JBC Ideal method for primary cell transfection

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chevet, E.
Right arrow Articles by Katinka, M. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chevet, E.
Right arrow Articles by Katinka, M. D.

J Biol Chem, Vol. 274, Issue 30, 20901-20908, July 23, 1999


Fibroblast Growth Factor Receptors Participate in the Control of Mitogen-activated Protein Kinase Activity during Nerve Growth Factor-induced Neuronal Differentiation of PC12 Cells*

Eric ChevetDagger §, Gilles LemaîtreDagger , Nebo&jcaron;a Janjic', Denis BarritaultDagger , Andreas Bikfalviparallel **Dagger Dagger , and Michaël Doron KatinkaDagger **§§

From the Dagger  Laboratoire CRRET, Université Paris XII-Val de Marne, 61, 94010 Créteil, France, parallel  Growth Factor and Cell Differentiation Laboratory, University Bordeaux I, 33405 Talence, France,  NexStar Pharmaceuticals Inc., Boulder, Colorado 80301

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The current paradigm for the role of nerve growth factor (NGF) or FGF-2 in the differentiation of neuronal cells implies their binding to specific receptors and activation of kinase cascades leading to the expression of differentiation specific genes. We examined herein the hypothesis that FGF receptors (FGFRs) are involved in NGF-induced neuritogenesis of pheochromocytoma-derived PC12 cells. We demonstrate that in PC12 cells, FGFR expression and activity are modulated upon NGF treatment and that a dominant negative FGFR-2 reduces NGF-induced neuritogenesis. Moreover, FGF-2 expression is modulated by NGF, and FGF-2 is detected at the cell surface. Oligonucleotides that specifically inhibit FGF-2 binding to its receptors are able to significantly reduce NGF-induced neurite outgrowth. Finally, the duration of mitogen-activated protein kinase (MAPK) activity upon FGF or NGF stimulation is shortened in FGFR-2 dominant negative cells through inactivation of signaling from the receptor to the Ras/MAPK pathway. In conclusion, these results demonstrate that FGFR activation is involved in neuritogenesis induced by NGF where it contributes to a sustained MAPK activity in response to NGF.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Growth factors participate in axon growth, neuron survival in the nervous system during embryonic development, and in regeneration of peripheral nerves of vertebrate organisms (for reviews see Refs. 1-3). Several studies depicted the primordial role of NGF,1 FGF-1, and FGF-2 in the differentiation and survival of neuronal cells in vivo and ex vivo (2, 4-6). Other studies suggested that the NGF/NGFR and the FGF/FGFR transduction pathways are interdependent. For example, in the early stages of embryonic chicken development, FGFR mRNAs are expressed, and the decline of their presence is accompanied by NGFR mRNA expression and, ultimately, by a new round of de novo FGFR transcription (7). Moreover, FGF-2 stimulates NGFR gene promoter activity in a human neuroblastoma-derived cell line (8) and acts in synergy with NGF in neuronal stem cell differentiation and proliferation (9). Taken together, these observations imply that in the nervous system NGF and FGFs intervene alternatively and sequentially in neuronal differentiation and are, to some extent, interdependent and co-regulated.

The PC12 rat adrenal pheochromocytoma-derived cell line differentiates either into sympathetic neuron-like cells or into chromaffin-like cells (10). NGF, FGF-1, or FGF-2 differentiate PC12 cells into cells morphologically and biochemically resembling sympathetic neurons (11, 12). NGF signal transduction is mediated through the activation of tyrosine kinase cell surface receptors (13). The NGF transduction pathways proceeded through p21ras (14) and B-Raf (15) activation, leading to the activation of MAPK kinase (MEK), which is sufficient for PC12 differentiation (16). The activation of the MAPK by NGF is insufficient, however, to mediate differentiation of PC12 cells (17), suggesting that other transduction pathways involving Shc, phospholipase C-gamma , or yet unidentified MAPK kinase-dependent pathways (18, 19, 16) may intervene. FGFs also signal through the activation of tyrosine kinase cell surface receptors. Four different structurally related FGF receptor sub-families (FGFR-1 to FGFR-4) have been identified, but little is known about the intracellular downstream signaling. However, it seems to involve Grb2/Sos and the MAPK pathway (20). phospholipase C-gamma does not play a significant role in PC12 cell differentiation because FGF-2 stimulates neuronal differentiation in cells that express a mutated FGFR-1 that does not bind phospholipase C-gamma (21-23). Recently, a 90-kDa tyrosine-phosphorylated protein (named SNT, SLP, or FRS-2) was involved in FGF signaling (24-27) by participating in the sustained activation of the MAPK pathway through Grb2 and SHP-2 (27, 28).

In this study, we show that FGFR-2 is involved in NGF signaling leading to PC12 neuronal differentiation. We report that FGFRs expression and activity are modulated by NGF. Furthermore, we show that endogenous FGF-2 expression is induced by NGF and participates in FGFR activation. Finally, we demonstrate that the NGF-induced transduction pathways involving FGFRs depend upon SLP/FRS activation and sustained MAPK activity. The hypothesis that in the nervous system, FGFR and FGF-2 are part of NGF signaling is discussed.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cell Culture and DNA Electroporation-- PC12 cells (ATCC CRL-1721) were grown on gelatin-coated Petri dishes in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum, 5% horse serum, and 4.5 g/liter glucose at 37 °C in a 5% CO2 atmosphere. NGF or FGF-2 treatments were performed once at the beginning of the experiment. The plasmid RK5 containing a 1.3-kb insert encoding a tyrosine kinase activity-deficient human FGF receptor-2 exon IIIc (DNFGFR-2 (29)) was kindly provided by Dr. J. Schlessinger. PC12 cells (8 × 105) were electroporated with pRK5 (0.9 µg) and pSVneo (0.1 µg) at 170 V and 1800 microfarads. Isolated G-418-resistant clones were tested for the presence of high affinity FGF-2 binding sites as described by Moscatelli (30) and by cross-linking to 125I-FGF-2.

Neurite Outgrowth Assay-- Cells seeded at 2 × 103 cells/cm2 were tested for neurite outgrowth for up to 10 days under NGF (30 ng/ml) or FGF-2 (10 ng/ml) treatment. Cells with one or more neurites of a length at least twice superior to the cell diameter were scored as positive. Three hundred cells (100 cells/dish) were scored for each time point. Neurite outgrowth studies were also performed in the presence of heparin (100 µg/ml) or neutralizing anti-FGF-2 antibodies (200 µg/ml; AB-33-NA; R&D System, Minneapolis, MN) or nuclease-resistant high affinity RNA ligands to FGF-2. The 2'-amino-2'-deoxypyrimidine-containing RNA (31) was further stabilized against nucleases by substituting 9 ribopurines with 2'-deoxy-2'-O-methylpurines and adding phosphorothioate caps to the 5' and 3' ends. These changes were incorporated in ligand NX-286: (5'-P) GGUGUGUGGAAGACAGCGGGUGGUUC (3'-P), where (5'-P) and (3'-P) represent the phosphorothioate caps (5'-d(TsTsTsTsTs) and d(TsTsTsTsTs-3'), with "s" representing the phosphorothioate internucleoside linkage), 2'-amino-2'-deoxypyrimidine nucleotides are italicized, and 2'-deoxy-2'-O-methylpurine nucleotides are underlined. NX-286 binds to FGF-2 with a Kd of 0.8 ± 0.2 × 10-9 and to NGF with a Kd >10-6 M. The sequence-scrambled analogue of this ligand, scNX-286, (5'P) AGGUGGGAGCGUGGUUGACGUGUGCA (3'P)), or vascular endothelial growth factor ligand, NX-213 (32), binds to FGF-2 with about 103-fold lower affinity and was used as a control. The different FGF-2 binding molecules were added 10 min before NGF or FGF-2 treatment at 100-500 nM.

125I-FGF-2 and 125I-NGF Binding, Cross-linking, and Scatchard Analysis-- Human recombinant FGF-2 (Synergen, Boulder, CO; 10 µg) was iodinated with 1 mCi of 125I (ICN, Costa Mesa, CA) by the Iodo-Gen method (Pierce) to a specific activity of about 7.5 × 104 cpm/ng. Murine 2.5 S NGF (Promega, Madison, WI; 10 µg) was iodinated by the same method to a specific activity of about 1.85 × 105 cpm/ng. After treatment with 30 ng/ml NGF in Dulbecco's modified Eagle's medium containing 1% fetal bovine serum and 0.5% horse serum (maintained throughout this work) for the indicated periods of time, cells were treated as described previously (29). The determination of the number of FGF-2 binding sites and the dissociation constants was analyzed according to Scatchard (33). The same procedure was used for 125I-NGF binding except that cells were lysed in 1 M NaOH. Cross-linking experiments were performed and analyzed as described (29). The quantity of protein used in each experiment was normalized to and corresponded to that of 106 cells.

RNA Extraction and Northern Blots-- Total RNA was extracted from 5 × 106 cells. RNA/106 cells along the first 96 h of differentiation was quantified and used as a standard (8.5 µg up to 15 µg in PC12 or PCN1 cells). RNA was then subjected to Northern blot experiments with the indicated [alpha -32P]dCTP random primed-labeled probes.

Immunoblotting and Immunoprecipitation-- Cells (1 to 3 × 107) were treated as described by Rabin et al. (24). Cellular extracts were clarified by centrifugation for 15 min at 15,000 × g. Proteins (corresponding to 106 cells) were either directly fractionated by a 15% SDS-PAGE or, alternatively, first adsorbed overnight at 4 °C on 100 µl of 50% heparin-Sepharose solution (Amersham Pharmacia Biotech) in 10 mM Tris-HCl (pH 7.4), 1 mM EDTA, and 150 mM NaCl. Conditioned media were incubated with 100 µl of 50% heparin-Sepharose solution. The heparin-Sepharose slurry was pelleted by centrifugation for 5 min at 1000 × g, washed twice in the same buffer, and electrophoresed. P13suc-1-agarose capture on membrane fractions and immunoprecipitations were performed as described previously (24-26). Isolated protein complexes were resolved by SDS-PAGE and transferred onto ImmobilonP. The membrane was incubated with antibodies raised against either 18-kDa FGF-2 (Ref. 29; 1:150) or the specific high molecular weight region of FGF-2 (Ref. 29; 1:150). The other antibodies utilized in this study were anti-ERK-1, -ERK-2, -FRS-2, -Grb2, -FGFR-1, and -FGFR-2 (Santa Cruz Biotechnologies, Santa Cruz, CA), anti-phosphotyrosine PY-20 (Transduction Laboratories, Lexington, KY), anti-Shc (34), anti-phospho-ERK (New England Biolabs). Immunoreactive bands were detected by chemiluminescence.

Detection of Extracellular Membrane-bound FGF-2 by Cell Surface Biotinylation-- NHS-SS-Biotin (Pierce) was used as recommended by the manufacturer to label 8 × 106 cells either before or after a 5-min treatment by NGF. Cells were washed three times with cold phosphate-buffered saline and lysed in 200 µl of 20 mM Tris-HCl (pH 7.4), 300 mM NaCl, 2% sodium deoxycholate, 2% Triton X-100, 0.2% SDS, and 0.2% bovine serum albumin. Lysates were incubated with anti-FGF-2 antibodies for 16-20 h at 4 °C followed by 1 h with protein A-Sepharose at 4 °C. Immuno complexes were resolved by SDS-PAGE and transferred onto ImmobilonP, then biotinylated proteins were revealed with the Vector Biotin/Avidin System (Vector Laboratories, Burlingame, CA) and detected by chemiluminescence.

Kinase Assays-- Phosphorylation of the myelin basic protein by ERK-1 or ERK-2 immunocomplexes was done as described elsewhere (35).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

NGF Modulates FGF-2 Binding on PC12 Cell Surface-- Previous studies have shown that FGFRs are present before the initiation of differentiation of PC12 cells (31). To monitor the evolution of the FGFRs in the early stages of NGF-induced differentiation, we carried out binding experiments with 125I-FGF-2 on PC12 cells treated for 0, 2, 6, 12, 24, 48, and 96 h with NGF. No competition between FGF-2 and NGF was observed (data not shown). After 2 h of NGF treatment, the level of FGF-2 binding to low affinity binding sites (proteo-heparan sulfates) increased by 7-fold and returned to the initial level after 24 h (Fig. 1A) as described previously (36). Binding of FGF-2 to its high affinity sites after NGF treatment resulted in a 3-4-fold increase in binding detected after 6 h, maybe because of a cooperation with low affinity binding sites and at 48 h (Fig. 1A). No change in FGF-2 binding was observed when cells were treated with EGF (not shown). To characterize the membrane-associated molecules that bind FGF-2, cross-linking experiments were carried out during NGF treatment as indicated above. Fig. 1B depicts a ~157-kDa cross-linked complex, and similar to the binding experiments, the abundance of this complex was highest at 6 and 48 h. Cross-linking of 125I-FGF-2 was competed by a 100-fold excess of unlabeled FGF-2 (not shown). Additional bands of lower molecular weight were detected during NGF treatment (121 kDa more so at 48 h; 103 kDa at 2, 6, 12, and 48 h and, 83 kDa at 2 and 6 h; Fig. 1B). The number and dissociation constants (Kd) of 125I-FGF-2 binding to FGF receptors were determined by Scatchard analysis (33) in either untreated or 48-h NGF-treated cells. Two classes of receptor binding sites (class 1: Kd = 134 ± 27 pM, number of sites = 1.6 ± 0.7 fmol/106 cells; class 2: Kd = 877 ± 125 pM, number of sites = 5.12 ± 1.1 fmol/106 cells) were detected in untreated PC12 cells. After NGF treatment (48 h), the following binding values were observed: class 1, Kd = 160 ± 11 pM, number of sites = 3.6 ± 0.2 fmol/106 cells; class 2: Kd = 457 ± 55 pM, number of sites = 7.7 ± 2 fmol/106 cells (Fig. 1C).


View larger version (25K):
[in this window]
[in a new window]
  		Fig. 1.   FGF-2 binding to NGF-treated PC12 cells. A, 125I-FGF-2 binding to NGF-treated PC12 cells. NGF (30 ng/ml) was added for the indicated time, and binding of 125I-FGF-2 was performed. Open bars (LA) represent "low affinity" binding, and closed bars (HA) represent "high affinity" binding. The values represent the mean ±S.D. from 11 independent experiments. B, cross-linking of 125I-FGF-2 to NGF-treated cells. Cells were treated with NGF as in A and then cross-linked to 125I-FGF-2. 125I-FGF-2 cross-linked material was loaded from samples representing identical cell numbers. The figure shows the autoradiogram (5-day exposure) of 125I-FGF-2-cross-linked material resolved on a 7.5% SDS-PAGE. C, Scatchard analysis results. Increasing amounts of 125I-FGF-2 were bound to NGF-treated or -untreated cells, and binding of 125I-FGF-2 to FGF receptors was analyzed according to Scatchard (33).

NGF Stimulates FGFR-1 and FGFR-2 Tyrosine Phosphorylation-- 125I-FGF-2 cross-linked material from untreated or NGF-treated cells was immunoprecipitated with anti-FGFR antibodies. FGFR-1 (~160 kDa) and FGFR-2 (~157 kDa) were principally present in PC12 cells under NGF treatment at 48 and 6 h, respectively (Fig. 2A). Northern blotting experiments with either one of the four specific probes for FGFR-1 to FGFR-4 was performed. The FGFR-1 and FGFR-2 probes hybridized to the blots (Fig. 2B) but not the FGFR-3 or the FGFR-4 probes (not shown). One 4-kb FGFR-1 and two FGFR-2 (2.3 kb and 2.9 kb) transcripts were identified. FGFR-1 mRNA was present before NGF stimulation, and its quantity increased by 2-3-fold during the first 60 min of NGF treatment and subsequently decreased to the initial level. The 2.9-kb FGFR-2 mRNA was present after 10 min of NGF treatment and disappeared after 60 min (Fig. 2B). The 2.3-kb transcript was present in untreated cells, and its amount increased between 30 to 60 min and dramatically decreased between 2 and 6 h. A sudden increase of the 2.9-kb mRNA after 48 h was also observed, and its presence might be required for survival. Reverse transcription-polymerase chain reaction experiments revealed that FGFR-2 exon IIIc was present in PC12 cells before NGF induction, and both IIIb and IIIc exons were present after 72 h of NGF or FGF treatment (data not shown). Activation of FGFRs was assessed in PC12 cells at early times after NGF treatment. Interestingly FGFR-1 as well as FGFR-2 was tyrosine-phosphorylated after 10 min up to 2 h of NGF stimulation (Fig. 2C).


View larger version (35K):
[in this window]
[in a new window]
  		Fig. 2.   FGFRs expression and activation during NGF-induced neuritogenesis. A, analysis of cross-linked (CL) 125I-FGF-2 from NGF-treated cell lysates immunoprecipitated with anti-FGFR antibodies (alpha  FGFR-1 or alpha  FGFR-2). Autoradiogram (15-day exposure) of 125I-FGF-2 cross-linked to PC12 cells treated by NGF for 0, 6, and 48 h, immunoprecipitated (Ip) with anti-FGFR-1 or anti-FGFR-2 antibodies, and resolved by a 7.5% SDS-PAGE. Five-fold more cells were used (4 × 107 cells) to immunoprecipitate FGFR-2 than to immunoprecipitate FGFR-1. B, FGFRs mRNA expression in NGF-treated cells. The autoradiogram (5-day exposure) of a Northern blot of total RNA extracted at the indicated time and hybridized with FGFR-1 (R1 probe) or FGFR-2 (R2 probe) is shown . The sizes of the detected RNAs are indicated (kb). C, FGFR phosphorylation in NGF-treated cells. Cell lysates were immunoprecipitated (Ip) with anti-FGFR-1 or anti-FGFR-2 antibodies. Immunocomplexes were electrophoresed, immunoblotted (Ib), and revealed with anti-phosphotyrosine antibodies (alpha PY).

FGFR Are Involved in NGF-Induced Neuritogenesis-- PC12 cells were electroporated with a cDNA encoding a dominant negative FGFR-2, which inhibits signaling not only of an identical FGFR but also of the other FGFRs (37). DNFGFR-2-expressing clones were identified by 125I-FGF-2 binding (not shown) and cross-linking (Fig. 3). Of 13 DN clones studied, 3 clones (DN21, DN62, and DN63) exhibited high levels of DN receptor (10-15-fold when compared with PC12 or PCN control cells), 6 (DN23, DN24, DN61, DN66, DN67, and DN68) exhibited medium levels of DN receptor (4-6-fold), and 4 (DN22, DN64, DN65, and DN69) exhibited low levels (1-2-fold). In addition to the truncated FGFR-2 monomer, a higher molecular weight band was detected by cross-linking experiments (Fig. 3, CL). This band corresponds to multimeric complexes (homodimers of DNFGFR-2 receptors; heterodimers DNFGFR-2 and endogenous FGF receptors) and may also include endogenous FGF receptor monomers. Moreover, no change in NGFR expression was detected in DN-expressing cells by 125I-NGF binding experiments (not shown). In Fig. 3, an example of each class of FGFR-DN-expressing cells (DN21, DN24, and DN64) and PCN1 control cells is shown. Experiments described below were done with cells from three clones of each DN receptor expression level (DN21, DN62, and DN63 for high; DN23, DN24, and DN61 for medium; DN22, DN64 and DN65 for low DN expression levels) and two clones harboring the G418-resistance vectors (PCN1 and PCN2). FGFR-1 as well as FGFR-2 was phosphorylated similarly in PC12, and in PCN1 (as shown in Fig. 2C) cells after 10 min of NGF treatment, but in DN21 cells, no phosphorylation was detectable (Fig. 4A). Neurite outgrowth in the presence of NGF for up to 10 days was measured in PC12, PCN1 and 2, DN21, DN24, and DN64 cells. With all of the clones studied, the number of cells with neurites reached a plateau after 96 h (Figs. 3 and 4B). Parental PC12 cells, PCN1, and PCN2 (data not shown) exhibited the same neurite outgrowth pattern. The morphology of PCN1, DN21, DN24, and DN64 was compared (Fig. 3). Neurite outgrowth of DN21 was the most strongly inhibited (70% at 48 h) upon NGF treatment, DN64 was the most weakly inhibited (45%), and DN24 exhibited an intermediary outgrowth pattern (60%); the quantification of this effect was performed by neurite-counting and reported in Fig. 4B. The percentage of cells with neurites did not significantly change over a 10-day period from the percentage estimated at day 4 (data not shown). A total of 11 clones were studied in the neurite outgrowth assay as indicated (9 clones expressing DNFGFR-2, 2 control clones expressing the geneticin-resistance gene only), and the number of cells with neurites after 4 or 10 days of NGF treatment is reported in Table I. These data indicate that inhibition of neurite outgrowth was observed in all DNFGFR-2 cell clones and that the degree of inhibition was correlated with the expression of DNFGFR-2. About 76 ± 3.7% of PC12 cells exhibited neurites upon FGF-2 treatment. The neurite outgrowth results were very similar with PCN1 or PCN2 cells. Upon FGF-2 treatment, DN21 and DN24 cells did not differentiate (<1% cells with neurites; not shown), and DN64 exhibited some neurite outgrowth (5-10% of the control; not shown). As other phenotypic differentiation marker, we analyzed peripherin mRNA expression in RNAs isolated from PCN1 or DN21 cells after NGF treatment during indicated periods of time (Fig. 4C). PCN1 cells exhibited a 2-3-fold increase in 73 mRNA levels after 12 h (Fig. 4C) as described previously for PC12 cells (38). The increase in peripherin mRNA level in DN21 cells was moderate and somewhat retarded (24-48 h; Fig. 4C).


View larger version (112K):
[in this window]
[in a new window]
  		Fig. 3.   Expression of DNFGFR-2 in PC12 cells. Cells expressing DNFGFR-2 (clones DN21, DN24, DN64) or PC12 control cells harboring the geneticin-resistance vector (clone PCN1) were treated by NGF. Clone DN21 expressed high, clone DN24 expressed intermediate, and clone DN64 expressed low levels of DNFGFR-2. The photographs (×100 magnification) depict the neurite outgrowth after 48 h of NGF treatment compared with their morphology prior treatment. Autoradiograms of 125I-FGF-2-cross-linked (CL) material resolved by 7.5% SDS-PAGE are shown at the right of each figure. Cross-linked DNFGFR-2 is identified by open triangles. The upper band (closed triangles) corresponds to multimeric complexes with possibly endogenous FGF receptors. CL was done with the same number of cells from each clone.


View larger version (30K):
[in this window]
[in a new window]
  		Fig. 4.   Effect of DNFGFR-2 expression on NGF-induced differentiation. A, FGFR phosphorylation in NGF-treated (T) PCN1 or DN21 cells. Untreated PCN1 cells are designated by U. Cell lysates were immunoprecipitated (Ip) with anti-FGFR-1 (alpha  FGFR1) or anti-FGFR-2 (alpha  FGFR-2) antibodies. Immunoprecipitated proteins were separated by 7.5% SDS-PAGE, immunoblotted (Ib), and revealed with anti-phosphotyrosine antibodies (alpha  PTyr). B, neurite outgrowth assay as a function of the time under NGF stimulation in cells expressing DNFGFR-2 or PC12 control cells. DN clones DN21 (black-diamond ), DN24 (), DN64 (black-triangle), and control clone PCN1 (black-square) are represented. C, expression of a differentiation marker in NGF-treated DNFGFR-2-expressing cells. Total RNA was extracted from cells expressing DNFGFR-2 (DN21) or from PC12 control cells (PCN1), and Northern blots were hybridized with the 73 probes. The 48-h exposure autoradiogram is shown.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Neurite outgrowth assay on different PC12 clones expressing various levels of DN-FGFR2
Cells were treated with 30 ng/ml NGF for up to 10 days, and the number of cells with neurites was determined after 4 and 10 days. The mean values ±S.E. for these different clones are reported. Expression of the DNFGFR-2 was measured in 125I-FGF-2 cross-linking experiments and compared to the basal expression of endogenous FGFRs. After 5 days in culture in the presence of NGF, medium was replaced, and fresh NGF was added. NA stands for not applicable.

NGF Modulates FGF-2 Expression-- FGF-2 expression was studied by Western blotting of cell extracts and culture media of cells stimulated by NGF. Practically no FGF-2 was detectable in cell extracts of nonstimulated PC12 or PCN1 control cells. After 5 min of NGF treatment, an 18-kDa FGF-2 isoform was detected in cell extracts (Fig. 5A). FGF-2 was present for up to 96 h with peaks at 1-6 h and at 48-96 h. In DN21 cell extracts, 18-kDa FGF-2 was present in the cell extracts before NGF treatment and disappeared 60 min after (Fig. 5A). In the PCN1-conditioned media, an 18-kDa FGF-2 species was detected from 6-12 h only, with a peak at 24 h. A 15-kDa FGF-2-related protein with apparition kinetics identical to FGF-2 was also revealed (Fig. 5A). Higher molecular mass bands were detected on Western blots by either anti-18-kDa or anti-high molecular weight FGF-2 antibodies at constant levels in PCN1 and DN21 cellular extracts (not shown). Because FGF-2 was detectable in the medium only after 6-12 h of NGF treatment, we assessed the presence of FGF-2 on the cell surface. PC12 cells, treated or not by NGF, were cell surface-biotinylated, and cell extracts were immunoprecipitated with anti-FGF-2 antibodies. NGF induced in 10 min the appearance of an 18-kDa FGF-2 and a 15-kDa FGF-2-related protein on the cell surface (Fig. 5B), quantities of which declined from 30 min on.


View larger version (41K):
[in this window]
[in a new window]
  		Fig. 5.   FGF-2 expression in NGF-treated PC12 cells. A, determination of the 18-kDa FGF-2 contained in NGF-treated cells. Cell extracts from PCN1 or DN21 DNFGFR-2-expressing cells and conditioned medium from PCN1 cells (PCN-M) were prepared at the indicated time of NGF treatment and immunoblotted as described under "Experimental Procedures." B, immunoprecipitation of cell surface-associated FGF-2 in NGF-treated cells. Autoradiogram of cell surface-biotinylated anti-FGF-2-immunoprecipitated (Ip) proteins from PCN1 cell extracts without (-) or following (+) 10 or 30 min NGF treatment, resolved by 15% SDS-PAGE.

RNA Oligonucleotides That Specifically Bind FGF-2 Inhibit Neuritogenesis-- The functional significance of extracellular or surface cell FGF-2 in induction of neuritogenesis was investigated by using anti-FGF-2 antibodies or an RNA oligonucleotide ligand that specifically binds FGF-2 (NX-286 (31)). Antibodies, heparin, or the oligonucleotide were added to the media 10 min before NGF or FGF treatment. Heparin (100 µg/ml) was used as a positive control. The NX-213 oligonucleotide (32), which binds to vascular endothelial growth factor, and the scNX-286 oligonucleotide (NX-286 scrambled sequence) were used as negative controls. Neurite outgrowth studies on PC12, PCN1, and PCN2 were carried out for 96 h of NGF treatment; heparin and NX-286 inhibited neuritogenesis by about 50-55%, but antibodies presented a lower inhibition (10-15%; Fig. 6). Neither NX-213 (Fig. 6) nor scNX-286 (not shown) modified the wild-type neurite outgrowth pattern. When neuritogenesis was induced by exogenous FGF-2, total inhibition of neuritogenesis was observed in the presence of anti-FGF-2 antibodies, NX286, or heparin, but NX-213 or scNX-286 did not show any detectable inhibitory effect (data not shown). The mean neurite outgrowth values ±S.E. for different experiments performed three times with cells from different passages after 96 h of NGF stimulation were the following: control, 91.7 ± 1.8%; heparin, 43.3 ± 1.86%; anti-FGF-2 antibodies, 78.3 ± 1.8%; NX-286, 42 ± 0.6%; NX-213, 89 ± 0.6%. These data suggest that autocrine FGF-2 is implicated in NGF-induced differentiation of PC12 cells.


View larger version (23K):
[in this window]
[in a new window]
  		Fig. 6.   Effect of anti-FGF-2 RNA oligonucleotides on NGF-induced neurite outgrowth. PCN1 cells treated with NGF (30 ng/ml (triangle )) were incubated with either 100 µg/ml heparin (open circle ), 200 µg/ml anti-FGF-2 antibodies (diamond ), 100 nM NX-286 FGF-2 binding-modified RNA oligonucleotide (down-triangle), or 100 nM NX-213 vascular endothelial growth factor-specific binding-modified RNA oligonucleotide () that were added 10 min before growth factor addition. Squares depict neurite outgrowth assays in which only NGF was added to the medium, as a positive control.

Signaling Events Are Differentially Regulated in PC12 and PC12-FGFRDN Cells-- Intracellular signaling pathways involved in the response to NGF or FGF-2 were then investigated. The membrane fraction of PC12 cells treated either by NGF or FGF-2 harbored tyrosine-phosphorylated proteins of 75 to 85 kDa that were associated with FGFR-1 and FGFR-2 (Fig. 7A). These proteins designated as SLP/FRS proteins (26, 27) bind to p13suc-1-agarose beads. When plasma membranes from NGF- or FGF-2-treated PC12 or DN cells were solubilized and incubated with p13suc-1-agarose beads, tyrosine-phosphorylated FRS proteins were detected only in FGF-2 and to a lesser extent in NGF-treated PC12 cells. No tyrosine phosphorylation was detected in DN cells (Fig. 7B, Ib:alpha PY). In both cases the amount of FRS-2 was comparable (Fig. 7B, Ib:alpha FRS-2). The FRS-2 molecular mass shift observed in the immunoblotting experiments corresponded to tyrosine phosphorylation of these proteins. FRS proteins were also known to bind Grb-2 and to constitute a link between FGFR and MAPK activation (27). The association of Grb-2 and FRS proteins at the plasma membrane in response to NGF or FGF-2 was studied. As shown in Fig. 7C (upper and middle panels), Grb-2 and FRS proteins were associated in response to FGF-2 and NGF stimulation with no major change in Grb-2 expression (Fig. 7C, lower panel). Moreover, Shc was tyrosine-phosphorylated in PC12 cells under NGF or FGF-2 treatment, but in PC12DN cells, Shc was found tyrosine-phosphorylated only under NGF stimulation (Fig. 7D, upper panel) with no change in Shc expression (Fig. 7D, lower panel). This result demonstrates that NGFRs are active, whereas endogenous FGFRs are inactivated by the dominant negative FGFR-2.


View larger version (60K):
[in this window]
[in a new window]
  		Fig. 7.   NGF and FGF-2 signaling from FGFR in wtPC12 cells, and PCN1 and DNFGFR-2 cells. A, PC12 cells were treated or not (U) by 30 ng/ml NGF (N) or 10 ng/ml FGF-2 (F) then lysed as described under "Experimental Procedures." Lysates were immunoprecipitated with anti-FGFR1 (left panel) or anti-FGFR-2 (right panel) antibodies. Immunoprecipitates (Ip) were electrophoresed, immunoblotted (Ib), and revealed by anti-Tyr(P) (PY) antibodies and chemiluminescence. Arrowheads indicate tyrosine-phosphorylated proteins appearing upon FGF-2 treatment. B, lysates from PCN1 (upper panel) or DN21 (lower panel) cells were incubated with p13suc-1-agarose beads, and the proteins were resolved by electrophoresis, immunoblotted, and revealed by anti-Tyr(P) antibodies and chemiluminescence. C, Grb-2/FRS association was assessed in PC12 cells by immunoblotting experiments using anti-Tyr(P) antibodies against proteins captured by p13suc-1-agarose (p13-Ag) beads after release from the Grb-2 immunoprecipitate (upper panel) or immunoblotting with anti-Grb-2 antibodies of Grb-2 proteins retained in FRS capture experiments (middle panel). The amount of Grb2 was assessed by Western blotting with anti-Grb-2 antibodies (lower panel). D, Shc tyrosine phosphorylation was analyzed by immunoprecipitation of Shc from PCN1 or DN21 cell lysates following or not (U) NGF (N) or FGF-2 (F). Immunocomplexes were separated by SDS-PAGE, blotted, and revealed by anti-phosphotyrosine antibodies (upper panel). The amount of Shc precipitated was assessed by Western blotting with anti-Shc antibodies (lower panel).

FGFRs Participate in the Net Sustained ERK Activity Induced by NGF-- ERK-1 and ERK-2 activities were determined by phosphorylation of myelin basic protein (MBP). Under NGF stimulation, ERK-1 immunoprecipitates from either PCN1 or DN21 cell extracts presented a similar MBP phosphorylation activity pattern. ERK-1 activity was maximal at 5-10 min and stayed elevated (at about 50% of maximum) for up to 4 h (Fig. 8A). ERK-1 activity in DN21 cell extracts was somewhat higher than in PCN1 cells between 10 and 120 min. ERK-2 activity, however, was 2-3-fold lower in DN21 than in PCN1 cells at 5 min and 7-fold lower 120 min after the beginning of NGF stimulation, and no significant activity was detected after 4 h. ERK-1 and ERK-2 activation were similar in PCN1 cells under NGF or FGF-2 treatment, although the stimulation with the latter was 2-fold lower (Fig. 8A). Furthermore, both ERK-1 and ERK-2 activities were strongly inhibited in DN21 cells following FGF-2 stimulation when compared with control cells (Fig. 8A). Finally, ERK2 activities were similarly low in FGF-2 and NGF-treated DN21 cells. As shown Fig. 8B, the kinetics of MBP phosphorylation by ERK-2 immunoprecipitates as well as ERK-2 phosphorylation were significantly decreased in intensity and length in DN21 cells compared with PCN1, although the amount of protein immunoprecipitated was similar.


View larger version (34K):
[in this window]
[in a new window]
  		Fig. 8.   ERKs activity in PCN1 and DN21 cells treated by NGF and FGF-2. A, myelin basic phosphorylation of MBP by ERK-1 or ERK-2 immunocomplexes from PCN1 or DN21 cells treated by NGF or FGF-2. PCN1 (closed symbols) and DN21 (open symbols) cells were treated by NGF (30 ng/ml; open circle , ) or by FGF-2 (10 ng/ml; , black-square). ERK activity found in untreated cells is indicated (diamond , black-diamond ). B, MBP phosphorylation by ERK-2 immunoprecipitated from PCN1 and DN21 cell lysates after NGF treatment for the indicated periods of time. ERK-2 (alpha  ERK-2) immunoprecipitates (Ip) were incubated with MBP in the presence of [gamma -32P]ATP and resolved by 12.5% SDS-PAGE (upper panel) or immunoblotted (Ib) with anti-phospho-ERK antibodies (Ib:alpha P-ERK, middle panel) or anti-ERK-2 antibodies (Ib:alpha ERK-2, bottom panel).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In this study, we show that in PC12 cells, FGFRs, and FGF-2 participate in NGF-induced neuritogenesis. This is based on the following observations. 1) NGF modulates FGFR expression and induces FGFR activation, 2) NGF modulates FGF-2 expression, 3) neurite outgrowth and FGFR activation are reduced in PC12 cells expressing dominant negative FGFR-2, 4) specific anti-FGF-2-modified RNA oligonucleotides inhibit NGF-induced neuritogenesis, and 5) specific FGFR transduction pathways play a crucial role in the maintenance of NGF-induced sustained MAPK activity.

The data presented here revealed the induction of two waves of FGFR expression under NGF treatment. In addition, one FGFR-1 and two FGFR-2 transcripts were identified during NGF stimulation. Numerous FGFR splicing variants have been identified (3, 39, 40). These include variants with either exon IIIb or IIIc usage, two immunoglobulin-like forms, and truncated or soluble FGFRs. Several molecular weight species were present in cross-linking studies, but only a unique complex was detected in either anti-FGFR-1 or anti-FGFR-2 immunoprecipitations. This discrepancy could be explained in part by the existence of FGFRs variants truncated at their carboxyl-terminal sequences (41, 42) that are not immunoreactive with the antibodies used. Beside these effects of NGF on FGFR expression, we show here that NGF was able to promote FGFR activation. The functional significance of the FGF receptor activation upon NGF treatment was investigated using the dominant negative FGF receptor approach. Overexpression of dominant negative FGFR-2 reduces the NGF-induced neuritogenesis and reduces the expression of peripherin. Moreover, the key role of SLP/FRS protein in this mechanism was previously reported (24-28, 43). The role of FRS-2 has been clearly demonstrated to participate in the sustained MAPK activity through its interaction with SHP-2 (28). Our data demonstrate also that in PC12DN the MAPK activity is reduced both in intensity and in duration possibly causing the inhibition of differentiation. Because the Shc pathway was affected in DN cells only after FGF-2 treatment, we may conclude that SLP/FRS pathway is probably stimulated only after FGFR activation itself promoted by NGF treatment. The maximal neuritogenesis inhibition we observed was of about 70%, the remaining 30% possibly caused by NGFR activation itself.

The expression of dominant-negative FGFR-1 was recently reported to inhibit neuronal differentiation of PC12 cells induced by FGF-2, L1, Neural cell adhesion molecule (N-CAM) or, N-cadherin but not by NGF (44). The apparent discrepancy between these data and ours may simply reside in the types of dominant negative FGFR used. Indeed, the transdominant effect of dominant negative FGFRs is not absolute, and inhibition by DNFGFR-2 was demonstrated to be more efficient than that of DNFGFR-1 as a result of increased dimer stability (45). Moreover, when DNFGFR-1 or DNFGFR-2 are targeted to photoreceptors by using the rhodopsin promoter, only DNFGFR-2 will induce focal photoreceptor degeneration (46), indicating that DNFGFR-2 is more potent than DNFGFR-1 in deregulating FGF signaling. Finally, the neurite outgrowth measured in our work reflected the number of cells with neurites and not the mean neurite length as described by Saffell et al. (44). Therefore, our observations may just be the result of an increased inhibition potential of DNFGFR-2.

The expression of the FGF-2 was stimulated by NGF in PC12 cells and found both in cell extracts and on the cell surface. We demonstrate here that newly produced FGF-2 mainly stays on the cell surface to act on its receptors. The feeble inhibitory effect of FGF-2-neutralizing antibodies has been already noted in previous studies (47) possibly because of their size which does not allow access to membrane- or extracellular matrix-bound FGF-2. However, when using anti-FGF-2 RNA oligonucleotides that specifically neutralize extracellular FGF-2 (31), neuronal differentiation induced by NGF was inhibited at about 50%. This implies the existence of an NGF-driven FGF-2 autocrine loop. The activation of the FGFRs by endogenous FGF-2 is not incompatible with the participation of other FGFR ligands in neuritogenesis. For example, FGF-1 is expressed during differentiation of PC12 cells and possibly participates in FGFR-1 activation (48) or the adhesion molecule L1 signals through FGFRs and induces neuronal differentiation of neurons in culture (49). FGF-2 knock-out mice show some abnormalities in the cytoarchitecture of the neocortex and significant reduction in neuronal density in most layers of the motor cortex (50). Moreover, neuronal defects are present in the hippocampal commissure, and neuronal deficiencies are observed in the cervical spinal cord. Furthermore, FGF-2 knock-out mice present an impaired neural regulation of blood pressure by the baroreceptor reflex, suggesting a role for the sympathetic system (51). Therefore, the interpretation of our results in that context suggests that FGF-2 may be important for neuronal differentiation especially in the case of sympathetic neurones, modeled by PC12 cells.

The results described in the present work indicate that FGFRs are involved in neuronal differentiation of PC12 cells induced by NGF and that MAPK-sustained activation is dependent on functional FGFR system. Furthermore, autocrine FGF-2 participates in NGF-mediated FGFR activation. It is possible that the mechanism of NGF action described herein is specific for a population of sympathetic neurons and regulate their function. But also, this mechanism could have a general significance and operate in different neuronal cell populations, thus placing FGFs/FGFRs in or alongside the NGF signal transduction pathway.

    ACKNOWLEDGEMENTS

We thank Dr. Ivor John Mason (Guy's and St. Thomas Hospital, London), Dr. Allan T. Nurden (CNRS, Bordeaux), Dr. Daniel B. Rifkin (NYU Medical Center, New York), and John J. M. Bergeron (McGill University, Montreal) for critical reading of the manuscript. We also thank Dr. Edward Ziff (NYU Medical Center, New York) for the 73 plasmid, Dr. Daniel B. Rifkin for FGF-2, and anti-FGF-2 antibodies. We also thank Louis Green and James Beeson (NeXstar Pharmaceuticals) for expert technical assistance.

    FOOTNOTES

* This work was supported by grants from the CNRS and from the Associetion de la Recherche sur le Cancer (ARC) to the CRRET Laboratory and by grants from the Fondation pour la Recherche Medicale (FRM) and the Ligue Contre le Cancer to the Growth Factor and the ARC to the Cell Differentiation Laboratory, University Bordeaux I (to A. B.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ Present address: Dept. of Anatomy and Cell Biology, McGill University, 3640 University St., Montreal, PQ, Canada H3A 2B2.

** Senior authors of this work.

Dagger Dagger Recipient in 1995 of a CNRS Visiting Grant to the CRRET Laboratory. To whom correspondence should be addressed: Growth Factor and Cell Differentiation Laboratory, University Bordeaux I, Avenue des Facultés, 33405 Talence, France. Tel.: 33 556 84 87 03; Fax: 33 556 84 87 01; E-mail: a.bikfalvi@croissance.u-bordeaux.fr.

§§ Present address: Génoscope, Centre National de Séquençage, 2, rue Gaston Crémieux, 91006 Evry, cedex, France.

    ABBREVIATIONS

The abbreviations used are: NGF, nerve growth factor; FGFR, NGF receptor; FGF, fibroblast growth factor; FGFR, FGF receptor; kb, kilobase(s); MAPK, mitogen-activated protein kinase; ERK, extracellular-regulated kinase; PAGE, polyacrylamide gel electrophoresis; FRS, FGFR substrate; SLP, suc-1-associated NGF receptor target like protein; MBP, myelin basic protein; DN, dominant negative.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Chiu, I. M. (1989) Mol. Cell. Pathol. 10, 37-52
2. Baird, A. (1994) Curr. Opin. Neurobiol. 4, 78-86[CrossRef][Medline] [Order article via Infotrieve]
3. Bikfalvi, A., Klein, S., Pintucci, G., and Rifkin, D. B. (1997) Endocr. Rev. 18, 26-45[Abstract/Free Full Text]
4. Morrisson, R. S., Sharma, A., DeVellis, J., and Bradshaw, R. A. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 7537-7541[Abstract/Free Full Text]
5. Lipton, S. A., Wagner, J. A., Madison, R. D., and D'Amore, P. A. (1988) Proc. Natl. Acad. Sci. U. S. A. 88, 2388-2392[Abstract/Free Full Text]
6. Barde, Y. A. (1989) Neuron 2, 1525-1534[CrossRef][Medline] [Order article via Infotrieve]
7. Heuer, J. G., von Bartheld, C. S., Kinoshita, Y., Evers, P. C., and Bothwell, M. (1990) Neuron 5, 283-296[CrossRef][Medline] [Order article via Infotrieve]
8. Taiji, M., Taiji, K., Deyerle, K. L., and Bothwell, M. (1992) Mol. Cell. Biol. 12, 2193-2202[Abstract/Free Full Text]
9. Cattaneo, E., and McKay, R. (1990) Nature 347, 762-765[CrossRef][Medline] [Order article via Infotrieve]
10. Greene, L. A., and Tischler, A. S. (1976) Proc. Natl. Acad. Sci. U. S. A. 73, 2424-2428[Abstract/Free Full Text]
11. Greene, L. A., and Tischler, A. S. (1982) Adv. Cell. Neurobiol. 3, 373-414
12. Neufeld, G., Gospodarowicz, D., Dodge, L., and Fujii, D. K. (1987) J. Cell. Physiol. 131, 131-140[CrossRef][Medline] [Order article via Infotrieve]
13. Scimeca, J. C., Nguyen, T. T., Filloux, C., and van Obberghen, E. (1992) J. Biol. Chem. 267, 17369-17374[Abstract/Free Full Text]
14. Thomas, S. M., DeMarco, M., D'Arcangelo, G., Halegoua, S., and Brugge, J. S. (1992) Cell 68, 1031-1040[CrossRef][Medline] [Order article via Infotrieve]
15. Jaiswal, R. K., Moodie, S. H., Wolfman, A., and Landreth, G. E. (1994) Mol. Cell. Biol. 14, 6944-6953[Abstract/Free Full Text]
16. Cowley, S., Paterson, H., Kemp, P., and Marshall, C. J. (1994) Cell 77, 841-852[CrossRef][Medline] [Order article via Infotrieve]
17. Vaillancourt, R. R., Heasly, L. E., Zamarripa, J., Storey, B., Valius, M., Kazlauskas, A., and Johnson, G. L. (1995) Mol. Cell. Biol. 15, 3644-3653[Abstract]
18. Obermeier, A., Bradshaw, R. A., Seedorf, K., Choidas, A., Schlessinger, J., and Ullrich, A. (1994) EMBO J. 13, 1585-1590[Medline] [Order article via Infotrieve]
19. Torres, M., and Bogenmann, E. (1996) Oncogene 12, 77-86[Medline] [Order article via Infotrieve]
20. Mohammadi, M., Dikic, I., Sorokin, A., Burgess, W. H., Jaye, M., and Schlessinger, J. (1996) Mol. Cell. Biol. 16, 977-989[Abstract]
21. Mohammadi, M., Honegger, A. M., Rotin, D., Fischer, R., Bellot, F., Li, W., Dionne, C. A., and Schlessinger, J. (1991) Mol. Cell. Biol. 11, 5068-5078[Abstract/Free Full Text]
22. Spivak-Kroizman, T., Mohammadi, M., Hu, P., Jaye, M., Schlessinger, J., and Lax, I. (1994) J. Biol. Chem. 269, 14419-14423[Abstract/Free Full Text]
23. Huang, J., Mohammadi, M., Rodrigues, G. A., and Schlessinger, J. (1995) J. Biol. Chem. 270, 5065-5072[Abstract/Free Full Text]
24. Rabin, S. J., Cleghon, V., and Kaplan, D. R. (1993) Mol. Cell. Biol. 13, 2203-2213[Abstract/Free Full Text]
25. Ong, S. H., Goh, K. C., Lim, P. Y., Low, B. C., Klint, P., Claesson-Welsh, L., Cao, X., Tan, Y. H., and Guy, G. R. (1996) Biochem. Biophys. Res. Commun. 225, 1021-1026[CrossRef][Medline] [Order article via Infotrieve]
26. Wang, J-K., Xu, H., Li, H-C., and Goldfarb, M. (1996) Oncogene 13, 721-729[Medline] [Order article via Infotrieve]
27. Kouhara, H., Hadari, Y. R., Spivak-Kroizman, T., Schilling, J., Bar-Sagi, D., Lax, I., and Schlessinger, J. (1997) Cell 98, 693-702
28. Hadari, Y. R., Kouhara, H., Lax, I., and Schlessinger, J. (1998) Mol. Cell. Biol. 18, 3966-3973[Abstract/Free Full Text]
29. Bikfalvi, A., Klein, S., Pintucci, G., Quarto, N., Mignatti, P., and Rifkin, D. B. (1995) J. Cell Biol. 129, 233-243[Abstract/Free Full Text]
30. Moscatelli, D. (1987) J. Cell. Physiol. 131, 123-130[CrossRef][Medline] [Order article via Infotrieve]
31. Jellinek, D., Green, L. S., Bell, C., Lynott, C. K., Gill, N., Vargeese, C., Kirshenheuter, G., McGee, D. P. C., Abesinghe, P., Pieken, W., Shapiro, R., Rifkin, D. B., Moscatelli, D., and Janjic, N. (1995) Biochemistry 34, 11363-11372[CrossRef][Medline] [Order article via Infotrieve]
32. Green, L. S., Jellinek, D., Bell, C., Beebe, L. A., Feistner, B. D., Gill, S. C., Jucker, F. A., and Janjic, N. (1995) Chem. Biol. (Lond.) 2, 683-695[CrossRef][Medline] [Order article via Infotrieve]
33. Scatchard, G. (1949) Ann. N. Y. Acad. Sci. 51, 660-672[CrossRef]
34. Di Guglielmo, G. M., Baass, P. C., Ou, W-J., Posner, B. I., and Bergeron, J. J. (1994) EMBO J. 13, 4269-4277[Medline] [Order article via Infotrieve]
35. Iwasaki, S., Hattori, A., Sato, M., Tsujimoto, M., and Kohno, M. (1996) J. Biol. Chem. 271, 17360-17365[Abstract/Free Full Text]
36. Katoh-Semba, R., Oohira, A., and Kashiwamata, S. (1992) J. Neurochem. 59, 282-289[CrossRef][Medline] [Order article via Infotrieve]
37. Ueno, H., Gunn, M., Dell, K., Tseng, A., Jr., and Williams, L. (1992) J. Biol. Chem. 267, 1470-1476[Abstract/Free Full Text]
38. Leonard, D. G. B., Ziff, E. B., and Greene, L. A. (1987) Mol. Cell. Biol. 7, 3156-3167[Abstract/Free Full Text]
39. McKeehan, W. L., and Kan, M. (1994) Mol. Reprod. Dev. 39, 69-81[CrossRef][Medline] [Order article via Infotrieve]
40. Ornitz, D. M., Xu, J., Colvin, J. S., McEwen, D. G., MacArthur, C. A., Coulier, F., Gao, G., and Goldfarb, M. (1996) J. Biol. Chem. 271, 15292-15297[Abstract/Free Full Text]
41. Ishii, H., Yoshida, T., Oh, H., Yoshida, S., and Terada, M. (1995) Mol. Cell. Biol. 15, 3664-3671[Abstract]
42. Yan, G., McBride, G., and McKeehan, W. L. (1993) Biochem. Biophys. Res. Commun. 194, 512-518[CrossRef][Medline] [Order article via Infotrieve]
43. Foehr, E. D., Raffioni, S., Fuji, R., and Bradshaw, R. A. (1998) Immunol. Cell Biol. 76, 406-413[CrossRef][Medline] [Order article via Infotrieve]
44. Saffell, J. L., Williams, E. J., Mason, I. J., Walsh, F. S., and Doherty, P. (1997) Neuron 18, 231-241[CrossRef][Medline] [Order article via Infotrieve]
45. Li, Y., Basilico, C., and Mansukhani, A. (1994) Mol. Cell. Biol. 14, 7660-7669[Abstract/Free Full Text]
46. Campochiaro, P. A., Chang, M., Ohsato, M., Vinores, M., Nie, S. A., Hjemeland, Z., Mansukhani, L., Basilico, C., and Zack, D. J. (1996) J. Neurosci. 16, 1679-1688[Abstract/Free Full Text]
47. Yayon, A., and Klagsbrun, M. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 5346-5350[Abstract/Free Full Text]
48. Renaud, F., Desset, S., Oliver, L., Gimenez-Gallego, G., van Obberghen, E., Courtois, Y., and Laurent, M. (1996) J. Biol. Chem. 271, 2801-2811[Abstract/Free Full Text]
49. Doherty, P., Williams, E., and Walsh, F. (1995) Neuron 14, 57-66[CrossRef][Medline] [Order article via Infotrieve]
50. Ortega, S., Ittmann, M., Tsang, S. H., Ehrlich, M., and Basilico, C. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 5672-5677[Abstract/Free Full Text]
51. Dono, R., Texido, T., Dussel, R., Ehmke, H., and Zeller, R. (1998) EMBO J. 17, 4213-4225[CrossRef][Medline] [Order article via Infotrieve]

Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.


This article has been cited by other articles:


Home page
 Biol. Reprod.Home page
J. C. Gill and P.-S. Tsai
Expression of a Dominant Negative FGF Receptor in Developing GNRH1 Neurons Disrupts Axon Outgrowth and Targeting to the Median Eminence
Biol Reprod, March 1, 2006; 74(3): 463 - 472.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Hashimoto, Y. Sagara, D. Langford, I. P. Everall, M. Mallory, A. Everson, M. Digicaylioglu, and E. Masliah
Fibroblast Growth Factor 1 Regulates Signaling via the Glycogen Synthase Kinase-3beta Pathway. IMPLICATIONS FOR NEUROPROTECTION
J. Biol. Chem., August 30, 2002; 277(36): 32985 - 32991.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chevet, E.
Right arrow Articles by Katinka, M. D.
Right arrow