 |
INTRODUCTION |
The MCL1 member of the BCL2 family was
discovered as part of a differential screen aimed at identifying genes
that are rapidly up-regulated as ML-1 human myeloblastic leukemia cells
initiate differentiation along the monocyte pathway (1). Thus,
MCL1 is expressed at very low levels in immature ML-1 cells
and is up-regulated upon exposure to the monocyte/macrophage
differentiation-inducing agent
TPA1 (1). The increase in
MCL1 mRNA occurs rapidly, being detectable within 1 h and approaching a maximum (~7-10-fold) at 3 h. The increase
is transient, MCL1 mRNA levels having declined to
~50% of the peak value within 1 day. An increase in the MCL1 protein parallels the increase in the mRNA (1, 5, 6) and precedes the
progressive accumulation of differentiated cells on days 1-3 (1, 7,
8). In contrast to MCL1, BCL2 levels remain constant until declining at
the terminal stages of differentiation (day 3) (5). In sum, a rapid,
transient increase in the expression MCL1, but not
BCL2, occurs during the early stages of TPA-induced ML-1
cell differentiation.
The increase in MCL1 seen in the early stages of TPA-induced
ML-1 cell differentiation is representative of the high levels of
expression seen at early stages of myeloid differentiation in a variety
of systems, including cell lines as well as differentiating cells in
the intact animal. In ML-1 cells, MCL1 expression increases in response to other inducers of monocyte differentiation, but not an
inducer of granulocyte differentiation (6). MCL1 expression can also be induced in other cell lines of myeloid origin, such as
HL-60, THP-1, U-937, and K-562, and has recently been shown to increase
in response to the myelomonocytic growth factor,
granulocyte/macrophage-colony-stimulating factor (GM-CSF) (9). The high
levels of expression seen in induced cell lines has a counterpart in
the bone marrow in vivo, where MCL1 expression is
high in myeloid cells at early stages of differentiation (10). Overall,
MCL1 is a readily inducible gene in a variety of myeloid
systems, prominently expressed at immature stages of differentiation.
Gene transfer experiments have demonstrated that MCL1 has
viability-enhancing effects. Thus, MCL1 was transfected into
a murine myeloid progenitor cell line, FDC-P1, as the ML-1 human
myeloid cell line from which the gene was isolated cannot be
transfected in a stable fashion. Here, MCL1 was found to
prolong the survival of cells exposed to a variety of
apoptosis-inducing stimuli (4). Similar effects were seen in Chinese
hamster ovary cells (2, 3). Interestingly, these effects were of short
duration, cells expressing the transfected MCL1 gene product living
about twice as long as controls but not as long as cells transfected
with BCL2 (2). Short term viability-enhancing effects, very
similar to those seen in transfected cell lines, have also recently
been observed in lymphoid cells from MCL1 transgenic mice
(11). In other experiments, MCL1 was found to be a rapidly turned over PEST protein (half-life of <3 h), providing another contrast to the
more stable BCL2 protein (Ref. 5 and references therein). Taken
together, these findings led us to hypothesize that MCL1 may
serve as a mediator of cell viability that can be rapidly induced,
albeit in some cases for short term effects, at specific stages in the
cell life cycle, as exemplified by the increase seen in early monocytic differentiation.
MCL1 exhibits a differentiation stage-specific pattern of
expression in lymphoid as well as myeloid cells. For example, in B
cells at early stages of immortalization with an Epstein-Barr virus
gene product, MCL1 expression increases rapidly and
transiently (12). This increase precedes a stable increase in
BCL2 and thus has again been postulated to mediate
short-term protection of viability. MCL1 expression also
increases in response to a variety of B cell growth, differentiation,
and activation factors (13, 14). For example, MCL1
expression is selectively increased during interleukin-6-induced
differentiation of Epstein-Barr virus-immortalized cells and is
subsequently decreased as differentiated cells undergo apoptosis (15).
Likewise, in peripheral blood lymphocytes placed in tissue culture,
MCL1 (but not BCL2) expression correlates with survival and loss of MCL1 expression with apoptosis (16). In lymphoid tissues in the intact animal, MCL1 expression is
abundant in the germinal center, where cells proliferate and undergo
affinity maturation, but is scant in the small, resting cells in the
mantle zone (10). BCL2 demonstrates the opposite pattern,
expression being low in germinal centers and abundant in the mantle
zone. Overall, MCL1 exhibits a highly regulated pattern of
expression, different from that of BCL2, in a variety of
hematopoietic cells. Opposing patterns of expression of MCL1
and BCL2 can also be seen in non-hematopoietic tissues, as
in a variety of epithelial tissues where BCL2 is expressed
at immature and MCL1 at mature stages of differentiation
(10).
We have been studying the mechanisms that underlie the rapid
inducibility and highly regulated pattern of expression of
MCL1, using human hematopoietic cell lines that can be
induced to differentiate with TPA as a model. Our previous studies
showed that the increase in MCL1 expression involves an
increase in transcription but does not require new protein synthesis
(6). Recent studies further showed that the signal for increased
MCL1 expression is transduced through the ERK branch of the
MAP kinase family (17). This signaling pathway is involved both in
maintaining basal MCL1 expression and in bringing about the
increased expression seen in response to TPA. Thus, cells treated with
a specific, non-toxic inhibitor of this pathway (PD 98059 (18)) exhibit
a decrease from the already low base-line MCL1 levels, and cells
treated with PD 98059 plus TPA exhibit MCL1 levels in the range of
those seen in untreated control cells.
Two lines of evidence indicate that, while the base-line levels of MCL1
in ML-1 and other immature hematopoietic cell lines are below the
threshold necessary for effects, the increased levels seen in cells
exposed to TPA contribute to viability enhancement. First, gene
transfer experiments showed that low levels of MCL1, in the range of
the base-line level in the cell lines, had marginal if any effects; in
contrast, higher levels, in the range of those seen after TPA
treatment, promoted cell viability (4). Second, use of PD 98059 to
inhibit MCL1 expression yielded the following results (17).
When the inhibitor was applied alone, a further decrease from the
already low basal MCL1 level occurred but was not accompanied by cell
death, indicating that this low level does not contribute to the
maintenance of viability. When the inhibitor was applied in conjunction
with TPA, MCL1 was expressed at a level equivalent to the
low basal level in untreated control cells (instead of an ~10-fold
higher level), and cells died by apoptosis rather than undergoing
differentiation. These observations bolstered the hypothesis that, in
immature myeloid cells, up-regulation of MCL1 serves to
enhance cell viability during the initiation of differentiation
(17).
