| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 274, Issue 31, 21499-21502, July 30, 1999
,
From the Lower Saxony Institute for Peptide Research,
Feodor-Lynen-Strasse 31, D-30 625 Hannover, Germany the
¶ Department of Anatomy, University of Zürich,
Wintherthurerstrasse 190, CH-8057 Zürich, Switzerland, and the
§ Department of Clinical Chemistry and Clinical
Biochemistry, Klinikum Innenstadt,
Ludwig-Maximilians-Universität, Nu
baumstrasse 20, D-80 336 Munich, Germany
 |
ABSTRACT |
|---|
 TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
|
|---|
Proteinase inhibitors are important negative
regulators of proteinase action in vivo. We have succeeded
in isolating two previously unknown polypeptides (HF6478 and HF7665)
from human blood filtrate that are parts of a larger precursor protein
containing two typical Kazal-type serine proteinase inhibitor motifs.
The entire precursor protein, as deduced from the nucleotide sequence
of the cloned cDNA, exhibits 15 potential inhibitory domains,
including the Kazal-type domains, HF6478, HF7665, and 11 additional
similar domains. An inhibitory effect of HF7665 on trypsin activity is demonstrated. Because all of the 13 HF6478- and HF7665-related domains
share partial homology to the typical Kazal-type domain but lack one of
the three conserved disulfide bonds, they may represent a novel type of
serine proteinase inhibitor. The gene encoding the
multidomain proteinase inhibitor, which we have termed LEKTI, was localized on human chromosome 5q31-32. As shown by reverse transcriptase-polymerase chain reaction and Northern blot analysis, it is expressed in the thymus, vaginal epithelium,
Bartholin's glands, oral mucosa, tonsils, and the parathyroid glands.
From these results, we assume that LEKTI may play a role in
anti-inflammatory and/or antimicrobial protection of mucous epithelia.
Proteinases are enzymes required for nonspecific processes of
digestion and intracellular protein turnover as well as specific proteolytic activation of inactive precursors of many regulatory proteins, such as enzymes and peptide hormones. In addition, they are
involved in several processes of extracellular matrix
remodeling. Depending on the nature of their reactive center, they are
subdivided into the classes of serine, cysteine, aspartate, and
metalloproteinases (for review see Ref. 1). To control the action of
proteinases in vivo, organisms produce another group of
proteins, namely the proteinase inhibitors (for review see Refs. 2-4).
Indeed, many pathological effects are due to the non-regulated action
of endogenously produced proteinases or such proteinases encoded or
synthesized by viruses, bacteria, and parasites (for review see Ref.
5). For instance, a genetically determined fault of the
Here we report the isolation of two peptides (HF6478
and HF7665) from human blood filtrate (hemofiltrate), which may
represent a novel class of proteinase inhibitor. Blood filtrate, a
by-product of ultrafiltration of the blood from patients with acute
renal failure, is routinely used by us as a source for the systematic as well as random isolation of novel human peptides (9). Due to the
cut-off limit of the hemofilters (approximately 20,000 Da), it mainly
contains peptides exhibiting a molecular mass below 20,000 Da.
Nevertheless, we succeeded in isolating members of many different
peptide/protein families such as hormones, cytokines, growth factors,
enzymes, proteinase inhibitors, transport, and plasma proteins (10).
The two isolated peptides, HF6478 and HF7665, as deduced from cDNA
cloning, are part of a common putative precursor protein termed LEKTI,
which contains 11 additional similar peptides plus two typical
Kazal-type serine proteinase inhibitor domains (a total of 15 potential
inhibitory domains). We demonstrate the ability of HF7665 to inhibit
trypsin and show the expression of the corresponding gene in human
thymus, vaginal epithelium, Bartholin's glands, oral mucosa, tonsils,
and the parathyroid glands. From the data obtained, we assume that
LEKTI may be important for the anti-inflammatory and/or
antimicrobial protection of mucous epithelia.
Isolation and Biochemical Characterization of the Peptides HF6478
and HF7665--
Human blood ultrafiltrate (hemofiltrate, HF) obtained
from a local nephrological center (Hannoversch-Münden, Germany)
was acidified with HCl to pH 3.0 and cooled to inhibit proteolysis. Following a random isolation strategy, extraction of the peptides and
subsequent analysis by mass spectrometry and sequencing was performed
as described for the isolation and characterization of
vitronectin-derived peptides (11). Conditioned blood filtrate was
loaded onto a cation exchange column (25 × 5 cm, Fractogel SP
650M, Merck, Darmstadt, Germany) and eluted with 1 M
ammonium acetate, 0.5 M acetic acid, and 20% methanol at a
flow rate of 50 ml/min. Aliquots of the fractions obtained were
subjected to an RP-C18 column (15-20 µm, 300 Å, 47 × 300 mm,
Vydac, Hesperia, CA) and further separated at a flow rate of 42 ml/min
using a gradient of 1% buffer B/min (buffer A, 0.1% trifluoroacetic
acid; buffer B, 80% acetonitrile, 0.1% trifluoroacetic acid).
Selected single fractions were loaded onto a cation exchange column (5 µm, 300 Å, 10 × 50 mm Pepkat, Biotek, Östringen,
Germany) and separated at a flow rate of 3 ml/min using a gradient of
1% buffer B/min (buffer A, 20 mM sodium phosphate, pH 3.0;
buffer B, 20 mM sodium phosphate, pH 3.0, 1 M
NaCl). To obtain highly purified homogenous peptides, selected peak
fractions were rechromatographed by
analytical RP-HPLC1 using a
C18 column (5 µm, 300 Å, 0.46 × 25 cm, Vydac,
Hesperia, CA) with the same buffers as for the preparative C18 RP-HPLC
described above. For the determination of intramolecular disulfide
bonds, native HF7665 was cleaved by endoproteinases (chymotrypsin,
Glu-C, Lys-C, Asp-N; Roche Molecular Biochemicals, Basel, Switzerland), and the generated fragments were subsequently analyzed by mass spectrometry and amino acid sequencing as described (11).
Molecular Biological Standard Methods--
RNA extraction,
cDNA first strand synthesis, polymerase chain reaction (PCR),
reverse transcriptase-polymerase chain reaction (RT-PCR), RACE PCR,
Northern blot hybridization, DNA sequencing, genome walking PCR,
sequence analysis, and chromosomal localization of the gene by
radiation hybrid mapping were performed as already described (12-14).
For Northern hybridization, a blot with 20 µg of total RNA from each
tissue as well as a commercially available blot (Human Immune System
II, CLONTECH) with 2 µg of poly(A)+
RNA from each tissue were used. As a hybridization probe, we used a
1713-bp PCR-generated and 32P-labeled partial fragment of
the entire cDNA mentioned below (GenBankTM/EBI
accession number AJ228139) which spans the region from nucleotide 679 to nucleotide 2391. PCR-based radiation hybrid mapping was performed by
means of an exon-specific sense primer (PSTILP-11,
TGCCATGAATTTCAGGCATTTATGAAAAATGG) and an intron-specific antisense primer (LEKTI-55, GAAAAATAATACATTTACCAGTTCAGAG)
corresponding to nucleotide positions 131-162 of the cloned
cDNA (EMI/GenBankTM accession number AJ228139) and
positions 78-51 of an intron following the nucleotide in position 252 of the cDNA, respectively. This intron was identified by the genome
walking strategy using the GenomeWalker kit human
(CLONTECH) (15) and cDNA-derived primers (not
shown). The products obtained by the radiation hybrid mapping PCR were
in the expected size range of 200 bp and could be verified as
LEKTI-specific by means of direct fluorescence sequencing. Analytical
RT-PCR was performed using the sense primer LEKEX-1S
(CCAGTGTACGTAAAGAATGAAGATCAGGAAATGTGCCATGA) in combination with the antisense primer LEKTI-53 (ATTCTTTGCCTGATTTTGATATTGACTGC). Both primers are exon-specific and flank the above-mentioned intron, thus allowing discrimination between amplified cDNA and genomic DNA
fragments. Other molecular biological standard methods were performed
according to Sambrook et al. (16).
Oligonucleotides--
Oligonucleotides were purchased as
"ResearchOligos" from Perkin Elmer (Weiterstadt, Germany). Within
the nucleotide sequences of the oligonucleotides mentioned, the letters
in italics represent "add-on regions" of the oligonucleotides that
do not correspond to coding regions of the cDNA/gene but contain
recognition sequences for certain restriction endonucleases.
Cloning of the LEKTI cDNA--
The following degenerate
oligonucleotides were constructed from the amino acid sequence of the
peptide HF6478 (listed in 5' Detection of Functional Protein Domains--
The potential
Kazal-type proteinase inhibitor domains occurring within the LEKTI
amino acid sequence derived from the cDNA sequence were identified
by means of the MacPattern program (17) and the Prosite data base (18)
on an Apple Power Macintosh computer.
Production of Recombinant HF7665 (rHF7665)--
A partial
cDNA fragment encoding the peptide HF7665 was PCR-amplified under
standard conditions using cDNA from human vaginal epithelium and
the primers VADEX-61S, GAATCTGGAAAAGCAACCTCATATGC (5'-phosphorylated), and VADEX-61AS,
CCGTATGGTACCGAATTCTTACTAGTTTCTTGATTCGCCTTCCTTC. The
Escherichia coli expression vector pTrcHis B (Invitrogen, Carlsbad, CA) was cleaved with BamHI and subsequently
treated with S1 single-strand nuclease (Amersham Pharmacia Biotech,
Freiburg, Germany) to generate blunt ends. The vector and the generated cDNA PCR fragment were then cleaved with EcoRI, and the
latter was cloned site-directed into the blunt-ended BamHI
and the EcoRI site of the vector. Transformation of E. coli TOP10 cells, induction of rHF7665 expression by
isopropyl-1-thio- Inhibition Assays--
Inhibitory effects of HF7665 and
recombinant HF7665 (rHF7665) on trypsin (Roche Molecular Biochemicals)
were examined in 50 mM Tris-HCl buffer, pH 8.0, containing
150 mM NaCl, and 0.01% (v/v) Triton X-100.
N The peptide isolation procedure described above resulted in
purification of two as yet unknown peptides. According to their source
(human hemofiltrate) and their molecular mass, they were designated as
HF6478 and HF7665 (hemofiltrate peptides with
molecular masses of 6478 and 7665 Da, respectively). Both peptides
exhibit deviations in their amino acid sequences and molecular masses but show an identical four-cysteine pattern (Fig.
1A).
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
1-proteinase inhibitor may lead to an enhanced proneness
to lung emphysema caused by uncontrolled action of leukocyte elastase
(6-8). Thus, proteinase inhibitors represent an important therapeutic
tool for a large number of different disorders.
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
3' orientation): MEMC-1,
CCTTCGAATTCTAGAAARAAYGARGAYCARGARATGTG (sense); CHEF-1, CAYGARTTYCARGCNTTYATGAARAAYGG (sense); CHEF-2,
ATCATYTTRCANGTNGCRCAYTT (antisense). As an oligonucleotide
complementary to the poly(A) tail of eukaryotic mRNA, UNIP-2 was
used: CCTGAATTCTAGAGCTCATTTTTTTTTTTTTTTTT. A part of
the LEKTI precursor cDNA was amplified using a two-step strategy as
follows. cDNA first strand was synthesized from biopsy material
representing 17 human tissues (parotid gland, pancreas, skeletal
muscle, brain, stomach, liver, kidney, lung, heart, heart auricle,
bladder, tonsils, corpus cavernosum penis, vaginal epithelium, colon,
bone marrow, and blood). 1/300 of each cDNA first-strand reaction
mixture was subjected to RT-PCR amplification under the following
conditions: 94 °C, 3 min; 98 °C, 1 s, 45 °C, 30 s,
72 °C, 2 min, 30 cycles; 72 °C, 3 min, 1 cycle; cold start;
primers used: MEMC-1/UNIP-2. 1/100 of each preamplification step was
used as a template for a second PCR amplification: 94 °C, 3 min;
98 °C, 1 s, 50 °C, 30 s, 72 °C, 2 min, 30 cycles;
72 °C, 3 min, 1 cycle; cold start; primers used: CHEF-1/CHEF-2.
Homogenous 140-bp PCR fragments from vaginal epithelium and tonsil
cDNA were cloned in pGEM T-vector and sequenced. The obtained
partial cDNA sequence served as a basis for further RACE PCR
experiments (see above), finally resulting in cloning and sequencing of
the entire LEKTI cDNA.
-D-galactopyranoside, and removal of
the His tag by cleavage with enterokinase were accomplished according
to the manufacturer's instructions using the pTrcHis Xpress kit and
EnterokinaseMax (both from Invitrogen, Carlsbad, CA). Pure rHF7665 was
finally isolated by means of RP-HPLC, and its identity to native HF7665
could be demonstrated by mass spectrometry and amino acid sequencing as
described above.
-benzoyl-L-arginine
p-nitroanilide (Sigma, Deisenhofen, Germany; final
concentration of 220 µM) was used as substrate, and its hydrolysis was monitored by the change in absorbance at 405 nm. Various
inhibitor and trypsin (bovine, Roche Molecular Biochemicals) concentrations were added to the reaction mixtures, and the residual activity of the proteinase was measured in a quartz cuvette
thermostatically controlled at 25 °C. Bovine albumin (fraction V;
Sigma, Deisenhofen, Germany) served as a negative control. Inhibition
assays with other serine proteinases (chymotrypsin, leukocyte elastase,
thrombin, tissue plasminogen activator, tryptase, plasmin, tissue
kallikrein, factor Xa, plasma kallikrein, and urokinase) were performed
in a similar way but using different appropriate chromogenic substrates.
RESULTS AND DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
View larger version (55K):
[in a new window]
Fig. 1.
Amino acid sequences of LEKTI and the
isolated domains HF6478 and HF7665 in N C-terminal direction.
A, structures of HF6478 and HF7665 in comparison with one
other and the typical Kazal-type domain. Cysteine residues are printed
in red. Disulfide bonds are indicated by black
dashes. Of all LEKTI domains, the actual pattern of
disulfide bonds was only determined for HF7665 (see text). A scheme of
the typical Kazal-type domain including conserved disulfide bonds is
also presented and compared with the cysteine pattern of the LEKTI
domains 2 and 15 (see also B). The numbers of amino acids
spacing the cysteine residues as well as a conserved tyrosine residue
(Y) and the flanking cysteines are given in black
and gray letters for the Kazal-type domain and
the LEKTI domains 2 and 15, respectively. B, amino acid
sequence of LEKTI as deduced from the 3528-bp cDNA sequence. A
typical N-terminal secretory signal sequence is printed in
green. The six-cysteine Kazal-type domains are printed in
orange (lines 2 and 15).
The peptides HF6478 (line 1) and HF7665
(line 6) purified from human blood filtrate are
printed in purple. The other 11 four-cysteine domains are
printed in blue. Sequences conserved within the 15 domains
are hatched in gray. The putative P1
and P1' sites are indicated. Cysteine residues probably
involved in the formation of disulfide bonds are printed in
red.
To determine the amino acid sequence of its precursor protein and to investigate the expression pattern of the corresponding gene, we cloned and sequenced the HF6478-specific cDNA as described above. The entire cDNA sequence (GenBankTM/EBI accession number AJ228139) comprises 3528 bp excluding the poly(A) tail. It exhibits an open reading frame of 3192 bp encoding a putative 1064-amino acid precursor protein which includes the purified peptide HF6478 and, surprisingly, also the peptide HF7665 (Fig. 1B). Thus, HF6478 and HF7665 represent fragments of the same precursor protein. In addition, the precursor protein contains 11 motifs exhibiting a high degree of sequence identity to HF6478 and HF7665 and an absolutely identical four-cysteine pattern. Using the MacPattern program (17) and the Prosite data base (18), a typical Kazal-type motif (19, 20) was identified occurring C-terminally behind HF6478. A second related domain is located at the C terminus of the entire precursor protein. Both domains match the six-cysteine pattern of the "classical" Kazal-type inhibitors (spacing between the six cysteine residues: 6-7-10-2, 3-17) almost exactly. As the only deviation, the spacing between the first two cysteines is 13 (first Kazal domain) and 12 (second Kazal domain) instead of six amino acids. Moreover, the putative reactive center of the first Kazal-type-related domain exhibits a significant sequence identity to the pancreatic secretory trypsin inhibitor (Kazal-type, data not shown) enabling determination of potential P1 and P1' sites as shown in Fig. 1B. This finding confirms the supposed function of the protein as a serine proteinase inhibitor.
Comparison of the 15 domains with one another revealed that their cysteine patterns are identical, but that the 13 non-Kazal-type domains lack cysteines three and six of the Kazal-type domain. However, as demonstrated for HF7665 by proteolytic digests with subsequent mass spectrometric analysis and sequencing (data not shown), the remaining four cysteines exhibit a 1-4/2-3 disulfide pattern which is in agreement with the 1-5/2-4/3-6 disulfide pattern of the six cysteines of the Kazal-type domain.
Because sufficient amounts of native HF7665 were available from human
blood filtrate (concentration > 100 pM), we tested
its inhibitory properties with the serine proteinases chymotrypsin, leukocyte elastase, thrombin, tissue plasminogen activator, tryptase, trypsin, plasmin, tissue kallikrein, factor Xa, plasma kallikrein, and
urokinase. Indeed, we obtained a significant but temporary inhibitory
effect on trypsin with an apparent KI of
approximately 150 nM (Fig.
2). To avoid errors caused by
contamination with non-detectable inhibitory components of the
preparation, we repeated the assays with HF7665 biotechnologically
produced in E. coli. In this case, we obtained identical
results, verifying the inhibitory effect of native HF7665. The amount
of purified native HF6478 was only sufficient for mass spectrometry and
sequence analysis. Thus, the recombinant production of all 15 domains,
which should enable further structural and functional analysis of the
single domains as well as the entire protein, is presently in
progress.
|
The tissue-specific expression pattern of the corresponding gene was
determined with the sensitive RT-PCR method. In addition to the 17 cDNA samples mentioned above, we used cDNA from the placenta,
Bartholin's glands, oral mucosa, and the parathyroid gland. Of all
tissues analyzed, an expression of the gene was detectable in the oral
mucosa, parathyroid gland, Bartholin's glands, tonsils, and vaginal
epithelium (Fig. 3A) and at
very low levels also in the lung, kidney, and prostate (data not
shown). To verify the cloning of an almost full-length cDNA and to
detect further loci of gene expression, we performed less sensitive
Northern blot hybridizations with 20 µg of total RNA of each of the
following human tissues: Bartholin's glands, vaginal epithelium,
tonsils, and placenta. Of these tissues, only the Bartholin's glands
gave a signal (Fig. 3B). In addition, we used a commercially
available blot containing 2 µg of poly(A)+ RNA of each of
the following human tissues: spleen, lymph node, thymus, peripheral
blood leukocytes, bone marrow, and fetal liver. In this case, we
obtained a strong hybridization signal from the thymus (Fig.
3B), indicating this organ as a locus of high level gene
expression. As calculated by means of logarithmic regression, the size
of the hybridizing mRNA is in the range of 3750 nucleotides. Taking
into consideration the fact that eukaryotic mRNA usually contains a
poly(A) tail which is not included in the cDNA sequence, this
finding is in good agreement with the cDNA size of 3528 bp. From
the results obtained, we termed the precursor protein "LEKTI" (lympho-epithelial
Kazal-type-related inhibitor).
|
The chromosomal localization of the LEKTI gene was determined by means of the PCR-based radiation hybrid mapping (see above). The evaluation of the PCR results revealed the positioning of the LEKTI gene between the markers WI-4870 and D5S413, which correlates to human chromosome 5q31-32 (data not shown). This is in agreement with the typical Kazal-type inhibitor pancreatic secretory trypsin inhibitor whose gene is also located on chromosome 5 (21).
In summarizing, 13 of the 15 LEKTI domains exhibit a Kazal-type-derived four-cysteine residue pattern which represents a novel protein module of serine proteinase inhibitor, possibly responsible for temporary fine tuning of proteinase action. Together with the extraordinarily high number of potential inhibitory domains, which is even higher than in the case of the seven-domain ovoinhibitor (22), these findings indicate that LEKTI may represent an as yet unknown type of human multidomain serine proteinase inhibitor. The isolation of the peptides HF6478 and HF7665 indicates a mechanism of specific endoproteolytic cleavage of the precursor protein in vivo, which may also result in the occurrence of the other 13 domains as single peptides or as parts of fragments of the precursor protein containing only lower numbers of domains. Because these domains have not yet been isolated, further attempts for their isolation from sources such as hemofiltrate or LEKTI gene-expressing tissues are planned. However, because the high degree of similarity of most of the domains will complicate their specific identification, for example by means of non-cross-reacting antibodies, the realization of this intention may be difficult.
As yet, the biological function of LEKTI is unclear. Antileukoprotease/secretory leukocyte protease inhibitor (ALP, SLPI), another serine proteinase inhibitor occurring in various external secretions, is described to exhibit antibacterial and antiviral properties (23, 24). Thus, a main role of LEKTI in antimicrobial and/or anti-inflammatory protection of mucous epithelia is conceivable. On the other hand, LEKTI shares some common structural features with agrin, a 200-kDa extracellular matrix protein (for review see Ref. 25). Like LEKTI, agrin also possesses a high number of Kazal-type-related domains, being able to inhibit serine proteinases such as trypsin and chymotrypsin (26). However, agrin seems to serve mainly as a differentiation factor, being important for the generation of neuromuscular junctions (25). Because the LEKTI gene is highly expressed in the thymus and probably in lower amounts also in the parathyroid gland (Fig. 3), the possibility of a comparable function in the regulation of differentiation processes, for example the maturation of T-lymphocytes, must be taken into consideration.
Further investigations are now necessary to determine the main target
proteinases of LEKTI, its function within the thymus and parathyroid
gland, the inhibitory potency of the other 12 non-Kazal-type domains in
comparison to HF7665 and the Kazal-type domains, and to clarify a
possible systemic as well as the pathophysiological role of LEKTI.
| |
FOOTNOTES |
|---|
* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AJ228139. Scanning of this sequence against the data base resulted in identification of a related sequence with the accession number AF086524.
To whom correspondence and reprint requests should be addressed.
Tel.: 49-511-546-6224; Fax: 49-511-546-6132; E-mail:
HJ-Maegert@gmx.de.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: RP-HPLC, reverse phase-high performance liquid chromatography; RT-PCR, reverse transcriptase-polymerase chain reaction; RACE, rapid amplification of cDNA ends; bp, base pair(s).
| |
REFERENCES |
|---|
|
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
|
|---|
| 1. |
Neurath, H.
(1984)
Science
224,
350-357 |
| 2. | Laskowski, M., Jr., and Kato, I. (1980) Annu. Rev. Biochem. 49, 593-626[CrossRef][Medline] [Order article via Infotrieve] |
| 3. | Bode, W., and Huber, R. (1992) Eur. J. Biochem. 204, 433-451[Medline] [Order article via Infotrieve] |
| 4. | Roberts, R. M., Mathialagan, N., Duffie, J. Y., and Smith, G. W. (1995) Crit. Rev. Eukaryotic Gene Expression 5, 385-436[Medline] [Order article via Infotrieve] |
| 5. |
Seife, C.
(1997)
Science
277,
1602-1603 |
| 6. | Miller, F., and Kuschner, M. (1969) Am. J. Med. 46, 615-623[CrossRef][Medline] [Order article via Infotrieve] |
| 7. | Ohlsson, K., Fryksmark, U., and Tegner, H. (1980) Eur. J. Clin. Invest. 10, 373-379[Medline] [Order article via Infotrieve] |
| 8. |
Hautamaki, R. D.,
Kobayashi, D. K.,
Senior, R. M.,
and Shapiro, S. D.
(1997)
Science
277,
2002-2004 |
| 9. | Schulz-Knappe, P., Raida, M., Meyer, M., Quellhorst, E. A., and Forssmann, W. G. (1996) Eur. J. Med. Res. 1, 223-236[Medline] [Order article via Infotrieve] |
| 10. | Richter, R., Schulz-Knappe, P., Schrader, M., Ständker, L., Jürgens, M., Tammen, H., and Forssmann, W. G. (1999) J. Chromatogr. B 726, 25-35 |
| 11. | Ständker, L., Enger, A., Schulz-Knappe, P., Wohn, K. D., Germer, M., Raida, M., Forssmann, W. G., and Preissner, K. T. (1996) Eur. J. Biochem. 241, 557-563[Medline] [Order article via Infotrieve] |
| 12. |
Pardigol, A.,
Forssmann, U.,
Zucht, H. D.,
Loetscher, P.,
Schulz-Knappe, P.,
Baggiolini, M.,
Forssmann, W. G.,
and Mägert, H. J.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
6308-6313 |
| 13. | Mägert, H. J., Reinecke, M., David, I., Raab, H. R., Adermann, K., Zucht, H. D., Hill, O., Hess, R., and Forssmann, W. G. (1998) Regul. Pept. 73, 165-176[CrossRef][Medline] [Order article via Infotrieve] |
| 14. |
Mägert, H. J.,
Cieslak, A.,
Alkan, O.,
Lüscher, B.,
Kauffels, W.,
and Forssmann, W. G.
(1999)
J. Biol. Chem.
274,
444-450 |
| 15. | Walter, M. A., Spillet, D. J., Thomas, P., Weissenbach, J., and Goodfellow, P. N. (1994) Nat. Genet. 7, 22-28[CrossRef][Medline] [Order article via Infotrieve] |
| 16. | Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY |
| 17. |
Fuchs, R.
(1991)
Comput. Appl. Biosci.
7,
105-106 |
| 18. | Bairoch, A. (1991) Nucleic Acids Res. 19 (suppl.), 2241-2245 |
| 19. | Kazal, L. A., Spicer, D. S., and Brahinsky, R. A. (1948) J. Am. Chem. Soc. 70, 3034-3040[CrossRef] |
| 20. |
Green, L. J.,
and Bartelt, D. C.
(1969)
J. Biol. Chem.
244,
2646-2657 |
| 21. | Yamamoto, T., Nakamura, Y., Nishide, T., Emi, M., Ogawa, M., Mori, T., and Matsubara, K. (1985) Biochem. Biophys. Res. Commun. 132, 605-612[CrossRef][Medline] [Order article via Infotrieve] |
| 22. |
Scott, M. J.,
Huckaby, C. S.,
Kato, I.,
Kohr, W. J.,
Laskowski, M., Jr.,
Tsai, M. J.,
and O'Malley, B. W.
(1987)
J. Biol. Chem.
262,
5899-5907 |
| 23. | Hiemstra, P. S., Maassen, R. J., Stolk, J., Heinzel-Wieland, R., Steffens, G. J., and Dijkman, J. H. (1996) Infect. Immun. 64, 4520-4524[Abstract] |
| 24. | Wahl, S. M., McNeely, T. B., Janoff, E. N., Shugars, D., Worley, P., Tucker, C., and Orenstein, J. M. (1997) Oral Dis. 3 Suppl. 1, 64-69[Medline] [Order article via Infotrieve] |
| 25. | Kleiman, R. J., and Reichardt, L. F. (1996) Cell 85, 461-464[CrossRef][Medline] [Order article via Infotrieve] |
| 26. | Biroc, S. L., Payan, D. G., and Fisher, J. M. (1993) Brain Res. Dev. Brain Res. 75, 119-129[CrossRef][Medline] [Order article via Infotrieve] |
This article has been cited by other articles:
|
|
 |
|
  C. Deraison, C. Bonnart, F. Lopez, C. Besson, R. Robinson, A. Jayakumar, F. Wagberg, M. Brattsand, J. P. Hachem, G. Leonardsson, et al. LEKTI Fragments Specifically Inhibit KLK5, KLK7, and KLK14 and Control Desquamation through a pH-dependent Interaction Mol. Biol. Cell, September 1, 2007; 18(9): 3607 - 3619. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. C. Timmons, S. M. Mitchell, C. Gilpin, and M. S. Mahendroo Dynamic Changes in the Cervical Epithelial Tight Junction Complex and Differentiation Occur during Cervical Ripening and Parturition Endocrinology, March 1, 2007; 148(3): 1278 - 1287. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. A. Borgono, I. P. Michael, N. Komatsu, A. Jayakumar, R. Kapadia, G. L. Clayman, G. Sotiropoulou, and E. P. Diamandis A Potential Role for Multiple Tissue Kallikrein Serine Proteases in Epidermal Desquamation J. Biol. Chem., February 9, 2007; 282(6): 3640 - 3652. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Yamasaki, J. Schauber, A. Coda, H. Lin, R. A. Dorschner, N. M. Schechter, C. Bonnart, P. Descargues, A. Hovnanian, and R. L. Gallo Kallikrein-mediated proteolysis regulates the antimicrobial effects of cathelicidins in skin FASEB J, October 1, 2006; 20(12): 2068 - 2080. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M.-F. Galliano, E. Toulza, H. Gallinaro, N. Jonca, A. Ishida-Yamamoto, G. Serre, and M. Guerrin A Novel Protease Inhibitor of the {alpha}2-Macroglobulin Family Expressed in the Human Epidermis J. Biol. Chem., March 3, 2006; 281(9): 5780 - 5789. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Tian, B. Benedetti, and S. Kamoun A Second Kazal-Like Protease Inhibitor from Phytophthora infestans Inhibits and Interacts with the Apoplastic Pathogenesis-Related Protease P69B of Tomato Plant Physiology, July 1, 2005; 138(3): 1785 - 1793. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. R. Hewett, A. L. Simons, N. E. Mangan, H. E. Jolin, S. M. Green, P. G. Fallon, and A. N.J. McKenzie Lethal, neonatal ichthyosis with increased proteolytic processing of filaggrin in a mouse model of Netherton syndrome Hum. Mol. Genet., January 15, 2005; 14(2): 335 - 346. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M Aslam, M H Chahrour, A Razzaq, S Haque, K Yan, S M Leal, and W Ahmad A novel locus for autosomal recessive form of hypotrichosis maps to chromosome 3q26.33-q27.3 J. Med. Genet., November 1, 2004; 41(11): 849 - 852. [Full Text] [PDF]
|
|
|
|
 |
|
 T. Yang, D. Liang, P. J. Koch, D. Hohl, F. Kheradmand, and P. A. Overbeek Epidermal detachment, desmosomal dissociation, and destabilization of corneodesmosin in Spink5-/- mice Genes & Dev., October 1, 2004; 18(19): 2354 - 2358. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Bowcock and W. O.C.M. Cookson The genetics of psoriasis, psoriatic arthritis and atopic dermatitis Hum. Mol. Genet., April 1, 2004; 13(90001): R43 - 55. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Bitoun, A. Micheloni, L. Lamant, C. Bonnart, A. Tartaglia-Polcini, C. Cobbold, T. Al Saati, F. Mariotti, J. Mazereeuw-Hautier, F. Boralevi, et al. LEKTI proteolytic processing in human primary keratinocytes, tissue distribution and defective expression in Netherton syndrome Hum. Mol. Genet., October 1, 2003; 12(19): 2417 - 2430. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. E. Gonzalez, M. Gujrati, M. Frederick, Y. Henderson, J. Arumugam, P. W. Spring, K. Mitsudo, H.-W. Kim, and G. L. Clayman Identification of 9 Genes Differentially Expressed in Head and Neck Squamous Cell Carcinoma Arch Otolaryngol Head Neck Surg, July 1, 2003; 129(7): 754 - 759. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Krause, R. Sillard, B. Kleemeier, E. Kluver, E. Maronde, J. R. Conejo-Garcia, W. G. Forssmann, P. Schulz-Knappe, M. C. Nehls, F. Wattler, et al. Isolation and biochemical characterization of LEAP-2, a novel blood peptide expressed in the liver Protein Sci., January 1, 2003; 12(1): 143 - 152. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. O. C. Cookson Asthma Genetics Chest, March 1, 2002; 121(2007): 7S - 13S. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. J. Stratigos and H. P. Baden Unraveling the Molecular Mechanisms of Hair and Nail Genodermatoses Arch Dermatol, November 1, 2001; 137(11): 1465 - 1471. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. O.C. Cookson and M. F. Moffatt Genetics of asthma and allergic disease Hum. Mol. Genet., October 1, 2000; 9(16): 2359 - 2364. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |
