J Biol Chem, Vol. 274, Issue 30, 20818-20825, July 23, 1999

Characterization of the Cytoplasmic Domain of Interleukin-13 Receptor-^*

Patricia L. Orchansky, Rainbow Kwan, Frances Lee, and John W. Schrader

From The Biomedical Research Centre, The University of British Columbia, Vancouver V6T 1Z3, British Columbia, Canada

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Interleukin (IL)-13 and IL-4 are pleiotropic immunoregulatory cytokines that share many overlapping biological properties reflecting the fact that both can utilize a receptor complex composed of the IL-4 receptor- (IL-4R) chain and the IL-13R chain. The cytoplasmic domain of the IL-13R is 60 amino acids long and is essential for IL-13-dependent growth. It contains a Pro-rich domain in the membrane-proximal region and two Tyr residues. Here we show that a truncated IL-13R, lacking the 38 carboxyl-terminal residues but retaining the Pro-rich region, can support IL-13-dependent proliferation, although with reduced efficiency. A Y402F mutant of the cytoplasmic domain of IL-13R supported normal IL-13-induced growth. However, tyrosine phosphorylation of signal transducer and activator of transcription 3 (STAT3), which we show is induced by IL-13 and IL-4 in cells that express the IL-13R, was significantly reduced. The cytoplasmic domain of IL-13R was constitutively associated with STAT3, Tyk2, and Janus kinase 1 (JAK1). IL-13-induced tyrosine phosphorylation of IL-13R in vivo could not be detected using anti-Tyr(P) antibodies. A glutathione S-transferase fusion protein of the cytoplasmic domain of IL-13R was phosphorylated on tyrosine in vitro by JAK1, JAK3, and Tyk2, although the tyrosine phosphorylation events mediated by Tyk2 and JAK3 were not detectable using anti-phosphotyrosine antibodies. These data, together with the demonstration that IL-13R associates constitutively with Tyk2 and that Tyr-402 is involved in IL-13-induced phosphorylation of STAT3, suggest that the latter is mediated by Tyk2. Tyrosine phosphorylation of STAT3, which was not necessary for IL-13-induced proliferation, may account for some of the effects of IL-4 and IL-13 on the function of their targets.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Interleukin-13 (IL-13)¹ is a pleiotropic immune regulatory cytokine that shares structural and biological characteristics with IL-4. IL-4 and IL-13 promote growth of B cells (1), induce expression of germ line C transcripts, and direct naive B cells to switch to the synthesis of IgE and IgG4 (2). Both IL-4 and IL-13 induce expression of the low affinity receptor for IgE (FcRII/CD23) and up-regulate class II major histocompatibility complex antigen expression on B cells and monocytes (3, 4). Conversely, in monocytes, IL-4 and IL-13 down-regulate Fc receptor surface expression (4), inhibit synthesis of inflammatory cytokines, including tumor necrosis factor-, IL-1, IL-6, and IL-8 (4, 5), and induce monocyte/macrophage fusion and mannose receptor expression (6). Moreover, they suppress synthesis of IL-12 (4), a critical cytokine for differentiation of uncommitted T cells toward the Th1 phenotype (7), inhibit the induction of nitric oxide synthase (8), and down-regulate the lipopolysaccharide-dependent induction of cyclooxygenase-2 (9). IL-4-deficient mice (10) and IL-13-deficient mice (11) show impairment of Th2 cell development.

IL-4 and IL-13 activate similar signal transduction pathways. Both induce activation of JAK1, but only IL-4 activates JAK3. IL-13, on the other hand, induces activation of Tyk2 but so too does IL-4 in cells that also respond to IL-13, such as human myeloid cells, B9, a mouse plasmacytoma cell lacking c (12-14), and premyeloid FD-5 cells transfected with the IL-13R gene (15). IL-13 and IL-4 induce tyrosine phosphorylation of the IL-4R chain (13, 16), insulin-receptor substrate 1 and 2 (IRS-1/2) (13), and STAT6 (17).

The overlapping activities of IL-4 and IL-13 reflect the existence of common receptor components, as revealed by receptor cross-competition studies (18, 19). The best characterized form of the IL-4 receptor is composed of a 140-kDa transmembrane glycoprotein (IL-4R) that binds IL-4 with a K_d of 50-600 pM depending on the cell type (20-23), and the c chain of the IL-2 receptor which, upon association with the complex of IL-4 and IL-4R, results in a 2-3-fold increase in affinity for IL-4 (24, 25). Neither IL-4R nor c, alone or together, binds IL-13. Novel receptor subunits that specifically bind IL-13 (IL-13R) have been identified in mouse (26) and human (27). IL-13R has an apparent molecular mass of 60-70 kDa and binds IL-13 with a K_d of 2-10 nM when transfected alone into COS cells (26) or 293 fibroblasts (27). However, when hu-IL-13R was cotransfected with hu-IL-4R into 293 cells, or mu-IL-13R was transfected into CTLL-2 cells that express IL-4R, the K_d values for human or murine IL-13 were 400 and 75 pM, respectively (26, 27), suggesting that IL-4R and IL-13R formed a higher affinity complex with IL-13. IL-13R is a transmembrane glycoprotein with a short cytoplasmic domain of 60 amino acids. This region exhibits 95% amino acid identity in the murine and human species (28). It contains a membrane-proximal Pro-rich region, analogous to those that occur in other members of the cytokine receptor superfamily and are thought to be involved in activation of JAK kinases. The carboxyl-terminal region contains two tyrosine residues, Tyr-399 and Tyr-402, the distal one in a YXXQ sequence motif that is a consensus sequence for binding of the SH2 domain of STAT3 (29). Another transmembrane protein that binds IL-13 and has a short cytoplasmic domain has been identified in humans (30) and mice (31).