The research described here was aimed at building on previous work on
the signal transduction pathway (17), by identifying transcription
factors involved in regulating MCL1. Of particular interest
were factors meaningful in terms of regulation for anti-apoptotic effects, such as those that contribute to the TPA-induced 7-10-fold increase from a subthreshold basal level to a level capable of promoting viability. Initially, a 162-bp segment of the human MCL1 5'-flank was found to mimic, in transient reporter
assays, the behavior of the endogenous gene (i.e. activity
was increased 10-fold by TPA, and this increase was inhibited by PD
98059). The transcription factors SRF and Elk-1 bound to cognate sites within this segment (in the vicinity of bp
107), and Sp1 bound to a
site between the other two. Inactivation of the SRF and Ets sites
resulted in reporter activity in the presence of TPA that was
7-11-fold lower than that of the wild-type plasmid (i.e. it was in the range of wild-type activity in the absence of TPA). This was
analogous to the previous finding that inhibition of the ERK pathway
resulted in endogenous MCL1 expression in the presence of
TPA being maintained at untreated control levels, which were below the
threshold for anti-apoptotic effects (17). The present and previous (6,
9) findings indicate that MCL1 expression is increased by
various agents that promote the viability and
proliferation/differentiation of cells at immature stages of
myelomonocytic differentiation. The mechanism of MCL1
up-regulation by one of these agents, TPA, involves signal transduction
through ERKs and transcriptional activation by SRF and Elk-1. This
finding provides a parallel to early response genes such as
c-FOS and EGR1, which influence the commitment of
immature myelomonocytic cells to maturation (20-23). Regulation of
MCL1 through a similar mechanism therefore suggests a means
through which enhancement of viability may be linked to the induction
of differentiation.
 |
EXPERIMENTAL PROCEDURES |
Cell Culture and Induction of MCL1 Expression--
Human
myeloblastic ML-1 cells were grown in Roswell Park Memorial Institute
(RPMI; BioWhittaker) 1640 medium supplemented with 7.5% fetal bovine
serum (FBS). These cells were maintained by subculturing 3 times weekly
to a density of 3 × 105 cells/ml. Human
erythroleukemia K-562 cells were grown in RPMI 1640 media supplemented
with 10% FBS, 100 units/ml penicillin, and 100 µg/ml streptomycin.
These cells were maintained by subculturing to a density of 2 × 105 cells/ml. Ramos (Epstein-Barr virus-negative) Burkitt
lymphoma cells, obtained from Dr. William Wade (Dartmouth Medical
School, Lebanon, NH), were grown in RPMI 1640 supplemented with 10%
FBS (Biocell catalog number 6201-00, lot number 2757). These cells were
maintained by subculturing every 2 days to a density of 5 × 105 cells/ml. Sort10 is a derivative of HL-60 (the latter
being a cell line that is similar to ML-1 in lineage and
differentiation stage but that can be stably transfected in some
cases), where Sort10 has been transfected with and selected for high
levels of expression of the receptor for macrophage colony-stimulating factor. HL-60 and Sort10 were maintained as described (24, 25).
Construction of a Reporter Plasmid Deletion Series--
A
1.7-kilobase pair XbaI/XbaI human MCL1
genomic fragment representing bp
1656 to bp +160 (where +1 denotes
the major transcriptional start site), along with a 14-bp adapter
ligated to its 3' end to place the luciferase gene in the correct
reading frame, was inserted into the NheI- and
HindIII-digested pGL2-Basic luciferase reporter vector
(Promega, Madison, WI), yielding p(
1656)MCL1luc. A series of
5'-deleted plasmids were constructed by double digestion of
p(
1656)MCL1luc with SmaI (which cuts just upstream of the MCL1 insert) and restriction enzymes known to cut at unique
sites within the MCL1 insert. Religation resulted in the
production of plasmids containing 1308, 847, 703, 577, 290, and 162 bp
of MCL1 5'-flanking sequence. Additional plasmids were
constructed using the polymerase chain reaction (PCR) (p(
107)MCL1luc,
p(
51)MCL1luc, and p(+11)MCL1luc), where the PCR products were
sequenced to confirm their identity.
Site-directed Mutagenesis--
Specific mutations were
introduced into the p(
162)MCL1luc plasmid using a two-stage PCR
method described elsewhere (29). The Ets site at bp
129 to bp
121
was converted from CCGGAAGC to CCTTAAGC; the Sp1
site at bp
118 to bp
113 was converted from
CCGCCC to CTGACC; and the
SRE at bp
106 to
97 was converted from CCTTTTATGG to
CCTTCGGCTG, where altered nucleotides are indicated in bold
type. The specific point mutations used were chosen based on previous
findings (30-32), and all mutations were verified by sequencing. The
PCR products containing the desired mutations were digested with
BstEII and EcoRI and ligated into the
p(
162)MCL1luc plasmid that had been digested with the same enzymes.
Electroporation and Transient Luciferase Expression Assay--
A
battery of cell lines of myeloid origin was tested for suitability for
use in transient transfection with MCL1-luciferase reporter
constructs. Upon testing of ML-1, U-937, THP-1, Namalwa, and K-562
cells, K-562 stood out as demonstrating readily detectable basal
luciferase activity, as well as induction by TPA that was in the range
of the ~10-fold increase seen endogenously. In the other cell lines,
basal luciferase activity was lower than in K-562 but could be
optimized; however, TPA did not elicit a reproducibly robust response,
producing at most a 2-3-fold increase in luciferase activity. (Note,
TPA did elicit a response with a pCMVluc plasmid used as a positive
control.) The reason for the poor TPA responsiveness of MCL1
reporter plasmids was further investigated in ML-1 cells, which would
have been the first choice of cell line for the present studies as it
was utilized for many previous studies (1, 5, 6). To this end, the
effect of electroporation on TPA-induction of the endogenous
MCL1 gene was monitored, as a robust response was known to
occur. It was found that induction was not inhibited by carrying out
the electroporation protocol in the absence of plasmid DNA. However,
induction was inhibited upon electroporation in the presence of plasmid
DNA, an effect that was observed even with the insert-less pGL2-Basic
control plasmid. Decreasing the amount of plasmid DNA minimized the
inhibition of induction but resulted in a decrease in luciferase
activity to below the level of detection. In sum, although
electroporation conditions could be optimized to test for basal
expression in other myeloid cell lines besides K-562, these lines could
not be practically used for the identification of elements involved in
induction by TPA. Such difficulties are not uncommon with immature
human myeloid cell lines (33).
Electroporation was therefore carried out with K-562 cells using the
following protocol, which was based on preliminary experiments aimed at
optimizing luciferase activity. Cells were washed twice and resuspended
in phosphate-buffered saline (5 × 106 cells in 0.5 ml) in the presence of a luciferase reporter plasmid (10 µg), along
with the pCMVhGH internal control plasmid used in most experiments (10 µg; described further below). After incubation on ice for 10 min,
cells were subjected to electroporation (960 microfarads and 280 V;
Bio-Rad Gene Pulser), placed on ice for 15 min, and then incubated at
37 °C (1 × 105 cells/ml) in Iscove's modified
Dulbecco's media supplemented with 10% FBS, 100 units/ml penicillin,
and 100 µg/ml streptomycin. After 17 h, the cell suspension was
divided into two portions, one of which was left untreated and the
other of which was exposed to TPA (1.7 × 10
9
M, a concentration found to increase MCL1
expression in K-562 cells in a manner equivalent to the effect seen
with 5 × 10
10 M TPA in ML-1 cells).
After 7 h of exposure to TPA (a time point where induction was
found to be at or near a peak), cells were washed with
phosphate-buffered saline prior to assay of luciferase activity
(relative light units), in triplicate, essentially as described
previously (34), using a Microlite ML2250 Microtiter plate luminometer
(Dynatech Laboratories, Chantilly, VA).
In most experiments, a human growth hormone reporter plasmid, pCMVhGH,
was used as a control for transfection efficiency (10 µg; obtained
from Dr. Daniel Tenen, Beth Israel Hospital, Boston). The choice of the
pCMVhHG plasmid (and protocol and reagents from Nichols Institute
Diagnostics (San Juan Capistrano, CA)) was based on a series of tests
of several possible plasmids, where
-galactosidase-based plasmids
and the TKhGH plasmid were not found to be useful as their activity in
the above human myeloid cell lines was close to the level of
sensitivity of the respective assays. pCMVhGH yielded a linear increase
in activity upon transfection with 2-10 µg of plasmid, where
activity with 2 µg of plasmid was near the limit of sensitivity of
the hGH assay, but activity with 5-10 µg was sufficiently above
background to be accurately quantifiable. Co-transfection with 5-10
µg of pCMVhGH did not decrease the basal (no TPA) activity of
luciferase reporter plasmids; this caused only a minor reduction in the
induction of luciferase activity by TPA (e.g. from
~13.5-to ~10.5-fold in an experiment examining p(
162)MCL1luc and
p(
1663)MCL1luc in the absence versus the presence of
pCMVhGH), which was deemed acceptable considering the potential disadvantage of not using an internal control plasmid. The experimental design described above (33), where an aliquot of cells electroporated with a given test plasmid was divided into two portions one of which
was exposed to TPA and the other of which was not, was chosen because
cytomegalovirus-based plasmids are themselves subject to induction by
TPA. With this design, cells exposed versus not exposed to
TPA were derived from the same initial aliquot of electroporated cells
and thus did not differ substantially in transfection efficiency. Luciferase activity in both portions of cells was then normalized to
hGH production as assayed in triplicate in the portion of the sample
not exposed to TPA. As it turned out and as is described in individual
figure legends, analysis with or without normalization for transfection
efficiency did not affect the interpretation of the results.
Electrophoretic Mobility Shift Assays (EMSAs)--
The sense
strand sequences of the oligonucleotides used are shown below. The WT
MCL1 oligonucleotide used as a probe represents bp
135 to
bp
92 of the MCL1 5'-flank, which contains potential binding sites for SRF, Ets, and Sp1. The
MCL1
oligonucleotide contains mutations in all three of these sites, as
indicated in bold and underlined below. Oligonucleotides were prepared
by Life Technologies, Inc., except for the Sp1 oligonucleotide which
was from Santa Cruz Biotechnology, Inc. WT MCL1,
CAACCCTCCGGAAGCTGCCGCCCCTTTCCCCTTTTATGGGAATA;
MCL1,
CAACCCTCCTTAAGCTGCTGACCCTTTCCCCTTCGGCTGGAATA; Sp1, ATTCGATCGGGGCGGGGCGAGC; c-FOS
SRE, CTTACACAGGATGTCCATATTAGGACATCT.
Nuclear extracts were prepared essentially as described previously
(35), and protein content was determined using the Bio-Rad Protein
Assay kit with bovine serum albumin as a standard. EMSAs were also
performed as described previously (32, 36). In assays where unlabeled
oligonucleotides (10- or 100-fold molar excess) or antibodies directed
against SRF, Elk-1, SAP-1a, or Sp1 (Santa Cruz Biotechnology, Inc.,
Santa Cruz, CA) were tested, these were added to the binding reaction
prior to the addition of nuclear extract. The antibodies used in most
experiments were chosen as antibodies that would not interfere with the
factor binding to DNA, except in one experiment in which an anti-Sp1
antibody that interferes with DNA binding was used for that purpose.
This latter antibody was the 1C6 antibody (Santa Cruz Biotechnology,
catalog number sc-420) which recognizes an epitope corresponding to
amino acid residues 520-538 of Sp1, where the DNA binding domain
corresponds to residues 537-619.
Western Blotting--
Western blotting was carried out as
described previously, except that a monoclonal, instead of the
previously used polyclonal (5), antibody was used. The monoclonal
antibody was produced by Dr. Chi-Yu Gregory Lee (Vancouver Biotech LTD,
Vancouver) using a bacterially produced N-terminally His-tagged MCL1
protein. Quantitation by densitometric scanning was carried out as
described previously (17). This antibody is being described elsewhere.
Statistical Analysis--
The results from assays of luciferase
activity were analyzed using analysis of variance with post-hoc Sheffe
testing (Systat 5 for the Macintosh). Results were converted to natural
logarithmic values for this analysis. Two-way analysis of variance
(plasmid × drug) was used to analyze relative luciferase
activity. One-way analysis of variance was used to compare the fold
increase with TPA among plasmids.
 |
RESULTS |
A 162-bp Segment of the MCL1 5'-Flank Mediates Transcriptional
Induction by TPA and Its Suppression by an Inhibitor of the ERK
Pathway--
p(
1656)MCL1luc, a luciferase reporter plasmid under the
control of a genomic fragment containing 1656 bp of human
MCL1 5'-flanking DNA (Fig.
1A), was introduced into the
K-562 transfection system (described under "Experimental
Procedures"). Luciferase activity was detectable in the absence of
TPA and was increased ~10-fold in its presence (Fig. 1B).
Thus, elements within p(
1656)MCL1luc directed both basal
MCL1 transcription and induction by TPA.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 1.
A 162-bp region of the human MCL1
5'-flank directs basal expression and TPA-inducible,
ERK-dependent up-regulation. A, reporter
plasmids representing serial deletions of the MCL1 5'-flank
in pGL2-Basic. Plasmid nomenclature indicates the amount of
MCL1 5'-genomic flanking sequence (bp) present, where the
major start site of MCL1 transcription (designated as +1) is
marked with an arrow. The p(+11)MCL1luc plasmid contains a
segment of DNA representing bp +11 to bp +160 of the MCL1
5'-untranslated region, which is present in all plasmids in the series.
B, retention of full activity with reporter plasmids
containing 162 bp of the MCL1 5'-flank. Reporter plasmids
(10 µg) containing deletions to bp 162 were electroporated into
K-562 cells, and luciferase activity was assayed in the absence or
presence of TPA (with normalization based on co-transfection with
pCMVhGH, as described under "Experimental Procedures"). Relative
luciferase activity represents the ratio of the normalized activity of
each sample to that of the longest plasmid in the series
(p( 1656)MCL1luc) assayed in the absence of TPA. The values shown are
the mean ± S.E. of 5-6 independent experiments, where the mean
values are also listed on the graph. The relative luciferase activity
of the pGL2-Basic insert-less control vector averaged 0.005 ± 0.002 (S.E.) and 0.006 ± 0.002 in the absence and the presence of
TPA, respectively. A pCMVluc plasmid (2 µg), assayed as a positive
control alongside the test samples, yielded a relative luciferase
activity of 0.9 ± 0.2 and 105 ± 11 in the absence and
presence of TPA, respectively. The results of these experiments were
identical when analyzed with normalization for transfection efficiency
(as shown) or without normalization; for example, when the calculations
were performed without normalization, the basal luciferase activity of
plasmids between p( 1656)MCL1luc and p( 162)MCL1luc averaged 1.3-fold
(±0.1; S.E.) that of p( 1656)MCL1luc, and this value was increased to
12.7-fold (±0.85) in the presence of TPA. The coefficient of variation
for the normalized values shown averaged 0.31 (±0.05; S.E.) and that
for the values calculated without normalization averaged 0.36 (±0.04).
In additional experiments in which only p( 1656)MCL1luc and
p( 162)MCL1luc were assayed, either with or without the co-transfected
pCMVhGH plasmid, the ratio of the activity of p( 162)MCL1luc to that
of p( 1656)MCL1luc averaged 1.88 (with or without the co-transfected
plasmid), induction with TPA averaging 13.2-fold (±1.2; S.E.) in the absence of the co-transfected plasmid and
10.9-fold (± 1.4) in its presence. Statistical analysis revealed that
the effect of TPA was significant in each case (p < 0.001) but that the different plasmids did not differ from each other
either in the absence or in the presence of TPA. C,
inhibition of MCL1 reporter plasmid activity in the presence
of an inhibitor of ERK activation. After electroporation with the
indicated plasmids (at 15.5 h), K-562 cells were either exposed or
not exposed to PD 98059 (100 µM) for 1.5 h and then
either exposed or not exposed to TPA for an additional 7 h.
Luciferase activity was calculated as in B except that
normalization with pCMVhGH was not carried out, and the activity of
each plasmid (p( 1656)MCL1luc or p( 162)MCL1luc which were assayed in
separate experiments) was calculated relative to the untreated control
for that plasmid. The values shown are the mean ± S.E. of 2-3
experiments with 1-3 replicates per experiment.
|
|
To determine whether a shorter segment of the MCL1 5'-flank
could similarly direct transcription, transfections were carried out
with a series of plasmids representing progressive 5' deletions of
p(
1656)MCL1luc. A plasmid containing 162 bp of the MCL1
5'-flank, p(
162)MCL1luc, was found to have activity equivalent to
that of the full-length plasmid, with some intermediately truncated plasmids exhibiting slightly, but non-significantly, higher activity. The activity of all these plasmids was increased ~9-11-fold in the
presence of TPA, mimicking the increase seen in endogenously expressing
hematopoietic cell lines (1, 6). p(
162)MCL1luc and p(
1656)MCL1luc
were also transfected into ML-1 and U-937 cells, myeloid cell lines
where basal activity (but not induction by TPA; see "Experimental
Procedures") could be measured reliably; here also, the basal
activity of p(
162)MCL1luc was in the range of that seen with
p(
1656)MCL1luc, the ratio of the activity of the former plasmid to
the latter being 1.0 ± 0.2 (S.E.; n = 3) in ML-1
and 1.3 in U-937 cells. Overall, K-562 cells transiently transfected
with a reporter plasmid containing 162 bp of the MCL1 5'-flank appeared to constitute a workable system for identifying elements involved in maintaining basal levels MCL1
transcription and in bringing about the ~10-fold increase in
transcription that occurs in response to TPA.
The PD 98059 inhibitor of ERK activation (18) was also applied to the
above K-562 cell transfection system, to determine whether the effect
would be similar to that observed in the case of endogenously expressed
MCL1. This inhibitor was found to substantially, but not
completely, inhibit the TPA-induced increase in luciferase activity
(Fig. 1C). This was similar to the previous findings showing
PD 98059 to substantially, but not completely, inhibit TPA-induced
endogenous MCL1 expression (17). The inhibitor also caused
some decline in basal activity in transfected cells, an effect that had
likewise been noted in the case of endogenous expression. Overall,
transfected cells exposed to PD 98059 exhibited inducibility by TPA
that was only about one-third that seen in cells not exposed to the
inhibitor (2.7-3.7-fold induction over the reduced basal activity in
the presence of the inhibitor as compared with 7.6-11.8-fold induction
in its absence). Thus, transfection with p(
1656)MCL1luc or
p(
162)MCL1luc paralleled endogenous expression both in TPA
inducibility and in the substantial suppression of this inducibility
seen in the presence of an inhibitor of ERK activation.
Truncation of the MCL1 5'-Flank to bp
107 Results in Decreased
Transcriptional Activity in the Absence and Presence of
TPA--
Further truncated plasmids were next tested to determine
whether these might point to a region of particular interest within the
162-bp MCL1 5'-flanking segment. Truncation to bp
107 was found to result in a substantial, but not a complete, loss of activity
in both the absence and presence of TPA (Fig.
2A), a finding that was
reminiscent of those above on the effect of PD 98059 on the activity of
longer plasmids. When compared in the absence of TPA, the activity of
p(
107)MCL1luc was 20% that seen with p(
162)MCL1luc. When compared
in the presence of TPA, the activity of p(
107)MCL1luc was <10% that
seen with p(
162)MCL1luc. Further truncation to bp
51 resulted in a
further loss of activity (to ~5% of the basal activity of
p(
162)MCL1luc), and a complete loss was seen upon elimination of all
MCL1 5'-flanking sequence. Thus, the bp
162 to
107
region was important for, although not the only region contributing to,
both basal transcription and the elevated transcription seen in the
presence of TPA.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 2.
SRE and Ets sites in the 107-bp region of
the human MCL1 5'-flank influence basal and TPA-induced
transcription, an Sp1 site between these two affecting basal activity
only. A, reduction in transcriptional activity in the
absence and presence of TPA upon truncation of the MCL1
5'-flank to bp 107. Transfections were carried out as in Fig.
1B using reporter plasmids deleted to bp 107 and beyond.
Relative luciferase activity represents the ratio of the normalized
activity of each sample to that of p( 162)MCL1luc assayed in the
absence of TPA. The values shown are the mean ± S.E. of five
independent experiments, where the mean values are also listed on the
graph. The relative luciferase activity of the pGL2-Basic insert-less
control vector averaged 0.006 (±0.004; S.E.) and 0.008 (±0.003) in
the absence and the presence of TPA, respectively. A pCMVluc plasmid (2 µg), assayed as a positive control alongside the test samples,
yielded a relative luciferase activity of 0.7 (±0.1) and 100 (±30) in
the absence and presence of TPA, respectively. The results of these
experiments were identical when analyzed with normalization for
transfection efficiency (as shown) or without normalization; when the
calculations were performed without normalization, the relative
luciferase activity of p( 107)MCL1luc and p( 51)MCL1luc in the
absence of TPA averaged 0.2 (±0.02; S.E.) and 0.05 (±0.01),
respectively, and these values were increased to 0.83 (±0.11) and 0.14 (±0.04) in the presence of TPA. Induction by TPA averaged 3.6- (±0.4;
S.E.) and 3.0 (±0.2)-fold with p( 107)MCL1luc and p( 51)MCL1luc,
respectively, as compared with the average 12.7-fold induction seen
with p( 162)MCL1luc. B, potential cis-regulatory
elements in the 107-bp region of the 5'-flank of MCL1. Bold
lettering indicates potential Ets-, Sp1-, and SRE-like
transcription factor binding sites identified using the MatInspector
(57) and TRANSFAC data bases. These sites are shown in p( 162)MCL1luc,
which contains 162 bp of MCL1 5'-flanking sequence as well
as 160 bp of downstream sequence (+1 indicates the major
transcriptional start site). The sites of further deletion in the
plasmids p( 107)MCL1luc, p( 51)MCL1luc, and p(+11)MCL1luc are
indicated with filled arrows, as is the translation start
site. Direct repeats in the region of the SRE are marked with
open arrows (CCCCTTT on the coding strand) and elements with
dyad symmetry character (6 out of 7 bp) are underlined on
the coding strand (TTCCCCT; ATGGGAA). Two adjacent initiator sequences
(YYAX(T/A)YY) at the major start site of transcription are
marked by bold overlining. The asterisks mark the
first and last nucleotides of the oligonucleotide probe used in Fig. 3. C, effect of
mutation of the SRE, Ets, and Sp1 sites in the bp 107 region of the
MCL1 5'-flank. p( 162)MCL1luc-based reporter plasmids
containing inactivating mutations in the Sp1 and SRF and/or Ets sites
were assayed for relative luciferase activity in the absence or
presence of TPA as in Fig. 1B. Relative luciferase activity
was defined as the ratio between the normalized activity of the mutated
plasmid and that of wild-type p( 162)MCL1luc. The values shown are the
mean ± S.E. of three independent experiments, where the mean
values are also listed on the graph, except in the case of the Sp1
plasmid where an additional experiment was carried out with six
replicate samples along with three wild-type controls. A pCMVluc
plasmid (2 µg), assayed as a positive control alongside the test
samples, yielded a relative luciferase activity of 0.8 (±0.1; S.E.)
and 60 (±5) in the absence and presence of TPA, respectively. The
relative luciferase activity of pGL2-Basic averaged 0.0005 (±0.0006)
and 0.0025 (±0.001) in the presence and absence of TPA, respectively.
The basal activity of the SRE and SRE/ Ets mutant plasmids was
found to be significantly different from that of wild-type plasmid
(p < 0.05). All plasmids demonstrated a significant
increase in the presence of TPA as compared with the corresponding
non-TPA-treated samples (p < 0.005). This increase
averaged 9.0- (±0.4; S.E.), 4.7- (±0.2), 3.0- (±0.63), and 4.1 (±0.7)-fold with the Sp1 plasmid, SRE, Ets, and Ets/ SRE
plasmids, respectively. There was no significant difference between the
SRE, Ets, and SRE/ Ets plasmids in the fold increase
observed with TPA, although the fold increase with these three differed
from that seen with p( 162)MCL1luc and the Sp1 plasmid. The
activity of the SRE, Ets, and SRE/ Ets plasmids in the
presence of TPA did not differ from that of the wild-type
p( 162)MCL1luc plasmid in the absence of TPA (p > 0.3). The abovementioned additional experiment with the Sp1 plasmid
was carried out as it was not clear from the initial experiment whether
this mutation resulted in any significant change. In this experiment,
the basal activity of the Sp1 plasmid differed significantly from
the basal activity with p( 162)MCL1luc (p < 0.001).
|
|
With p(
107)MCL1luc and similarly with p(
51)MCL1luc, the activity
seen in the presence of TPA represented an ~3.5-fold increase over
the corresponding reduced basal value, which contrasted with the
10-12-fold induction seen with longer plasmids and thus represented a
fold increase of only approximately one-third of the maximum value. In
sum, truncation to bp
107 resulted in reduced basal activity and
reduced induction in the presence of TPA; the net result was that
activity with the truncated p(
107)MCL1luc plasmid in the presence of
TPA was only in the range of that seen with the longer p(
162)MCL1luc
plasmid in the absence of TPA.
In the
162 to
107-bp region, the human MCL1 5'-flank
contains potential Ets- and Sp1-like sites, with a potential SRE lying immediately downstream (Fig. 2B). The presence of Ets and
SRF sites provided a parallel to the dyad symmetry region in
c-FOS and suggested that MCL1 might be regulated
through an SRF/Ets-mediated mechanism similar to that utilized by early
response genes. TPA-induced c-FOS transcription is activated
by MAP kinase, which phosphorylates the Ets component of an SRF·Ets
complex (Refs. 19 and 37-40 and references therein). Such a mechanism
would be compatible with the previous finding of ERK involvement in the
MCL1 signal transduction pathway. It would also be
compatible with the reduced induction seen with p(
107)MCL1luc, which
retains the potential SRE but not the upstream Ets site.
Present and previous data were further considered in the light of the
hypothesis that a MAP kinase/SRF/Ets-mediated mechanism might play a
role in the regulation of MCL1; the purpose here was to make
a judgment as to whether assessing these sites took priority over
testing other potential downstream areas. A mechanism involving signal
transduction through ERKs and transcriptional activation by SRF/Ets
could potentially account both for the changes observed in transfected
cells upon truncation to bp
107 (Fig. 2A) or upon exposure
of longer plasmids to PD 98059 (Fig. 1C), as well as the
changes seen in endogenously expressing cells upon inhibition of ERK
activation (17). In point of fact, the changes observed in cells
transfected with p(
107)MCL1luc and those observed in cells
endogenously expressing MCL1 and exposed to an inhibitor of
the ERK pathway exhibited striking similarities. Thus, paralleling the
fact that both basal and TPA-induced expression were decreased upon
truncation to bp
107 in transfection experiments (Fig.
2A), both were comparably decreased upon inhibition of the
ERK pathway in endogenously expressing cells (17). Neither was
completely eliminated, TPA causing reduced induction over a reduced
basal value upon truncation to bp
107 (Fig. 2A) or upon
ERK inhibition (17), with the reduced induction in both cases being in
the range of 3.5-fold. As a result, just as the activity of
p(
107)MCL1luc in the presence of TPA was equivalent to that of
p(
162)MCL1luc in its absence, endogenous MCL1 expression
in cells exposed to PD 98059 plus TPA was in the range of the basal
level present in untreated control cells (17). The parallels between
these two systems lent credence to the possibility that a common
underlying pathway might be at work. We therefore directed our
attention to the potential SRE and Ets sites, and the Sp1 site between
them, in the
107-bp region of the MCL1 5'-flank.
The Coordinate Actions of SRF and Ets Are Required for Maximal
Induction of MCL1 by TPA, both SRF/Ets and Sp1 Contributing to Basal
Activity--
To assess the functionality of the SRE, Ets, and Sp1
sites, inactivating alterations were introduced into these sites in the context of p(
162)MCL1luc. Alteration of the SRE, with or without alteration of the Ets site, reduced but did not eliminate basal activity and reduced but did not eliminate induction by TPA (Fig. 2C). Reduced activity was seen with the
SRE and
Ets
single mutant plasmids as well as with the
SRE/
Ets double mutant;
thus, the coordinate actions of SRF and Ets were required for maximal
activity, as is the case for TPA-induced activation of c-FOS
(19). Alteration of the Sp1 site also reduced but did not eliminate
basal activity; however, it did not substantially decrease the 9-fold
induction seen in the presence of TPA in this experiment. Overall, the
SRE and Ets sites were necessary for, and acted coordinately to
produce, maximal basal activity and maximal induction by TPA. The Sp1
site was necessary for maximal basal activity but not for induction by TPA.
The activity of the
SRE/
Ets double mutant plasmid in the presence
of TPA was in the range of that of the wild-type p(
162)MCL1luc plasmid in its absence. This result was reminiscent of the previous observations with p(
107)MCL1luc, although the wild-type plasmid exhibited slightly lower induction by TPA in the present experiments than it had previously (Fig. 2, A versus
C). Additional experiments with the
SRE/
Ets plasmid
showed that, on average, basal activity was decreased by about
two-thirds (Table I row IIA), and the fold induction by TPA above this reduced basal value was decreased by
nearly an equivalent proportion, from a value of ~11- to ~4-fold (Table I row IIB and C). These observations paralleled the experiments involving truncation to bp
107, where the fold induction by TPA was
also reduced by approximately two-thirds (Table I row IIIB and C and
Fig. 2A); here, basal expression was reduced by slightly more than two-thirds (Table I row IIIA), which could relate to the fact
that the Sp1 site is not present in the truncated plasmid. These
findings also paralleled the experiments with wild-type plasmids in the
presence of PD 98059, where a two-thirds reduction in fold induction by
TPA was also seen (Table I rows IVC and D); in this case, basal
activity was not reduced as much as in the other experiments (Table I
compare row IVA to rows IIA and IIIA). This is probably due to the fact
that PD 98059 was added 1.5 h before the addition of TPA (15.5 h
after electroporation, Fig. 1C), in an experimental design
focused on the effect of PD 98059 on induction by TPA above a
pre-existing basal level; this design paralleled exactly the design
used in previous experiments on endogenous MCL1, where a
basal level of expression is present before TPA addition (17). Thus, in
the transient transfections, the decline in basal activity seen in the
presence of PD 98059 represented that occurring from 15.5-24 h (Table
I row IVA and Fig. 1C), whereas the decline with the
p(
107)MCL1luc or
SRE/
Ets plasmids reflected the entire 24-h
plasmid expression period (Table I rows IIA and IIIA and Fig. 2,
A and C). One additional point is that basal
activity in the presence of PD 98059 was also not reduced as much in
transiently transfected cells (Table I row IVA and Fig. 1C)
as in endogenously expressing cells (where basal expression decreased
to ~25% of the value in the absence of PD 98059 over the 8.5-h assay
period), although in both systems induction by TPA was reduced to
~3.5-fold (17). This probably relates to the fact that the effect of
PD 98059 on basal expression in transient transfections reflects loss
of luciferase, whereas in endogenously expressing cells it reflects
loss of the MCL1 protein. This latter difference
notwithstanding, a common theme was noted in experiments involving
truncation to bp
107, alteration of the SRE and Ets sites, or
application of PD 98059 to cells transfected with wild-type plasmids or
even cells endogenously expressing MCL1, as these
experiments all demonstrated a loss of about two-thirds of the TPA
inducibility (to 3-4-fold induction) above a reduced level of basal
activity.
View this table:
[in this window]
[in a new window]
|
Table I
Comparison of deletion of the MCL1 5'-flank to bp 107, mutation of
the SRE/Ets sites, or exposure of the unaltered reporter plasmid to
PD 98059
|
|
SRF, Elk-1, and Sp1 Bind to the Cognate Sites in the
107-bp
Region of the MCL1 5'-Flank--
EMSAs were carried out with a probe
containing the Ets, SRF, and Sp1 sites in the
107-bp region of the
MCL1 5'-flank to test for the binding of specific nuclear
proteins. Four major complexes formed, and proteins present in two of
these could be identified definitively: complexes I and II clearly
represented specific binding, as their formation was inhibited by
excess unlabeled competitor probe but not by a competitor in which the
three sites had been altered (Fig.
3A). Complex I (but not
complex II) was also inhibited by a competitor representing the
c-FOS SRE and Ets site (Fig. 3, B and
C, compare lanes 10 and 11 to
lane 2), whereas complex II (but not complex I) was
inhibited by a competitor representing a consensus Sp1-binding site
(Fig. 3, B and C, compare lanes 7 and
8 to lane 2). Thus, complex I appeared to contain SRF and/or an Ets protein while complex II contained Sp1. The formation
of these complexes was not substantially altered when TPA-treated
versus untreated cells were used (Fig. 3A). With
other genes regulated by SRF and Ets, stimulated versus
unstimulated cells frequently demonstrate identical EMSA complexes (37,
41, 44, 45), probably because the prebound SRF·Ets complex may be
activated upon stimulation (19, 37), as mentioned above and discussed
further below.

View larger version (67K):
[in this window]
[in a new window]
|
Fig. 3.
Serum response factor, the Elk-1 member of
the Ets family, and Sp1 bind to cognate sites in the 107-bp region of
the human MCL1 5'-flank. A, formation of
specific EMSA complexes with a probe representing the 107-bp region
of the MCL1 5'-flank. Nuclear extracts from K-562 cells that
had either been left untreated (U) or treated with TPA
(T; 1.7 × 10 9 M) were used
in EMSAs with a probe representing bp 135 to bp 92 of the
MCL1 5'-flank (probe is indicated with asterisks
in Fig. 2B). Unlabeled (cold) competitor
nucleotides were either not added (none; lanes 1, 2, and 7, where free probe was run in lane
1) or added at a 10- or 100-fold molar excess as indicated, where
the WT MCL1 oligonucleotide (lanes 3, 4, 8, and
9) was identical in sequence to the probe and the
MCL1 oligonucleotide (lanes 5, 6, 10, and
11) contained mutations in the Ets, Sp1, and SRF sites. Material
migrating more rapidly than complex IV, as well as material at the top
of the gel, did not display any distinctive pattern suggestive of a
role in regulation. B-D, presence of Elk-1/SRF and Sp1 in
complexes I and II demonstrated by oligonucleotide competitor and gel
shift analysis. EMSAs were carried out as in A in the
presence of either additional competitor oligonucleotides or antibodies
to transcription factors. The additional competitors used included an
oligonucleotide containing a consensus Sp1-binding site (B
and C, lanes 7 and 8), as well as one
containing the c-FOS SRE and adjacent Ets-binding site
(B and C, lanes 10 and 11).
The antibodies (Ab.) used were directed against Sp1, SRF,
Elk-1, or Sap-1a (B and C, lanes 9, 12, 13, and 14, respectively), or against a region directly
adjacent to the Sp1 DNA-binding domain (DBD; D).
The EMSAs shown in B utilized untreated cells and that shown
in C utilized cells treated with TPA for 60 min, where
identical results were obtained with cells treated with TPA for 30 min.
A heavily exposed autoradiograph is shown in B as this
facilitated confirmation of the appearance of supershifted complex I
material in lanes 12 and 13 (marked with
squares to the right of these lanes).
|
|
The presence of SRF/Ets and Sp1 in complexes I and II, respectively,
was confirmed using antibodies specific for these factors. Antibodies
recognizing either SRF or the Elk-1 member of the Ets family caused
complex I to supershift, whereas an antibody recognizing Sap-1a did not
(Fig. 3, B and C, lanes 12-14;
supershifted bands are indicated with squares in Fig.
3B). Similarly, an antibody recognizing Sp1 caused complex
II to supershift (Fig. 3, B and C, lane
9). Here, the supershifted complex migrated at the same position
as complex I. Therefore, another antibody recognizing Sp1 was also
utilized, in this case an antibody that interferes with the binding of
Sp1 to its cognate site in DNA. This antibody decreased the formation
of complex II (Fig. 3D; see disappearance of complex II in
the last lane where the antibody was added, as compared with
the middle lane where the antibody was not added); this was
consistent with the ability of this antibody to block Sp1 DNA binding,
confirming the presence of Sp1.
Complex IV appeared to be a nonspecific band, as it could be partially
inhibited by high concentrations of various oligonucleotides (i.e. WT MCL1,
MCL1 (Fig.
3A, compare lanes 6 and 11 to
lanes 4 and 9), and a 100-fold excess of the Sp1
competitor (Fig. 3C, compare lane 8 to lane
2)). Complex III appeared to be Sp1-related, as inhibition was
seen with the Sp1 competitor but not the c-FOS SRE (Fig.
3C, compare lane 8 to lanes 2, 10, and
11, an effect that is obscured in the heavy exposure in Fig.
3B). Accordingly, this complex was inhibited by the anti-Sp1
antibody that interfered with DNA binding (Fig. 3D), although it was
not supershifted by the other anti-Sp1 antibody (Fig. 3, B
and C, lane 9). Others have reported similar
observations with a breakdown product of Sp1 which migrated more
rapidly than Sp1 and was sensitive to Sp1-binding site competitors but
could not be supershifted (46, 47). Overall, EMSAs indicated that SRF
and Elk-1, as well as Sp1 and possibly related species, bound
specifically to the sites found in mutagenesis experiments to be
involved in regulating MCL1 transcription.
MCL1 Expression Can Be Increased through Serum and Growth Factor
Receptor-stimulated Pathways--
Besides TPA, MCL1
expression is increased by a variety of agents that induce
hematopoietic cell differentiation, as exemplified in cells
differentiating along the myelomonocytic lineage (6). Most recently,
increased expression has been shown to occur upon stimulation of the
GM-CSF receptor (GM-CSF-R), which promotes the growth and
differentiation of immature myelomonocytic cells (9). The macrophage
colony-stimulating factor receptor (M-CSF-R) promotes the growth and
differentiation of cells at a more mature stage of differentiation,
those that are committed to the monocyte lineage. This receptor is
known to activate MAP kinase and SRF/Ets resulting in increased
c-FOS expression (45) and thus might also be expected to
affect MCL1. To assess this possibility, and thus confirm
and extend the association between increased MCL1 expression
and the stimulation of myelomonocytic growth and differentiation, we
utilized a cell line (Sort10) that had previously been transfected with
and selected for high levels of M-CSF-R expression. This cell line has
been studied extensively and is known to exhibit enhanced
differentiation responsiveness (24, 48). This effect appears to be
mediated through a mechanism similar to that described for previous
factor-independent M-CSF-R transfectants, where a high density of the
transfected receptor triggers downstream events and produces effects in
the absence of ligand (49). The reason for using this transfected cell
line, instead of cells expressing the receptor endogenously, was that
this approach had proved very valuable in the recent studies with the
GM-CSF-R (9). Although earlier studies had suggested that expression of
BCL2 increased in response to stimulation through the
GM-CSF-R (50-52), this result was not confirmed in the more recent
studies (9). Instead, increased expression of MCL1 (but not
BCL2) occurred in association with the presence of the
transfected GM-CSF-R but did not occur in control cells. The increase
in BCL2 seen in the earlier studies may then have been due,
in part, to secondary events not directly related to the presence of
the receptor. By using a conceptually similar approach, we found that
expression of MCL1 was increased in Sort10 cells (Fig.
4A, upper photograph, lanes 1 and 3), whereas expression of BCL2 was not (Fig.
4A, lower photograph). We assayed expression under both
standard (10% FBS) and reduced serum (0.3% FBS) conditions, and
observed serum to also have an effect. Thus, MCL1 levels were lowest in
non-transfected cells in 0.3% FBS, were higher in the presence of
either the transfected M-CSF-R or 10% FBS, and were even higher in the
presence of the receptor plus 10% FBS, paralleling results in other
systems (53-55). The increase in MCL1 expression seen upon
stimulation with TPA or through the GM-CSF-R is associated with
increased transcription and no alteration in protein stability (5, 6,
9), and it remains to be determined whether this is also the case with the M-CSF-R (Fig. 4). Nonetheless, these findings together with previous reports (6, 9) demonstrate that MCL1 expression is
increased in the presence of a variety of myelomonocytic growth and
differentiation stimuli and further suggest that expression may also be
affected by serum.

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 4.
MCL1 expression can be increased by
serum or growth factor receptor stimulation. A,
MCL1 expression is increased in transfectants overexpressing
the M-CSF receptor. The Sort10 cell line expressing the M-CSF receptor
and parental HL-60 cells were incubated for 24 h in either
standard medium (10% FBS) or medium containing a reduced concentration
of serum (0.3% FBS). Expression of MCL1 and BCL2
was then assayed by Western blotting. In four independent experiments
carried out in 10% FBS, Sort10 exhibited MCL1 expression
that was 3.9-fold (±0.5; S.E.) higher than that seen in HL-60 and
BCL2 expression that was 0.6-fold (±0.05) that seen in
HL-60. In the experiment shown where cells were also placed in reduced
serum, MCL1 expression in Sort10 in the presence of 0.3%
FBS was 0.4-fold that seen in 10% FBS or 1.7-fold that seen in HL-60
in the presence of 10% FBS. B, MCL1 expression
can be increased by serum stimulation. ML-1 cells were preincubated in
0.3% FBS for 1 day, exposed to 20% FBS for the indicated times, and
then assayed for expression of MCL1 and BCL2. In
two independent experiments, expression of MCL1 at 2-8 h
was increased 4.1-fold (±0.2; S.E.) over the zero time value; this was
equivalent to about 50% of the expression seen in cells treated with
TPA (5 × 10 10 M for 3.5 h in cells
maintained in 10% FBS). Expression of BCL2 did not increase
substantially, averaging 1.5-fold the zero time value at 0.5 to 24 h. Expression of MCL1 was also assayed in K-562 cells in
these two experiments and averaged 2.1-fold (±0.5) the zero time value
upon serum stimulation.
|
|
To follow up on the above observation, the effects of serum on
MCL1 expression were assessed in the ML-1 and K-562 cell
lines used in most of our studies. MCL1 expression increased
in response to serum stimulation in ML-1 cells, although the increase
was not as pronounced as that seen with TPA (Fig. 4B). K-562
cells assayed in parallel exhibited even less of a response (Fig.
4B legend), and cells transfected with p(
1656)MCL1luc
exhibited only a 2-fold increase in luciferase activity upon serum
stimulation. However, in separate experiments, a marked response to
serum was observed in B lymphoid cell lines (~7-fold increase in the
Ramos line).2 Thus, in some
hematopoietic cells, MCL1 expression can respond to stimuli
other than strictly those that specifically affect myelomonocytic cells.
 |
DISCUSSION |
Our interest in the mechanisms that control expression of
MCL1 stemmed from its highly regulated pattern of expression
and from the fact that expression level is a major determinant of the
ability of this gene to promote cell viability (4, 17). MCL1
can be rapidly up-regulated and subsequently down-regulated, is
expressed at specific stages of differentiation, and differs from
BCL2 in its expression pattern (1, 5, 10). In some cases,
early induction of MCL1 precedes more long term changes in
BCL2 (5, 12), and the viability-enhancing effects of
MCL1 appear short-lived compared with those of
BCL2 (2-4). Taken together, these findings suggest that the
unique physiologic role of MCL1 within the BCL2
family may relate to its ability to provide rapidly inducible, albeit
somewhat short term, enhancement of cell viability at specific stages
of the cell life cycle.
We have used cultured human hematopoietic cell lines, such as ML-1 and
K-562, to study the pathway(s) involved in MCL1
regulation. The low levels of endogenous MCL1 in these
cells are up-regulated ~7-10-fold in the presence of TPA, which
causes subthreshold expression to increase into the range capable of
promoting viability. Previous studies demonstrated that the
signal for this increase was transduced through the ERK pathway. Upon
inhibition of this pathway, MCL1 expression did not
increase above the basal level, and cells exposed to TPA died instead
of remaining viable and undergoing differentiation (17).
The present work was aimed at identifying transcription factors that
play a role in the regulation of MCL1, to extend the signal
transduction studies. We identified a 162-bp segment of the human
MCL1 5'-flank that could mimic the above-described pattern of endogenous MCL1 expression in that it allowed an
~10-fold increase in reporter activity in response to TPA which was
suppressed by an inhibitor of ERK activation. A region within this
segment (centered on bp
107) appeared particularly important for both
basal and TPA-induced activity. This region contained sites that bound
the transcription factors SRF and Elk-1, with an Sp1 site lying between these two. Mutation of these sites revealed that the coordinate actions
of SRF and Ets accounted for a substantial proportion (about
two-thirds) of both basal activity and induction by TPA, whereas Sp1
affected basal activity only. Loss of about two-thirds of the
inducibility by TPA (i.e. a decrease from ~10- to ~3- to 4-fold induction) was a common theme, as it was also seen upon truncation to bp
107 or upon the addition of PD 98059 prior to TPA
induction of wild-type plasmids. As a result of this loss of both basal
activity and TPA inducibility, the activity of a
SRE/
Ets mutant
plasmid in the presence of TPA was equivalent to wild-type activity in
the absence of TPA. This paralleled the previous observation that, upon
inhibition of the ERK pathway, endogenous MCL1 levels in the presence
of TPA were equivalent to those seen in untreated control cells, levels
that were below the threshold necessary for anti-apoptotic effects
(17). The simplest model to account for these findings is that
MCL1 can be regulated through a mechanism similar to that
utilized by early response genes, where signal transduction is through
MAP kinase and transcriptional activation is through an SRF·Ets
complex (19, 37).
The mechanism of SRF/Ets-mediated transcriptional activation has been
studied extensively in the case of c-FOS. From a series of
experiments, a model has emerged suggesting that SRF and Ets constitutively associate with the cognate binding sites in DNA (19, 37,
43). MAP kinase-induced phosphorylation of the Ets component of the
bound SRF·Ets complex is thought to produce increased transcription
(Refs. 19, 37-40, and 43 and references therein, but see also Refs.
39-41 and 59-61). Since both the unphosphorylated and the
phosphorylated complex can bind DNA, identical EMSA complexes are
frequently seen with nuclear extracts from unstimulated and stimulated
cells (37, 41, 44, 45). This is what we observed in the case of
MCL1, using nuclear extracts from untreated and TPA-treated
cells. The finding of equivalent EMSA complexes also relates to the
fact that, because of the high molecular weight of the SRF·Ets
complex, phosphorylation of the bound complex generally does not result
in a detectable alteration in mobility. A phosphorylation dependent
mobility shift can be detected in systems utilizing an artificially
truncated "core" SRF of lower molecular weight (37), systems that
were beyond the scope of the present studies. In the case of
MCL1, untreated and TPA-treated cells exhibited not only
equivalent EMSA complexes but also equivalent DNase I-hypersensitive sites in the MCL1 5'-flank (carried out using the methods
described in Ref. 26). Thus, MCL1 may exist in a
"competent" or "pre-activated" state (62), which would agree
with the fact that MCL1 is expressed, albeit at low levels,
in unstimulated cells. Overall, although our studies of MCL1
are not as extensive as those of c-FOS, they are consistent
with the model developed for c-FOS in which SRF and Ets can
bind constitutively to the cognate sites in DNA and be activated
through MAP kinase.
What is the significance of the finding that MCL1 can be
regulated by an ERK-mediated signal transduction pathway (17) and SRF/Elk-1-mediated transcriptional activation? Early response genes
regulated through MAP kinases and SRF/Ets proteins are expressed during
the induction of differentiation and/or the stimulation of
proliferation. These genes appear important to these processes as, for
example, c-FOS can increase the probability of
differentiation in myelomonocytic cell lines, whereas EGR1
is critical for differentiation along the monocyte lineage (20, 21,
63). Regulation of MCL1 through an SRF/Elk-1-mediated
mechanism might then be speculated to serve as a means of linking
control of viability to critical steps within the differentiation
continuum. For example, some early response genes have
apoptosis-inducing effects in immature myeloid cells (see Refs. 20-23
and 63-68 but see also Refs. 69-71). Thus, up-regulation of
MCL1 through mechanisms similar to those utilized by
c-FOS, EGR1, NUR77, and others might
aid in maintaining viability as these cells move along the
differentiation pathway. The early response mechanism may also serve to
restrict MCL1 expression to specific windows of time
(e.g. the initiation of a step forward in differentiation),
preventing prolonged exposure of cells to the viability-promoting gene
product and minimizing the possibility of transformation. In summary,
we previously hypothesized that, in hematopoietic cell lines such as
ML-1, MCL1 may function to promote viability during the
induction of differentiation (17); the present findings allow us to
carry this hypothesis one step further, as they suggest that genes
involved in these two processes may be controlled through overlapping
regulatory mechanisms.
These studies bring up four interrelated and as-yet-unanswered
questions concerning our overall understanding of the regulation of
MCL1. (i) The data available to date hint at the possibility that there may be a subtle difference between MCL1 and
c-FOS. The EMSA complex that formed with the MCL1
probe contained SRF and Elk-1 but not Sap-1a. Analogously, the
MCL1 signal transduction pathway was previously seen to
involve ERKs but not JNKs (17). In contrast, c-FOS can be
regulated through multiple branches of the MAP kinase/SRF/Ets network
(19, 58, 61). For example, in the BAC-1 macrophage line stimulated
through the M-CSF-R, c-FOS can be activated by either an
SRF·Elk-1 or an SRF·Sap-1 complex; the former is the target of ERK
activation and the latter is the target of another member of the MAP
kinase family (45). Thus, the question arises as to whether
MCL1 is primarily regulated through an ERK/SRF/Elk-1 pathway
or whether other branches of the broader network might be effective in
systems other than those examined so far. If MCL1 is
regulated through a different subset of pathways than c-FOS,
this could be speculated to relate to the fact that c-FOS
appears to have apoptosis-inducing effects in some contexts but not
others (20-23, 63-71). (ii) It is also not clear how the
SRF/Ets-mediated pathway, elucidated here to be involved in the case of
stimulation by TPA, compares to that involved in the case of serum or
growth factor receptor-mediated stimulation. Such studies will require
a transfection system other than the K-562 system developed here, which
was chosen because of its reproducible, robust response to TPA but
which exhibited a poor MCL1 response to a growth stimulus.
Several cell systems are being considered as candidates, given that
many immature human myeloid lines are difficult to transfect (see
"Experimental Procedures" and Ref. 33) and fibroblasts exhibit
limited responsiveness (6). (iii) A related matter is the fact that
serum responsiveness was prominent in some cell lines but not others
and was particularly notable in B cell lines, which were not the focus
of the present studies. Serum stimulation can be effected through a MAP
kinase mediated pathway or an alternate pathway involving a G
protein-coupled serpentine receptor and SRF but not Ets (72). Different
cell lines differ in the extent to which serum acts through these
different paths (19, 72), and this could relate to the fact that
different cell types exhibit differences in MCL1
responsiveness. (iv) Finally, the mechanisms that mediate the activity
remaining (approximately one-third) upon inhibition of the ERK/SRF/Ets
mechanism have yet to be explored, beyond the observation that Sp1 can
affect basal activity. The elements involved in induction could lie
within or very near a core promoter supporting transcriptional
initiation (62), as p(
51)MCL1luc demonstrated a very low level of
basal activity that was increased 3-fold by TPA. The significance of this other induction mechanism in terms of apoptosis regulation is not
clear, since in experiments with endogenously expressing cells, cell
death proceeded despite the TPA-induced residual increase in
MCL1 that occurred when the ERK-dependent
pathway was inhibited (17). In summary, additional work will be
required to more completely characterize the regulation of
MCL1. It will be particularly interesting to define how
different stimuli affect MCL1 in different systems and to
compare further the regulation of MCL1 to that of
c-FOS.
These findings on the regulation of MCL1, while providing
parallels to early response genes, provide a contrast to what is known
about the regulation of BCL2 and other members of this
family studied to date. The BCL2 down-regulation seen in
pre- and immature B cells is mediated through Ets-like
sites (29),
but SRF has not been suggested to be involved. Likewise, the sequence
of the upstream regulatory region of BCLX reveals potential
Ets sites but no obvious SRE (73). Conversely, p53 appears to be
important in the regulation of expression of a variety of family
members, a finding that did not extend to MCL1 (27, 28, 42,
56, 74). Thus, to some extent, BCL2 family members can be
regulated independently. At the same time, the regulatory networks
involved appear to interrelate, as exemplified by the fact that
DNA-damaging agents cause p53-dependent up-regulation of
BAX and concomitant down-regulation of BCL2 (74-78).
Appropriate expression of the BCL2 family is critical to the
physiologic maintenance of cell viability and death. Inappropriate
expression can have pathologic consequences, either