JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Townsend, K. J.
Right arrow Articles by Craig, R. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Townsend, K. J.
Right arrow Articles by Craig, R. W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 3, 1801-1813, January 15, 1999


Regulation of MCL1 through a Serum Response Factor/Elk-1-mediated Mechanism Links Expression of a Viability-promoting Member of the BCL2 Family to the Induction of Hematopoietic Cell Differentiation*

Karen J. TownsendDagger §, Ping ZhouDagger , Liping QianDagger , Christine K. BieszczadDagger , Christopher H. LowreyDagger parallel , Andrew Yen**, and Ruth W. CraigDagger Dagger Dagger

From the Dagger  Departments of Pharmacology and Toxicology and the parallel  Department of Medicine, Dartmouth Medical School, Hanover, New Hampshire 03755-3835 and the ** Department of Pathology, Cancer Biology Laboratories, Cornell University, Ithaca, New York 14853

    ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Proliferation, differentiation, and apoptosis are tightly regulated during hematopoiesis, allowing amplification along specific lineages while preventing excessive proliferation of immature cells. The MCL1 member of the BCL2 family is up-regulated during the induction of monocytic differentiation (~10-fold with 12-O-tetradecanoylphorbol 13-acetate (TPA)). MCL1 has effects similar to those of BCL2, up-regulation promoting viability, but differs from BCL2 in its rapid inducibility and its pattern of expression. Nuclear factors that regulate MCL1 transcription have now been identified, extending the previous demonstration of signal transduction through mitogen-activated protein kinase. A 162-base pair segment of the human MCL1 5'-flank was found to direct luciferase reporter activity, allowing ~10-fold induction with TPA that was suppressible upon inhibition of the extracellular signal-regulated kinase (ERK) pathway. Serum response factor (SRF), Elk-1, and Sp1 bound to cognate sites within this segment, SRF and Elk-1 acting coordinately to affect both basal activity and TPA inducibility, whereas Sp1 affected basal activity only. Thus, the mechanism of the TPA-induced increase in MCL1 expression seen in myelomonocytic cells at early stages of differentiation involves signal transduction through ERKs and transcriptional activation through SRF/Elk-1. This finding provides a parallel to early response genes (e.g. c-FOS and EGR1) that affect maturation commitment in these cells and therefore suggests a means through which enhancement of cell viability may be linked to the induction of differentiation.

    INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

The MCL1 member of the BCL2 family was discovered as part of a differential screen aimed at identifying genes that are rapidly up-regulated as ML-1 human myeloblastic leukemia cells initiate differentiation along the monocyte pathway (1). Thus, MCL1 is expressed at very low levels in immature ML-1 cells and is up-regulated upon exposure to the monocyte/macrophage differentiation-inducing agent TPA1 (1). The increase in MCL1 mRNA occurs rapidly, being detectable within 1 h and approaching a maximum (~7-10-fold) at 3 h. The increase is transient, MCL1 mRNA levels having declined to ~50% of the peak value within 1 day. An increase in the MCL1 protein parallels the increase in the mRNA (1, 5, 6) and precedes the progressive accumulation of differentiated cells on days 1-3 (1, 7, 8). In contrast to MCL1, BCL2 levels remain constant until declining at the terminal stages of differentiation (day 3) (5). In sum, a rapid, transient increase in the expression MCL1, but not BCL2, occurs during the early stages of TPA-induced ML-1 cell differentiation.

The increase in MCL1 seen in the early stages of TPA-induced ML-1 cell differentiation is representative of the high levels of expression seen at early stages of myeloid differentiation in a variety of systems, including cell lines as well as differentiating cells in the intact animal. In ML-1 cells, MCL1 expression increases in response to other inducers of monocyte differentiation, but not an inducer of granulocyte differentiation (6). MCL1 expression can also be induced in other cell lines of myeloid origin, such as HL-60, THP-1, U-937, and K-562, and has recently been shown to increase in response to the myelomonocytic growth factor, granulocyte/macrophage-colony-stimulating factor (GM-CSF) (9). The high levels of expression seen in induced cell lines has a counterpart in the bone marrow in vivo, where MCL1 expression is high in myeloid cells at early stages of differentiation (10). Overall, MCL1 is a readily inducible gene in a variety of myeloid systems, prominently expressed at immature stages of differentiation.

Gene transfer experiments have demonstrated that MCL1 has viability-enhancing effects. Thus, MCL1 was transfected into a murine myeloid progenitor cell line, FDC-P1, as the ML-1 human myeloid cell line from which the gene was isolated cannot be transfected in a stable fashion. Here, MCL1 was found to prolong the survival of cells exposed to a variety of apoptosis-inducing stimuli (4). Similar effects were seen in Chinese hamster ovary cells (2, 3). Interestingly, these effects were of short duration, cells expressing the transfected MCL1 gene product living about twice as long as controls but not as long as cells transfected with BCL2 (2). Short term viability-enhancing effects, very similar to those seen in transfected cell lines, have also recently been observed in lymphoid cells from MCL1 transgenic mice (11). In other experiments, MCL1 was found to be a rapidly turned over PEST protein (half-life of <3 h), providing another contrast to the more stable BCL2 protein (Ref. 5 and references therein). Taken together, these findings led us to hypothesize that MCL1 may serve as a mediator of cell viability that can be rapidly induced, albeit in some cases for short term effects, at specific stages in the cell life cycle, as exemplified by the increase seen in early monocytic differentiation.

MCL1 exhibits a differentiation stage-specific pattern of expression in lymphoid as well as myeloid cells. For example, in B cells at early stages of immortalization with an Epstein-Barr virus gene product, MCL1 expression increases rapidly and transiently (12). This increase precedes a stable increase in BCL2 and thus has again been postulated to mediate short-term protection of viability. MCL1 expression also increases in response to a variety of B cell growth, differentiation, and activation factors (13, 14). For example, MCL1 expression is selectively increased during interleukin-6-induced differentiation of Epstein-Barr virus-immortalized cells and is subsequently decreased as differentiated cells undergo apoptosis (15). Likewise, in peripheral blood lymphocytes placed in tissue culture, MCL1 (but not BCL2) expression correlates with survival and loss of MCL1 expression with apoptosis (16). In lymphoid tissues in the intact animal, MCL1 expression is abundant in the germinal center, where cells proliferate and undergo affinity maturation, but is scant in the small, resting cells in the mantle zone (10). BCL2 demonstrates the opposite pattern, expression being low in germinal centers and abundant in the mantle zone. Overall, MCL1 exhibits a highly regulated pattern of expression, different from that of BCL2, in a variety of hematopoietic cells. Opposing patterns of expression of MCL1 and BCL2 can also be seen in non-hematopoietic tissues, as in a variety of epithelial tissues where BCL2 is expressed at immature and MCL1 at mature stages of differentiation (10).

We have been studying the mechanisms that underlie the rapid inducibility and highly regulated pattern of expression of MCL1, using human hematopoietic cell lines that can be induced to differentiate with TPA as a model. Our previous studies showed that the increase in MCL1 expression involves an increase in transcription but does not require new protein synthesis (6). Recent studies further showed that the signal for increased MCL1 expression is transduced through the ERK branch of the MAP kinase family (17). This signaling pathway is involved both in maintaining basal MCL1 expression and in bringing about the increased expression seen in response to TPA. Thus, cells treated with a specific, non-toxic inhibitor of this pathway (PD 98059 (18)) exhibit a decrease from the already low base-line MCL1 levels, and cells treated with PD 98059 plus TPA exhibit MCL1 levels in the range of those seen in untreated control cells.

Two lines of evidence indicate that, while the base-line levels of MCL1 in ML-1 and other immature hematopoietic cell lines are below the threshold necessary for effects, the increased levels seen in cells exposed to TPA contribute to viability enhancement. First, gene transfer experiments showed that low levels of MCL1, in the range of the base-line level in the cell lines, had marginal if any effects; in contrast, higher levels, in the range of those seen after TPA treatment, promoted cell viability (4). Second, use of PD 98059 to inhibit MCL1 expression yielded the following results (17). When the inhibitor was applied alone, a further decrease from the already low basal MCL1 level occurred but was not accompanied by cell death, indicating that this low level does not contribute to the maintenance of viability. When the inhibitor was applied in conjunction with TPA, MCL1 was expressed at a level equivalent to the low basal level in untreated control cells (instead of an ~10-fold higher level), and cells died by apoptosis rather than undergoing differentiation. These observations bolstered the hypothesis that, in immature myeloid cells, up-regulation of MCL1 serves to enhance cell viability during the initiation of differentiation (17).

The research described here was aimed at building on previous work on the signal transduction pathway (17), by identifying transcription factors involved in regulating MCL1. Of particular interest were factors meaningful in terms of regulation for anti-apoptotic effects, such as those that contribute to the TPA-induced 7-10-fold increase from a subthreshold basal level to a level capable of promoting viability. Initially, a 162-bp segment of the human MCL1 5'-flank was found to mimic, in transient reporter assays, the behavior of the endogenous gene (i.e. activity was increased 10-fold by TPA, and this increase was inhibited by PD 98059). The transcription factors SRF and Elk-1 bound to cognate sites within this segment (in the vicinity of bp -107), and Sp1 bound to a site between the other two. Inactivation of the SRF and Ets sites resulted in reporter activity in the presence of TPA that was 7-11-fold lower than that of the wild-type plasmid (i.e. it was in the range of wild-type activity in the absence of TPA). This was analogous to the previous finding that inhibition of the ERK pathway resulted in endogenous MCL1 expression in the presence of TPA being maintained at untreated control levels, which were below the threshold for anti-apoptotic effects (17). The present and previous (6, 9) findings indicate that MCL1 expression is increased by various agents that promote the viability and proliferation/differentiation of cells at immature stages of myelomonocytic differentiation. The mechanism of MCL1 up-regulation by one of these agents, TPA, involves signal transduction through ERKs and transcriptional activation by SRF and Elk-1. This finding provides a parallel to early response genes such as c-FOS and EGR1, which influence the commitment of immature myelomonocytic cells to maturation (20-23). Regulation of MCL1 through a similar mechanism therefore suggests a means through which enhancement of viability may be linked to the induction of differentiation.

    EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Cell Culture and Induction of MCL1 Expression-- Human myeloblastic ML-1 cells were grown in Roswell Park Memorial Institute (RPMI; BioWhittaker) 1640 medium supplemented with 7.5% fetal bovine serum (FBS). These cells were maintained by subculturing 3 times weekly to a density of 3 × 105 cells/ml. Human erythroleukemia K-562 cells were grown in RPMI 1640 media supplemented with 10% FBS, 100 units/ml penicillin, and 100 µg/ml streptomycin. These cells were maintained by subculturing to a density of 2 × 105 cells/ml. Ramos (Epstein-Barr virus-negative) Burkitt lymphoma cells, obtained from Dr. William Wade (Dartmouth Medical School, Lebanon, NH), were grown in RPMI 1640 supplemented with 10% FBS (Biocell catalog number 6201-00, lot number 2757). These cells were maintained by subculturing every 2 days to a density of 5 × 105 cells/ml. Sort10 is a derivative of HL-60 (the latter being a cell line that is similar to ML-1 in lineage and differentiation stage but that can be stably transfected in some cases), where Sort10 has been transfected with and selected for high levels of expression of the receptor for macrophage colony-stimulating factor. HL-60 and Sort10 were maintained as described (24, 25).

Construction of a Reporter Plasmid Deletion Series-- A 1.7-kilobase pair XbaI/XbaI human MCL1 genomic fragment representing bp -1656 to bp +160 (where +1 denotes the major transcriptional start site), along with a 14-bp adapter ligated to its 3' end to place the luciferase gene in the correct reading frame, was inserted into the NheI- and HindIII-digested pGL2-Basic luciferase reporter vector (Promega, Madison, WI), yielding p(-1656)MCL1luc. A series of 5'-deleted plasmids were constructed by double digestion of p(-1656)MCL1luc with SmaI (which cuts just upstream of the MCL1 insert) and restriction enzymes known to cut at unique sites within the MCL1 insert. Religation resulted in the production of plasmids containing 1308, 847, 703, 577, 290, and 162 bp of MCL1 5'-flanking sequence. Additional plasmids were constructed using the polymerase chain reaction (PCR) (p(-107)MCL1luc, p(-51)MCL1luc, and p(+11)MCL1luc), where the PCR products were sequenced to confirm their identity.

Site-directed Mutagenesis-- Specific mutations were introduced into the p(-162)MCL1luc plasmid using a two-stage PCR method described elsewhere (29). The Ets site at bp -129 to bp -121 was converted from CCGGAAGC to CCTTAAGC; the Sp1 site at bp -118 to bp -113 was converted from CCGCCC to CTGACC; and the SRE at bp -106 to -97 was converted from CCTTTTATGG to CCTTCGGCTG, where altered nucleotides are indicated in bold type. The specific point mutations used were chosen based on previous findings (30-32), and all mutations were verified by sequencing. The PCR products containing the desired mutations were digested with BstEII and EcoRI and ligated into the p(-162)MCL1luc plasmid that had been digested with the same enzymes.

Electroporation and Transient Luciferase Expression Assay-- A battery of cell lines of myeloid origin was tested for suitability for use in transient transfection with MCL1-luciferase reporter constructs. Upon testing of ML-1, U-937, THP-1, Namalwa, and K-562 cells, K-562 stood out as demonstrating readily detectable basal luciferase activity, as well as induction by TPA that was in the range of the ~10-fold increase seen endogenously. In the other cell lines, basal luciferase activity was lower than in K-562 but could be optimized; however, TPA did not elicit a reproducibly robust response, producing at most a 2-3-fold increase in luciferase activity. (Note, TPA did elicit a response with a pCMVluc plasmid used as a positive control.) The reason for the poor TPA responsiveness of MCL1 reporter plasmids was further investigated in ML-1 cells, which would have been the first choice of cell line for the present studies as it was utilized for many previous studies (1, 5, 6). To this end, the effect of electroporation on TPA-induction of the endogenous MCL1 gene was monitored, as a robust response was known to occur. It was found that induction was not inhibited by carrying out the electroporation protocol in the absence of plasmid DNA. However, induction was inhibited upon electroporation in the presence of plasmid DNA, an effect that was observed even with the insert-less pGL2-Basic control plasmid. Decreasing the amount of plasmid DNA minimized the inhibition of induction but resulted in a decrease in luciferase activity to below the level of detection. In sum, although electroporation conditions could be optimized to test for basal expression in other myeloid cell lines besides K-562, these lines could not be practically used for the identification of elements involved in induction by TPA. Such difficulties are not uncommon with immature human myeloid cell lines (33).

Electroporation was therefore carried out with K-562 cells using the following protocol, which was based on preliminary experiments aimed at optimizing luciferase activity. Cells were washed twice and resuspended in phosphate-buffered saline (5 × 106 cells in 0.5 ml) in the presence of a luciferase reporter plasmid (10 µg), along with the pCMVhGH internal control plasmid used in most experiments (10 µg; described further below). After incubation on ice for 10 min, cells were subjected to electroporation (960 microfarads and 280 V; Bio-Rad Gene Pulser), placed on ice for 15 min, and then incubated at 37 °C (1 × 105 cells/ml) in Iscove's modified Dulbecco's media supplemented with 10% FBS, 100 units/ml penicillin, and 100 µg/ml streptomycin. After 17 h, the cell suspension was divided into two portions, one of which was left untreated and the other of which was exposed to TPA (1.7 × 10-9 M, a concentration found to increase MCL1 expression in K-562 cells in a manner equivalent to the effect seen with 5 × 10-10 M TPA in ML-1 cells). After 7 h of exposure to TPA (a time point where induction was found to be at or near a peak), cells were washed with phosphate-buffered saline prior to assay of luciferase activity (relative light units), in triplicate, essentially as described previously (34), using a Microlite ML2250 Microtiter plate luminometer (Dynatech Laboratories, Chantilly, VA).

In most experiments, a human growth hormone reporter plasmid, pCMVhGH, was used as a control for transfection efficiency (10 µg; obtained from Dr. Daniel Tenen, Beth Israel Hospital, Boston). The choice of the pCMVhHG plasmid (and protocol and reagents from Nichols Institute Diagnostics (San Juan Capistrano, CA)) was based on a series of tests of several possible plasmids, where beta -galactosidase-based plasmids and the TKhGH plasmid were not found to be useful as their activity in the above human myeloid cell lines was close to the level of sensitivity of the respective assays. pCMVhGH yielded a linear increase in activity upon transfection with 2-10 µg of plasmid, where activity with 2 µg of plasmid was near the limit of sensitivity of the hGH assay, but activity with 5-10 µg was sufficiently above background to be accurately quantifiable. Co-transfection with 5-10 µg of pCMVhGH did not decrease the basal (no TPA) activity of luciferase reporter plasmids; this caused only a minor reduction in the induction of luciferase activity by TPA (e.g. from ~13.5-to ~10.5-fold in an experiment examining p(-162)MCL1luc and p(-1663)MCL1luc in the absence versus the presence of pCMVhGH), which was deemed acceptable considering the potential disadvantage of not using an internal control plasmid. The experimental design described above (33), where an aliquot of cells electroporated with a given test plasmid was divided into two portions one of which was exposed to TPA and the other of which was not, was chosen because cytomegalovirus-based plasmids are themselves subject to induction by TPA. With this design, cells exposed versus not exposed to TPA were derived from the same initial aliquot of electroporated cells and thus did not differ substantially in transfection efficiency. Luciferase activity in both portions of cells was then normalized to hGH production as assayed in triplicate in the portion of the sample not exposed to TPA. As it turned out and as is described in individual figure legends, analysis with or without normalization for transfection efficiency did not affect the interpretation of the results.

Electrophoretic Mobility Shift Assays (EMSAs)-- The sense strand sequences of the oligonucleotides used are shown below. The WT MCL1 oligonucleotide used as a probe represents bp -135 to bp -92 of the MCL1 5'-flank, which contains potential binding sites for SRF, Ets, and Sp1. The Delta MCL1 oligonucleotide contains mutations in all three of these sites, as indicated in bold and underlined below. Oligonucleotides were prepared by Life Technologies, Inc., except for the Sp1 oligonucleotide which was from Santa Cruz Biotechnology, Inc. WT MCL1, CAACCCTCCGGAAGCTGCCGCCCCTTTCCCCTTTTATGGGAATA; Delta MCL1, CAACCCTCCTTAAGCTGCTGACCCTTTCCCCTTCGGCTGGAATA; Sp1, ATTCGATCGGGGCGGGGCGAGC; c-FOS SRE, CTTACACAGGATGTCCATATTAGGACATCT.

Nuclear extracts were prepared essentially as described previously (35), and protein content was determined using the Bio-Rad Protein Assay kit with bovine serum albumin as a standard. EMSAs were also performed as described previously (32, 36). In assays where unlabeled oligonucleotides (10- or 100-fold molar excess) or antibodies directed against SRF, Elk-1, SAP-1a, or Sp1 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) were tested, these were added to the binding reaction prior to the addition of nuclear extract. The antibodies used in most experiments were chosen as antibodies that would not interfere with the factor binding to DNA, except in one experiment in which an anti-Sp1 antibody that interferes with DNA binding was used for that purpose. This latter antibody was the 1C6 antibody (Santa Cruz Biotechnology, catalog number sc-420) which recognizes an epitope corresponding to amino acid residues 520-538 of Sp1, where the DNA binding domain corresponds to residues 537-619.

Western Blotting-- Western blotting was carried out as described previously, except that a monoclonal, instead of the previously used polyclonal (5), antibody was used. The monoclonal antibody was produced by Dr. Chi-Yu Gregory Lee (Vancouver Biotech LTD, Vancouver) using a bacterially produced N-terminally His-tagged MCL1 protein. Quantitation by densitometric scanning was carried out as described previously (17). This antibody is being described elsewhere.

Statistical Analysis-- The results from assays of luciferase activity were analyzed using analysis of variance with post-hoc Sheffe testing (Systat 5 for the Macintosh). Results were converted to natural logarithmic values for this analysis. Two-way analysis of variance (plasmid × drug) was used to analyze relative luciferase activity. One-way analysis of variance was used to compare the fold increase with TPA among plasmids.

    RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References

A 162-bp Segment of the MCL1 5'-Flank Mediates Transcriptional Induction by TPA and Its Suppression by an Inhibitor of the ERK Pathway-- p(-1656)MCL1luc, a luciferase reporter plasmid under the control of a genomic fragment containing 1656 bp of human MCL1 5'-flanking DNA (Fig. 1A), was introduced into the K-562 transfection system (described under "Experimental Procedures"). Luciferase activity was detectable in the absence of TPA and was increased ~10-fold in its presence (Fig. 1B). Thus, elements within p(-1656)MCL1luc directed both basal MCL1 transcription and induction by TPA.


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 1.   A 162-bp region of the human MCL1 5'-flank directs basal expression and TPA-inducible, ERK-dependent up-regulation. A, reporter plasmids representing serial deletions of the MCL1 5'-flank in pGL2-Basic. Plasmid nomenclature indicates the amount of MCL1 5'-genomic flanking sequence (bp) present, where the major start site of MCL1 transcription (designated as +1) is marked with an arrow. The p(+11)MCL1luc plasmid contains a segment of DNA representing bp +11 to bp +160 of the MCL1 5'-untranslated region, which is present in all plasmids in the series. B, retention of full activity with reporter plasmids containing 162 bp of the MCL1 5'-flank. Reporter plasmids (10 µg) containing deletions to bp -162 were electroporated into K-562 cells, and luciferase activity was assayed in the absence or presence of TPA (with normalization based on co-transfection with pCMVhGH, as described under "Experimental Procedures"). Relative luciferase activity represents the ratio of the normalized activity of each sample to that of the longest plasmid in the series (p(-1656)MCL1luc) assayed in the absence of TPA. The values shown are the mean ± S.E. of 5-6 independent experiments, where the mean values are also listed on the graph. The relative luciferase activity of the pGL2-Basic insert-less control vector averaged 0.005 ± 0.002 (S.E.) and 0.006 ± 0.002 in the absence and the presence of TPA, respectively. A pCMVluc plasmid (2 µg), assayed as a positive control alongside the test samples, yielded a relative luciferase activity of 0.9 ± 0.2 and 105 ± 11 in the absence and presence of TPA, respectively. The results of these experiments were identical when analyzed with normalization for transfection efficiency (as shown) or without normalization; for example, when the calculations were performed without normalization, the basal luciferase activity of plasmids between p(-1656)MCL1luc and p(-162)MCL1luc averaged 1.3-fold (±0.1; S.E.) that of p(-1656)MCL1luc, and this value was increased to 12.7-fold (±0.85) in the presence of TPA. The coefficient of variation for the normalized values shown averaged 0.31 (±0.05; S.E.) and that for the values calculated without normalization averaged 0.36 (±0.04). In additional experiments in which only p(-1656)MCL1luc and p(-162)MCL1luc were assayed, either with or without the co-transfected pCMVhGH plasmid, the ratio of the activity of p(-162)MCL1luc to that of p(-1656)MCL1luc averaged 1.88 (with or without the co-transfected plasmid), induction with TPA averaging 13.2-fold (±1.2; S.E.) in the absence of the co-transfected plasmid and 10.9-fold (± 1.4) in its presence. Statistical analysis revealed that the effect of TPA was significant in each case (p < 0.001) but that the different plasmids did not differ from each other either in the absence or in the presence of TPA. C, inhibition of MCL1 reporter plasmid activity in the presence of an inhibitor of ERK activation. After electroporation with the indicated plasmids (at 15.5 h), K-562 cells were either exposed or not exposed to PD 98059 (100 µM) for 1.5 h and then either exposed or not exposed to TPA for an additional 7 h. Luciferase activity was calculated as in B except that normalization with pCMVhGH was not carried out, and the activity of each plasmid (p(-1656)MCL1luc or p(-162)MCL1luc which were assayed in separate experiments) was calculated relative to the untreated control for that plasmid. The values shown are the mean ± S.E. of 2-3 experiments with 1-3 replicates per experiment.

To determine whether a shorter segment of the MCL1 5'-flank could similarly direct transcription, transfections were carried out with a series of plasmids representing progressive 5' deletions of p(-1656)MCL1luc. A plasmid containing 162 bp of the MCL1 5'-flank, p(-162)MCL1luc, was found to have activity equivalent to that of the full-length plasmid, with some intermediately truncated plasmids exhibiting slightly, but non-significantly, higher activity. The activity of all these plasmids was increased ~9-11-fold in the presence of TPA, mimicking the increase seen in endogenously expressing hematopoietic cell lines (1, 6). p(-162)MCL1luc and p(-1656)MCL1luc were also transfected into ML-1 and U-937 cells, myeloid cell lines where basal activity (but not induction by TPA; see "Experimental Procedures") could be measured reliably; here also, the basal activity of p(-162)MCL1luc was in the range of that seen with p(-1656)MCL1luc, the ratio of the activity of the former plasmid to the latter being 1.0 ± 0.2 (S.E.; n = 3) in ML-1 and 1.3 in U-937 cells. Overall, K-562 cells transiently transfected with a reporter plasmid containing 162 bp of the MCL1 5'-flank appeared to constitute a workable system for identifying elements involved in maintaining basal levels MCL1 transcription and in bringing about the ~10-fold increase in transcription that occurs in response to TPA.

The PD 98059 inhibitor of ERK activation (18) was also applied to the above K-562 cell transfection system, to determine whether the effect would be similar to that observed in the case of endogenously expressed MCL1. This inhibitor was found to substantially, but not completely, inhibit the TPA-induced increase in luciferase activity (Fig. 1C). This was similar to the previous findings showing PD 98059 to substantially, but not completely, inhibit TPA-induced endogenous MCL1 expression (17). The inhibitor also caused some decline in basal activity in transfected cells, an effect that had likewise been noted in the case of endogenous expression. Overall, transfected cells exposed to PD 98059 exhibited inducibility by TPA that was only about one-third that seen in cells not exposed to the inhibitor (2.7-3.7-fold induction over the reduced basal activity in the presence of the inhibitor as compared with 7.6-11.8-fold induction in its absence). Thus, transfection with p(-1656)MCL1luc or p(-162)MCL1luc paralleled endogenous expression both in TPA inducibility and in the substantial suppression of this inducibility seen in the presence of an inhibitor of ERK activation.

Truncation of the MCL1 5'-Flank to bp -107 Results in Decreased Transcriptional Activity in the Absence and Presence of TPA-- Further truncated plasmids were next tested to determine whether these might point to a region of particular interest within the 162-bp MCL1 5'-flanking segment. Truncation to bp -107 was found to result in a substantial, but not a complete, loss of activity in both the absence and presence of TPA (Fig. 2A), a finding that was reminiscent of those above on the effect of PD 98059 on the activity of longer plasmids. When compared in the absence of TPA, the activity of p(-107)MCL1luc was 20% that seen with p(-162)MCL1luc. When compared in the presence of TPA, the activity of p(-107)MCL1luc was <10% that seen with p(-162)MCL1luc. Further truncation to bp -51 resulted in a further loss of activity (to ~5% of the basal activity of p(-162)MCL1luc), and a complete loss was seen upon elimination of all MCL1 5'-flanking sequence. Thus, the bp -162 to -107 region was important for, although not the only region contributing to, both basal transcription and the elevated transcription seen in the presence of TPA.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 2.   SRE and Ets sites in the -107-bp region of the human MCL1 5'-flank influence basal and TPA-induced transcription, an Sp1 site between these two affecting basal activity only. A, reduction in transcriptional activity in the absence and presence of TPA upon truncation of the MCL1 5'-flank to bp -107. Transfections were carried out as in Fig. 1B using reporter plasmids deleted to bp -107 and beyond. Relative luciferase activity represents the ratio of the normalized activity of each sample to that of p(-162)MCL1luc assayed in the absence of TPA. The values shown are the mean ± S.E. of five independent experiments, where the mean values are also listed on the graph. The relative luciferase activity of the pGL2-Basic insert-less control vector averaged 0.006 (±0.004; S.E.) and 0.008 (±0.003) in the absence and the presence of TPA, respectively. A pCMVluc plasmid (2 µg), assayed as a positive control alongside the test samples, yielded a relative luciferase activity of 0.7 (±0.1) and 100 (±30) in the absence and presence of TPA, respectively. The results of these experiments were identical when analyzed with normalization for transfection efficiency (as shown) or without normalization; when the calculations were performed without normalization, the relative luciferase activity of p(-107)MCL1luc and p(-51)MCL1luc in the absence of TPA averaged 0.2 (±0.02; S.E.) and 0.05 (±0.01), respectively, and these values were increased to 0.83 (±0.11) and 0.14 (±0.04) in the presence of TPA. Induction by TPA averaged 3.6- (±0.4; S.E.) and 3.0 (±0.2)-fold with p(-107)MCL1luc and p(-51)MCL1luc, respectively, as compared with the average 12.7-fold induction seen with p(-162)MCL1luc. B, potential cis-regulatory elements in the -107-bp region of the 5'-flank of MCL1. Bold lettering indicates potential Ets-, Sp1-, and SRE-like transcription factor binding sites identified using the MatInspector (57) and TRANSFAC data bases. These sites are shown in p(-162)MCL1luc, which contains 162 bp of MCL1 5'-flanking sequence as well as 160 bp of downstream sequence (+1 indicates the major transcriptional start site). The sites of further deletion in the plasmids p(-107)MCL1luc, p(-51)MCL1luc, and p(+11)MCL1luc are indicated with filled arrows, as is the translation start site. Direct repeats in the region of the SRE are marked with open arrows (CCCCTTT on the coding strand) and elements with dyad symmetry character (6 out of 7 bp) are underlined on the coding strand (TTCCCCT; ATGGGAA). Two adjacent initiator sequences (YYAX(T/A)YY) at the major start site of transcription are marked by bold overlining. The asterisks mark the first and last nucleotides of the oligonucleotide probe used in Fig. 3. C, effect of mutation of the SRE, Ets, and Sp1 sites in the bp -107 region of the MCL1 5'-flank. p(-162)MCL1luc-based reporter plasmids containing inactivating mutations in the Sp1 and SRF and/or Ets sites were assayed for relative luciferase activity in the absence or presence of TPA as in Fig. 1B. Relative luciferase activity was defined as the ratio between the normalized activity of the mutated plasmid and that of wild-type p(-162)MCL1luc. The values shown are the mean ± S.E. of three independent experiments, where the mean values are also listed on the graph, except in the case of the Delta Sp1 plasmid where an additional experiment was carried out with six replicate samples along with three wild-type controls. A pCMVluc plasmid (2 µg), assayed as a positive control alongside the test samples, yielded a relative luciferase activity of 0.8 (±0.1; S.E.) and 60 (±5) in the absence and presence of TPA, respectively. The relative luciferase activity of pGL2-Basic averaged 0.0005 (±0.0006) and 0.0025 (±0.001) in the presence and absence of TPA, respectively. The basal activity of the Delta SRE and Delta SRE/Delta Ets mutant plasmids was found to be significantly different from that of wild-type plasmid (p < 0.05). All plasmids demonstrated a significant increase in the presence of TPA as compared with the corresponding non-TPA-treated samples (p < 0.005). This increase averaged 9.0- (±0.4; S.E.), 4.7- (±0.2), 3.0- (±0.63), and 4.1 (±0.7)-fold with the Delta Sp1 plasmid, Delta SRE, Delta Ets, and Delta Ets/Delta SRE plasmids, respectively. There was no significant difference between the Delta SRE, Delta Ets, and Delta SRE/Delta Ets plasmids in the fold increase observed with TPA, although the fold increase with these three differed from that seen with p(-162)MCL1luc and the Delta Sp1 plasmid. The activity of the Delta SRE, Delta Ets, and Delta SRE/Delta Ets plasmids in the presence of TPA did not differ from that of the wild-type p(-162)MCL1luc plasmid in the absence of TPA (p > 0.3). The abovementioned additional experiment with the Delta Sp1 plasmid was carried out as it was not clear from the initial experiment whether this mutation resulted in any significant change. In this experiment, the basal activity of the Delta Sp1 plasmid differed significantly from the basal activity with p(-162)MCL1luc (p < 0.001).

With p(-107)MCL1luc and similarly with p(-51)MCL1luc, the activity seen in the presence of TPA represented an ~3.5-fold increase over the corresponding reduced basal value, which contrasted with the 10-12-fold induction seen with longer plasmids and thus represented a fold increase of only approximately one-third of the maximum value. In sum, truncation to bp -107 resulted in reduced basal activity and reduced induction in the presence of TPA; the net result was that activity with the truncated p(-107)MCL1luc plasmid in the presence of TPA was only in the range of that seen with the longer p(-162)MCL1luc plasmid in the absence of TPA.

In the -162 to -107-bp region, the human MCL1 5'-flank contains potential Ets- and Sp1-like sites, with a potential SRE lying immediately downstream (Fig. 2B). The presence of Ets and SRF sites provided a parallel to the dyad symmetry region in c-FOS and suggested that MCL1 might be regulated through an SRF/Ets-mediated mechanism similar to that utilized by early response genes. TPA-induced c-FOS transcription is activated by MAP kinase, which phosphorylates the Ets component of an SRF·Ets complex (Refs. 19 and 37-40 and references therein). Such a mechanism would be compatible with the previous finding of ERK involvement in the MCL1 signal transduction pathway. It would also be compatible with the reduced induction seen with p(-107)MCL1luc, which retains the potential SRE but not the upstream Ets site.

Present and previous data were further considered in the light of the hypothesis that a MAP kinase/SRF/Ets-mediated mechanism might play a role in the regulation of MCL1; the purpose here was to make a judgment as to whether assessing these sites took priority over testing other potential downstream areas. A mechanism involving signal transduction through ERKs and transcriptional activation by SRF/Ets could potentially account both for the changes observed in transfected cells upon truncation to bp -107 (Fig. 2A) or upon exposure of longer plasmids to PD 98059 (Fig. 1C), as well as the changes seen in endogenously expressing cells upon inhibition of ERK activation (17). In point of fact, the changes observed in cells transfected with p(-107)MCL1luc and those observed in cells endogenously expressing MCL1 and exposed to an inhibitor of the ERK pathway exhibited striking similarities. Thus, paralleling the fact that both basal and TPA-induced expression were decreased upon truncation to bp -107 in transfection experiments (Fig. 2A), both were comparably decreased upon inhibition of the ERK pathway in endogenously expressing cells (17). Neither was completely eliminated, TPA causing reduced induction over a reduced basal value upon truncation to bp -107 (Fig. 2A) or upon ERK inhibition (17), with the reduced induction in both cases being in the range of 3.5-fold. As a result, just as the activity of p(-107)MCL1luc in the presence of TPA was equivalent to that of p(-162)MCL1luc in its absence, endogenous MCL1 expression in cells exposed to PD 98059 plus TPA was in the range of the basal level present in untreated control cells (17). The parallels between these two systems lent credence to the possibility that a common underlying pathway might be at work. We therefore directed our attention to the potential SRE and Ets sites, and the Sp1 site between them, in the -107-bp region of the MCL1 5'-flank.

The Coordinate Actions of SRF and Ets Are Required for Maximal Induction of MCL1 by TPA, both SRF/Ets and Sp1 Contributing to Basal Activity-- To assess the functionality of the SRE, Ets, and Sp1 sites, inactivating alterations were introduced into these sites in the context of p(-162)MCL1luc. Alteration of the SRE, with or without alteration of the Ets site, reduced but did not eliminate basal activity and reduced but did not eliminate induction by TPA (Fig. 2C). Reduced activity was seen with the Delta SRE and Delta Ets single mutant plasmids as well as with the Delta SRE/Delta Ets double mutant; thus, the coordinate actions of SRF and Ets were required for maximal activity, as is the case for TPA-induced activation of c-FOS (19). Alteration of the Sp1 site also reduced but did not eliminate basal activity; however, it did not substantially decrease the 9-fold induction seen in the presence of TPA in this experiment. Overall, the SRE and Ets sites were necessary for, and acted coordinately to produce, maximal basal activity and maximal induction by TPA. The Sp1 site was necessary for maximal basal activity but not for induction by TPA.

The activity of the Delta SRE/Delta Ets double mutant plasmid in the presence of TPA was in the range of that of the wild-type p(-162)MCL1luc plasmid in its absence. This result was reminiscent of the previous observations with p(-107)MCL1luc, although the wild-type plasmid exhibited slightly lower induction by TPA in the present experiments than it had previously (Fig. 2, A versus C). Additional experiments with the Delta SRE/Delta Ets plasmid showed that, on average, basal activity was decreased by about two-thirds (Table I row IIA), and the fold induction by TPA above this reduced basal value was decreased by nearly an equivalent proportion, from a value of ~11- to ~4-fold (Table I row IIB and C). These observations paralleled the experiments involving truncation to bp -107, where the fold induction by TPA was also reduced by approximately two-thirds (Table I row IIIB and C and Fig. 2A); here, basal expression was reduced by slightly more than two-thirds (Table I row IIIA), which could relate to the fact that the Sp1 site is not present in the truncated plasmid. These findings also paralleled the experiments with wild-type plasmids in the presence of PD 98059, where a two-thirds reduction in fold induction by TPA was also seen (Table I rows IVC and D); in this case, basal activity was not reduced as much as in the other experiments (Table I compare row IVA to rows IIA and IIIA). This is probably due to the fact that PD 98059 was added 1.5 h before the addition of TPA (15.5 h after electroporation, Fig. 1C), in an experimental design focused on the effect of PD 98059 on induction by TPA above a pre-existing basal level; this design paralleled exactly the design used in previous experiments on endogenous MCL1, where a basal level of expression is present before TPA addition (17). Thus, in the transient transfections, the decline in basal activity seen in the presence of PD 98059 represented that occurring from 15.5-24 h (Table I row IVA and Fig. 1C), whereas the decline with the p(-107)MCL1luc or Delta SRE/Delta Ets plasmids reflected the entire 24-h plasmid expression period (Table I rows IIA and IIIA and Fig. 2, A and C). One additional point is that basal activity in the presence of PD 98059 was also not reduced as much in transiently transfected cells (Table I row IVA and Fig. 1C) as in endogenously expressing cells (where basal expression decreased to ~25% of the value in the absence of PD 98059 over the 8.5-h assay period), although in both systems induction by TPA was reduced to ~3.5-fold (17). This probably relates to the fact that the effect of PD 98059 on basal expression in transient transfections reflects loss of luciferase, whereas in endogenously expressing cells it reflects loss of the MCL1 protein. This latter difference notwithstanding, a common theme was noted in experiments involving truncation to bp -107, alteration of the SRE and Ets sites, or application of PD 98059 to cells transfected with wild-type plasmids or even cells endogenously expressing MCL1, as these experiments all demonstrated a loss of about two-thirds of the TPA inducibility (to 3-4-fold induction) above a reduced level of basal activity.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Comparison of deletion of the MCL1 5'-flank to bp -107, mutation of the SRE/Ets sites, or exposure of the unaltered reporter plasmid to PD 98059

SRF, Elk-1, and Sp1 Bind to the Cognate Sites in the -107-bp Region of the MCL1 5'-Flank-- EMSAs were carried out with a probe containing the Ets, SRF, and Sp1 sites in the -107-bp region of the MCL1 5'-flank to test for the binding of specific nuclear proteins. Four major complexes formed, and proteins present in two of these could be identified definitively: complexes I and II clearly represented specific binding, as their formation was inhibited by excess unlabeled competitor probe but not by a competitor in which the three sites had been altered (Fig. 3A). Complex I (but not complex II) was also inhibited by a competitor representing the c-FOS SRE and Ets site (Fig. 3, B and C, compare lanes 10 and 11 to lane 2), whereas complex II (but not complex I) was inhibited by a competitor representing a consensus Sp1-binding site (Fig. 3, B and C, compare lanes 7 and 8 to lane 2). Thus, complex I appeared to contain SRF and/or an Ets protein while complex II contained Sp1. The formation of these complexes was not substantially altered when TPA-treated versus untreated cells were used (Fig. 3A). With other genes regulated by SRF and Ets, stimulated versus unstimulated cells frequently demonstrate identical EMSA complexes (37, 41, 44, 45), probably because the prebound SRF·Ets complex may be activated upon stimulation (19, 37), as mentioned above and discussed further below.


View larger version (67K):
[in this window]
[in a new window]
 
Fig. 3.   Serum response factor, the Elk-1 member of the Ets family, and Sp1 bind to cognate sites in the -107-bp region of the human MCL1 5'-flank. A, formation of specific EMSA complexes with a probe representing the -107-bp region of the MCL1 5'-flank. Nuclear extracts from K-562 cells that had either been left untreated (U) or treated with TPA (T; 1.7 × 10-9 M) were used in EMSAs with a probe representing bp -135 to bp -92 of the MCL1 5'-flank (probe is indicated with asterisks in Fig. 2B). Unlabeled (cold) competitor nucleotides were either not added (none; lanes 1, 2, and 7, where free probe was run in lane 1) or added at a 10- or 100-fold molar excess as indicated, where the WT MCL1 oligonucleotide (lanes 3, 4, 8, and 9) was identical in sequence to the probe and the Delta MCL1 oligonucleotide (lanes 5, 6, 10, and 11) contained mutations in the Ets, Sp1, and SRF sites. Material migrating more rapidly than complex IV, as well as material at the top of the gel, did not display any distinctive pattern suggestive of a role in regulation. B-D, presence of Elk-1/SRF and Sp1 in complexes I and II demonstrated by oligonucleotide competitor and gel shift analysis. EMSAs were carried out as in A in the presence of either additional competitor oligonucleotides or antibodies to transcription factors. The additional competitors used included an oligonucleotide containing a consensus Sp1-binding site (B and C, lanes 7 and 8), as well as one containing the c-FOS SRE and adjacent Ets-binding site (B and C, lanes 10 and 11). The antibodies (Ab.) used were directed against Sp1, SRF, Elk-1, or Sap-1a (B and C, lanes 9, 12, 13, and 14, respectively), or against a region directly adjacent to the Sp1 DNA-binding domain (DBD; D). The EMSAs shown in B utilized untreated cells and that shown in C utilized cells treated with TPA for 60 min, where identical results were obtained with cells treated with TPA for 30 min. A heavily exposed autoradiograph is shown in B as this facilitated confirmation of the appearance of supershifted complex I material in lanes 12 and 13 (marked with squares to the right of these lanes).

The presence of SRF/Ets and Sp1 in complexes I and II, respectively, was confirmed using antibodies specific for these factors. Antibodies recognizing either SRF or the Elk-1 member of the Ets family caused complex I to supershift, whereas an antibody recognizing Sap-1a did not (Fig. 3, B and C, lanes 12-14; supershifted bands are indicated with squares in Fig. 3B). Similarly, an antibody recognizing Sp1 caused complex II to supershift (Fig. 3, B and C, lane 9). Here, the supershifted complex migrated at the same position as complex I. Therefore, another antibody recognizing Sp1 was also utilized, in this case an antibody that interferes with the binding of Sp1 to its cognate site in DNA. This antibody decreased the formation of complex II (Fig. 3D; see disappearance of complex II in the last lane where the antibody was added, as compared with the middle lane where the antibody was not added); this was consistent with the ability of this antibody to block Sp1 DNA binding, confirming the presence of Sp1.

Complex IV appeared to be a nonspecific band, as it could be partially inhibited by high concentrations of various oligonucleotides (i.e. WT MCL1, Delta MCL1 (Fig. 3A, compare lanes 6 and 11 to lanes 4 and 9), and a 100-fold excess of the Sp1 competitor (Fig. 3C, compare lane 8 to lane 2)). Complex III appeared to be Sp1-related, as inhibition was seen with the Sp1 competitor but not the c-FOS SRE (Fig. 3C, compare lane 8 to lanes 2, 10, and 11, an effect that is obscured in the heavy exposure in Fig. 3B). Accordingly, this complex was inhibited by the anti-Sp1 antibody that interfered with DNA binding (Fig. 3D), although it was not supershifted by the other anti-Sp1 antibody (Fig. 3, B and C, lane 9). Others have reported similar observations with a breakdown product of Sp1 which migrated more rapidly than Sp1 and was sensitive to Sp1-binding site competitors but could not be supershifted (46, 47). Overall, EMSAs indicated that SRF and Elk-1, as well as Sp1 and possibly related species, bound specifically to the sites found in mutagenesis experiments to be involved in regulating MCL1 transcription.

MCL1 Expression Can Be Increased through Serum and Growth Factor Receptor-stimulated Pathways-- Besides TPA, MCL1 expression is increased by a variety of agents that induce hematopoietic cell differentiation, as exemplified in cells differentiating along the myelomonocytic lineage (6). Most recently, increased expression has been shown to occur upon stimulation of the GM-CSF receptor (GM-CSF-R), which promotes the growth and differentiation of immature myelomonocytic cells (9). The macrophage colony-stimulating factor receptor (M-CSF-R) promotes the growth and differentiation of cells at a more mature stage of differentiation, those that are committed to the monocyte lineage. This receptor is known to activate MAP kinase and SRF/Ets resulting in increased c-FOS expression (45) and thus might also be expected to affect MCL1. To assess this possibility, and thus confirm and extend the association between increased MCL1 expression and the stimulation of myelomonocytic growth and differentiation, we utilized a cell line (Sort10) that had previously been transfected with and selected for high levels of M-CSF-R expression. This cell line has been studied extensively and is known to exhibit enhanced differentiation responsiveness (24, 48). This effect appears to be mediated through a mechanism similar to that described for previous factor-independent M-CSF-R transfectants, where a high density of the transfected receptor triggers downstream events and produces effects in the absence of ligand (49). The reason for using this transfected cell line, instead of cells expressing the receptor endogenously, was that this approach had proved very valuable in the recent studies with the GM-CSF-R (9). Although earlier studies had suggested that expression of BCL2 increased in response to stimulation through the GM-CSF-R (50-52), this result was not confirmed in the more recent studies (9). Instead, increased expression of MCL1 (but not BCL2) occurred in association with the presence of the transfected GM-CSF-R but did not occur in control cells. The increase in BCL2 seen in the earlier studies may then have been due, in part, to secondary events not directly related to the presence of the receptor. By using a conceptually similar approach, we found that expression of MCL1 was increased in Sort10 cells (Fig. 4A, upper photograph, lanes 1 and 3), whereas expression of BCL2 was not (Fig. 4A, lower photograph). We assayed expression under both standard (10% FBS) and reduced serum (0.3% FBS) conditions, and observed serum to also have an effect. Thus, MCL1 levels were lowest in non-transfected cells in 0.3% FBS, were higher in the presence of either the transfected M-CSF-R or 10% FBS, and were even higher in the presence of the receptor plus 10% FBS, paralleling results in other systems (53-55). The increase in MCL1 expression seen upon stimulation with TPA or through the GM-CSF-R is associated with increased transcription and no alteration in protein stability (5, 6, 9), and it remains to be determined whether this is also the case with the M-CSF-R (Fig. 4). Nonetheless, these findings together with previous reports (6, 9) demonstrate that MCL1 expression is increased in the presence of a variety of myelomonocytic growth and differentiation stimuli and further suggest that expression may also be affected by serum.


View larger version (50K):
[in this window]
[in a new window]
 
Fig. 4.   MCL1 expression can be increased by serum or growth factor receptor stimulation. A, MCL1 expression is increased in transfectants overexpressing the M-CSF receptor. The Sort10 cell line expressing the M-CSF receptor and parental HL-60 cells were incubated for 24 h in either standard medium (10% FBS) or medium containing a reduced concentration of serum (0.3% FBS). Expression of MCL1 and BCL2 was then assayed by Western blotting. In four independent experiments carried out in 10% FBS, Sort10 exhibited MCL1 expression that was 3.9-fold (±0.5; S.E.) higher than that seen in HL-60 and BCL2 expression that was 0.6-fold (±0.05) that seen in HL-60. In the experiment shown where cells were also placed in reduced serum, MCL1 expression in Sort10 in the presence of 0.3% FBS was 0.4-fold that seen in 10% FBS or 1.7-fold that seen in HL-60 in the presence of 10% FBS. B, MCL1 expression can be increased by serum stimulation. ML-1 cells were preincubated in 0.3% FBS for 1 day, exposed to 20% FBS for the indicated times, and then assayed for expression of MCL1 and BCL2. In two independent experiments, expression of MCL1 at 2-8 h was increased 4.1-fold (±0.2; S.E.) over the zero time value; this was equivalent to about 50% of the expression seen in cells treated with TPA (5 × 10-10 M for 3.5 h in cells maintained in 10% FBS). Expression of BCL2 did not increase substantially, averaging 1.5-fold the zero time value at 0.5 to 24 h. Expression of MCL1 was also assayed in K-562 cells in these two experiments and averaged 2.1-fold (±0.5) the zero time value upon serum stimulation.

To follow up on the above observation, the effects of serum on MCL1 expression were assessed in the ML-1 and K-562 cell lines used in most of our studies. MCL1 expression increased in response to serum stimulation in ML-1 cells, although the increase was not as pronounced as that seen with TPA (Fig. 4B). K-562 cells assayed in parallel exhibited even less of a response (Fig. 4B legend), and cells transfected with p(-1656)MCL1luc exhibited only a 2-fold increase in luciferase activity upon serum stimulation. However, in separate experiments, a marked response to serum was observed in B lymphoid cell lines (~7-fold increase in the Ramos line).2 Thus, in some hematopoietic cells, MCL1 expression can respond to stimuli other than strictly those that specifically affect myelomonocytic cells.

    DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Our interest in the mechanisms that control expression of MCL1 stemmed from its highly regulated pattern of expression and from the fact that expression level is a major determinant of the ability of this gene to promote cell viability (4, 17). MCL1 can be rapidly up-regulated and subsequently down-regulated, is expressed at specific stages of differentiation, and differs from BCL2 in its expression pattern (1, 5, 10). In some cases, early induction of MCL1 precedes more long term changes in BCL2 (5, 12), and the viability-enhancing effects of MCL1 appear short-lived compared with those of BCL2 (2-4). Taken together, these findings suggest that the unique physiologic role of MCL1 within the BCL2 family may relate to its ability to provide rapidly inducible, albeit somewhat short term, enhancement of cell viability at specific stages of the cell life cycle.

We have used cultured human hematopoietic cell lines, such as ML-1 and K-562, to study the pathway(s) involved in MCL1 regulation. The low levels of endogenous MCL1 in these cells are up-regulated ~7-10-fold in the presence of TPA, which causes subthreshold expression to increase into the range capable of promoting viability. Previous studies demonstrated that the signal for this increase was transduced through the ERK pathway. Upon inhibition of this pathway, MCL1 expression did not increase above the basal level, and cells exposed to TPA died instead of remaining viable and undergoing differentiation (17).

The present work was aimed at identifying transcription factors that play a role in the regulation of MCL1, to extend the signal transduction studies. We identified a 162-bp segment of the human MCL1 5'-flank that could mimic the above-described pattern of endogenous MCL1 expression in that it allowed an ~10-fold increase in reporter activity in response to TPA which was suppressed by an inhibitor of ERK activation. A region within this segment (centered on bp -107) appeared particularly important for both basal and TPA-induced activity. This region contained sites that bound the transcription factors SRF and Elk-1, with an Sp1 site lying between these two. Mutation of these sites revealed that the coordinate actions of SRF and Ets accounted for a substantial proportion (about two-thirds) of both basal activity and induction by TPA, whereas Sp1 affected basal activity only. Loss of about two-thirds of the inducibility by TPA (i.e. a decrease from ~10- to ~3- to 4-fold induction) was a common theme, as it was also seen upon truncation to bp -107 or upon the addition of PD 98059 prior to TPA induction of wild-type plasmids. As a result of this loss of both basal activity and TPA inducibility, the activity of a Delta SRE/Delta Ets mutant plasmid in the presence of TPA was equivalent to wild-type activity in the absence of TPA. This paralleled the previous observation that, upon inhibition of the ERK pathway, endogenous MCL1 levels in the presence of TPA were equivalent to those seen in untreated control cells, levels that were below the threshold necessary for anti-apoptotic effects (17). The simplest model to account for these findings is that MCL1 can be regulated through a mechanism similar to that utilized by early response genes, where signal transduction is through MAP kinase and transcriptional activation is through an SRF·Ets complex (19, 37).

The mechanism of SRF/Ets-mediated transcriptional activation has been studied extensively in the case of c-FOS. From a series of experiments, a model has emerged suggesting that SRF and Ets constitutively associate with the cognate binding sites in DNA (19, 37, 43). MAP kinase-induced phosphorylation of the Ets component of the bound SRF·Ets complex is thought to produce increased transcription (Refs. 19, 37-40, and 43 and references therein, but see also Refs. 39-41 and 59-61). Since both the unphosphorylated and the phosphorylated complex can bind DNA, identical EMSA complexes are frequently seen with nuclear extracts from unstimulated and stimulated cells (37, 41, 44, 45). This is what we observed in the case of MCL1, using nuclear extracts from untreated and TPA-treated cells. The finding of equivalent EMSA complexes also relates to the fact that, because of the high molecular weight of the SRF·Ets complex, phosphorylation of the bound complex generally does not result in a detectable alteration in mobility. A phosphorylation dependent mobility shift can be detected in systems utilizing an artificially truncated "core" SRF of lower molecular weight (37), systems that were beyond the scope of the present studies. In the case of MCL1, untreated and TPA-treated cells exhibited not only equivalent EMSA complexes but also equivalent DNase I-hypersensitive sites in the MCL1 5'-flank (carried out using the methods described in Ref. 26). Thus, MCL1 may exist in a "competent" or "pre-activated" state (62), which would agree with the fact that MCL1 is expressed, albeit at low levels, in unstimulated cells. Overall, although our studies of MCL1 are not as extensive as those of c-FOS, they are consistent with the model developed for c-FOS in which SRF and Ets can bind constitutively to the cognate sites in DNA and be activated through MAP kinase.

What is the significance of the finding that MCL1 can be regulated by an ERK-mediated signal transduction pathway (17) and SRF/Elk-1-mediated transcriptional activation? Early response genes regulated through MAP kinases and SRF/Ets proteins are expressed during the induction of differentiation and/or the stimulation of proliferation. These genes appear important to these processes as, for example, c-FOS can increase the probability of differentiation in myelomonocytic cell lines, whereas EGR1 is critical for differentiation along the monocyte lineage (20, 21, 63). Regulation of MCL1 through an SRF/Elk-1-mediated mechanism might then be speculated to serve as a means of linking control of viability to critical steps within the differentiation continuum. For example, some early response genes have apoptosis-inducing effects in immature myeloid cells (see Refs. 20-23 and 63-68 but see also Refs. 69-71). Thus, up-regulation of MCL1 through mechanisms similar to those utilized by c-FOS, EGR1, NUR77, and others might aid in maintaining viability as these cells move along the differentiation pathway. The early response mechanism may also serve to restrict MCL1 expression to specific windows of time (e.g. the initiation of a step forward in differentiation), preventing prolonged exposure of cells to the viability-promoting gene product and minimizing the possibility of transformation. In summary, we previously hypothesized that, in hematopoietic cell lines such as ML-1, MCL1 may function to promote viability during the induction of differentiation (17); the present findings allow us to carry this hypothesis one step further, as they suggest that genes involved in these two processes may be controlled through overlapping regulatory mechanisms.

These studies bring up four interrelated and as-yet-unanswered questions concerning our overall understanding of the regulation of MCL1. (i) The data available to date hint at the possibility that there may be a subtle difference between MCL1 and c-FOS. The EMSA complex that formed with the MCL1 probe contained SRF and Elk-1 but not Sap-1a. Analogously, the MCL1 signal transduction pathway was previously seen to involve ERKs but not JNKs (17). In contrast, c-FOS can be regulated through multiple branches of the MAP kinase/SRF/Ets network (19, 58, 61). For example, in the BAC-1 macrophage line stimulated through the M-CSF-R, c-FOS can be activated by either an SRF·Elk-1 or an SRF·Sap-1 complex; the former is the target of ERK activation and the latter is the target of another member of the MAP kinase family (45). Thus, the question arises as to whether MCL1 is primarily regulated through an ERK/SRF/Elk-1 pathway or whether other branches of the broader network might be effective in systems other than those examined so far. If MCL1 is regulated through a different subset of pathways than c-FOS, this could be speculated to relate to the fact that c-FOS appears to have apoptosis-inducing effects in some contexts but not others (20-23, 63-71). (ii) It is also not clear how the SRF/Ets-mediated pathway, elucidated here to be involved in the case of stimulation by TPA, compares to that involved in the case of serum or growth factor receptor-mediated stimulation. Such studies will require a transfection system other than the K-562 system developed here, which was chosen because of its reproducible, robust response to TPA but which exhibited a poor MCL1 response to a growth stimulus. Several cell systems are being considered as candidates, given that many immature human myeloid lines are difficult to transfect (see "Experimental Procedures" and Ref. 33) and fibroblasts exhibit limited responsiveness (6). (iii) A related matter is the fact that serum responsiveness was prominent in some cell lines but not others and was particularly notable in B cell lines, which were not the focus of the present studies. Serum stimulation can be effected through a MAP kinase mediated pathway or an alternate pathway involving a G protein-coupled serpentine receptor and SRF but not Ets (72). Different cell lines differ in the extent to which serum acts through these different paths (19, 72), and this could relate to the fact that different cell types exhibit differences in MCL1 responsiveness. (iv) Finally, the mechanisms that mediate the activity remaining (approximately one-third) upon inhibition of the ERK/SRF/Ets mechanism have yet to be explored, beyond the observation that Sp1 can affect basal activity. The elements involved in induction could lie within or very near a core promoter supporting transcriptional initiation (62), as p(-51)MCL1luc demonstrated a very low level of basal activity that was increased 3-fold by TPA. The significance of this other induction mechanism in terms of apoptosis regulation is not clear, since in experiments with endogenously expressing cells, cell death proceeded despite the TPA-induced residual increase in MCL1 that occurred when the ERK-dependent pathway was inhibited (17). In summary, additional work will be required to more completely characterize the regulation of MCL1. It will be particularly interesting to define how different stimuli affect MCL1 in different systems and to compare further the regulation of MCL1 to that of c-FOS.

These findings on the regulation of MCL1, while providing parallels to early response genes, provide a contrast to what is known about the regulation of BCL2 and other members of this family studied to date. The BCL2 down-regulation seen in pre- and immature B cells is mediated through Ets-like pi  sites (29), but SRF has not been suggested to be involved. Likewise, the sequence of the upstream regulatory region of BCLX reveals potential Ets sites but no obvious SRE (73). Conversely, p53 appears to be important in the regulation of expression of a variety of family members, a finding that did not extend to MCL1 (27, 28, 42, 56, 74). Thus, to some extent, BCL2 family members can be regulated independently. At the same time, the regulatory networks involved appear to interrelate, as exemplified by the fact that DNA-damaging agents cause p53-dependent up-regulation of BAX and concomitant down-regulation of BCL2 (74-78). Appropriate expression of the BCL2 family is critical to the physiologic maintenance of cell viability and death. Inappropriate expression can have pathologic consequences, either