We have previously shown that a truncated IL-13R encoding the extracellular and transmembrane domains but lacking the cytoplasmic domain failed to stimulate detectable biological or biochemical responses to IL-13 in terms of JAK1, Tyk2, IL-4R, IRS-2, and STAT6 phosphorylation and proliferation (15). Here we show that a mutant IL-13R that contains only the membrane-proximal Pro-rich sequence and six carboxyl-terminal residues supported IL-13-induced cell proliferation, although with a diminished efficiency. Mutation of Tyr-402 of IL-13R did not affect IL-13-induced mitogenesis but reduced the level of tyrosine phosphorylation of STAT3, which we show is induced by IL-13 and IL-4 when they signal through the IL-13R. Although we failed to detect IL-13-induced tyrosine phosphorylation of IL-13R in vivo, GST protein fused to the cytoplasmic domain of IL-13R was efficiently phosphorylated on tyrosine residues in vitro by JAK1, JAK3, and Tyk2. However, only Tyk2 and JAK1 associated with the IL-13R in vivo, in a direct interaction not mediated by IL-4R. Taken together, the results suggest the existence of complex interactions between IL-13R, tyrosine kinases, and STAT3.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Cell Lines and Reagents-- FD-5 cells (32), a subclone of the premyeloid cell line FDMACII, are dependent upon IL-3, IL-4, GM-CSF, or CSF-1 for proliferation. FDCP-1 cells, a myeloid cell line, are dependent upon IL-3 or GM-CSF for proliferation. Cells were passaged in RPMI 1640 medium, supplemented with 10% fetal bovine serum, 20 µM 2-mercaptoethanol, 100 units of penicillin/streptomycin, and either 2% (v/v) L cell conditioned media (LCCM) containing CSF-1 for FD-5 cells or 2% (v/v) WEHI-3 conditioned media (W3) containing IL-3 for FDCP-1 cells. Crude preparations of chemically synthesized IL-4, IL-13, and GM-CSF were kindly provided by Dr. I. Clark-Lewis (The Biomedical Research Center, University of British Columbia, Canada), and recombinant IL-4 and IL-13 were purchased from Intergen and R & D Systems, respectively. Antiserum against STAT6, STAT3, Tyk2, and IL-4R (Western blotting) were obtained from Santa Cruz Biotechnology. Antiserum against JAK1, JAK3, Ser(P)-STAT3, and mAb against phosphotyrosine (4G10) were obtained from Upstate Biotechnology Inc. Other anti-phosphotyrosine Abs used in this study were from Zymed Laboratories Inc. (sampler pack), Santa Cruz Biotechnology (mAb PY99), and Transduction Laboratories (RC20:HRP). Anti-mu-IL-4R mAb (immunoprecipitation and FACScan analysis) was purchased from Genzyme; anti-FLAG mAb soluble or conjugated to Sepharose beads was from Sigma; antiserum against glutathione S-transferase (GST) was from Molecular Probes, and glutathione-Sepharose was from Amersham Pharmacia Biotech.

Recombinant Plasmids-- pEB-13R (26), a plasmid encoding the full-length IL-13R cloned into a pEF-BOS vector (33), was digested with XbaI generating two fragments of 5.4 and 1.2 kb. The 1.2-kb fragment, encoding the mature protein sequence for IL-13R, was purified from 0.8% agarose gels and ligated into pBluescriptIISK, creating the plasmid pBS-13R. To generate the plasmid pEB-13386 that encodes the extracellular, transmembrane, and 21 proximal amino acid residues of the cytoplasmic domain of IL-13R, a double-stranded oligonucleotide encoding a stop codon at position 386 of the protein sequence was cloned into the cDNA of IL-13R. Briefly, oligonucleotides 5'p-TTAAGATCATTATATTTCCTCCAATTCCTGATCCCGGGAAGATTTTTAAAGAATAGGTAGC-3' and 5'pTTAAGCTACCTATTCTTTAAAAATCTTCCCGGGATCAGGAATTGGAGGAAATATAATGATC-3' (where p indicates phosphate) were annealed and cloned into calf intestinal phosphatase-treated AflII-linearized pBS-13R. The new plasmid pBS-13386 was digested with XbaI, and the 1.25-kb fragment was subcloned into the expression vector pEF-BOS. The plasmid pEB-13YF that encodes the full-length IL-13R with a mutation of Tyr-402 to Phe was generated by polymerase chain reaction-based site-directed mutagenesis (34). Briefly, the wild-type 0.2-kb AflII-XbaI fragment of pBS-13R was replaced with the 0.2-kb AflII-XbaI fragment of the polymerase chain reaction product generated using the following four primers: GGAGCAAAACTCCACCTTCTAC, GACATCTTTGAGAAACAATCC, GGATTGTTTCTCAAAGATGTC, and TGTAATACGACTCACTATAGGGCGATT. The new plasmid pBS-13YF carrying the mutated tyrosine codon was digested with XbaI, and the 1.2-kb fragment was subcloned into the expression vector pEF-BOS. The plasmid pGEX-13RCD that encodes the cytoplasmic domain of IL-13R fused to GST was generated as follows: pBS-13R was digested with XbaI and AflII generating three fragments of 3.0, 1.0, and 0.2 kb. The 0.2-kb fragment, encoding the cytoplasmic domain of IL-13R, was purified from 1.2% agarose gels, blunt-ended with Klenow polymerase, and cloned into a SmaI site in the polylinker of pGEX-4T-3. The identity of the constructs was confirmed by restriction mapping and sequencing.

Transfections and Screening of Protein Expression-- FD-5 and FDCP-1 cells, grown in RPMI containing 10% FCS, and either 2% LCCM or W3, respectively, were washed and resuspended in transfection buffer (25 mM Hepes; 0.75 mM Na₂HPO₄; 140 mM KCl; 5 mM NaCl; 2 mM MgCl₂; 0.5% Ficoll 400) at a concentration of 1.3 × 10⁷ cells/ml. For each transfection, 1 × 10⁷ cells were mixed with 1 µg of pPGK/Neo, a plasmid conferring neomycin resistance, alone or together with 10 µg of either pEB-13R, pEB-13386, or pEB-13YF cDNA, and were subjected to electroporation using a Bio-Rad gene-pulsar at 960 microfarads and 280 or 300 V for FD-5 or FDCP-1, respectively. In parallel, 10⁷ cells were electroporated without DNA, to subsequently monitor neomycin-induced death, or with 1 µg of pPGK/Neo alone, to monitor potential transfection-induced phenotypic alterations. After transfection, these groups of cells were cultured in the appropriate media for 48 h and then transferred to selection media in 96 well-plates at 10⁴ cells/well. FD-5 cells were selected in RPMI containing 10% FCS, 200 µg/ml G418, and 2% LCCM. FCDP-1 cells were selected in RPMI containing 10% FCS, 300 µg/ml G418, and 2% W3. Individual colonies of neomycin-resistant cells were cloned and propagated for assays (cell proliferation and protein tyrosine phosphorylation of whole cell lysates). Cells were tested for expression of wild-type (FD-13R or FDCP-13R), partially truncated IL-13R (FD-13386 or FDCP-13386), and mutated IL-13R (FD-13YF or FDCP-13YF) by FACScan analysis using M2, a mAb against FLAG, and goat anti-mouse IgG-FITC. A representative clone from each cell population was recloned by limit dilution and used for further experiments. Expression of the second functional chain of the receptor was tested by FACScan analysis using anti-IL-4R Ab and goat anti-rat IgG-FITC.

Biological Assays-- FD-5 and FDCP-1 transfectants were washed three times with Hanks' buffered salts supplemented with 2% (v/v) FCS and plated at 10,000 or 25,000 cells per well, respectively, in 96-well tissue culture plates in the presence of various concentrations of recombinant mu-IL-4 and recombinant mu-IL-13. As positive control, cells were incubated with 1 µg/ml synthetic mu-GM-CSF. After 5 days' incubation for FD-5 transfectants and 2 days' incubation for FDCP-1 transfectants, MTT (3,4,5-dimethyltiazole-2,5-diphenyltetrazolium bromide) was added at a concentration of 375 µg/ml for 4 h. Cells were lysed in 6% SDS, 20% N,N-dimethylformamide, and the optical density was measured at 550 nm (35). The results were expressed as a percentage of the maximal MTT incorporation observed in cultures stimulated with GM-CSF. Experiments were done in triplicate, and standard errors were less than 10%. Results are representative of several independent experiments.

Immunoprecipitation, Electrophoresis, and Immunoblotting Analysis-- To investigate the biochemical effects of stimulation with different cytokines FD-5 transfectants were placed in RPMI, 10% FCS, 0.2% LCCM for 16 h, washed twice with serum/factor-free media containing 20 mM Hepes, and incubated at 5 × 10⁷ cells/ml of the same media at 37 °C for 1 h. Cells were then stimulated at 37 °C with synthetic IL-4 (20 µg/ml), synthetic IL-13 (20 µg/ml) for 10 min, or left untreated. Cells were lysed in lysis buffer (20 mM Tris, pH 7.6; 150 mM NaCl; 1% Nonidet P-40; 2 mM EDTA; 1 mM sodium orthovanadate; 1 mM sodium molybdate; 10 mM sodium fluoride; 1 mM phenylmethylsulfonyl fluoride; 10 µg/ml leupeptin; 0.7 µg/ml pepstatin; 10 µg/ml aprotinin). Lysates were cleared by centrifugation and incubated with antisera against JAK1, JAK3, Tyk2, STAT3, STAT6 or with mAbs against IL-4R or FLAG for 2-16 h at 4 °C followed by 1-2 h with Protein A- or Protein G-Sepharose. The beads were washed three times with cold lysis buffer containing decreasing concentrations of detergent and heated in Laemmli sample buffer (36) containing dithiothreitol at a concentration of 40 mM final. The samples were subjected to 7.5% SDS-polyacrylamide gel electrophoresis. The gels were then equilibrated in transfer buffer (20 mM Tris; 150 mM glycine; 20% methanol) and transferred to polyvinylidene difluoride (PVDF) membranes by electrophoresis toward the anode at 200 mA for 2 h in a Bio-Rad transblot apparatus (37). The PVDF membranes were blocked in 4% bovine serum albumin in TBST (10 mM Tris, pH 7.5; 150 mM NaCl; 0.1% Tween 20) for 4-16 h at room temperature and incubated for 2 h with anti-Tyr(P) mAb 4G10 (0.25 µg/ml) (or other anti-phosphotyrosine Abs as described in the text), anti-FLAG mAb (1 µg/ml), or antisera against JAK1 (1:1000), JAK3 (1:1000), Tyk2 (1:500), STAT3 (1:1000), STAT6 (1:2000), IL-4R (1:500), or Ser(P)-STAT3 (1:1000) in TBST, 1% bovine serum albumin. The blots were further incubated with goat anti-mouse or goat anti-rabbit IgG antibody conjugated to horseradish peroxidase (DAKO A/S, Denmark) and subsequently developed with the enhanced chemiluminescence assay as described by the manufacturer (ECL kit, Amersham Pharmacia Biotech). Membranes immunoblotted with anti-Tyr(P) mAb and anti-Ser(P)-STAT3 were stripped and blotted with the specific immunoprecipitating antibody.

In Vitro Kinase Assay-- FD5-13R cells (3-6 × 10⁶) were cultured overnight in a suboptimal concentration of LCCM, stimulated with IL-4 or IL-13, and lysed as described previously. Lysates of cells stimulated with IL-4 were immunoprecipitated with JAK1 or JAK3 antisera; lysates of cells stimulated with IL-13 were immunoprecipitated with Tyk2 antisera, as described previously. The beads were washed three times with cold lysis buffer containing decreasing concentrations of detergent, twice more with 100 mM Tris (pH 7.4), 500 mM LiCl₂, and once with kinase buffer (20 mM Tris (pH 7.4), 10 mM MgCl₂, 10 mM MnCl₂). Immunoprecipitates were incubated with 20 µl of kinase buffer containing 10 µCi [-³²P]ATP and 1 µg of either IL-13R cytoplasmic domain-GST fusion protein or GST protein alone. After 20 min at room temperature, SDS sample buffer was added to stop the reaction. Samples were electrophoresed onto 10% SDS-polyacrylamide gel electrophoresis and transferred to PVDF membranes, and phosphorylation was detected by autoradiography. After ³²P-protein decay, membranes were washed with TBST and proteins immunoblotted with anti-Tyr(P) mAbs, as described previously. A duplicate membrane was treated with 1 M KOH at 55 °C for 2 h to dephosphorylate Thr/Ser residues (38).

GST Fusion Protein and Affinity Purification-- The IL-13R cytoplasmic domain-GST fusion protein as well as GST protein alone were expressed in Escherichia coli DH5 cells under isopropyl-1-thio--D-galactopyranoside induction. GST fusion proteins were loaded onto glutathione-Sepharose 4B columns and eluted with 20 mM reduced glutathione. Affinity purified proteins were typically 90-95% homogeneous as determined by SDS-polyacrylamide gel electrophoresis/Coomassie Blue staining and immunoblotting with anti-GST antibodies.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Generation of Transfectants Expressing the Wild-type or Mutant IL-13R-- The expression plasmid pEB-13R (Fig. 1A, top) contains the coding sequence for the full-length IL-13R cDNA. The sequence encoding the carboxyl-terminal region of IL-13R was deleted by introduction of a stop codon at position 1159 of the cDNA. The new expression plasmid pEB-13386 (Fig. 1A, middle) encodes the extracellular, transmembrane, and 22 proximal amino acid residues of the cytoplasmic domain including the Pro-rich region. A point mutation at position 1204 of the cDNA was introduced by polymerase chain reaction-mediated site-directed mutagenesis. The plasmid generated in this way, pEB-13YF (Fig. 1A, bottom), encodes a full-length IL-13R in which Tyr-402 has been substituted by Phe.

View larger version (27K): [in this window] [in a new window]   Fig. 1.   Construction and expression of full-length and mutated IL-13R. A, the expression vector pEB-13R encodes the full-length IL-13R; pEB-13386 encodes a truncated IL-13R containing the extracellular, transmembrane, and 22 cytoplasmic proximal amino acid residues containing the Pro-rich region; and pEB-13YF encodes the full-length IL-13R with a substitution of Tyr-402 by Phe. B, FD-5 (thin line), and FD5-13R, FD-13386, and FD-13YF cells (black thick lines) were incubated sequentially with anti-FLAG mAb and goat anti-mouse Ig-FITC. Control cells were incubated with the second antibody alone. Fluorescence intensity was detected by flow cytometry. C, FD-5, FD-13R, FD-13386, and FD-13YF were incubated sequentially with anti-IL-4R antibody and goat anti-rat Ig-FITC (shaded) or with the second antibody alone (open), and fluorescence intensity was assessed by flow cytometry. D, FDCP-1 (thin line), FDCP-13R, FDCP-13386, and FCDP-13YF cells (thick lines) were incubated sequentially with anti-FLAG mAb and goat anti-mouse Ig-FITC. E, FDCP-1, FDCP-13R, FDCP-13386, and FDCP-13YF were incubated sequentially with anti-IL-4R antibody and goat-anti-rat-Ig-FITC (shaded) or with the second antibody alone (open) and fluorescence intensity assessed by flow cytometry.

The mutated and full-length receptor expression plasmids were used to transfect FD-5 and FCDP-1 cells. Both cell lines are unresponsive to IL-13 stimulation, but respond to IL-4, in the case of FD-5 growing continuously and in the case of FDCP-1 exhibiting prolonged survival but not long term growth. Establishment of FD-5 cells expressing the wild-type IL-13R (FD-13R) and propagation conditions were previously described (15). For each mutated form of IL-13R transfected into FD-5 and FDCP-1 cells, neomycin-resistant colonies were individually cloned and analyzed for IL-13R expression by fluorometric studies using anti-FLAG mAb and FITC conjugated to goat anti-mouse antibody. FACS analysis of FD-5 clones showed that 4 out of 6 clones analyzed expressed IL-13386 and 12 out of 12 clones analyzed expressed IL-13YF, all of them exhibiting the same level of receptor expression for each transfected population (results not shown). In the case of FDCP-1 cells, 6 out of 6 and 7 out of 12 clones analyzed expressed IL-13386 and IL-13YF receptor, respectively, with similar levels of expression for each different population. Within each transfected cell type, each clone responded equally in terms of proliferation or survival in response to specific cytokines. Therefore, only one clone of each transfected type was used for further experiments. FD-5 and FDCP-1 cells transfected with pPGK/Neo alone responded normally to IL-4 in terms of proliferation and survival, indicating that expression of this plasmid did not interfere with IL-4 signaling. The transfected receptors were expressed as surface proteins as detected by FACScan analysis. Fig. 1B shows that whereas FD-13R and FD-13YF cells express equivalent amounts of receptor protein, the levels of expression were 10-fold higher in FD-13386 cells. This differential level of expression between wild-type and IL-13386 receptor was also observed in FDCP-1 cells (Fig. 1D). Importantly, endogenous murine IL-4R was expressed at equivalent levels on the surface of parental or transfected FD-5 (Fig. 1C) and FDCP-1 (Fig. 1E) cells, as determined by staining with anti-IL-4R Ab and goat anti-rat IgG-FITC and flow cytometry.

Biological Responses to IL-13-- To elucidate whether the Pro-rich region of IL-13R was sufficient to mediate responses to IL-13, we measured the effect of IL-13 on cellular proliferation and/or survival as determined by MTT incorporation. Fig. 2, A and C, shows that both FD-13386 and FDCP-13386 cells responded to IL-13 in a dose-dependent manner, although 30% less efficiently than cells expressing the full-length receptor, FD-13R and FDCP-13R, respectively. As expected, neither FD-5 (Fig. 2A) nor FDCP-1 (Fig. 2C) cells responded to IL-13. The ability of FDCP-1, FDCP-13R, and FDCP-13386 cells to respond to IL-4 was very similar (Fig. 2D). In the case of FD-5 cells and transfectants derived from them, the dose-response curves showed similar slopes at high and intermediate concentrations of IL-4, but a higher basal level at low concentrations of IL-4 for FD-13386 cells was observed (Fig. 2B).

View larger version (36K): [in this window] [in a new window]   Fig. 2.   Proliferation of FD-5 and FDCP-1 transfectants in response to IL-4 and IL-13. FD-5 and FDCP-1 transfectants were plated at a concentration of 10,000 and 25,000 cells/well, respectively, in 96-well plates and incubated with increasing concentrations of recombinant IL-4 or IL-13 for 5 and 2 days, respectively. MTT reagent was added for 4 h; cells were lysed and absorbance values were measured at 550 nm. Percent cell proliferation indicates the growth/survival induced by IL-4 or IL-13 in comparison to 100% growth/survival induced by 1 µg/ml synthetic GM-CSF. Standard errors were less than 10%. The results are representative of 5 independent experiments.

To analyze the contribution of Tyr-402 of IL-13R to IL-13-induced responses, proliferation was tested in FD-13YF and FDCP-13YF cells. Fig. 2, A and C, showed the same level of response to IL-13 in FD-13YF and FDCP-13YF as compared with their wild-type counterparts. Thus, Tyr-402 did not appear to play a crucial role in IL-13-induced proliferation or increased survival. Moreover, responses to IL-4 were similar in FD-13YF (Fig. 2B) and FDCP-13YF (Fig. 2D) and cells expressing the full-length IL-13R, FD-13R, and FDCP-13R.

Phosphorylation of STAT3-- We noted that Tyr-402 of the IL-13R is part of a YXXQ sequence motif that has been previously identified as a consensus sequence for binding the SH2 domain of STAT3 binding (29). To determine whether this Tyr residue plays a role in STAT3 activation, FD-5, FD-13R, and FD-13YF cells were stimulated with IL-4, IL-13, or left untreated, and tyrosine phosphorylation of STAT3 was determined. Fig. 3A, shows that STAT3 was phosphorylated on tyrosine residues in response to either IL-4 or IL-13 in FD5-13R cells. In contrast in the parental FD-5 cells, neither IL-13 nor IL-4 induced tyrosine phosphorylation of STAT3, indicating that the IL-13R was required for IL-13 and IL-4 to induce phosphorylation of STAT3. The level of IL-13-induced phosphorylation of STAT3 was greatly reduced in FD-13YF cells. In both, FD-13R and FD-13YF cells, IL-13 induced higher levels of tyrosine phosphorylation of STAT3 than IL-4. The much lower levels of IL-13-induced phosphorylation of STAT3 in FD-13YF cells suggests that STAT3 phosphorylation is greatly enhanced in the presence of Tyr-402. The decreased levels of IL-4- or IL-13-induced tyrosine phosphorylation of STAT3 in FD-13YF cells was specific for STAT3 as IL-4- or IL-13-induced phosphorylation of STAT6 was not reduced in FD-13YF cells (Fig. 3E).

View larger version (17K): [in this window] [in a new window]   Fig. 3.   Phosphorylation of STATs and association with IL-13R. FD-5, FD5-13R, and FD-13YF cells were stimulated with either synthetic IL-4 (4), synthetic IL-13 (13), or left untreated (). Cells were lysed and immunoprecipitated (I.P.) with specific antibodies, and membranes were immunoblotted (I.B.). Lysates of the equivalent of 5 × 107 cells were immunoprecipitated with either anti-STAT3 Ab (A-C) or anti-FLAG mAb (D) and immunoblotted with either anti-Tyr(P) mAb (A), anti-Ser(P)-STAT3 (C), or anti-STAT3 Ab (B and D). Lysates of the equivalent of 2 × 107 cells were immunoprecipitated with either anti-STAT6 Ab (E and F) or anti-FLAG mAb (G) and immunoblotted with either anti-Tyr(P) mAb (E) or anti-STAT6 Ab (F and G). C, STAT6 in lysates.

