A., and Corfe, B. M. (1994) FEMS Microbiol. Lett. 121, 315-320[CrossRef][Medline] [Order article via Infotrieve]
  44. Yamane, K., Kumano, M., and Kurita, K. (1996) Microbiology 142, 3047-3056[Abstract/Free Full Text]
  45. Wu, H. C., and Tokunaga, M. (1986) Curr. Top. Microbiol. Immunol. 125, 127-157[Medline] [Order article via Infotrieve]
  46. Dalbey, R. E., Lively, M. O., Bron, S., and van Dijl, J. M. (1997) Protein Sci. 6, 1129-1138[Medline] [Order article via Infotrieve]
  47. Tjalsma, H., Noback, M. A., Bron, S., Venema, G., Yamane, K., and van Dijl, J. M. (1997) J. Biol. Chem. 272, 25983-25992[Abstract/Free Full Text]
  48. Cronan, J. E., Jr. (1990) J. Biol. Chem. 265, 10327-10333[Abstract/Free Full Text]
  49. Bolhuis, A., Sorokin, A., Azevedo, V., Ehrlich, S. D., Braun, P. G., de Jong, A., Venema, G., Bron, S., and van Dijl, J. M. (1996) Mol. Microbiol. 22, 605-618[CrossRef][Medline] [Order article via Infotrieve]
  50. van Dijl, J. M., de Jong, A., Vehmaanperä, J., Venema, G., and Bron, S. (1992) EMBO J. 11, 2819-2828[Medline] [Order article via Infotrieve]
  51. Kunst, F., Ogasawara, N., Moszer, I., Albertini, A. M., Alloni, G., Azevedo, V., Bertero, M. G., Bessieres, P., Bolotin, A., Borchert, S., et al.. (1997) Nature 390, 249-256[CrossRef][Medline] [Order article via Infotrieve]
  52. Yamagata, H., Ippolito, C., Inukai, M., and Inouye, M. (1982) J. Bacteriol. 152, 1163-1168[Abstract/Free Full Text]
  53. Hayashi, S., and Wu, H. C. (1983) J. Bacteriol. 156, 773-777[Abstract/Free Full Text]
  54. Muhlradt, P. F., Kiess, M., Meyer, H., Sussmuth, R., and Jung, G. (1997) J. Exp. Med. 185, 1951-1958[Abstract/Free Full Text]
  55. Pogliano, K. J., and Beckwith, J. (1993) Genetics 133, 763-773[Abstract]
  56. Duong, F., Eichler, J., Price, A., Leonard, M. R., and Wickner, W. (1997) Cell 91, 567-573[CrossRef][Medline] [Order article via Infotrieve]
  57. Hayashi, S., Chang, S. Y., Chang, S., and Wu, H. C. (1984) J. Biol. Chem. 259, 10448-10454[Abstract/Free Full Text]
  58. Hayashi, S., Chang, S. Y., Chang, S., and Wu, H. C. (1986) J. Bacteriol. 165, 678-681[Abstract/Free Full Text]
  59. Vagner, V., Dervyn, E., and Ehrlich, S. D. (1998) Microbiology 144, 3097-3104[Abstract/Free Full Text]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Immunol.Home page
M. Schmaler, N. J. Jann, F. Ferracin, L. Z. Landolt, L. Biswas, F. Gotz, and R. Landmann
Lipoproteins in Staphylococcus aureus Mediate Inflammation by TLR2 and Iron-Dependent Growth In Vivo
J. Immunol., June 1, 2009; 182(11): 7110 - 7118.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
E. L. Denham, P. N. Ward, and J. A. Leigh
In the absence of Lgt, lipoproteins are shed from Streptococcus uberis independently of Lsp
Microbiology, January 1, 2009; 155(1): 134 - 141.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
P. L. Pelczar and P. Setlow
Localization of the Germination Protein GerD to the Inner Membrane in Bacillus subtilis Spores
J. Bacteriol., August 15, 2008; 190(16): 5635 - 5641.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
E. L. Denham, P. N. Ward, and J. A. Leigh
Lipoprotein Signal Peptides Are Processed by Lsp and Eep of Streptococcus uberis
J. Bacteriol., July 1, 2008; 190(13): 4641 - 4647.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
M. Baumgartner, U. Karst, B. Gerstel, M. Loessner, J. Wehland, and L. Jansch
Inactivation of Lgt Allows Systematic Characterization of Lipoproteins from Listeria monocytogenes
J. Bacteriol., January 15, 2007; 189(2): 313 - 324.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. Hamilton, C. Robinson, I. C. Sutcliffe, J. Slater, D. J. Maskell, N. Davis-Poynter, K. Smith, A. Waller, and D. J. Harrington
Mutation of the Maturase Lipoprotein Attenuates the Virulence of Streptococcus equi to a Greater Extent than Does Loss of General Lipoprotein Lipidation
Infect. Immun., December 1, 2006; 74(12): 6907 - 6919.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
M. I. Hutchings, H.-J. Hong, E. Leibovitz, I. C. Sutcliffe, and M. J. Buttner
The {sigma}E Cell Envelope Stress Response of Streptomyces coelicolor Is Influenced by a Novel Lipoprotein, CseA.
J. Bacteriol., October 1, 2006; 188(20): 7222 - 7229.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
M. J. J. B. Sibbald, A. K. Ziebandt, S. Engelmann, M. Hecker, A. de Jong, H. J. M. Harmsen, G. C. Raangs, I. Stokroos, J. P. Arends, J. Y. F. Dubois, et al.
Mapping the Pathways to Staphylococcal Pathogenesis by Comparative Secretomics
Microbiol. Mol. Biol. Rev., September 1, 2006; 70(3): 755 - 788.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. P. Bhavsar, R. Truant, and E. D. Brown
The TagB Protein in Bacillus subtilis 168 Is an Intracellular Peripheral Membrane Protein That Can Incorporate Glycerol Phosphate onto a Membrane-bound Acceptor in Vitro
J. Biol. Chem., November 4, 2005; 280(44): 36691 - 36700.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
T. Igarashi and P. Setlow
Interaction between Individual Protein Components of the GerA and GerB Nutrient Receptors That Trigger Germination of Bacillus subtilis Spores
J. Bacteriol., April 1, 2005; 187(7): 2513 - 2518.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
T. Stein, S. Heinzmann, S. Dusterhus, S. Borchert, and K.-D. Entian
Expression and Functional Analysis of the Subtilin Immunity Genes spaIFEG in the Subtilin-Sensitive Host Bacillus subtilis MO1099
J. Bacteriol., February 1, 2005; 187(3): 822 - 828.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Robichon, D. Vidal-Ingigliardi, and A. P. Pugsley
Depletion of Apolipoprotein N-Acyltransferase Causes Mislocalization of Outer Membrane Lipoproteins in Escherichia coli
J. Biol. Chem., January 14, 2005; 280(2): 974 - 983.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
H. Tjalsma, H. Antelmann, J. D.H. Jongbloed, P. G. Braun, E. Darmon, R. Dorenbos, J.-Y. F. Dubois, H. Westers, G. Zanen, W. J. Quax, et al.
Proteomics of Protein Secretion by Bacillus subtilis: Separating the "Secrets" of the Secretome
Microbiol. Mol. Biol. Rev., June 1, 2004; 68(2): 207 - 233.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
T. Igarashi, B. Setlow, M. Paidhungat, and P. Setlow
Effects of a gerF (lgt) Mutation on the Germination of Spores of Bacillus subtilis
J. Bacteriol., May 15, 2004; 186(10): 2984 - 2991.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Reglier-Poupet, C. Frehel, I. Dubail, J.-L. Beretti, P. Berche, A. Charbit, and C. Raynaud
Maturation of Lipoproteins by Type II Signal Peptidase Is Required for Phagosomal Escape of Listeria monocytogenes
J. Biol. Chem., December 5, 2003; 278(49): 49469 - 49477.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
S. Y. M. Ng and K. F. Jarrell
Cloning and Characterization of Archaeal Type I Signal Peptidase from Methanococcus voltae
J. Bacteriol., October 15, 2003; 185(20): 5936 - 5942.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
A. de Greeff, A. Hamilton, I. C. Sutcliffe, H. Buys, L. van Alphen, and H. E. Smith
Lipoprotein signal peptidase of Streptococcus suis serotype 2
Microbiology, June 1, 2003; 149(6): 1399 - 1407.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Tjalsma, S. Bron, and J. M. van Dijl
Complementary Impact of Paralogous Oxa1-like Proteins of Bacillus subtilis on Post-translocational Stages in Protein Secretion
J. Biol. Chem., April 25, 2003; 278(18): 15622 - 15632.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Venema, H. Tjalsma, J. M. van Dijl, A. de Jong, K. Leenhouts, G. Buist, and G. Venema
Active Lipoprotein Precursors in the Gram-positive Eubacterium Lactococcus lactis
J. Biol. Chem., April 18, 2003; 278(17): 14739 - 14746.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
A. K. Dunn, A. K. Klimowicz, and J. Handelsman
Use of a Promoter Trap To Identify Bacillus cereus Genes Regulated by Tomato Seed Exudate and a Rhizosphere Resident, Pseudomonas aureofaciens
Appl. Envir. Microbiol., February 1, 2003; 69(2): 1197 - 1205.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Stein, S. Heinzmann, I. Solovieva, and K.-D. Entian
Function of Lactococcus lactis Nisin Immunity Genes nisI and nisFEG after Coordinated Expression in the Surrogate Host Bacillus subtilis
J. Biol. Chem., January 3, 2003; 278(1): 89 - 94.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. D. H. Jongbloed, H. Antelmann, M. Hecker, R. Nijland, S. Bron, U. Airaksinen, F. Pries, W. J. Quax, J. M. van Dijl, and P. G. Braun
Selective Contribution of the Twin-Arginine Translocation Pathway to Protein Secretion in Bacillus subtilis
J. Biol. Chem., November 8, 2002; 277(46): 44068 - 44078.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
I. C. Sutcliffe and D. J. Harrington
Pattern searches for the identification of putative lipoprotein genes in Gram-positive bacterial genomes
Microbiology, July 1, 2002; 148(7): 2065 - 2077.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Masuda, S.-i. Matsuyama, and H. Tokuda
Elucidation of the function of lipoprotein-sorting signals that determine membrane localization
PNAS, May 28, 2002; 99(11): 7390 - 7395.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. J. Sakamoto, M. Sasaki, and T. Tsuchido
Purification and Characterization of a Bacillus subtilis 168 Nuclease, YokF, Involved in Chromosomal DNA Degradation and Cell Death Caused by Thermal Shock Treatments
J. Biol. Chem., December 7, 2001; 276(50): 47046 - 47051.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
H. Antelmann, H. Tjalsma, B. Voigt, S. Ohlmeier, S. Bron, J. M. van Dijl, and M. Hecker
A Proteomic View on Genome-Based Signal Peptide Predictions
Genome Res., September 1, 2001; 11(9): 1484 - 1502.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
M. Vitikainen, T. Pummi, U. Airaksinen, E. Wahlström, H. Wu, M. Sarvas, and V. P. Kontinen
Quantitation of the Capacity of the Secretion Apparatus and Requirement for PrsA in Growth and Secretion of {alpha}-Amylase in Bacillus subtilis
J. Bacteriol., March 15, 2001; 183(6): 1881 - 1890.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
M. Nishiguchi, M. Matsumoto, T. Takao, M. Hoshino, Y. Shimonishi, S. Tsuji, N. A. Begum, O. Takeuchi, S. Akira, K. Toyoshima, et al.
Mycoplasma fermentans Lipoprotein M161Ag-Induced Cell Activation Is Mediated by Toll-Like Receptor 2: Role of N-Terminal Hydrophobic Portion in its Multiple Functions
J. Immunol., February 15, 2001; 166(4): 2610 - 2616.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
K.-I. Yoshida, Y. Fujita, and S. D. Ehrlich
An Operon for a Putative ATP-Binding Cassette Transport System Involved in Acetoin Utilization of Bacillus subtilis
J. Bacteriol., October 1, 2000; 182(19): 5454 - 5461.
[Abstract] [Full Text]


Home page
Microbiol. Mol. Biol. Rev.Home page
H. Tjalsma, A. Bolhuis, J. D. H. Jongbloed, S. Bron, and J. M. van Dijl
Signal Peptide-Dependent Protein Transport in Bacillus subtilis: a Genome-Based Survey of the Secretome
Microbiol. Mol. Biol. Rev., September 1, 2000; 64(3): 515 - 547.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
I. Hirose, K. Sano, I. Shioda, M. Kumano, K. Nakamura, and K. Yamane
Proteome analysis of Bacillus subtilis extracellular proteins: a two-dimensional protein electrophoretic study
Microbiology, January 1, 2000; 146(1): 65 - 75.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
H. Tjalsma, G. Zanen, G. Venema, S. Bron, and J. M. van Dijl
The Potential Active Site of the Lipoprotein-specific (Type II) Signal Peptidase of Bacillus subtilis
J. Biol. Chem., October 1, 1999; 274(40): 28191 - 28197.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Bolhuis, G. Venema, W. J. Quax, S. Bron, and J. M. van Dijl
Functional Analysis of Paralogous Thiol-disulfide Oxidoreductases in Bacillus subtilis
J. Biol. Chem., August 27, 1999; 274(35): 24531 - 24538.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Bolhuis, A. Matzen, H.-L. Hyyrylainen, V. P. Kontinen, R. Meima, J. Chapuis, G. Venema, S. Bron, R. Freudl, and J. M. van Dijl
Signal Peptide Peptidase- and ClpP-like Proteins of Bacillus subtilis Required for Efficient Translocation and Processing of Secretory Proteins
J. Biol. Chem., August 27, 1999; 274(35): 24585 - 24592.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. D. H. Jongbloed, U. Martin, H. Antelmann, M. Hecker, H. Tjalsma, G. Venema, S. Bron, J. M. van Dijl, and J. Muller
TatC Is a Specificity Determinant for Protein Secretion via the Twin-arginine Translocation Pathway
J. Biol. Chem., December 22, 2000; 275(52): 41350 - 41357.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tjalsma, H.
Right arrow Articles by van Dijl, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tjalsma, H.
Right arrow Articles by van Dijl, J. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement