![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 3, 1848-1855, January 15, 1999
From the Department of Molecular Biology, The Lerner Research Institute, The Cleveland Clinic Foundation, Cleveland, Ohio 44195
| |
ABSTRACT |
|---|
|
|
|---|
P69 is an isozyme of the medium size class of
human 2'-5' oligoadenylate synthetases. In this study, recombinant P69
was expressed and used for enzymological and structural investigations.
Bacterially expressed P69 was inactive whereas the same protein
expressed in insect cells was highly active. Whether this difference
could be due to differential post-translational modifications of the protein was investigated. Mutations of appropriate residues showed that
myristoylation of the protein was not necessary for enzyme activity. In
contrast, inhibition of glycosylation of P69, by tunicamycin treatment
of the insect cells, produced an enzymatically inactive protein.
Recombinant P69 produced in insect cells was purified by affinity
chromatography. It was a dimeric glycoprotein, very stable and
completely dependent on double stranded (ds) RNA for activity. The
enzyme catalyzed the non-processive synthesis of 2'-5'-linked
oligoadenylate products containing up to 30 residues. 2'-O-Methylated dsRNA was incapable of activating P69 and a
25-base pair dsRNA was as effective as larger dsRNA. This expression
system will be useful for large scale production of P69 and its mutants for structural studies.
2'-5' Oligoadenylate
(2-5(A))1 synthetases are a
family of enzymes that polymerize ATP into a series of 2'-5'-linked
oligoadenylates (1, 2). Trimers and higher oligomers of 2-5(A) can
activate a latent ribonuclease, RNase L, by causing its dimerization
(3). Cellular synthesis of the 2-5(A) synthetases is induced by
interferons and viral infection of interferon-treated cells causes
activation of the enzymes by viral dsRNA, production of 2-5(A),
activation of RNase L, and degradation of RNA. This chain of events can
prevent the replication of certain classes of viruses, such as
picornaviruses, but other viruses are not affected by the 2-5(A)
synthetase/RNase L pathway (4).
According to their sizes, the 2-5(A) synthetases can be divided into
three classes: large, medium, and small, and within each class there
are many isozymes (2). Multiple genes, alternative splicing of the
mRNAs, and differential post-translational modification of the
proteins add to the diversity of these enzymes. For example, in mouse,
there are at least three genes encoding small synthetases and 9-2 and
3-9 isozymes are encoded by two alternately spliced mRNAs of the
same gene (5-7). Similarly, the human medium synthetase gene gives
rise to two alternatively spliced mRNAs encoding the isozymes P69
and P71 (8). The three classes of the enzymes are structurally related
and highly conserved across the species. The small synthetases are
homotetramers, the medium synthetases are dimers, and the large isozyme
is a monomer (9). These enzymes are interesting to study for many
reasons: their interferon inducibility, their activation by dsRNA,
their ability to synthesize 2'-5'-linked oligonucleotides, and their
cellular actions. Structure-function and enzymological studies of
2-5(A) synthetases have not progressed well in the past because of the
lack of an efficient expression system for recombinant proteins.
Recently, we have used a bacterial system and a insect cell/baculovirus
system effectively for producing a small isozyme of 2-5(A) synthetase
and its mutants (10, 11). The same systems were used in the current
study for producing the recombinant medium synthetase P69. The
recombinant P69 protein was purified and used for enzymological studies.
Bacterially produced P69 was enzymatically inactive but recombinant P69
produced in insect cells was highly active, completely dependent of
dsRNA, non-processive, and stable. The recombinant protein was a dimer
and had sugar modifications that were required for its activity. A
25-bp dsRNA, but not a 15-bp dsRNA, could activate P69 maximally and
free 2'-OH groups on the dsRNA were required for its activity.
Cloning of Human P69--
Total RNA was prepared using RNAzol
(Tel-Test Inc.) from human Daudi cells treated with 200 units/ml
interferon Expression of P69 in Bacteria--
Bacterial expression and
partial purification of NH2-terminal hexahistidine-tagged
P69 was done in a similar way as described earlier for 9-2 (11). The
yield of pure P69 protein from bacterial expression system was 5 µg/50 ml of culture.
Site-directed Mutagenesis--
To be able to use convenient
unique restriction enzyme sites on full-length P69 cDNA, it was
subcloned in pGEM4 without any tag. For this purpose, the pET28a-P69
construct was used as a template for PCR. Two primers, the forward
primer (GGAGATATACCATGGGAAATGGGGAG) containing a NcoI site
overlapping with protein start codon and a reverse primer downstream of
BamHI site (nucleotides 873-892) were used to PCR a
~900-bp fragment. The PCR product was Klenow filled and cloned into
the SmaI site of pBluescript KS+. The insert was then
excised out from pBluescript KS+ with NcoI and
BamHI and swapped with the corresponding fragment of the
pET28a-P69 construct. The full-length cDNA insert from the above
construct was excised out with XbaI and SalI and
subcloned into the EcoRI-SalI site of pGEM4. The
resulting construct, called pGM13, contained full-length P69 cDNA
without any NH2-terminal tag, and could be transcribed from
the SP6 promoter of pGEM4. The G2A and G2D mutants were made using the
pGM13 construct as template for PCR with similar forward primers as
before having a NcoI site and the mutation (G to A or D) and
the same reverse primer downstream of BamHI site
(nucleotides 873-892). The 900-bp PCR products were Klenow filled and
cloned into the SmaI site of pBluescript KS+. The mutated inserts were then excised out from pBluescript KS+ with NcoI
and BamHI, swapped with the corresponding fragment on wild
type cDNA in PGM13.
Expression and Purification of P69 from Insect Cells--
The
insect cell expression of P69 was done using the Bac-to-Bac Baculovirus
expression system (Life Technologies) in a similar way as described
earlier (10, 13). The NH2-terminal hexahistidine-tagged P69
insert from pET28a was cloned into the XbaI and
XhoI site of pFastBac. The recombinant baculovirus was
produced according to Bac-to-Bac Baculovirus expression system
instruction mannual. High Five (H5) cells (Invitrogen) were infected
with the recombinant virus containing hexahistidine-tagged P69 at a
multiplicity of infection of 10 and were harvested 32 h
post-infection. Cells were washed twice with phosphate-buffered saline,
resuspended in lysis buffer (1 ml of buffer for cells from one 150-mm
plate) containing 300 mM NaCl, 20 mM Tris-Cl,
pH 7.4, 10% glycerol, 5 mM 2-5(A) Synthetase Assay--
A typical assay reaction contained
1 µg/ml P69 protein, 20 mM Tris-Cl (pH 7.4), 20 mM magnesium acetate, 2.5 mM dithiothreitol, 5 mM ATP, 5 µCi of [ Lectin Binding of P69--
Purified P69 (200 ng each) was used
to test the binding with lectins-wheat germ agglutinin and concanavalin
A (ConA) according to Roquemore et al. (15). Briefly, 20 µl of wheat germ agglutinin or ConA-Sepharose (Sigma), was washed
twice in the binding buffer (10 mM sodium phosphate buffer
(pH 7.4), 150 mM NaCl, and 0.2% Nonidet P40). Purified
protein was incubated with the beads in 500 µl of volume at 4 °C
with shaking for 2 h. At the end of the incubation, beads were
centrifuged, washed twice in binding buffer, and twice in binding
buffer containing 1 M galactose. Bound proteins were eluted
by boiling beads in 1 × SDS-PAGE loading buffer, and analyzed on
an SDS-PAGE. P69 protein was detected by Western blotting using
anti-His antibody (Santa Cruz Biotechnology). To express unglycosylated
P69, insect cells were treated with 10 µg/ml tunicamycin (16), 1 h post-infection. Cells were harvested 30 h post-infection, and
P69 protein was purified from the treated cells along with an untreated
control (Fig. 5A). The purified proteins were tested for
glycosylation by their ability to bind ConA-Sepharose, and tested for
2-5(A) synthetase activity.
Size Fractionation Analysis--
Purified proteins were size
fractionated at room temperature on a 1 × 100-cm Sephacryl S300
column, which was equilibrated with a buffer containing 20 mM Tris-Cl (pH 7.5), 450 mM NaCl, 5 mM MgCl2, 5 mM dsRNA Activation of P69--
Synthetic dsRNA of various lengths
were made by transcribing the multicloning site of pBluescript KS+ as
described earlier (17). These synthetic dsRNA were used in a standard
reaction mixture to assay the activation of P69 activity. The
2'-O-methylated dsRNA (36 bp) was obtained as two
complementary pure single stranded RNA using commercial nucleic acid
synthesis service from Operon Technologies. The single stranded
2'-O-methylated RNAs were hybridized to form the dsRNA
(11).
Bacterially Expressed P69 Is Inactive--
For the purpose of
producing recombinant P69 protein, we cloned its full-length coding
sequence by reverse transcription-polymerase chain reaction using
primers derived from the published sequence (8). The newly cloned
cDNA was expressed in the rabbit reticulocyte lysate system and the
in vitro synthesized protein was enzymatically active (Fig.
1A). Since we have previously
expressed active 9-2 isozyme in Escherichia coli, (11),
bacterial expression of P69 was first attempted. A hexahistidine-tagged
protein was expressed in bacteria and it was purified by Ni-agarose
affinity chromatography (Fig. 1B). Surprisingly, the
bacterially expressed P69 protein was enzymatically inactive although
similarly expressed and purified 9-2 isozyme was active (Fig.
1C).
Unlike 9-2, native P69 from interferon-treated human cells is a
myristoylated protein (9). Since myristoylation occurs in rabbit
reticulocyte lysate, but not in E. coli (18, 19), the lack
of activity of bacterially expressed P69 could be due to the lack of
this modification of the protein. To examine whether myristoylation is
indeed needed for enzymatic activity, appropriate mutants of P69 were
generated. Myristoylation of a protein is directed by the sequence
present at its NH2 terminus (20) and mutation of the Gly
residue at position 2 is known to destroy the proteins ability to be
myristoylated (18, 21). Using site-directed mutagenesis, such mutants
of P69, G2A, and G2D were generated and the corresponding proteins were
synthesized in vitro. The mutant proteins were as active as
the wild type protein (Fig. 2A) thus demonstrating that
myristoylation is not required for enzyme activity. Another possible
reason for a bacterially expressed protein to be inactive could be the
presence of the extraneous hexahistidine tag at its NH2
terminus. This possibility was also ruled out by the demonstration that
(His)6P69 made in vitro was enzymatically active
(Fig. 2B). Although the reason for the observed inactivity
of the bacterially expressed P69 was not revealed, the above series of
experiments established that the presence of the polyhistidine tag at
the NH2 terminus or the absence of myristoylation does not
affect the protein's enzyme activity.
Recombinant P69 Expressed in Insect Cell Is Active--
Since
bacterial expression of active recombinant P69 was ineffective, we
decided to express it in insect cells using the baculovirus system. A
recombinant baculovirus, encoding (His)6P69, was
constructed for this purpose. Recombinant P69 protein was produced in
the infected cells in quantities large enough to be easily detected by
Coomassie Blue staining of proteins in total cell extracts (data not
shown). The P69 protein was purified from the soluble supernatant of
the cell extract using Ni-agarose affinity chromatography. This single
step purification process was very efficient yielding an apparently
homogeneous P69 preparation, as shown in Fig.
3A. A 290-fold purification of
the activity was obtained by this method with about 30% yield (Table
I).
Unlike the bacterially expressed P69, the recombinant P69 produced in
insect cells was highly active (Fig. 3B). A series of 2-5(A)
oligomers is synthesized by 2-5(A) synthetases. Using denaturing gel
electrophoresis for analyzing the products by size, we have previously
observed that small 9-2 isozyme is capable of synthesizing dimers to
hexamers of 2-5(A) (10). In contrast, the recombinant P69 protein was
very efficient in synthesizing higher oligomers (Fig. 3B).
With increasing lengths of incubation time, more of the higher
oligomers were synthesized. Up to 30-mers of 2-5(A) could be detected
after 9 h of incubation.
Recombinant P69 Is a Dimeric Glycoprotein--
Native P69 is a
dimer (9). The same was true for the recombinant P69 purified from
insect cells. Gel filtration analysis revealed that the purified
recombinant P69 had an apparent molecular mass of 160 kDa (Fig.
4A). Since the calculated
molecular mass of the polyhistidine-tagged P69 is 80.8 kDa, it showed
that the protein exists primarily as a dimer.
The protein sequence of P69 indicates the presence of four potential
N-glycosylation sites in the protein. That information, coupled with our failure to produce active protein in bacteria that
lack protein glycosylation activity, prompted us to examine the
glycosylation status of P69 expressed in insect cells. Because glycoproteins are known to bind to lectins, purified P69 was challenged to bind to two different lectins (Fig. 4B). P69 bound to
both wheat germ agglutinin and ConA-coupled Sepharose but not to the Sepharose matrix itself. These data strongly suggest that P69 has sugar
modifications. To determine if glycosylation of the protein is needed
for its enzyme activity, unglycosylated P69 was synthesized in
tunicamycin-treated insect cells because tunicamycin is known to
inhibit all sugar modifications of glycoproteins. P69 was purified from
tunicamycin-treated and untreated cells (Fig.
5A) and, as expected, the
protein purified from the drug-treated cells did not bind to
ConA-Sepharose (Fig. 5) thus demonstrating its lack of glycosylation.
The unglycosylated protein was enzymatically inactive (Fig.
5C) indicating that sugar modification of the P69 protein is
required for producing an active enzyme.
P69 Is a dsRNA-activated Non-processive Enzyme--
The enzymatic
characteristics of the recombinant protein were determined in the next
series of experiments. In these experiments, thin layer chromatography
of phosphatase-treated products was used for measuring the total
amounts of 2-5(A) production. Under the experimental conditions used,
enzyme activity increased linearly with increasing protein
concentration and length of incubation (Fig.
6, A and B). The
protein was enzymatically active even after 30 h of incubation
(data not shown). A substrate concentration curve revealed that the
Km for ATP of this enzyme was 2.1 mM
(Fig. 6C). A similar experiment with increasing
concentrations of the cofactor, dsRNA, demonstrated that the purified
protein was totally inactive without dsRNA and for the maximum enzyme activation, 5-10 µg/ml of poly(I):poly(C) was required (Fig.
6D). The various characteristics of the recombinant P69
protein are listed in Table II.
For other isozymes it has been suggested that 2-5(A) oligomerization is
non-processive (22). The kinetics of synthesis of different oligomers
by P69 (Fig. 3B) indicated that the same was also true for
this isozyme. To directly examine the processivity of P69, the
experiment shown in Fig. 6 was carried out. No 2-5(A) oligomers
remained bound to the protein (lane 2, Fig.
7) and the profiles of the products made
by fresh enzyme (lane 1, Fig. 7) and preincubated enzyme
(lane 4, Fig. 7) were identical.
A 25-bp dsRNA Can Activate P69 Maximally--
The nature of the
dsRNA required for P69 activation was investigated in the next series
of experiments. Perfect dsRNA of defined lengths were synthesized by
in vitro transcription and their ability to activate P69 was
tested. When tested at a high concentration (20 µg/ml), a 25-bp dsRNA
was as active as longer dsRNAs (Fig. 8A), whereas a 15-bp dsRNA was
less efficient in activating the enzyme. Moreover,
higher oligomers of 2-5(A) were more efficiently synthesized in the
presence of the 25-bp or longer dsRNA as compared with the 15-bp dsRNA
(Fig. 8, A and B). Quantitation of total 2-5(A)
synthesis in the presence of different concentrations of various dsRNAs
revealed that 25-bp dsRNA was as good as the longer RNAs at every
concentration tested (Fig. 8C). Their product profiles at
each concentrations were also very similar (data not shown). But for
15-bp dsRNA, the maximum level of synthesis was about 25% of that
achieved by others (Fig. 8C) and synthesis of the higher
oligomers was very inefficient (Fig. 8B). Curiously, for all
RNAs, the product profile changed with the activator concentration, i.e. the formation of the higher oligomers was favored at
higher concentrations of the dsRNA (Fig. 8B). Moreover, a
low concentration of the 25-bp RNA (0.1 µg/ml) produced the same
product profile as a high concentration (10 µg/ml) of the 15-bp RNA
(Fig. 8B).
A different property of the dsRNA was tested in Fig. 8D.
Another dsRNA-activated enzyme, PKR, cannot be activated by
2'-O-methylated dsRNA (23). To examine if this property is
shared by P69, a 36-bp 2'-O-methylated dsRNA was
synthesized. Even at 50 µg/ml, this RNA could not activate the P69
protein (Fig. 8D). Thus, it appears that free 2'-OH groups
on the ribose moieties of the dsRNA are required for proper
interactions with the P69 isozyme of 2-5(A) synthetases.
The 2-5(A) synthetases are interesting enzymes primarily because
of their two unique properties: they are activated by dsRNA and they,
unlike any other DNA or RNA polymerases, catalyze the formation of
2'-5' phosphodiester bonds. Pursuit of mechanistic and structural
investigation of these enzymes has been hampered by the lack of an
ample source of pure proteins. Although synthesis of 2-5(A) synthetases
can be induced in mammalian cells by interferon treatment, many
isozymes are induced together and the cells do not tolerate their
sustained expression at high levels. For these reasons, we sought to
express recombinant enzymes in unnatural expression systems, such as
bacteria or insect cells, that are not susceptible to the anticellular
effects of 2-5(A) synthetases because they lack the complementary
enzyme, RNase L. Expression of recombinant proteins also allows one to
express various mutant proteins, an ability that is crucial for
conducting structure-function studies. Thus, we attempted to develop a
high level expression system of an epitope-tagged protein that can be
purified easily. We chose the medium isozyme P69 over the small
isozymes for several reasons. Like poly(A) polymerase, medium, but not
the small 2-5(A) synthetase, polymerize long chains of 2-5(A).
Moreover, the medium synthetases are dimers and thus easier to study
structurally than small synthetases that are tetramers. An additional
feature was the ease with which the recombinant P69 could be purified.
We have previously expressed a small isozyme, 9-2, in both bacteria and
insect cells (11, 13). Both systems produced enzymatically active 9-2 proteins although the bacterially expressed protein had a lower
specific activity (10). As reported here, P69, a medium isozyme was
also expressed efficiently in both of these expression systems. But
surprisingly, the bacterially expressed P69 was enzymatically inactive.
We suspected that this was because of the lack of some crucial
post-translational modification of the protein expressed in E. coli. Because the natural protein is known to be myristoylated, a
modification missing in bacteria, we investigated whether this
modification was required for enzyme activity. An appropriate
mutational study demonstrated that this was not the cause. Similarly,
phosphorylation of P69 does not appear to be the difference either.
Even in the insect cells, we failed to detect radiolabeled phosphate
incorporation in the protein by in vivo phosphate labeling
of cells and then purifying the P69 protein by immunoprecipitation.
However, under the same conditions similarly expressed recombinant
vesicular stomatitis virus P protein was highly radiolabeled (data not
shown). The third possible protein modification that we tested was
glycosylation because P69 contains several potential
N-glycosylation sites. Our data clearly demonstrated that
P69 synthesized in insect cells was glycosylated and glycosylation was
necessary for enzyme activity of the protein. Further studies will be
needed to determine if the lack of sugar modification affects proper
folding of the protein (24) or its substrate and cofactor binding (25).
Nonetheless, these results provide a probable explanation for the
inactivity of P69 expressed in bacteria which lack the ability to
glycosylate proteins.
The baculovirus-infected insect cell system produced a high yield of
the recombinant P69 protein. It was also easy to purify using the
hexahistidine tag at its NH2 terminus. The tagged P69 protein bound to the affinity matrix quite efficiently indicating that
the amino-terminal region of P69 is not buried inside. This was unlike
the polyhistidine-tagged 9-2 isozyme that did not bind to the same
affinity resin efficiently (10).
The purified recombinant P69 protein had a high specific activity and
its Km for ATP and the dsRNA optimum were similar to
those of the natural enzyme (26). The catalytic properties of the
recombinant P69 and 9-2 isozymes were very similar. Both had high
Km for ATP, the specific activities were similar and
the kcat values were similar. The dsRNA optimum
for P69, 10 µg/ml, was however, lower than the optimum for 9-2, 25 µg/ml. Both proteins were also extremely stable: their enzymatic
activity was maintained even after 20 h of incubation at 30 °C.
There was, however, a major difference in one property of the two
isozymes: the P69 isozyme synthesized much longer 2-5(A) chains than
the 9-2 isozyme, which synthesized mostly dimers and trimers. Although, for 9-2, long incubations produced some higher oligomers, but nothing
longer than hexamers could be detected as its product activity (10). In
contrast, up to 30-mer of 2-5(A) was synthesized by the P69 isozyme.
The mechanistic basis of this observed difference in the properties of
the two isozymes is unclear at this time.
The possible basis of the ability of P69 to synthesize higher 2-5(A)
oligomers could be that the enzyme was highly processive. Our
experimental results, however, point to the contrary. No oligomer remained bound to the protein after their synthesis, suggesting that
chain lengthening proceeds through multiple initiation events. The
presence of all intermediates, from dimers to the highest oligomer, in
the products produced during a given length of incubation, and the
observed uniform gradient in the amounts of longer to shorter
oligomers, also indicate that the reaction is non-processive. Our
observation is in contrast to the recent report of Marie et al. (27) suggesting that the natural P69 may be a processive enzyme. Their conclusion was based on the negative observation that
isolated dimers were poor acceptors for chain elongation. This
observation is explainable by our finding that ATP is a much better
acceptor than dimers or higher oligomers of 2-5(A). As a result, high
concentrations of ATP favors dimer formation and inhibit the formation
of higher oligomers (data not shown). In contrast, our conclusion that
the enzyme reaction is non-processive is in tune with the earlier
observation by Justesen et al. (22) that the enzyme purified
from the reticulocyte lysate could efficiently use dimers and trimers
of 2-5(A) as acceptors.
We used the recombinant purified P69 protein for studying the nature of
its activator. The protein was inactive as such and single-stranded
RNA, DNA-RNA hybrid, or dsDNA could not activate it (data not shown).
Double-stranded RNAs were the only activators and there were no
specific sequence requirements for this activity. We have previously
shown that the small isozyme can be activated by dsRNAs as short as 40 bp and by HIV-1 TAR RNA (28) and adenoviral VAI RNA (11) which are not
perfect dsRNAs. Results presented here show that the P69 isozyme can be
activated maximally even by a 25-bp dsRNA. Moreover, unlike 9-2, P69
was activated equally well by shorter or longer dsRNAs even at
subsaturating concentrations. However, the shortest dsRNA tested, 15-bp
dsRNA, behaved differently. It was a poor activator even at high
concentrations. It suggests that more than one complete helical turn of
the dsRNA may be necessary for optimum P69 recognition and its
activation. This observation is reminiscent of the length requirement
of dsRNA for activation of PKR, another class of dsRNA-activated enzyme
(29). Similarly, like PKR (23), the lack of activation of P69 by
2'-O-methylated dsRNA indicates that free 2'-OH groups on
the RNA are necessary for its interaction, a conclusion supported by
its lack of activation by dsDNA or DNA-RNA hybrids. These observations
revealed remarkable mechanistic similarities between the two classes of
dsRNA-activated enzymes, 2-5(A) synthetase and PKR. Such similarities
were somewhat unexpected in view of the known differences of their
relevant properties: the dsRNA binding motifs of PKR are not present in P69; PKR, but not P69, is inhibited at high concentrations of dsRNA and
dsRNA-binding of PKR is much stronger as revealed by the lack of
dissociation of the PKR·dsRNA complex even at 0.5 M NaCl
(30). As discussed above, it is not apparent why P69, but not 9-2, can
synthesize longer 2-5(A) oligomers. Since our data indicates that
2-5(A) chain elongation is a non-processive reaction, binding of
shorter 2-5(A) molecules, as acceptors of the next AMP, may be more
efficient for P69 than 9-2. In this respect, it is interesting to note
that higher 2-5(A) oligomer formation by P69 was also impaired at low
dsRNA concentrations or when the activator was the short 15-bp dsRNA
(Fig. 7, A and B). Thus, it appears that optimal
interaction of dsRNA with the P69 protein not only dictates its ability
to catalyze the 2'-5'-phosphodiester bond formation but also influences
its choice of acceptor molecules such as ATP or 2-5(A) oligomers.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
for 12 h. This RNA were reverse transcribed by
priming with random hexamers using reverse transcriptase kit (Life
Technologies, Inc.) according to the manufacturer's instructions,
followed by PCR using primers (primer 1:
GGCCGAATTCCATATGATGGGAAATGGGGAGTCC; primer 2:
CCGGGTCGACTTAAAGCTTGATGACTTTTACCGGCAC) specific to 5' and 3' end
sequences of P69, respectively. The PCR cycles were (i) 95 °C for 5 min; (ii) 95 °C for 1 min, 50 °C for 2 min, 72 °C for 1 min
(30 cycles); and (iii) 72 °C for 10 min. The full-length PCR product
was purified by low melting-agarose gel electrophoresis and cloned into
pCRII vector (TA cloning kit, Invitrogen). To examine the protein
production from the construct, it was translated in vitro in
rabbit reticulocyte lysate (TNT rabbit reticulocyte lysate system,
Promega), and tested for 2-5(A) synthetase activity as mentioned
earlier (12). The PCR product was excised out from pCRII vector with
NdeI and SalI, which were incorporated in the PCR
primers for the convenience of subsequent cloning, and cloned into the
same sites of pET28a vector (Novagen), which puts a hexahistidine tag
at the NH2 terminus of P69.
-mercaptoethanol, 0.1%
Nonidet P-40, 1 mM phenylmethylsulfonyl fluoride, 2 µg/ml
aprotinin, 1 µg/ml leupeptin, and 1 µg/ml pepstatin, and lysed by
sonication of six 15-s pulses. Clarified cell lysate was prepared by
centrifuging at 30,000 × g for 15 min and applied to
Ni-NTA beads (Qiagen). For 1 ml of cell extract, a 0.2-ml bead suspension was used. Prior to loading with the cell extract, beads were
washed twice in the binding buffer (300 mM NaCl, 20 mM Tris-Cl, pH 7.4, 10% glycerol, 10 mM
imidazole 5 mM
-mercaptoethanol, 0.3% Triton X-100, 1 mM phenylmethylsulfonyl fluoride, 2 µg/ml aprotinin, 1 µg/ml leupeptin, and 1 µg/ml pepstatin). Cell extract was diluted
1:1 (v/v) with the binding buffer, the final imidazole concentration
was adjusted to 10 mM and applied to the beads for binding
at 4 °C with shaking on a rotary shaker. After 2 h, beads were
centrifuged and washed for 15 min each: once with binding buffer, three
times with washing buffer A (binding buffer, with the NaCl and
imidazole concentrations at 450 and 25 mM, respectively), and once with washing buffer B (washing buffer A, with 30 mM imidazole). Protein was eluted from the beads with
elution buffer (450 mM NaCl, 20 mM Tris-Cl, pH
7.4, 10% glycerol, 100 mM imidazole, 5 mM
-mercaptoethanol, 0.03% Triton X-100, 1 mM
phenylmethylsulfonyl fluoride, 2 µg/ml aprotinin, 1 µg/ml
leupeptin, and 1 µg/ml pepstatin; volume, 0.5 ml for 1 ml of original
cell extract). The eluted protein was then dialyzed against 125 mM NaCl, 20 mM Tris-Cl, pH 7.4, 10% glycerol
for 12 h at 4 °C. Final yield of the purified protein was about
5 µg/150-mm plate. Purified protein was stored at
80 °C in
aliquots. Protein quantifications were done using the Bio-Rad's
Protein assay reagent according to the manufacturer's protocol.
-32P]ATP (specific
activity 800 Ci/mmol), and 50 µg/ml poly(I):poly(C) in a 10-µl
volume, and incubated for 4 h at 30 °C. The reaction was
stopped by heating for 5 min at 95 °C. The reaction products were
treated with calf intestinal alkaline phosphatase (0.3 units/µl, for
3 h at 37 °C) and analyzed by thin layer chromatography (13). Alternatively, the reaction products were analyzed by gel
electrophoresis on 20% polyacrylamide gel in the presence of 7 M urea (14). One microliter from a 10-µl heat-inactivated
reaction mixture was diluted in 4 µl of gel loading buffer (25%
formamide, 0.5% bromphenol blue, 0.5% xylene cyanol), from which 2 µl of each sample was loaded on alternate lanes and electrophoresed
for 4-5 h at 1600 V until the bromphenol blue of the loading dye ran
halfway through the gel, which ensured the retention of unused ATP. At the end of the electrophoresis, the gel was transferred on a x-ray film
support, covered with a Saran Wrap and directly exposed for 12 h
to a storage phosphor screen. The amount of radioactivity in each spot
was quantified using Imagequant software in a PhosphorImager (Molecular
Dynamics). The amount of ATP polymerized by the enzyme for each
reaction was determined by the following method. In every experiment, a
blank sample without the enzyme was included in the incubation, which
was processed in the same way as the experimental samples. After
analyzing the products by gel electrophoresis, the total radioactivity
in each lane was quantified and normalized with respect to the blank
sample lane to normalize for loading variations. The PhosphorImager
counts obtained in the blank sample lane was equivalent to 50 nmol of
ATP, present in a 10 µl of reaction mixture. The nanomoles of ATP
polymerized in each reaction was then determined by comparing the total
counts from 2-5(A) products with the blank lane. In Fig. 6 data were
plotted and fitted with appropriate equations using Prism software
(Graph Pad Inc.)
-meraptoethanol,
and 0.05% Triton X-100. 8 µg of either wild type or mutant protein
was diluted in 400 µl of the above buffer and applied to the column
and chromatographed at a flow rate of 7 ml/h. 500-µl fractions were
collected and protein from 400 µl of each alternate fractions were
concentrated by Ni-affinity chromatography, and analyzed by SDS-PAGE.
Gels were stained with Coomassie Blue, dried, and P69 bands were
quantified for plotting as a chromatogram.
![]()
RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

View larger version (14K):
[in a new window]
Fig. 1.
Activity of P69 expressed in vitro
and in E. coli. A, 2-5(A) synthetase
activity of in vitro translated P69. Lane 1, P69;
lane 2, no addition. B, Western blot of
NH2-terminal hexahistidine-tagged P69 partially purified
from E. coli.
P69 was expressed and partially purified
using nickel affinity column as described earlier (11). Western
blotting was done using anti-histidine antibody. C, activity
assay of partially purified P69 and 9-2 expressed in E. coli.
, lane 1, vector control; lane 2, 9-2; lane 3, P69.

View larger version (18K):
[in a new window]
Fig. 2.
Effect of myristoylation and hexahistidine
tag on enzyme activity. A, activity assay of
myristoylation mutants of P69. The wild type and mutant proteins were
made by in vitro translation. The amount of each
radiolabeled protein was quantified and equal amounts of proteins were
assayed for each sample. Lane 1, wild type P69; lane
2, G2A mutant; lane 3, G2D mutant; and lane
4, DNA control. B, activity of in vitro
translated NH2-terminal hexahistidine-tagged P69.

View larger version (31K):
[in a new window]
Fig. 3.
Purification of active P69 in insect
cells. A, NH2-terminal hexahistidine-tagged
P69 protein was expressed in insect cells and purified as discussed
under "Materials and Methods," electrophoresed on a 8%
SDS-polyacrylamide gel, and visualized by Coomassie Blue staining.
B, activity assay of purified recombinant P69. For each
lane, 30 ng of protein was incubated in a 10-µl reaction with 50 µg/ml poly(I):poly(C) and 1 mM ATP for indicated time.
2-5(A) products were analyzed by gel electrophoresis.
Purification of recombinant P69

View larger version (17K):
[in a new window]
Fig. 4.
Physical characterization of purified
P69. A, the recombinant P69 exists as a dimer. Purified
proteins were analyzed by chromatography on a Sephacryl S300 column.
Proteins present in each alternate fraction was analyzed as described
under "Materials and Methods" and presented as percent of total.
The positions of the different molecular weight markers are noted at
the top. B, P69 binding to lectins. Purified protein (200 ng) was used for binding to wheat germ agglutinin-Sepharose (lane
1); ConA-Sepharose (lane 2), or Sepharose 6MB
(lane 3). After washing, samples were eluted with SDS-PAGE
loading buffer and analyzed by Western blotting. In lane 4,
purified protein (20 ng) was loaded as positive control.

View larger version (16K):
[in a new window]
Fig. 5.
Effect of glycosylation on P69 activity.
A, affinity purified P69 from tunicamycin treated
(lane 1) and untreated (lane 2) cells. H5 cells
were treated with 10 µg/ml tunicamycin, P69 proteins from treated and
untreated cells were purified as described under "Materials and
Methods." A Coomassie Blue-stained electrophorogram is shown.
B, lectin binding of unglycosylated (lane 1) and
glycosylated (lane 2) P69. 200 ng of purified protein for
each sample was used for binding to ConA-Sepharose as described above.
After binding, samples were analyzed by Western blotting with anti-His
antibody. C, activity assay of unglycosylated and
glycosylated P69. 1 µg/ml purified protein for each sample was
assayed; products were analyzed and quantified.

View larger version (15K):
[in a new window]
Fig. 6.
Kinetic properties of purified P69.
A, dependence of 2-5(A) synthesis on enzyme concentrations.
Different amounts of proteins were incubated for 4 h under
standard assay conditions, followed by product analysis by thin layer
chromatography. B, time course of 2-5(A) synthesis. For each
point, 1 µg/ml protein was assayed for the indicated length of time.
C, synthesis of 2-5(A) as a function of substrate
concentration. 0.8 µg/ml protein was assayed for 4 h. The
Km for ATP (2.1 mM) was determined by
fitting the data points with Michaelis-Menten equation. The
inset shows the reciprocal plot of the same data.
D, double-stranded RNA activation profile of P69. Purified
protein (1 µg/ml each) was incubated for 4 h in presence of
different concentrations of poly(I):poly(C), and the products were
analyzed by thin layer chromatography.
Enzymatic properties of purified P69

View larger version (41K):
[in a new window]
Fig. 7.
Non-processive synthesis of 2-5(A) by
P69. Four samples containing 1 µg/ml protein were incubated in
standard reaction mixture for 3 h. At the end of incubation, one
reaction mixture was directly analyzed by gel electrophoresis
(lane 1), and the other three were subjected to Ni-NTA
agarose (lanes 2 and 4) or agarose (lane
3) binding as follows. 10 µl of reaction mixture was diluted
with 40 µl of binding buffer (20 mM Tris-Cl, pH 7.5, 20 mM magnesium acetate, 2.5 mM dithiothreitol),
applied to Ni-NTA beads, and incubated for 2 h at 4 °C.
Following the incubation, beads were washed twice with the binding
buffer, and resuspended in 10 µl of binding buffer of which 5 µl,
which is 5 times compared with lane 1, were analyzed by gel
electrophoresis (lanes 2 and 3). To show that the
enzyme remained bound to Ni-NTA agarose, the bound enzyme was
reincubated for 3 h with 50 µg/ml poly(I):poly(C) and 5 mM ATP, and the products were analyzed in lane
4.

View larger version (42K):
[in a new window]
Fig. 8.
dsRNA activation characteristics of P69.
A, product profile of 2-5(A) synthesis by different sized
dsRNA. The assay was done under standard conditions in the presence of
20 µg/ml dsRNA for 3 h. B, product profiles of 2-5(A)
synthesized in response to 15- and 25-bp dsRNA at various
concentrations (0.1, 0.5, 2.5, 5, 10, and 20 µg/ml) for 3 h.
C, activation of P69 by different sized dsRNA.
Double-stranded RNAs of various lengths (15 bp (a), 25 bp
(b), 55 bp (c), and 112 bp (d)) were
synthesized as described earlier (17) and used to test their activation
properties in standard assay condition (5 mM ATP, 3 h). D, effects of 2'-O-methylation. Product
profiles of 2-5(A) synthesized in presence of 50 µg/ml 34-bp dsRNA
(lane 1) or 50 µg/ml 36-bp dsRNA with
2'-O-methyl modifications.
![]()
DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
| |
FOOTNOTES |
|---|
* This work was supported in part by National Institutes of Health Grants CA-68782 and CA-62220.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of Molecular
Biology, The Lerner Research Institute, The Cleveland Clinic Foundation, 9500 Euclid Ave., NC20, Cleveland, OH 44195. Tel.: 216-444-0636; Fax: 216-444-0512; E-mail: seng{at}cesmtp.ccf.org.
The abbreviations used are: 2-5(A), 2'-5' oligoadenylate; dsRNA, double-stranded RNA; poly(I):poly(C), polyinosinic acid:polycytidilic acid; PCR, polymerase chain reaction; bp, base pair(s); PKR, dsRNA activated protein kinase; ConA, concanavalin A; PAGE, polyacrylamide gel electrophoresis.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
S. N. Sarkar, S. Pal, and G. C. Sen Crisscross Enzymatic Reaction between the Two Molecules in the Active Dimeric P69 Form of the 2'-5' Oligodenylate Synthetase J. Biol. Chem., November 15, 2002; 277(47): 44760 - 44764. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. N. Sarkar, M. Miyagi, J. W. Crabb, and G. C. Sen Identification of the Substrate-binding Sites of 2'-5'-Oligoadenylate Synthetase J. Biol. Chem., June 28, 2002; 277(27): 24321 - 24330. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. N. Sarkar, A. Ghosh, H.-W. Wang, S.-S. Sung, and G. C. Sen The Nature of the Catalytic Domain of 2'-5'-Oligoadenylate Synthetases J. Biol. Chem., September 3, 1999; 274(36): 25535 - 25542. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |