JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Han, Z. S.
Right arrow Articles by Ip, Y. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Han, Z. S.
Right arrow Articles by Ip, Y. T.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 30, 21355-21361, July 23, 1999


Interaction and Specificity of Rel-related Proteins in Regulating Drosophila Immunity Gene Expression*

Z. Stanley HanDagger and Y. Tony IpDagger §

From the Dagger  Program in Molecular Medicine, Department of Biochemistry and Molecular Biology and § Department of Cell Biology, University of Massachusetts Medical School, Worcester, Massachusetts 01605

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

NF-kappa B/Rel family proteins regulate genes that are critical for many cellular processes including apoptosis, inflammation, immune response, and development. NF-kappa B/Rel proteins function as homodimers or heterodimers, which recognize specific DNA sequences within target promoters. We examined the activity of different Drosophila Rel-related proteins in modulating Drosophila immunity genes by expressing the Rel proteins in stably transfected cell lines. We also compared how different combinations of these transcriptional regulators control the activity of various immunity genes. The results show that Rel proteins are directly involved in regulating the Drosophila antimicrobial response. Furthermore, the drosomycin and defensin expression is best induced by the Relish/Dif and the Relish/Dorsal heterodimers, respectively, whereas the attacin activity can be efficiently up-regulated by the Relish homodimer and heterodimers. These results illustrate how the formation of Rel protein dimers differentially regulate target gene expression.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The molecular components of the innate immune system show remarkable conservation among mammals, insects, and plants (1-3). The recent studies on the homologues of the Drosophila Toll and Rel-related proteins have reinforced the idea that some aspects of immune response have common evolutionary origins (4-6). The Toll-mediated signaling pathway was identified to be essential in determining the dorsal-ventral polarity in the Drosophila embryo. This pathway has recently been shown to be essential also for the Drosophila immune defense (1, 7, 8). The cytoplasmic domain of the Drosophila Toll receptor is homologous to those of the mammalian type I interleukin-1 (IL-1)1 receptor and the newly identified human Toll-like receptors (9-11). This homology can also be found within the vertebrate MyD88 protein (12, 13) and the tobacco N protein (14). Whereas MyD88 is an adaptor protein in the human Toll and IL-1 receptor family signaling pathways (5), N protein in tobacco functions to mediate resistance to the viral pathogen tobacco mosaic virus (14). An intracellular serine-threonine kinase Pelle functions downstream of Toll. Although the immediate substrate of Pelle is still not clear, Pelle interacts with the Toll receptor complex and probably phosphorylates a downstream component to relay the signal (15). A mammalian homologue of Pelle, the IL-1 receptor-associated kinase (16), probably functions through a similar mechanism. In plant, a Pto family of kinases has been identified as homologues of Pelle (17). Interestingly, Pelle, IL-1 receptor-associated kinase, and Pto all contain the homologous death domain, which was first identified in proteins involved in controlling apoptosis. More intriguingly, Drosophila Toll, mammalian Toll-like receptor, and IL-1 receptor signaling all lead to the activation of NF-kappa B/Rel family of transcription factors (1, 6, 11).

NF-kappa B/Rel proteins are held from activation in the cytoplasm of cells by a family of inhibitors, the Ikappa B proteins. The activation of NF-kappa B/Rel is initiated by the phosphorylation, ubiquitination, and degradation of Ikappa B proteins to unmask a nuclear localization signal within NF-kappa B/Rel proteins, leading to the nuclear translocation of NF-kappa B/Rel proteins and the transcription activation of target genes (6, 18). Cactus, a Drosophila Ikappa B homologue, is regulated through a similar mechanism as in vertebrates to regulate Drosophila Rel proteins (1). The extensive conservation of the regulatory pathways makes Drosophila an excellent model system to study mammalian immune response regulation.

NF-kappa B/Rel family proteins are widely distributed dimeric transcription factors that inducibly and coordinately regulate genes that control apoptosis, inflammation, immune response, and development (6, 19). After over a decade of studies in defining the function of Rel protein family, however, the molecular control mechanisms by which these proteins interact with each other to act in various cell types and during different cellular processes remains to be determined. Although it has been shown that different combinations of Rel protein dimers preferentially bind to distinct DNA sequences (kappa B sites) (20), it is not entirely clear how different Rel proteins are individually regulated and how different Rel proteins interact with each other to control specific endogenous gene expression. In Drosophila, Rel proteins such as Dif, Dorsal, and Relish have been shown to participate in the response to bacterial challenge (21-23). One of the Drosophila immune responses against microorganisms is the induction of a group of potent antimicrobial peptides including Attacin, Cecropin, Defensin, Diptericin, and Drosomycin (2, 24, 25). However, it is not understood how the activation of the Rel proteins leads to increased expression of these immunity genes. Since Rel proteins activate transcription as dimers, we overexpressed Rel proteins in different combinations in cultured Drosophila cells to study their interactions and how these interactions lead to the activation of immunity genes in their native chromosomal environment. Our results demonstrate that Rel proteins directly regulate Drosophila immune response by binding to the promoters of antimicrobial peptide genes. Detailed analysis of different Rel protein combinations revealed that although Dif or Dorsal homodimer can be involved in regulating drosomycin gene expression, the activation of drosomycin expression is greatly enhanced by co-expressing Relish. Similarly, Dorsal/Relish heterodimer is the preferred combination, and Dif/Relish heterodimer is also a significant combination, to regulate defensin expression. Molecular analysis reveals that Relish can enhance the binding activity of Dif and Dorsal to kappa B site located within the drosomycin and defensin promoters, providing an explanation for the regulation of these genes by the heterodimer formation. The Relish homodimer and heterodimers can efficiently activate attacin expression, and various dimer combinations can activate cecropin and diptericin. Therefore, the differential regulation of Rel proteins can lead to preferential expression of specific immunity genes.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cell Culture and LPS Challenge-- Drosophila Schneider-2 cells were maintained at 25 °C, in Schneider's medium supplemented with 10% heat-inactivated fetal calf serum, 1× Glutamax-1 and 1× Penstrep (Life Technologies, Inc.). For cells that carried metallothionein promoter plasmid, Rel protein expression was induced by the addition of 0.7 mM CuSO4. After 18 h of CuSO4 incubation, LPS was added to 10 µg/ml. Samples were taken at different time points for protein or RNA analysis.

Plasmid Construction and Stable Cell Line Establishment-- The pBmIEGLacZ-BmIEGhyg, which encodes the hygromycin-resistant gene (26), was used to select stably transfected cells. All Rel protein expression vectors were derived from pRmHa-3 (27). To create pSHflag or pSHhis, a DNA linker coding the FLAG epitope (gaattcatggactataaggacgatgacgacaaaagtagatctctcgaggtc) or a linker coding the hexahistidine epitope (His) (gaattcatgagaggatcgcatcaccatcaccatcacagtagatctctcgaggtc) was inserted into pRmHa-3 between EcoRI and SmaI sites, which placed the cDNA under the control of metallothionein promoter. Polymerase chain reaction mutagenesis was employed to create a SalI site in relish cDNA, a XhoI site in Dif cDNA, and a SalI site in dorsal cDNA immediately upstream of the start codons. Dif, relish, and dorsal cDNA were then subcloned into appropriate pSH vector to create pSHflag-Relish, pSHhis-Dif, and pSHhis-Dorsal. RelD was created as described by Dushay et al. (23), except that the restriction site SalI was used. Stable cell lines that express Relish, Dif, Dorsal, or RelD proteins were established as described by Vulsteke et al. (26), except that Lipofectin (from Invitrogen) was used for transfection according to manufacturer's instruction. Briefly, 5 µg of each Rel protein expression plasmid was mixed with 0.25 µg of pBmIEGLacZ-BmIEGhyg to transfect 1 × 106 cells in each experiment. Stable cell lines were selected and maintained in Schneider's medium supplemented with 200 µg/ml hygromycin B (Life Technologies, Inc.) and 10% heat-inactivated fetal bovine serum (HyClone).

Western Blot-- Mouse anti-FLAG M2 was purchased from Eastman Kodak Co. Mouse anti-RGSHis was purchased from Qiagen. Protein samples were resuspended in Laemmli buffer, separated by 8% denaturing SDS-PAGE, and electroblotted onto a nitrocellulose filter that was then incubated for 1 h in blocking solution (5% nonfat dry milk). The blot was probed with anti-RGSHis antibody or anti-FLAG antibody (1:1000 dilution) overnight at 4 °C. The secondary antibody was a goat anti-mouse horseradish peroxidase conjugate (Jackson ImmunoResearch), and the detection of the target proteins was done using enhanced chemiluminescence performed as recommended by the manufacturer (NEN Life Science Products).

RNA Preparation and Analysis-- Total RNA was prepared using the TRI REAGENT (Molecular Research Center, Inc.), according to the protocol furnished by the manufacturer. Approximately 10 µg of RNA from each sample was separated on 1% agarose-formaldehyde gels and transferred to GeneScreen Plus membranes (NEN Life Science Products). The following random primer-labeled probes were used for Northern hybridization: attacin cDNA (28), cecropin A1 cDNA (29), diptericin cDNA (30), drosomycin cDNA (31), defensin cDNA (32), and rp49 cDNA (33). Hybridization was performed at 45 °C in 50% formamide and 2× SSC for 20 h. The stringent wash was carried out at 65 °C in 0.1× SSC, 0.1% SDS. After washing, the membrane was exposed to x-ray film or quantified with a PhosphorImager (Molecular Dynamics).

Electrophoretic Mobility Shift Assay (EMSA)-- EMSA was done as described previously with modification (34). Cell extracts were prepared from S2* cells by sonication in EMSA buffer containing 20 mM Hepes (pH 8.0), 100 mM NaCl, 1 mM EDTA, 12% glycerol, 10 µg/ml leupeptin, 10 µg/ml aprotinin, 1 mM phenylmethylsulfonyl fluoride. Insoluble materials were removed by centrifugation at 4 °C for 15 min at 14,000 rpm. Synthetic oligonucleotides were annealed from complementary strands and labeled using T4 DNA polymerase and [32P]dCTP. Binding reactions were carried out by adding 2 ng of 32P-labeled kappa B probe and cell extract containing 5 µg of protein in a final volume of 20 µl EMSA buffer. After 30 min incubation at room temperature, samples were separated on 4% native polyacrylamide gel. For antibody supershift, about 0.75 µg of M2 anti-FLAG antibody was added to the reaction buffer. For competition assay, EMSA was carried out in the presence or absence of 20-fold of competing oligonucleotides. The sequences of the oligonucleotides were shown in Fig. 5. The genomic DNA sequence of drosomycin was deposited by the Berkeley Drosophila Genome Project and can be obtained from GenBankTM under accession number AC004358. The genomic DNA sequence of defensin has been described previously (32).

Immunoprecipitation-- Cells were lysed in a buffer containing 20 mM Tris-HCl (pH 7.4), 137 mM NaCl, 2 mM EDTA, 1% Triton X-100, 10% glycerol, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, 10 µg/ml aprotinin. Insoluble materials were pelleted by centrifugation at 14,000 rpm, 4 °C for 15 min. Cell lysates were pre-cleared with G protein-agarose beads (Roche Molecular Biochemicals) and incubated with M2 anti-FLAG antibody that was pre-bound to G protein-agarose beads. After washing, antigen-antibody-protein G complexes were separated on SDS-PAGE for Western blot analysis.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Expression of Immunity Genes in S2* Cells-- We first characterized the cell line for the study. The parental S2 cell line used in this series of experiments can be induced by lipopolysaccharide (LPS) to express a subset of antimicrobial genes and is therefore designated as S2* cells (35). In these cells, attacin, cecropin, and diptericin were inducible, but drosomycin induction was not detectable. Comparing with the induction levels of attacin and cecropin, defensin was less inducible (see Fig. 3A, the left four lanes). The differential expression of the antimicrobial genes is consistent with a multiple pathway model (7) in which either LPS activates multiple receptors leading to the induction of individual immunity genes or a single LPS receptor can activate an intracellular pathway that branches at certain point to regulate different immunity genes. The S2* cells may lack some, but not all, of the regulatory molecules that act downstream of the branch point, resulting in a partial inducibility by LPS.

Although different pathways have been proposed to regulate various immunity gene expression, the utilization of specific Rel proteins in each pathway is not known even though most of these genes can be regulated by NF-kappa B-binding elements (34, 36-38). To correlate the function of Rel proteins with the regulation of immune response, we examined the mRNA expression of Rel protein genes in S2* cells after LPS challenge. The mRNA for all three Rel protein genes was detectable in S2* cells, albeit at different levels. relish mRNA had high basal expression level, and the expression could be further up-regulated by 4-fold after 1 h of LPS treatment. Dif and dorsal mRNA levels were low and less responsive to LPS treatment (Fig. 1). The different expression levels of Dif, dorsal, and relish mRNA may account for the inducibility of only a subset of immunity genes and suggest that Relish can function as a primary transcription factor in controlling attacin and cecropin expression (also see Fig. 4).


View larger version (60K):
[in this window]
[in a new window]
  		Fig. 1.   mRNA expression of Rel-related genes in S2* cells induced by LPS. S2* cells were challenged with 10 mg/ml LPS. Total RNA were prepared at 1-, 3-, and 6-h time point. The 0-h sample was control cells without LPS treatment. The RNA were separated by denaturing gel, transferred to GeneScreen Plus membrane, and hybridized with various 32P-labeled cDNA probes as indicated.

Inducible Expression of Rel-related Proteins in Stably Transfected Cell Lines-- Stable cell lines that overexpress different Rel proteins, including Dif, Dorsal, and Relish, were established and used to analyze immunity gene regulation. S2* cells were transfected with different combination of plasmids that contained the Rel protein coding sequences under the control of metallothionein promoter. Stably transfected cells were selected as described under "Experimental Procedures." To examine the expression of the transfected constructs, the established cell lines were first incubated with 0.7 mM CuSO4 for 18 h. Approximately equal numbers of cells were then lysed with Triton X-100 and centrifuged to remove the insoluble materials. Supernatants containing Rel proteins were separated by SDS-PAGE, and Rel protein expression was detected with antibodies raised against either the FLAG or the hexahistidine (His) epitope. Western blot results showed that all three proteins were expressed, individually or in combination, to significant levels. The FLAG-tagged Relish expression was relatively uniform in cells designed to express Relish (Fig. 2, upper panel). Expression of His-tagged Dif and Dorsal showed some variations (Fig. 2, lower panels). Despite the variations, the interaction of different Rel proteins seems to be a more important determinant in gene regulation as demonstrated later in Fig. 3 by examining immunity gene induction.


View larger version (25K):
[in this window]
[in a new window]
  		Fig. 2.   Expression of Rel proteins in stably transfected Drosophila S2* cells. S2* cells were transfected with pSHhis-Dif, pSHhis-Dorsal, pSHflag-Relish separately or in different combinations as indicated. The established stable cell lines were treated with 0.7 mM CuSO4 for 18 h to express Rel proteins. Cell extracts were separated by SDS-PAGE, transferred onto a nitrocellulose membrane, and analyzed by anti-FLAG or anti-RGSHis antibodies.


View larger version (35K):
[in this window]
[in a new window]
  		Fig. 3.   Different combinations of Rel proteins preferentially activate different target genes. After 18 h of CuSO4 treatment to induce Rel protein expression, the cells were challenged with LPS. Samples were taken at the 1-, 3-, and 6-h time point for RNA extraction. The 0-h samples were control cells without LPS treatment. Hybridization was carried out as described in Fig. 1. A, autoradiographs of the blots showing antimicrobial peptide gene induction by LPS in stably transfected cells. rp49 was used as RNA loading control. - represents control S2* cells. The bottom panel shows relish expression with shorter exposure than that in Fig. 1 in order to have a better comparison of the endogenous relish and the overexpressed relish. B, quantitative comparison of antimicrobial peptide gene expression in stably transfected cells. The hybridization signal in the Northern blots was quantified with a PhosphorImager. The results represent an average of three independent experiments. dl, dorsal. The parental S2* cells used as a control is represented by c.

Relish Interacts with Dif and Dorsal to Differentially Regulate Immunity Gene Activity-- We examined the expression of anti-microbial genes in the presence of exogenous Rel proteins prior to or after LPS treatment. After 18 h of incubation with CuSO4 to induce the Rel proteins, the cells were challenged with LPS, and RNA samples were analyzed by Northern blot (Fig. 3A). The relative average value of the antimicrobial gene expression from three independent experiments is also shown in Fig. 3B. The expression of Dif or Dorsal alone prior to LPS incubation caused a modest up-regulation of drosomycin gene expression (Fig. 3, A and B, compare 0 h induction in -, Dif, and Dorsal). Dif and Dorsal together have a similar modest effect on drosomycin induction. 1-6 h of LPS treatment further up-regulated drosomycin expression. This Dif or Dorsal dependent up-regulation is specific, because Relish itself did not cause S2* cells to express drosomycin.

A functional interaction between Relish and Dif or Relish and Dorsal was detected by co-expressing two Rel proteins in the S2* cells. When Relish was co-expressed with Dif, drosomycin induction was enhanced significantly (Fig. 3A). This increased expression was observed before LPS challenge. Treatment of the cells with LPS further increased drosomycin expression by 2-fold (Fig. 3, A and B). Even though there is a significant amount of Relish RNA in parental S2* cell as shown in Fig. 1, Dif functions better with more exogenous Relish expression. It is possible that Dif and Relish form unstable heterodimer, and the formation of the heterodimer requires higher concentrations of Dif and Relish than that produced by the endogenous genes. The result nonetheless suggests that the formation of Dif/Relish dimer is the rate-limiting step for full activation of drosomycin. Although the Relish and Dorsal combination also increased the expression and the inducibility of drosomycin, the effect of Dif/Relish on drosomycin expression was 4-fold higher than that of Dorsal/Relish (Fig. 3B). It is possible that the promoter of drosomycin has higher affinity toward Dif/Relish heterodimer. Alternatively, additional protein factors are involved in activating drosomycin expression, and these proteins coordinate better with Dif/Relish heterodimer. In summary, these results demonstrated that Relish functionally interacts with Dif and Dorsal to control drosomycin expression and that drosomycin expression is most efficiently activated by Dif/Relish heterodimer.

The induction of defensin prefers the Relish/Dorsal heterodimer over other combinations, which is different from that of drosomycin. Surprisingly, the induction of the defensin gene was down-regulated by the expression of Dif or Dorsal alone. The Dif/Dorsal combination showed similar repressive effect (Fig. 3, A and B). These results suggest that the Dif or Dorsal homodimers bind to the defensin promoter in a nonproductive conformation, thereby blocking the activation by an endogenous factor such as Relish. Expression of Relish in combination with Dorsal and Dif, on the other hand, restored the inducibility of defensin upon LPS treatment. Unlike the induction of drosomycin by Dif/Relish and Dorsal/Relish, defensin was not expressed prior to LPS treatment even in the presence of the heterodimers. One interpretation is that an additional protein factor, activated by LPS, coordinates with Rel proteins to activate defensin expression. The results, therefore, showed that although the expression of Dif or Dorsal alone represses defensin expression, the co-expression of Dorsal and Relish best enhances defensin gene induction, and the co-expression of Dif and Relish can also mediate the induction (Fig. 3B).

Dif, when expressed alone, is sufficient to activate cecropin and diptericin expression before LPS treatment (Fig. 3, A and B, compare the 0-h lanes in -, Dif, Relish). The result is consistent with the previous reports (35, 39) that Dif can activate cecropin and diptericin expression in transfection assays. On the other hand, the co-expression of Dif or Dorsal, in combination with Relish, did not show additional effect on the expression levels of cecropin and diptericin induced by LPS. Taken together, most combinations of Rel proteins can mediate cecropin and diptericin induction, and Dif homodimer is an efficient activator for these two genes.

A Processed Form of Relish Homodimer Activates Attacin and Cecropin Expression-- The Relish protein contains both Rel domain and Ikappa B domain (23). It is likely that the Ikappa B domain of Relish can complex with the Rel domain (RelD) to prevent the activation of Relish when expressed as a full-length protein. To study the function of Relish without the interference of the inhibitory domain, we expressed RelD (from amino acid 4 to 600) in a stable cell line (Fig. 4). When RelD was expressed in S2* cells, attacin and cecropin were already activated prior to LPS treatment. In contrast, full-length Relish protein expression did not significantly activate attacin expression prior to LPS treatment (Fig. 4, compare 0-h lane of each set). Furthermore, RelD did not affect drosomycin expression. In the presence of LPS, the expression of attacin and cecropin in the RelD-expressing cells was further elevated by only 2-fold. This suggests that RelD, in the absence of other Rel factors, can activate transcription of specific target genes. The result is in agreement with the observation that the ability of the parental S2* cells to up-regulate Relish by LPS is coincidental with the expression of attacin and cecropin (Fig. 1). It may be that the formation of the processed Relish (RelD-like product) is the rate-limiting step, which is regulated by LPS. Therefore, the result supports the notion that Relish can function as the primary transcription factor in controlling attain and cecropin gene induction. Because RelD alone can function to activate attacin and cecropin but not drosomycin expression, it further supports the idea that different combinations of Rel proteins have preferred target genes in vivo.


View larger version (43K):
[in this window]
[in a new window]
  		Fig. 4.   The Rel domain of Relish activates attacin and cecropin gene expression. Stable cell lines were established to inducibly express RelD alone or in combination with Dif. Cells expressing exogenous Rel proteins were challenged with LPS, and samples were taken at the 1-, 3-, and 6-h time point for RNA preparation. The 0-h samples were control cells without LPS treatment. Hybridization was done as described in Fig. 1.

Relish Can Complex with Dif and Dorsal-- Based on the functional interaction of Drosophila Rel proteins, we expected that part of the protein function was achieved by the formation of heterodimers. To analyze further the interaction of Relish with Dif or Dorsal, we performed co-immunoprecipitation experiments (Fig. 5). Anti-FLAG antibody was used to pull down FLAG-tagged Relish from extracts of cells that expressed Relish. The reaction was specific because the antibody did not recognize Dif or Dorsal protein, which contains the HIS epitope (Fig. 5, lower panel). From the samples that had Relish co-expressed with Dif or Dorsal, the His-tagged Dif and Dorsal can be co-immunoprecipitated as examined by Western blot (Fig. 5, upper panel). Quantitative analysis showed that 1-2% of total Dif or Dorsal can be co-immunoprecipitated along with Relish (data not shown). It is possible that higher percentage of heterodimers are formed in the cells but escaped detection. Furthermore, such amounts of heterodimer formation may be sufficient to account for the biological activities observed when assaying for the immunity gene expression. Nevertheless, the results demonstrated the specific interactions between Relish and Dif or Relish and Dorsal.


View larger version (34K):
[in this window]
[in a new window]
  		Fig. 5.   Dif and Dorsal can be co-immunoprecipitated with Relish as detected by Western blot. Cells were lysed with Triton X-100, and FLAG-tagged Relish was immunoprecipitated with M2 anti-FLAG antibody. Immunoprecipitates (IP) and cell extracts (Input) were separated by SDS-PAGE, transferred to nitrocellulose membrane, and blotted with either anti-FLAG or anti-His antibodies to detect the tagged exogenous Rel proteins. To detect weak protein-protein interaction and avoid overloading, the amount of proteins from each immunoprecipitate loaded on the SDS-PAGE was equivalent to 20 times the amount of proteins from the input cell extracts.

Rel Proteins Bind to kappa B Sites in Drosomycin and Defensin Promoters-- Since co-expression of Relish with Dif or Dorsal can enhance the expression of drosomycin and defensin, we speculate that the proteins can interact directly with the target genes to regulate their expression. Among the immunity genes, the cecropin and diptericin promoters have been the most thoroughly analyzed. Previously, it has been shown that Dif can bind to the kappa B site in the cecropin promoter, whereas Dorsal can bind to a similar site in the diptericin promoter. The binding probably leads to activated transcription of cecropin and diptericin (35, 39). Furthermore, Dif and Dorsal may preferentially activate cecropin and diptericin, respectively, based on DNA binding and transfection studies. Meanwhile, our results suggest the possibility that the heterodimers formed by these Rel proteins bind to kappa B sites in the promoters of drosomycin and defensin. Based on the conserved sequence of insect kappa B motif (34), we have identified similar kappa B sites in the promoters of both drosomycin and defensin (Fig. 6, A and C). We then tested whether Rel proteins expressed in the stable cell lines can interact directly with these kappa B sites using EMSA (Fig. 6). The parental S2* cell extract exhibited very little DNA binding activity (lane -). The cell extract that expressed FLAG-tagged Relish had strong binding activity toward the oligonucleotide containing the drosomycin kappa B site (Fig. 6A, indicated by triangle ). This activity was supershifted by anti-FLAG antibody (Fig. 6A, indicated by black-triangle), showing Relish was the protein factor that bound directly to the kappa B site. Compared with Relish, Dif and Dorsal had relatively lower binding affinity. When Relish was co-expressed with Dif or Dorsal, new complexes were formed that had faster mobility (Fig. 6A, indicated by *), probably due to the formation of Dif/Relish or Dorsal/Relish heterodimer which has lower molecular weight. The result indicated that Relish enhanced the binding of Dif and Dorsal to the kappa B site. Moreover, the corresponding bands were supershifted by anti-FLAG antibody, demonstrating that FLAG-tagged Relish complexed with Dif and Dorsal in binding to DNA.


View larger version (26K):
[in this window]
[in a new window]
  		Fig. 6.   Rel proteins bind to kappa B sites in the promoters of drosomycin and defensin. 5 µg of cell extract, from cell lines expressing different Rel proteins as indicated, was incubated with 2 ng of 32P-labeled kappa B probe for 30 min at 25 °C in EMSA buffer. The reaction complex was separated on a 4% native polyacrylamide gel. A, EMSA performed with oligonucleotide probe containing the kappa B motif (boxed) in drosomycin promoter. The prominent complexes are indicated by triangle , black-triangle, and *. The triangle  complex is seen in extract containing transfected Relish and therefore likely represents the Relish homodimer-DNA complex. Similarly, the * complexes likely represent heterodimer-DNA complexes. The supershift experiments using anti-FLAG antibody (labeled as +Ab) show that the antibody recognizes Relish homodimer and heterodimers (indicated by black-triangle). B, competition EMSA performed with kappa B probes. 20-fold excess amounts of wild type kappa B or kappa Bmut oligonucleotides were added to the reaction buffer to compete with 32P-labeled kappa B probe. The wild type kappa B probe caused a significant decrease in complex formation, whereas the mutant probe did not. This shows that the expressed protein specifically recognizes the consensus kappa B motif. C, EMSA performed with an oligonucleotide containing a kappa B motif in defensin promoter. DNA-protein complexes containing Relish are similarly marked as in A.

To confirm further that Rel proteins bind to the kappa B sites within the oligonucleotides, we carried out competition EMSA. Whereas 20-fold excess amount of the same wild type oligonucleotide effectively blocked the binding of the Rel proteins to the 32P-labeled wild type oligonucleotide, the oligonucleotide with mutated kappa B motif did not affect the binding (Fig. 6B), suggesting that the Rel proteins bind specifically to the kappa B motif of drosomycin.

The binding activity of Rel proteins to the kappa B site of defensin promoter showed similar pattern to that of drosomycin promoter, albeit with lower affinity (Fig. 6C). Interestingly, this is coincident with lower level of defensin expression in S2* cells and in adult fly. Whether the affinity of the Rel proteins toward the target promoter determines the inducibility requires further investigation. When we examined the cellular extracts that contain combinations of Rel proteins, we found that Relish enhanced the binding activity of both Dif and Dorsal (Fig. 6C, indicated by *). The corresponding bands could also be supershifted using the anti-FLAG antibody, showing that the complex indeed contained Relish. The result therefore demonstrated that Rel proteins can interact directly with the defensin promoter.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Our results demonstrated that all five immunity genes that we have tested can be regulated by Rel-related proteins. Moreover, heterodimer formation can lead to an increased potential of gene regulatory activity by these factors. At least three pathways have been proposed to be involved in the transcriptional activation of Drosophila anti-microbial gene expression (7, 40). drosomycin is largely regulated by the Toll/Cactus pathway, whereas attacin and cecropin are regulated by a pathway involving imd and 18wheeler. The third pathway involving imd is employed to regulate diptericin and drosocin. Further evidence indicates that Drosophila immune system may involve additional regulatory molecules. One example is that attacin and cecropin respond to p38 mitogen-activated protein kinase signaling pathway (41). It has also been shown that Dif and Dorsal can be activated independently, implying the presence of multiple signaling components that may lead to the activation of individual Rel proteins (42). Our present results reveal another level of complexity in the regulatory mechanism as depicted in Fig. 7. Despite some overlapping activations by other combinations, drosomycin expression is primarily activated by Dif/Relish heterodimer, and defensin expression is primarily activated by Dorsal/Relish heterodimer. The attacin expression is primarily activated by Relish homodimer, and Dif/Relish and Dorsal/Relish heterodimers can perform the function during LPS stimulation of attacin. Therefore, whereas the numbers of Rel proteins are limited, they can mediate a broad range of cellular processes by using different combinations of these transcription factors.


View larger version (46K):
[in this window]
[in a new window]
  		Fig. 7.   Different combinations of Rel proteins have preferred target genes during Drosophila immune response. drosomycin is mainly activated by the Dif/Relish heterodimer; defensin is mainly activated by the Dorsal/Relish, and attacin can be activated by the Relish homodimer as well as heterodimers. Genes shown in boldface represent major targets, and those shown in smaller letters are less dependent on the specific Rel protein combinations.

In vertebrates, there are five known Rel proteins. Most of them can form homodimers and heterodimers in vitro except RelB, which only forms dimers with NF-kappa B1 (p50) or NF-kappa B2 (p52) (18). Loss-of-function mutations of individual Rel proteins generate distinctive immune defective phenotype in knockout mice (6, 19). It is not clear, however, whether the phenotype is due to the lack of homodimers or heterodimers. Although it was reported (6, 20) that different combinations of Rel protein dimers bind to distinct kappa B sites with differential affinities, the effect of different dimers on endogenous genes expression has not been tested extensively. We overexpressed Drosophila NF-kappa B/Rel proteins in S2* cells and examined the expression of the immunity genes in their native chromosomal environment. Our results demonstrate that although both Dif and Dorsal homodimers can be involved in regulating drosomycin gene expression, the activity of Dif is greatly enhanced by co-expressing Relish. Meanwhile Dorsal/Relish heterodimer is the preferred combination that regulates defensin expression. The Relish homodimer can efficiently activate attacin and cecropin expression. It has been shown that Dif and Dorsal can interact in vitro (39). Although we did not detect any significant functional interaction between Dif and Dorsal (Fig. 3), it is possible that Dif/Dorsal heterodimer may contribute redundant function or may control the expression of genes other than those we have examined.

It was previously shown that Dif can activate cecropin expression in transfection experiments (35, 39). Our results also support this observation (Fig. 3). It is therefore possible that Dif is involved in regulating cecropin expression. On the other hand, genetic study showed Toll signaling pathway controls the activation of Dif and Dorsal, yet mutations in the Toll pathway only partially affect cecropin expression (7, 8). We showed that in S2* cells, even though Dif is not actively expressed or up-regulated by LPS, yet cecropin expression can be induced (Figs. 1 and 3). It is therefore likely that Dif and Relish both contribute to the expression of cecropin.

Our results from co-immunoprecipitation and EMSA showed the complex formation between Relish and Dif as well as Relish and Dorsal (Figs. 5 and 6). The complex formation provides the molecular basis for the regulation of immunity genes by the heterodimers. Although there is a significant level of Relish RNA present in the parental S2* cells, very little functional interaction and DNA binding activity are detected in cells transfected to overexpress Dif or Dorsal. It may reflect the requirement of higher levels of Relish expression in order to form heterodimers for full expression of drosomycin. It is possible that proper processing of Relish, such as proteolytic cleavage, is required for heterodimerization. In the parental S2* cells, there may not be enough mature Relish for heterodimerization. When a high level of Relish is provided by transfection, more Relish protein may be properly processed to enhance heterodimer formation. These heterodimers then become most productive in regulating drosomycin and defensin expression.

Since our results show that different heterodimers have different preferences on target gene regulation, it raises the possibility that the cell may regulate Relish/Dif and Relish/Dorsal through different pathways in order to achieve specific needs. This may explain reported observations showing that in different mutant flies the activation of Dif and Dorsal can be independently regulated and that different micro-organisms induce different subsets of antimicrobial peptides (42, 43). Based on our results, we also expect that Relish has a broader effect than Dif or Dorsal on Drosophila immunity gene expression since Relish is a common subunit of the heterodimers. In summary, we establish that the differential regulation of Rel proteins can lead to preferential expression of specific target genes.

    ACKNOWLEDGEMENTS

We thank R. Huybrechts for plasmids carrying hygromycin-resistant gene; L. Goldstein for plasmid pRmHa-3; Dan Hultmark for the attacin and relish cDNA; Y. Engstrom for the cecropin cDNA; J. Hoffmann for the defensin and drosomycin cDNA; M. Hou, S. Ashraf, and K. Hemavathy for reading the manuscript; and A. Purohit for immunoprecipitation protocol.

    FOOTNOTES

* This work was supported by National Institutes of Health Grant GM53269 (to Y. T. I.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Recipient of a Scholar Award of the Leukemia Society of America. To whom correspondence should be addressed: Program in Molecular Medicine, University of Massachusetts Medical School, 373 Plantation St., Worcester, MA 01605. Tel.: 508-856-5136; Fax: 508-856-4289; E-mail: Tony.Ip@ummed.edu.

    ABBREVIATIONS

The abbreviations used are: IL-1, interleukin-1; LPS, lipopolysaccharide; PAGE, polyacrylamide gel electrophoresis; EMSA, electrophoretic mobility shift assay.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Belvin, M. P., and Anderson, K. V. (1996) Annu. Rev. Cell Dev. Biol. 12, 393-416[CrossRef][Medline] [Order article via Infotrieve]
2. Dushay, M. S., and Eldon, E. D. (1998) Am. J. Hum. Genet. 62, 10-14[CrossRef][Medline] [Order article via Infotrieve]
3. O'Neill, L. A., and Greene, C. (1998) J. Leukocyte Biol. 63, 650-657[Abstract]
4. Yang, R. B., Mark, M. R., Gray, A., Huang, A., Xie, M. H., Zhang, M., Goddard, A., Wood, W. I., Gurney, A. L., and Godowski, P. J. (1998) Nature 395, 284-288[CrossRef][Medline] [Order article via Infotrieve]
5. Medzhitov, R., Preston-Hurlburt, P., Kopp, E., Stadlen, A., Chen, C., Ghosh, S., and Janeway, C. A. J. (1998) Mol. Cell 2, 253-258[CrossRef][Medline] [Order article via Infotrieve]
6. Ghosh, S., May, M. J., and Kopp, E. B. (1998) Annu. Rev. Immunol. 16, 225-260[CrossRef][Medline] [Order article via Infotrieve]
7. Lemaitre, B., Nicolas, E., Michaut, L., Reichhart, J. M., and Hoffmann, J. A. (1996) Cell 86, 973-983[CrossRef][Medline] [Order article via Infotrieve]
8. Meng, X., Khanuja, B. S., and Ip, Y. T. (1999) Genes Dev. 13, 792-797[Abstract/Free Full Text]
9. Hashimoto, C., Hudson, K. L., and Anderson, K. V. (1988) Cell 52, 269-279[CrossRef][Medline] [Order article via Infotrieve]
10. Rock, F. L., Hardiman, G., Timans, J. C., Kastelein, R. A., and Bazan, J. F. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 588-593[Abstract/Free Full Text]
11. Medzhitov, R., Preston-Hurlburt, P., and Janeway, C. A. J. (1997) Nature 388, 394-397[CrossRef][Medline] [Order article via Infotrieve]
12. Lord, K. A., Hoffman-Liebermann, B., and Liebermann, D. A. (1990) Oncogene 5, 1095-1097[Medline] [Order article via Infotrieve]
13. Hultmark, D. (1994) Biochem. Biophys. Res. Commun. 199, 144-146[CrossRef][Medline] [Order article via Infotrieve]
14. Whitham, S., Dinesh-Kumar, S. P., Choi, D., Hehl, R., Corr, C., and Baker, B. (1994) Cell 78, 1101-1115[CrossRef][Medline] [Order article via Infotrieve]
15. Shen, B., and Manley, J. L. (1998) Development 125, 4719-4728[Abstract]
16. Cao, Z., Henzel, W. J., and Gao, X. (1996) Science 271, 1128-1131[Abstract]
17. Martin, G. B., Brommonschenkel, S. H., Chunwongse, J., Frary, A., Ganal, M. W., Spivey, R., Wu, T., Earle, E. D., and Tanksley, S. D. (1993) Science 262, 1432-1436[Abstract/Free Full Text]
18. Verma, I. M., Stevenson, J. K., Schwarz, E. M., Van Antwerp, D., and Miyamoto, S. (1995) Genes Dev. 9, 2723-2735[Free Full Text]
19. Baeuerle, P. A., and Baltimore, D. (1996) Cell 87, 13-20[CrossRef][Medline] [Order article via Infotrieve]
20. Kunsch, C., Ruben, S. M., and Rosen, C. A. (1992) Mol. Cell. Biol. 12, 4412-4421[Abstract/Free Full Text]
21. Ip, Y. T., Reach, M., Engstrom, Y., Kadalayil, L., Cai, H., Gonzalez-Crespo, S., Tatei, K., and Levine, M. (1993) Cell 75, 753-763[CrossRef][Medline] [Order article via Infotrieve]
22. Lemaitre, B., Meister, M., Govind, S., Georgel, P., Steward, R., Reichhart, J. M., and Hoffmann, J. A. (1995) EMBO J. 14, 536-545[Medline] [Order article via Infotrieve]
23. Dushay, M. S., Asling, B., and Hultmark, D. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 10343-10347[Abstract/Free Full Text]
24. Hultmark, D. (1993) Trends Genet. 9, 178-183[CrossRef][Medline] [Order article via Infotrieve]
25. Ip, Y. T., and Levine, M. (1994) Curr. Opin. Genet. and Dev. 4, 672-677[CrossRef][Medline] [Order article via Infotrieve]
26. Vulsteke, V., Janssen, I., Broeck, J. B., De Loof, A., and Huybrechts, R. (1993) Insect Mol. Biol. 2, 195-204[Medline] [Order article via Infotrieve]
27. Bunch, T. A., Grinblat, Y., and Goldstein, L. S. (1988) Nucleic Acids Res. 16, 1043-1061[Abstract/Free Full Text]
28. Asling, B., Dushay, M. S., and Hultmark, D. (1995) Insect Biochem. Mol. Biol. 25, 511-518[CrossRef][Medline] [Order article via Infotrieve]
29. Kylsten, P., Samakovlis, C., and Hultmark, D. (1990) EMBO J. 9, 217-224[Medline] [Order article via Infotrieve]
30. Wicker, C., Reichhart, J. M., Hoffmann, D., Hultmark, D., Samakovlis, C., and Hoffmann, J. A. (1990) J. Biol. Chem. 265, 22493-22498[Abstract/Free Full Text]
31. Fehlbaum, P., Bulet, P., Michaut, L., Lagueux, M., Broekaert, W. F., Hetru, C., and Hoffmann, J. A. (1994) J. Biol. Chem. 269, 33159-33163[Abstract/Free Full Text]
32. Dimarcq, J. L., Hoffmann, D., Meister, M., Bulet, P., Lanot, R., Reichhart, J. M., and Hoffmann, J. A. (1994) Eur. J. Biochem. 221, 201-209[Medline] [Order article via Infotrieve]
33. O'Connell, P. O., and Rosbash, M. (1984) Nucleic Acids Res. 12, 5495-5513[Abstract/Free Full Text]
34. Engstrom, Y., Kadalayil, L., Sun, S. C., Samakovlis, C., Hultmark, D., and Faye, I. (1993) J. Mol. Biol. 232, 327-333[CrossRef][Medline] [Order article via Infotrieve]
35. Petersen, U. M., Bjorklund, G., Ip, Y. T., and Engstrom, Y. (1995) EMBO J. 14, 3146-3158[Medline] [Order article via Infotrieve]
36. Sun, S. C., and Faye, I. (1992) Eur. J. Biochem. 204, 885-892[Medline] [Order article via Infotrieve]
37. Reichhart, J. M., Georgel, P., Meister, M., Lemaitre, B., Kappler, C., and Hoffmann, J. A. (1993) C. R. Acad. Sci. III 316, 1218-1224[Medline] [Order article via Infotrieve]
38. Kadalayil, L., Petersen, U. M., and Engstrom, Y. (1997) Nucleic Acids Res. 25, 1233-1239[Abstract/Free Full Text]
39. Gross, I., Georgel, P., Kappler, C., Reichhart, J. M., and Hoffmann, J. A. (1996) Nucleic Acids Res. 24, 1238-1245[Abstract/Free Full Text]
40. Williams, M. J., Rodriguez, A., Kimbrell, D. A., and Eldon, E. D. (1997) EMBO J. 16, 6120-6130[CrossRef][Medline] [Order article via Infotrieve]
41. Han, Z. S., Enslen, H., Hu, X., Meng, X., Wu, I. H., Barrett, T., Davis, R. J., and Ip, Y. T. (1998) Mol. Cell. Biol. 18, 3527-3539[Abstract/Free Full Text]
42. Wu, L. P., and Anderson, K. V. (1998) Nature 392, 93-97[CrossRef][Medline] [Order article via Infotrieve]
43. Lemaitre, B., Reichhart, J. M., and Hoffmann, J. A. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 14614-14619[Abstract/Free Full Text]

Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Proc. Natl. Acad. Sci. USAHome page
D. E. Reed, X. M. Huang, J. A. Wohlschlegel, M. S. Levine, and K. Senger
DEAF-1 regulates immunity gene expression in Drosophila
PNAS, June 17, 2008; 105(24): 8351 - 8356.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
T. Tanji, X. Hu, A. N. R. Weber, and Y. T. Ip
Toll and IMD Pathways Synergistically Activate an Innate Immune Response in Drosophila melanogaster
Mol. Cell. Biol., June 15, 2007; 27(12): 4578 - 4588.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
J. A. Kroemer and B. A. Webb
Divergences in Protein Activity and Cellular Localization within the Campoletis sonorensis Ichnovirus Vankyrin Family
J. Virol., December 15, 2006; 80(24): 12219 - 12228.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
H. Thoetkiattikul, M. H. Beck, and M. R. Strand
Inhibitor {kappa}B-like proteins from a polydnavirus inhibit NF-{kappa}B activation and suppress the insect immune response
PNAS, August 9, 2005; 102(32): 11426 - 11431.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. W. Shin, V. Kokoza, G. Bian, H.-M. Cheon, Y. J. Kim, and A. S. Raikhel
REL1, a Homologue of Drosophila Dorsal, Regulates Toll Antifungal Immune Pathway in the Female Mosquito Aedes aegypti
J. Biol. Chem., April 22, 2005; 280(16): 16499 - 16507.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
M. Beck and M. R. Strand
Glc1.8 from Microplitis demolitor Bracovirus Induces a Loss of Adhesion and Phagocytosis in Insect High Five and S2 Cells
J. Virol., February 1, 2005; 79(3): 1861 - 1870.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Y. Yoshida, A. Kumar, Y. Koyama, H. Peng, A. Arman, J. A. Boch, and P. E. Auron
Interleukin 1 Activates STAT3/Nuclear Factor-{kappa}B Cross-talk via a Unique TRAF6- and p65-dependent Mechanism
J. Biol. Chem., January 16, 2004; 279(3): 1768 - 1776.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
N. Silverman, R. Zhou, R. L. Erlich, M. Hunter, E. Bernstein, D. Schneider, and T. Maniatis
Immune Activation of NF-{kappa}B and JNK Requires Drosophila TAK1
J. Biol. Chem., December 5, 2003; 278(49): 48928 - 48934.
[Abstract] [Full Text]