It has been reported that phosphorylation of Ser-727 on STAT3 might potentiate phosphorylation on Tyr-705. Fig. 5C shows that STAT3 was constitutively phosphorylated on Ser-727 in these cells. Constitutive phosphorylation of STAT3 on serine in NJBC cells has been previously reported (39).

Association of STAT3 with IL-13R-- To investigate the association of STAT3 with IL-13R, we used anti-FLAG antibodies to immunoprecipitate IL-13R from FD-13R and FD-13YF cells. The precipitates were immunoblotted with anti-STAT3 antibodies. We observed that STAT3 was constitutively associated with both wild-type and mutated IL-13R (Fig. 3D); however, the interaction with IL-13YF was slightly decreased indicating that even though Tyr-402 plays some role in stabilizing the interaction, it is not the major domain responsible for binding.

IL-13- and IL-4-induced Phosphorylation of Other Proteins-- We have previously shown that FD5-13R cells respond to IL-13 with tyrosine phosphorylation of JAK1 and Tyk2 and to IL-4 with tyrosine phosphorylation of JAK1, JAK3, and Tyk2. Moreover, both IL-4 and IL-13 induce tyrosine phosphorylation of IL-4R, STAT6, and IRS-2 (15). In FD-13386 cells stimulated with IL-4, the levels of tyrosine phosphorylation of all the above proteins were reduced (results not shown). Levels of tyrosine phosphorylation of these proteins were even lower in FD-13386 cells stimulated with IL-13. In that these cells grew continuously in IL-4 or IL-13, these data indicate that only a minor level of IL-4/IL-13-induced phosphorylation of intermediate substrates was sufficient to support proliferation of FD-13386 (Fig. 2A). Neither IL-13 nor IL-4 induced detectable levels of tyrosine phosphorylation of STAT3 in FD-13386 cells (results not shown).

In Vivo and in Vitro Phosphorylation of the IL-13R-- To determine whether phosphorylation of IL-13R was induced in response to IL-13 in vivo, FD-13R cells were stimulated and IL-13R was precipitated with anti-FLAG-mAb. Fig. 4A shows that at least two major proteins of ±75 and ±65 kDa were precipitated, consistent with the broad form of IL-13R (65-85 kDa) observed in chemical cross-linking studies (22, 23, 27). However, tyrosine phosphorylation of these proteins could not be detected by immunoblotting with anti-Tyr(P) mAb 4G10 (Fig. 4B). Furthermore, three other anti-phosphotyrosine Abs failed to detect tyrosine phosphorylation of IL-13R (results not shown).

View larger version (41K): [in this window] [in a new window]   Fig. 4.   In vivo and in vitro phosphorylation of IL-13R. FD5-13R cells were stimulated with either synthetic IL-4 (4), IL-13 (13), or left untreated (). Cells were lysed, immunoprecipitated (I.P.) with specific antibodies, and either immunoblotted (I.B.) or subjected to in vitro kinase assays (I.V.K.). Lysates of the equivalent of 1-3 × 107 cells were immunoprecipitated with anti-FLAG mAb and immunoblotted with either anti-FLAG mAb (A) or anti-Tyr(P) 4G10 mAb (B). A mock immunoprecipitation was included (C). Molecular mass standards in kDa are shown at the right side of the figure. The arrows in A indicate the bands corresponding to FLAG-tagged IL-13R. Lysates of the equivalent of 3-6 × 106 cells were immunoprecipitated with anti-Jak1 Ab (C), anti-Jak3 Ab (D), or anti-Tyk2 Ab (E) incubated with kinase buffer, [-32P]ATP, and IL-13R cytoplasmic domain-GST fusion protein (13) or GST alone (G) as alternative substrates. Phosphorylated samples were electrophoresed, transferred to PVDF membranes, and detected by autoradiography. After 32P decay, the membranes were immunoblotted with anti-Tyr(P) 4G10 mAb. The arrows denote the position of phosphorylated IL-13R cytoplasmic domain-GST fusion protein (13-GST) and the putative position of GST alone (GST).

Phosphorylation of the IL-13R was also tested in an in vitro kinase assay. JAK kinases were precipitated, and their ability to phosphorylate the IL-13R was tested using GST protein fused to the cytoplasmic domain of IL-13R or GST alone as substrates. Fig. 4, C-E (upper), shows that JAK1, JAK3, and Tyk2 can phosphorylate IL-13R in vitro. However, when the membranes were immunoblotted with anti-Tyr(P) mAb, only IL-13R phosphorylated by JAK1 was detected (Fig. 4C, bottom) but not IL-13R phosphorylated in vitro by Jak3 (Fig. 4D, bottom) or Tyk2 (Fig. 4E, bottom). Membranes were subjected to treatment at high pH with KOH to dephosphorylate serine/threonine residues (38). This treatment resulted in only a marginal decrease in the level of phosphorylation of GST-IL-13R fusion protein, indicating that ³²P labeling occurred mainly on Tyr residues (results not shown). Control experiments showed that the treatment with KOH successfully dephosphorylated other proteins phosphorylated on Ser/Thr residues. JAK2 did not phosphorylate the IL-13R as detected either by in vitro kinase assay or anti-Tyr(P) mAb (results not shown).

Association of JAK Kinases with IL-13R-- We have previously shown that FD-13R cells responded to IL-13 with tyrosine phosphorylation of JAK1 and Tyk2 but not JAK3 or JAK2 and to IL-4 with tyrosine phosphorylation of JAK1, JAK3, and Tyk2 but not JAK2 (15). To determine whether any of the JAK kinases that phosphorylated the IL-13R in vitro associate with IL-13R, we performed coprecipitation experiments. Fig. 5A shows that JAK1 and Tyk2 (Fig. 5B) but not JAK3 (Fig. 5C) were constitutively associated with the IL-13R. Nor was the IL-4R constitutively associated with IL-13R (Fig. 5D), demonstrating that the IL-13R interacted directly with JAK1 and Tyk2 and not through IL-4R. As expected, stimulation of the cells with IL-13 resulted in phosphorylation of JAK1 (Fig. 5A) and Tyk2 (Fig. 5B) but not JAK3 (Fig. 5C), whereas stimulation with IL-4 resulted in phosphorylation of all three kinases. The association of Tyk2 (but not JAK1) with IL-13R was increased following stimulation with IL-13 or IL-4. JAK3 was not tyrosine-phosphorylated in response to IL-13, but it was in response to IL-4; however, it did not associate with the IL-13R even upon IL-4 stimulation (Fig. 5C), ruling out the possibility of a trimeric (IL-4R·IL-13R·c) receptor complex.

View larger version (36K): [in this window] [in a new window]   Fig. 5.   Tyrosine phosphorylation of JAK kinases and IL-4R and association with IL-13R. FD5-13R cells were stimulated with either synthetic IL-4 (4), IL-13 (13), or left untreated (). Cells were lysed and immunoprecipitated (I.P.) with specific antibodies, and membranes were immunoblotted (I.B.). Lysates of the equivalent of 5 × 107 cells were immunoprecipitated with either anti-JAK1 Ab or anti-FLAG mAb and immunoblotted with either anti-Tyr(P) mAb or anti-JAK1 Ab (A). Lysates of the equivalent of 5 × 107 cells were immunoprecipitated with either anti-Tyk2 Ab or anti-FLAG mAb and immunoblotted with either anti-Tyr(P) mAb or anti-Tyk2 Ab (B). Lysates of the equivalent of 3 × 107 cells were immunoprecipitated with either anti-JAK3 Ab or anti-FLAG mAb and immunoblotted with either anti-Tyr(P) mAb or anti-FLAG mAb (C). Lysates of the equivalent of 5 × 107 cells were immunoprecipitated with either anti-IL-4R Ab or anti-FLAG mAb and immunoblotted with either anti-Tyr(P) mAb or anti-IL-4R Ab (D). Membranes probed with anti-Tyr(P) mAb were stripped and reprobed with the specific immunoprecipitating Ab.

Fig. 5D shows that both IL-4 and IL-13 can induce phosphorylation of the IL-4R as detected by anti-Tyr(P) mAb; however, IL-4R was only precipitated by anti-FLAG mAb after stimulation of cells with IL-13. These results might reflect higher stability of the complex in the presence of IL-13 and also the engagement and sequestration of IL-4R with c upon IL-4 stimulation. As expected, the IL-4R was detected when precipitated and immunoblotted with IL-4R antibodies, independently of the stimulation conditions. The results indicate that JAK1 and Tyk2 bind directly to IL-13R under these experimental conditions.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

We have previously shown that the cytoplasmic domain of IL-13R was necessary for biological and biochemical responses to IL-13 (15). Here we have performed a more detailed analysis of structure-function relationships in this relatively short 60 amino acid cytoplasmic domain. We show that the 22 membrane-proximal amino acids are sufficient to support IL-13-dependent proliferation albeit with reduced efficiency. We also show that Tyr-402, while not required for proliferative responses, did contribute to IL-13-induced tyrosine phosphorylation of STAT3. The cytoplasmic domain of IL-13R was shown to be constitutively associated with Tyk2, JAK1, and STAT3 and was phosphorylated in vitro by Tyk2, JAK1, and JAK3.

We and others (13, 15, 16) have previously shown that both IL-4 and IL-13 induce tyrosine phosphorylation of IL-4R. Here we formally demonstrate that association of IL-13R and IL-4R was not constitutive and occurred only after ligand binding (Fig. 5). Our demonstration that the IL-13R coprecipitated with JAK1 and Tyk2 from unstimulated cells thus suggests that IL-13R associates directly with these kinases and not through IL-4R. It has been reported that IL-4 and IL-13 can bind the trimeric complex of IL-4R·IL-13R·c (49, 50). Here we show that this is unlikely since JAK3, which is constitutively associated with c (51), did not coprecipitate with IL-13R under any conditions.

The truncated IL-13R386 retained the membrane-proximal Pro-rich region but lacked Tyr or Ser residues. The fact that cells expressing this mutant (FD-13386 and FDCP-13386) responded to IL-13 with 30% lower efficiency than cells expressing the wild-type receptor (Fig. 2) correlated with observations that IL-13-induced tyrosine phosphorylation of JAK1, Tyk2, STAT3, STAT6, and IRS-2 was greatly diminished in FD-13386 cells in comparison to FD-13R. These data are consistent with our results² showing that receptors able to mediate stimulation of only minor levels of phosphorylation nevertheless support ligand-dependent growth. Our results indicate that the Pro-rich region and 6 downstream amino acids, which based on experiments with other receptors of the family are likely to govern interactions with JAK kinases (40), are sufficient to support cell proliferation. The fact that the truncated receptor signaled with reduced efficiency could indicate that the carboxyl-terminal region of IL-13R mediates interactions with additional signaling molecules that enhance proliferation. Alternatively, the carboxyl-terminal 38 amino acids could be required for proper folding of the cytoplasmic domain and thus for appropriate presentation of the Pro-rich region or stabilization of the receptor complex. Sequences downstream of the Pro-rich region in the ligand-binding chain of other heterodimeric cytokine receptors are critical for function (41-45).

The IL-13R has two tyrosine residues in its cytoplasmic domain, one (amino acids 402-405) we noted is in a consensus YXXQ, which when phosphorylated is recognized by the SH2 domain of STAT3 (29). We have shown that both IL-13 and IL-4 induced tyrosine phosphorylation of STAT3 in FD-13R cells (Fig. 3). IL-4 was unable to induce phosphorylation of STAT3 in parental FD-5 cells indicating that the IL-13R chain was necessary for IL-4-induced activation of STAT3. Replacement of Tyr-402 with Phe resulted in decreased levels of IL-4- or IL-13-induced phosphorylation of STAT3, suggesting that Tyr-402 was phosphorylated in response to IL-4 and IL-13 and was important in activation of STAT3 by these cytokines. This decrease in IL-13- or IL-4-induced tyrosine phosphorylation of STAT3 mediated by the Y402F mutant of the IL-13R was specific for STAT3, as it was accompanied by normal levels of IL-4- or IL-13-induced tyrosine phosphorylation of STAT6. We also observed that IL-13R was constitutively associated with STAT3. This was specific as STAT6 did not associate with the IL-13R. In FD-13YF cells, association of STAT3 with the IL-13R was only slightly diminished, indicating that the constitutive interaction of STAT3 with the IL-13R did not require interaction of its SH2 domain with phosphorylated Tyr-402. Collectively, our data suggest a model where STAT3 is constitutively associated with the IL-13R through a non-SH2 domain interaction. When cells are stimulated with IL-13 or IL-4, a kinase is activated that phosphorylates IL-13R on Tyr-402, allowing the SH2 domain of STAT3 to interact with the phosphorylated Tyr-402. STAT3 could be phosphorylated on tyrosine residues by the same or another kinase. An alternative model proposes that the constitutive interaction of STATs with receptors occurs indirectly through JAK proteins (46-47). However, we saw no evidence that STAT3 coprecipitated with Tyk2 or JAK1 (results no shown), and thus we favor the notion that IL-13 R interacts directly with STAT3.

The kinase involved in phosphorylation of Tyr-402 of the IL-13R is probably Tyk2, as Tyk2 was associated with the IL-13R in vivo (Fig. 5) and Tyk2 could phosphorylate the IL-13R in vitro (Fig. 4). Our failure to detect tyrosine phosphorylation of IL-13R in IL-13-stimulated cells using anti-phosphotyrosine antibodies is consistent with the failure of a series of anti-Tyr(P) antibodies to detect tyrosine phosphorylation of IL-13R by Tyk2 in vitro (Fig. 4). In contrast, when IL-13R was phosphorylated in vitro by JAK1, the resultant phosphotyrosine was readily detected by anti-Tyr(P) antibodies (Fig. 4). Certainly our results demonstrating that the Y402F mutant is defective in mediated IL-13-induced phosphorylation of STAT3 suggest that Tyr-402 is phosphorylated in vivo in response to IL-13. We exclude JAK3 because it is not phosphorylated in response to IL-13 in vivo (Fig. 5).

We do not know the functional relevance of phosphorylation of STAT3 in response to IL-4 and IL-13. Certainly, evidence that the Y402F mutation of the IL-13R failed to affect IL-13-induced proliferation (Fig. 2) suggests that phosphorylation of STAT3 is not important in growth. We speculate that activation of STAT3 may account for other activities of IL-13 and IL-4 such as inhibition of the growth in carcinoma cells (52) or of the production of proinflammatory cytokines such as IL-12 or tumor necrosis factor- by macrophages, which is only partially dependent upon STAT6 (48).

	ACKNOWLEDGEMENTS

We thank Sara Eaves, Gemma Olmos Centenera, and Johnny Chen for technical assistance; Megan Leving for critical suggestions; Dr. I. Clark-Lewis for synthetic cytokine preparations; and Dr. Douglas Hilton, The Walter and Eliza Hall Institute of Medical Research, Melbourne, Australia, for providing pEF-Bos-IL-13R.

	FOOTNOTES

^* This work was supported by The Arthritis Society of Canada.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence and reprint requests should be addressed. Tel.: 604-822-7822; Fax: 604-822-7815; E-mail: john@brc.ubc.ca.

² P. L. Orchansky, R. Kwan, F. Lee, and J. W. Schrader, unpublished results.

	ABBREVIATIONS

The abbreviations used are: IL-13, interleukin-13; IL-4, interleukin-4; IL-13R, IL-13 receptor  chain; IL-4R, IL-4 receptor  chain; c, common chain of IL-2, IL-4, IL-7, IL-9, and IL-15 receptors; STAT, signal transducer and activator of transcription; JAK, Janus kinase; GST, glutathione S-transferase; LCCM, L cell conditioned media; PVDF, polyvinylidene difluoride; FCS, fetal calf serum; kb, kilobase pair; Ab, antibody; mAb, monoclonal antibody; FITC, fluorescein isothiocyanate; MTT, 3,4,5-dimethyltiazole-2,5-diphenyltetrazolium bromide; GM-CSF, granulocyte macrophage colony-stimulating factor; IRS, insulin-receptor substrate; hu, human; mu, murine; FACS, fluorescence-activated cell sorter.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES