|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 274, Issue 31, 21908-21912, July 30, 1999
From the Department of Chemistry and Biochemistry, Neuromuscular
Research Laboratory, Laurentian University, Sudbury, Ontario P3E 2C6,
Canada
Molecular signaling pathways linking increases in
skeletal muscle usage to alterations in muscle size have not been
identified. In the present study, we tested the hypothesis that
calcineurin, a calcium-regulated phosphatase recently implicated in the
signaling of some forms of cardiomyopathic growth, is required to
induce skeletal muscle hypertrophy and muscle fiber type conversions associated with functional overload in vivo. Administration
of the specific calcineurin inhibitors cyclosporin (CsA) or FK506 to
mice, for which the fast plantaris muscle was overloaded for 1-4
weeks, prevented the rapid doubling of mass and individual fiber size
and the 4-20-fold increase in the number of slow fibers that
characterize this condition. CsA treatment influenced the expression of
muscle myofibrillar protein genes in a way reflective of fiber
phenotype transformations but only in the long term of the overload
condition, suggesting that the control of this growth response by
calcineurin is not limited to the transcriptional activation of these
muscle-specific genes. Clinically, these results provide insight to the
post-surgical muscle wasting and weakness observed in recovering
transplant recipients administered therapeutic dosages of these immunosuppressants.
The amount and type of contractile proteins incorporated into the
myofibrils of skeletal muscle fibers are major determinants of the
size, strength, and speed of these cells (1). To date, the molecular
events linking muscle usage to the cellular expression and accumulation
of these proteins are unknown. Recently, calcineurin, a cytoplasmic
calcium-regulated phosphatase implicated in the pathogenesis of
hypertrophic cardiomyopathy (2, 3), has emerged as a possible candidate
in the signaling of skeletal muscle cellular growth and the fiber type
transformations (4) of these cells. Calcineurin is an enticing prospect
as a regulatory enzyme in this signaling because its selective
activation of NF-AT (nuclear factor of
activated T cells) transcription factors in
response to sustained increases in intracellular calcium concentrations (5) is reminiscent of calcium fluctuations provoked by the activation
of muscle cells during extensive contractile work (4, 6).
Typically, a fast weight-bearing muscle subjected to the functional
loss of its synergists will compensate by displaying within 2-4 weeks
a doubling of mass and individual fiber sizes and an increase in
strength (7, 8). A muscle overloaded in this manner will also contract
more slowly as a result of rapid fiber type transformations
characterized by an increase in the number of fibers exhibiting slower,
more energy-efficient contractile and calcium-handling proteins (7-9).
In rodent fast muscle, the myosin heavy chain
(MHC)1 enzyme component of
the major contractile protein myosin displays a conversion pattern in
response to overload that follows from the fastest to the slowest
isoform in the order MHC IIb Plantaris Overload and Drug Administration--
The plantaris in
each hind limb was overloaded (OV) via surgical removal of soleus and
gastrocnemius muscles (7) in male CD-1 mice (22-28 g) injected with
either CsA (25 mg/kg, subcutaneously), FK506 (3-5 mg/kg,
subcutaneously), or vehicle (cremophor EL) twice daily (2) for 1, 2, or
4 weeks. This dose of CsA is higher than that reported to inhibit 90%
of total calcineurin phosphatase activity in the heart, to block
Ca2+-induced NF-AT dephosphorylation in spleen cell
lysates, and to inhibit calcineurin-mediated transcriptional activation
in skeletal muscle (3, 12, 13). Our treatment resulted in blood levels of CsA that were 1682 ± 308 (n = 7) ng/ml 6 h after the last injection. Blood levels for FK506 were 83 ± 14 (n = 4) and 262 (n = 1) ng/ml for each
respective dose (Isotechnika, Edmonton, Alberta). A separate group of
OV animals (n = 4) were also administered rapamycin
(Alexis, San Diego, CA; 2 mg/kg in 2.5% Tween 80, 5%
N',N'-dimethylacetamide, 17.5% polyethylene
glycol in saline, subcutaneously once daily) over a 2-week period which
resulted in blood levels for this drug of 208 ± 10 ng/ml
(Isotechnika). For OV animals, access to food was adjusted to promote
usage of the hind limb musculature during feeding. Sham-operated mice
administered vehicle or CsA served as controls. Injection of these
chemical agents did not affect the health (from general observations
and autopsy results), growth (body weights were not different among
mice at any time during treatment), or noticeably alter the daily
amount of locomotor activity displayed by experimental animals. The
efficacy of ankle plantar flexion was verified twice daily using
established functional criteria (14) and was found to be noticeably
weaker in overloaded mice administered calcineurin inhibitors at
treatment end points compared with overload-vehicle counterparts. At
the appropriate end points, muscles were excised, weighed, and quick
frozen in melting isopentane precooled with liquid nitrogen. All
surgical procedures were performed under sterile conditions on mice
anesthetized (1.2 µl/g intramuscularly) with 100 mg/ml ketamine
hydrochloride, 20 mg/ml xylazine in a volume ratio of 1.6:1. Treatment
of animals was in accordance with guidelines established by the
Canadian Council on Animal Care.
Immunolabeling of MHC and Fiber Size Analysis--
Cryosections
(10 µm) were cut from the same anatomical location in the midbelly of
each plantaris muscle. Tissue sections were probed with mouse
antibodies raised against embryonic (F1.652), I (BA-F8), IIa (SC-71),
IIb (BF-F3), and all MHCs except IIx (BF-35), followed by
peroxidase-conjugated goat anti-mouse IgG, or IgM in the case of BF-F3
(7). Bound antibodies were visualized using diaminobenzidine
tetrahydrochloride. Fibers expressing or coexpressing I, IIa, IIb, or
exclusively expressing IIx MHC were identified within three distinct
tissue fascicles of each muscle, and their cross-sectional size was
measured using a microscope linked to a computer-based image analysis
system as described previously (7).
Labeling of Cell Nuclei--
As a post hoc
consideration, the proliferation of satellite cell and non-muscle
nuclei in plantaris muscles of 5-day treated OV-veh and OV-CsA mice was
assessed by labeling their uptake of the thymidine analog
5-bromo-2'-deoxyuridine (BrdUrd) as described previously (15). Briefly,
a mini-osmotic pump (model 1007D, Alza Corp., Palo Alto, CA) containing
BrdUrd (25 mg/ml) was implanted along the dorsal midline of 3 Sham-veh,
OV-veh, and OV-CsA mice and delivered BrdUrd systemically at a
continuous rate of 0.5 µl/h for the 5-day duration of the experiment.
Muscle nuclei (pre-existing myonuclei plus satellite cell nuclei) were
stained in cryosections using the BrdUrd antibody G3G4 and delineated
from non-muscle nuclei by staining the extracellular matrix with the
laminin antibody 2E8 (15). Both antibodies were obtained from the
Developmental Studies Hybridoma Bank, University of Iowa.
Quantitative Reverse Transcription-Polymerase Chain Reaction
(RT-PCR)--
Total RNA was extracted from analogous distal portions
(i.e. devoid of any remnant gastrocnemius fibers) of each
plantaris muscle, and 2 µg of each sample was reverse-transcribed as
described (16). The RT-negative control consisted of total RNA plus RT mixture minus the addition of reverse transcriptase. Amplification of
MHC, slow troponin I (TnIs), fast troponin I (TnIf), and 28 S ribosomal
RNA cDNAs was achieved using specific primers designed as follows.
For amplification of MHC I, IIa, IIx, and IIb cDNAs, we used a
common 5' primer designed from the rat cDNA sequence (5'AAGGAGCAGGACACCAGCGCCCA3', corresponding to
cDNA positions 101-123) and distinct 3' primers encoding
nonhomologous regions of these genes: I
(5'GATCTACTCTTCATTCAGGC3', complementary to
cDNA positions 533-552), IIa
(5'CCTTACTCTTCACTTATGACTTTA3', complementary to
cDNA positions 528-551), IIx
(5'ATCTCTTTGGTCACTTTCCTGCT3', complementary to
cDNA positions 560-582), and IIb
(5'TAGGCTTTCACTTTAGTCTGTAA3', complementary to
cDNA positions 351-373) (17). TnIs 5' and 3' primers were designed
from the rat mRNA sequence (GenBankTM/EBI ACJ04993) and
were 5'TGCTGAAGAGCCTGATGCTA3' (corresponding to
mRNA positions 93-103) and
5'GAACATCTTCTTGCGACCTTC3' (complementary to
mRNA positions 557-577), respectively. TnIf 5' and 3' primers were
designed from the mouse mRNA sequence (GenBankTM/EBI
ACJ04992) and were 5'GAAGGAGAACTACCTGTCAGA3'
(corresponding to mRNA positions 143-163) and
5'TGGGCAGTTAGGACTCAGACTC3' (complementary to
mRNA positions 558-579). Ribosomal 28 S RNA subunit 5' and 3'
primers designed from the rat cDNA sequence (GenBankTM/EBI ACM11167) were
5'TTGTTGCCATGGTAATCCTGCTCAGTACG3'
(corresponding to cDNA positions 4535-4564) and
5'TCTGACTTAGAGGCGTTCAGTCATAATCCC3'
(complementary to cDNA positions 4667-4638).
Quantitative PCR analysis was performed as described previously (14).
Sense primers were labeled with As expected, overloaded mice administered vehicle displayed an
increase (90-110%) in mean plantaris mass after 2-4 weeks of this
condition compared with Sham-operated counterparts (Fig. 1a). This increase in muscle
mass in response to overload corresponded to a progressive increase
(55-130%) in the mean cross-sectional size of all plantaris MHC-typed
fibers over 4 weeks of this treatment (Fig. 1, b and
c). Although mean plantaris mass of overloaded mice
administered CsA was higher (90%) at 2 weeks, the mean muscle mass of
overloaded counterparts administered FK506 was not different from
Sham-veh at 2- and 4-week time points (Fig. 1a). Similarly consistent with this drug effect, CsA treatment significantly counteracted the overload-associated increase in mean muscle mass over
4 weeks of this condition (Fig. 1a). More importantly, mean cross-sectional size across all MHC-typed fibers in both OV-CsA- or
OV-FK506-treated tissues was not different from controls at either 2 or
4 weeks post-surgery (Fig. 1, b and c), clearly
demonstrating the inability of these cells to hypertrophy in the
presence of these calcineurin inhibitors despite the increased
functional demands imposed by the overload condition. The histological
appearance of plantaris fibers was normal at all post-treatment time
points. Taken in this light, the increase in mean plantaris whole
muscle mass observed in OV-CsA mice at 2 weeks is consistent with the notion that these muscles would be most susceptible to work-related extrafiber phenomena (i.e. interstitial edema) sustained as
a result of their inability to adapt to the overload condition at the
single-fiber level. The fact that this extrafiber response was tempered
in OV-FK506 animals may relate to the relatively higher potency of this
drug as an anti-inflammatory agent over its CsA counterpart (18). The
absence of muscle hypertrophy in overloaded mice administered
calcineurin inhibitors was not related to the effects of injection of
these drugs alone (Fig. 1, a, b, and
c; but see Fig. 1 legend) or to OV-CsA and OV-FK506 animals
demonstrating less daily locomotor activity compared with vehicle-injected counterparts (see "Experimental Procedures"). Moreover, the effects of overload and CsA administration were not
species-specific since muscle fiber hypertrophy was also prevented in
adult rats under similar
conditions.2
To determine whether the prevention of hypertrophy by CsA and FK506 was
related to immunophilin inactivation, we administered rapamycin to a
separate group of overloaded mice (n = 3). Rapamycin is
an immunosuppressant drug that complexes with an FK506-binding protein
(FKBP12) but does not target calcineurin (19). Similar to the effects
of OV-veh and in contrast to those of FK506, administration of
rapamycin to OV mice resulted in a significant increase (37-49%) in
size of plantaris fibers expressing MHC IIa (860 ± 28 versus 578 ± 45) and IIx (1267 ± 65 versus 924 ± 54) above Sham-veh levels after 2 weeks
of this condition, emphasizing that the prevention of hypertrophy in
these cell types at this time was likely mediated via calcineurin
inhibition. On the other hand, rapamycin did prevent hypertrophy of
fibers expressing I MHC (564 ± 32 versus 559 ± 50), a finding that is hard to reconcile but may relate to the fact
that rapamycin-FKBP complexes also interfere with mRNA translation via mTOR (mammalian target of rapamycin), an important signaling intermediate for cellular protein turnover (20). The finding that
rapamycin may have other as yet undetermined effects in vivo is further supported by the observation that OV-rapamycin tissues were
extensively degenerative, displaying a distinct and considerable reappearance of small (<350 µm2) de novo
fibers that decorated with embryonic MHC compared with FK506 or CsA
counterparts (data not shown).
The rapid muscle fiber growth associated with functional overload has
been attributed in part to the proliferation of satellite cells and
subsequent fusion of their progeny with pre-existing muscle fibers
(15). The recent findings that CsA administration prevents the
differentiation and fusion of myoblasts in vitro and hinders
muscle regeneration in response to injury in vivo (21)
raised the possibility that the prevention of hypertrophy in adult
OV-CsA-treated muscles is related to an inhibition of satellite cell
differentiation under these conditions. To address this, we tested for
the presence of fibers expressing embryonic MHC and displaying
centrally located nuclei, both hallmarks of muscle regeneration (21),
within excised tissue sections after 1-2 weeks of OV-veh and OV-CsA
treatments. We detected a comparable number of regenerating fibers
after both conditions mainly within remnant portions of the ablated
gastrocnemius (data not shown). We also assessed the extent of
satellite cell proliferation within OV-veh and OV-CsA plantaris tissues
using the thymidine analog BrdUrd and found it to be minimal,
suggesting that proliferation of satellite cells is not a major
contributor to the rapid growth of pre-existing plantaris fibers in
response to overload (data not shown). Taken together, these findings
suggest that the prevention of hypertrophy in OV-CsA-treated tissues
cannot be ascribed in any major way to mechanisms involving inhibition
of satellite cell differentiation or muscle fiber regeneration by
CsA.
Also consistent with our hypothesis, fiber conversions that occur in
response to functional overload (7) were also prevented by the
administration of these specific calcineurin inhibitors. Immunolabeling
of plantaris cross-sections with a slow/type I MHC-specific antibody
showed that overload induced a quadrupling of the number of fibers
expressing this protein after 2 weeks, which progressed to a 20-fold
increase in this number by 4 weeks (Fig.
2). These gains in the proportion of
fibers expressing I MHC over the 4-week period were at the major
expense of pre-existing mature fibers expressing fast MHC isoforms and
not the result of a significant generation of new fibers (data not
shown; see Ref. 7). These extensive MHC fast/type II
Calcineurin Is Required for Skeletal Muscle Hypertrophy*
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
IIx IIa I/slow. The signaling
of these adaptations may well be mediated by calcineurin since most of
the functional indices of overloaded muscles (8) suggest that fiber
intracellular calcium levels are chronically elevated in these tissues.
We thus tested the hypothesis that administration of CsA or FK506, both
specific inhibitors of calcineurin (10), to adult mice, for which the fast plantaris hind limb muscle was subjected to compensatory functional overload, would prevent the ensuing hypertrophy and MHC-type
conversions that characterize this model. Preliminary results have
appeared in abstract form (11).
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
-32P using T4
polynucleotide kinase (Amersham Pharmacia Biotech, Oakville, Ontario).
For PCR, 2.5 µl of RT sample was added to a PCR reaction mixture that
contained 10 × PCR buffer, 0.65 unit of Taq polymerase
(both from Qiagen, Burlington, Ontario), 10 pmol of each primer, and 5 mM each dNTP (Life Technologies, Inc., Burlington,
Ontario). Amplification conditions consisted of a 1-min denaturation at
94 °C, 1-min annealing at 55 °C, and 1-min extension at 72 °C
for 11-31 cycles. For each primer set, cycle number was adjusted to
permit comparison of PCR products across treatments within their linear
phase of amplification. Tubes that contained PCR reagents plus the
RT-negative sample or ultrapure water served as controls. PCR products
were electrophoresed on 1% agarose gels and visualized with ethidium
bromide. For quantification, individual product bands and
representative background were excised from each gel lane and subjected
to Cerenkov counting (cpm). A DNA 100-bp ladder was used to estimate
the length of each PCR product. The identity of each PCR product was
also verified using a series of restriction enzymes and DNA sequencing
(Biomolecular Sequencing, Charlottesville, VA).
RESULTS AND DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
View larger version (22K):
[in a new window]
Fig. 1.
Inhibition of calcineurin signaling prevents
overload-induced hypertrophy. a, plantaris wet weight
(MW) relative to animal body weight (BW) after
2-4 weeks of treatment in Sham-operated (Sham) or
overloaded (OV) mice receiving vehicle (veh),
CsA, or FK506 injections. Values are means ± S.E.
n = 4-7 muscles/treatment. Asterisks denote
significant (p < 0.05) differences from corresponding
2- or 4-week Sham-veh and CsA controls. Significant (p < 0.05) differences between OV-CsA or OV-FK506 and corresponding 2- or
4-week OV-veh treatments are marked with an a. b
and c, experimental tissue analysis of the cross-sectional
area (CSA) of plantaris fibers expressing or coexpressing I,
IIa, IIb or exclusively expressing IIx MHC showed that calcineurin
inhibition prevented the overload-associated increases in mean size of
all cell types after 2 (b) or 4 weeks (c) of
treatment. Values for b and c are means ± S.E. (n = 3-5 muscles/treatment) of muscle means
(n = 2-52 fibers/muscle). Asterisks and
a denote significant (p < 0.05) differences
as in panel a. Note the different ordinate scales
in b and c. Also note that mean ± S.E.
tissue relative masses (mg/g of body weight) were not significantly
(p > 0.05) different between mice administered vehicle
or CsA, respectively, for the heart (4.1 ± 0.2 versus
4.3 ± 0.3), extensor digitorum longus (0.35 ± 0.08 versus 0.38 ± 0.08), tibialis anterior (1.61 ± 0.27 versus 1.47 ± 0.04), or soleus (0.24 ± 0.03 versus 0.22 ± 0.04).
slow/type I
fiber transformations did not occur in overloaded mice administered CsA
(Fig. 2, c and e). Additionally, immunolabeling
of the fast IIa, IIx, and IIb MHCs in serial cross-sections showed that
OV mice administered vehicle displayed the IIb IIx IIa MHC
conversions typical of this condition, whereas these transformations
were prevented in CsA-injected counterparts (data not shown). In this respect, our findings in vivo not only support the recent
contention that calcineurin may influence the expression of slow
contractile proteins in vitro (4) but further these
observations by showing that this enzyme also plays a critical role in
the expression of fast MHC counterparts during transitions within the
fast fiber population itself (i.e. MHC IIb IIx or IIx
IIa) in response to chronic increases in muscle usage.
View larger version (111K):
[in a new window]
Fig. 2.
Administration of calcineurin inhibitors
prevents the fast-to-slow fiber conversions associated with
overload. Plantaris muscle cross-sections displaying individual
fibers labeled (brown) with a type I/slow MHC-specific
antibody. Chronic overload induced a progressive increase in the size
of all fibers as well as the number of fibers decorated by MHC I
antibody after 2 (panel b, slow no. = 24 ± 6) and 4 (panel d, slow no. = 110 ± 32) weeks compared with
Sham-operated counterparts (panel a, slow no. = 6 ± 2). Treatment of overloaded mice with CsA effectively
counteracted this adaptive response to overload at both 2 (panel
c) and 4 (panel e) weeks. Scale
bar = 100 µm for panels a,
b, and c. Scale bar = 200 µm for panels d and e.
Recent studies provide evidence that calcineurin-NF-AT signaling may mediate hypertrophy in cardiac muscle and fast-to-slow phenotypic adaptations in skeletal muscles in vitro, in part, via the transcriptional activation of a subset of slow muscle-specific genes (2-4). This is particularly true of the slow isoform of troponin I which harbors distinct consensus elements for NF-AT in its promoter (22). Indeed, calcineurin-mediated transcriptional activation of slow fiber genes such as TnIs and associated reciprocal repression of its fast fiber counterpart TnIf by NF-AT factors has been proposed as a model to explain fast-to-slow fiber conversions in skeletal muscle in response to chronic increases in muscle activation (4). In light of this, we examined whether the prevention of overload-induced hypertrophy and fiber transitions by calcineurin inhibition were related to changes in the expression of TnI and MHC genes. To this end we used a semiquantitative RT-PCR assay to assess TnI and MHC transcript levels relative to total RNA in treated tissues.
For the most part, overload-induced changes in TnI and MHC transcript
levels were more reflective of fast-to-slow fiber conversions than the
hypertrophic growth observed across all plantaris cell types.
Specifically, we observed increases in TnIs mRNA and reciprocal decreases in TnIf mRNA after 1 (data not shown), 2 (Fig.
3), and 4 (Fig.
4) weeks of overload that were in line
with predictions based on the fiber-type transformations associated
with this model. A similar reciprocal change in mRNA levels was
observed for MHC I and IIb, but only after 4 weeks of overload,
suggesting a discoordinate modulation of the expression of specific
myofibrillar genes during the course of this condition. In this sense,
our data are consistent with those of others using this same model (23)
and suggest that the cellular expression and accumulation of key
myofibrillar proteins in the early stages of overload may be mediated,
in large part, by post-transcriptional events.
|
|
Calcineurin did appear to influence transcription of TnI and MHC genes in a way reflective of fiber conversions but only in the long term of overload, such that increases in TnIs and MHC I and decreases in TnIf and MHC IIb mRNAs were prevented by CsA administration at 4 weeks (Fig. 4). Surprisingly, in the short term, the combination of CsA and overload triggered a large accumulation of TnIs mRNA after 1 (data not shown) and 2 weeks of this condition (Fig. 3), rather than the anticipated down-regulation of this gene in the presence of this calcineurin inhibitor (4). Moreover, CsA administration to overloaded mice did not appear to influence the expression of MHC mRNAs in the short term of this treatment in any way predicted by the protein adaptations observed at this time (Fig. 3). Our data therefore suggest that the influence of calcineurin-NF-AT signaling on the expression of fast and slow isoforms of distinct myofibrillar proteins, including TnIs, in intact animals is more complex than what is proposed to occur in vitro (4) and is not limited to the transcriptional activation of these contractile protein genes.
Our results are the first to show that calcineurin has a profound influence on the accumulation of skeletal muscle contractile proteins under conditions of increased activation. In this sense, the actions of calcineurin in skeletal muscle resemble those recently purported to mediate various forms of hypertrophic cardiac myopathy (2, 3). The etiology of these cardiomyopathies is proposed to involve alterations in the cellular handling of calcium (2, 3), leading to higher sustained intracellular levels of this cation, a condition necessary for calcineurin activation (5). CsA and FK506 can only interfere with the action of calcineurin when this enzyme is in its activated configuration (10). In light of this, our finding that CsA and FK506 prevented the growth of all MHC-typed fibers, but only during overload, suggests that signaling via calcineurin in skeletal muscle fibers is initiated only when the nerve-mediated frequency of calcium oscillations (5) becomes higher (i.e. more sustained calcium levels), relative to levels intrinsic to each cell type under normal contractile loading conditions. In this respect, our findings corroborate reports of a lack of change in the size and phenotype of skeletal muscle in normal weight-bearing rats administered lower dosages of CsA (24). This apparent dependence of calcineurin signaling on relative increases in muscle activation characteristics may also explain why transplant recipients administered therapeutic dosages of this immunosuppressant during their recovery from surgery are unable to regain losses in skeletal muscle mass and strength related to pre- and post-surgical bed rest (25).
Although the downstream molecular actions of calcineurin in the control
of skeletal muscle growth and fiber conversion are not known, our
results suggest that they are not limited to the transcriptional
activation of contractile protein genes via NF-AT dephosphorylation or
to an inhibition of satellite cell differentiation. The effects of
calcineurin on the expression of skeletal myofibrillar proteins may be
mediated by direct or indirect mechanisms. For instance, calcineurin is
known to directly dephosphorylate specific muscle cytoskeletal proteins
and to interact with other phosphatase signaling pathways via its
dephosphorylation of inhibitor-1 (26). Future studies will be needed to
address the mechanism by which calcineurin exerts its control over
skeletal muscle fiber growth and type conversions. Nonetheless, our
present finding of a role for this enzyme in the adaptations of this
tissue to increased usage is important and should provide insight to
the development of counteraction strategies for the muscle wasting and
loss of function associated with a wide range of neuromuscular diseases.
| |
ACKNOWLEDGEMENTS |
|---|
We thank J. Gagnon, Sudbury Regional Hospital, Sudbury, Ontario for supplying CsA and the London Health Sciences Center, London, Ontario for measuring blood concentrations of CsA and providing FK506. MHC antibodies were generously provided by Dr. D. J. Parry, University of Ottawa.
| |
FOOTNOTES |
|---|
* This work was supported in part by Natural Sciences and Engineering Research Council, Canada and the Ontario Thoracic Society (to R. N. M.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of Chemistry & Biochemistry, Laurentian University, Ramsey Lake Rd., Sudbury, Ontario
P3E 2C6, Canada. Tel.: 705-675-1151 (Ext. 1010); Fax: 705-675-4844;
E-mail: rnmichel@nickel.laurentian.ca.
2 S. E. Dunn, J. L. Burns, and R. N. Michel, unpublished observations.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: MHC, myosin heavy chain; CsA, cyclosporin A; OV, overloaded; BrdUrd, 5-bromo-2'-deoxyuridine; RT-PCR, reverse transcription-polymerase chain reaction; bp, base pair(s); TnIs, slow troponin I; TnIf, fast troponin I.
| |
REFERENCES |
|---|
|
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
|
|---|
| 1. |
Schiaffino, S.,
and Reggiani, C.
(1996)
Physiol. Rev.
76,
371-423 |
| 2. | Molkentin, J. D., Lu, J.-R., Antos, C. L., Markham, B., Richardson, J., Robbins, J., Grant, S. R., and Olson, E. N. (1998) Cell 93, 215-228[CrossRef][Medline] [Order article via Infotrieve] |
| 3. |
Sussman, M. A.,
Lim, H. W.,
Gude, N.,
Taigen, T.,
Olson, E. N.,
Robbins, J.,
Colbert, M. C.,
Gualberto, A.,
Wieczorek, D. F.,
and Molkentin, J. D.
(1998)
Science
281,
1690-1690 |
| 4. |
Chin, E.,
Olson, E. N.,
Richardson, J. A.,
Yang, Q.,
Humphries, C.,
Shelton, J. M.,
Wu, H.,
Zhu, W.,
Bassel-Duby, R.,
and Williams, R. S.
(1998)
Genes Dev.
12,
2499-2509 |
| 5. | Dolmetsch, R. E., Lewis, R. S., Goodnow, C. C., and Healy, J. I. (1997) Nature 386, 855-858[CrossRef][Medline] [Order article via Infotrieve] |
| 6. |
Hongbo, K.,
White, E.,
Gannier, F.,
Argibay, J. A.,
and Garnier, D.
(1995)
Am. J. Physiol.
269,
C690-C697 |
| 7. |
Dunn, S. E.,
and Michel, R. N.
(1997)
Am. J. Physiol.
273,
C371-C383 |
| 8. |
Olha, A. E.,
Jasmin, B. J.,
Michel, R. N.,
and Gardiner, P. F.
(1988)
J. Neurophysiol.
60,
2138-2151 |
| 9. |
Kandarian, S. C.,
Peters, D. G.,
Taylor, J. A.,
and Williams, J. H.
(1994)
Am. J. Physiol.
266,
C1190-C1194 |
| 10. |
Clipstone, N. A.,
Fiorentino, D. F.,
and Crabtree, G. R.
(1994)
J. Biol. Chem.
269,
26431-26437 |
| 11. | Dunn, S. E., Burns, J. L., and Michel, R. N. (1999) FASEB J. 13, A84 |
| 12. |
Mende, U.,
Kagen, A.,
Cohen, A.,
Aramburu, J.,
Schoen, F. J.,
and Neer, E. J.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
13893-13898 |
| 13. |
Zhang, W.,
Kowal, R. C.,
Rusnak, F.,
Sikkink, R. A.,
Olson, E. N.,
and Victor, R. G.
(1999)
Circ. Res.
84,
722-7228 |
| 14. |
Michel, R. N.,
Vu, C. Q.,
Tetzlaff, W.,
and Jasmin, B. J.
(1994)
J. Cell Biol.
127,
1061-1069 |
| 15. | Phelan, J. N., and Gonyea, W. J. (1997) Anat. Rec. 247, 179-188[CrossRef][Medline] [Order article via Infotrieve] |
| 16. | Gauthier, E. R., Madison, S. D., and Michel, R. N. (1997) Pflügers Arch. 433, 664-668[CrossRef][Medline] [Order article via Infotrieve] |
| 17. |
Huey, K. A.,
and Bodine, S. C.
(1996)
Am. J. Physiol.
271,
C2016-2026 |
| 18. | Thompson, A. W. (1989) Immunol. Today 10, 6-9[CrossRef][Medline] [Order article via Infotrieve] |
| 19. | Sehgal, S. N. (1995) Ther. Drug Monitor 17, 660-665[Medline] [Order article via Infotrieve] |
| 20. | Dennis, P. B., Fumagalli, S., and Thomas, G. (1999) Curr. Opin. Genet. Dev. 9, 49-54[CrossRef][Medline] [Order article via Infotrieve] |
| 21. |
Abbott, K. L.,
Friday, B. B.,
Thaloor, D.,
Murphy, T. J.,
and Pavlath, G.
(1998)
Mol. Biol. Cell
9,
2905-2916 |
| 22. | Nakayama, M., Stauffer, J., Cheng, J., Banerjee-Basu, S., Wawrousek, E., and Buonanno, A. (1996) Mol. Cell. Biol. 16, 2408-2417[Abstract] |
| 23. | Crerar, M. M., Hamilton, N. C., Blank, S., Urdea, M. S., and Ianuzzo, C. D. (1989) Mol. Cell. Biochem. 86, 115-123[CrossRef][Medline] [Order article via Infotrieve] |
| 24. |
Biring, M. S.,
Fournier, M.,
Ross, D. J.,
and Lewis, M. I.
(1998)
J. Appl. Physiol.
84,
1967-1975 |
| 25. | Goy, J.-J., Stauffer, J.-C., Deruaz, J.-P., Gillard, D., Kaufmann, U., Kuntzer, T., and Kappenberger, L. (1989) Lancet i, 1446-1447 |
| 26. | Guerini, D. (1997) Biochem. Biophys. Res. Commun. 234, 271-275 |
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  B. S. Cowling, M. J. McGrath, M.-A. Nguyen, D. L. Cottle, A. J. Kee, S. Brown, J. Schessl, Y. Zou, J. Joya, C. G. Bonnemann, et al. Identification of FHL1 as a regulator of skeletal muscle mass: implications for human myopathy J. Cell Biol., December 16, 2008; 183(6): 1033 - 1048. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. L. J. van der Velden, A. M. W. J. Schols, J. Willems, M. C. J. M. Kelders, and R. C. J. Langen Glycogen Synthase Kinase 3 Suppresses Myogenic Differentiation through Negative Regulation of NFATc3 J. Biol. Chem., January 4, 2008; 283(1): 358 - 366. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. S. Quinn, B. G. Anderson, and S. R. Plymate Muscle-specific overexpression of the type 1 IGF receptor results in myoblast-independent muscle hypertrophy via PI3K, and not calcineurin, signaling Am J Physiol Endocrinol Metab, December 1, 2007; 293(6): E1538 - E1551. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. D. Hand, M. C. Kostek, R. E. Ferrell, M. J. Delmonico, L. W. Douglass, S. M. Roth, J. M. Hagberg, and B. F. Hurley Influence of promoter region variants of insulin-like growth factor pathway genes on the strength-training response of muscle phenotypes in older adults J Appl Physiol, November 1, 2007; 103(5): 1678 - 1687. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Stupka, J. D. Schertzer, R. Bassel-Duby, E. N. Olson, and G. S. Lynch Calcineurin-A{alpha} activation enhances the structure and function of regenerating muscles after myotoxic injury Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2007; 293(2): R686 - R694. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. L. J. van der Velden, R. C. J. Langen, M. C. J. M. Kelders, J. Willems, E. F. M. Wouters, Y. M. W. Janssen-Heininger, and A. M. W. J. Schols Myogenic differentiation during regrowth of atrophied skeletal muscle is associated with inactivation of GSK-3beta Am J Physiol Cell Physiol, May 1, 2007; 292(5): C1636 - C1644. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. V. Chakkalakal, S. A. Michel, E. R. Chin, R. N. Michel, and B. J. Jasmin Targeted inhibition of Ca2+/calmodulin signaling exacerbates the dystrophic phenotype in mdx mouse muscle Hum. Mol. Genet., May 1, 2006; 15(9): 1423 - 1435. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. L. Gooch An emerging role for calcineurin A{alpha} in the development and function of the kidney Am J Physiol Renal Physiol, April 1, 2006; 290(4): F769 - F776. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Pardo, E. Colin, E. Regulier, P. Aebischer, N. Deglon, S. Humbert, and F. Saudou Inhibition of Calcineurin by FK506 Protects against Polyglutamine-Huntingtin Toxicity through an Increase of Huntingtin Phosphorylation at S421 J. Neurosci., February 1, 2006; 26(5): 1635 - 1645. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. M. Angus, J. V. Chakkalakal, A. Mejat, J. K. Eibl, G. Belanger, L. A. Megeney, E. R. Chin, L. Schaeffer, R. N. Michel, and B. J. Jasmin Calcineurin-NFAT signaling, together with GABP and peroxisome PGC-1{alpha}, drives utrophin gene expression at the neuromuscular junction Am J Physiol Cell Physiol, October 1, 2005; 289(4): C908 - C917. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. I. Martin and I. A. Johnston The role of myostatin and the calcineurin-signalling pathway in regulating muscle mass in response to exercise training in the rainbow trout Oncorhynchus mykiss Walbaum J. Exp. Biol., June 1, 2005; 208(11): 2083 - 2090. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. G. Tidball Mechanical signal transduction in skeletal muscle growth and adaptation J Appl Physiol, May 1, 2005; 98(5): 1900 - 1908. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Sugiura, N. Abe, M. Nagano, K. Goto, K. Sakuma, H. Naito, T. Yoshioka, and S. K. Powers Changes in PKB/Akt and calcineurin signaling during recovery in atrophied soleus muscle induced by unloading Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2005; 288(5): R1273 - R1278. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. S. Bickel, J. Slade, E. Mahoney, F. Haddad, G. A. Dudley, and G. R. Adams Time course of molecular responses of human skeletal muscle to acute bouts of resistance exercise J Appl Physiol, February 1, 2005; 98(2): 482 - 488. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. A. Parsons, D. P. Millay, B. J. Wilkins, O. F. Bueno, G. L. Tsika, J. R. Neilson, C. M. Liberatore, K. E. Yutzey, G. R. Crabtree, R. W. Tsika, et al. Genetic Loss of Calcineurin Blocks Mechanical Overload-induced Skeletal Muscle Fiber Type Switching but Not Hypertrophy J. Biol. Chem., June 18, 2004; 279(25): 26192 - 26200. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Tashiro, L. C. Samuelson, R. A. Liddle, and J. A. Williams Calcineurin mediates pancreatic growth in protease inhibitor-treated mice Am J Physiol Gastrointest Liver Physiol, May 1, 2004; 286(5): G784 - G790. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. V. Chakkalakal, M.-A. Harrison, S. Carbonetto, E. Chin, R. N. Michel, and B. J. Jasmin Stimulation of calcineurin signaling attenuates the dystrophic pathology in mdx mice Hum. Mol. Genet., February 15, 2004; 13(4): 379 - 388. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. G. Hogan, L. Chen, J. Nardone, and A. Rao Transcriptional regulation by calcium, calcineurin, and NFAT Genes & Dev., September 15, 2003; 17(18): 2205 - 2232. [Full Text] [PDF]
|
|
|
|
|
|
T. E. Childs, E. E. Spangenburg, D. R. Vyas, and F. W. Booth Temporal alterations in protein signaling cascades during recovery from muscle atrophy Am J Physiol Cell Physiol, August 1, 2003; 285(2): C391 - C398. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Zoll, B. N'Guessan, F. Ribera, E. Lampert, D. Fortin, V. Veksler, X. Bigard, B. Geny, J. Lonsdorfer, R. Ventura-Clapier, et al. Preserved response of mitochondrial function to short-term endurance training in skeletal muscle of heart transplant recipients J. Am. Coll. Cardiol., July 2, 2003; 42(1): 126 - 132. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. V. Chakkalakal, M. A. Stocksley, M.-A. Harrison, L. M. Angus, J. Deschenes-Furry, S. St-Pierre, L. A. Megeney, E. R. Chin, R. N. Michel, and B. J. Jasmin Expression of utrophin A mRNA correlates with the oxidative capacity of skeletal muscle fiber types and is regulated by calcineurin/NFAT signaling PNAS, June 24, 2003; 100(13): 7791 - 7796. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. A. Parsons, B. J. Wilkins, O. F. Bueno, and J. D. Molkentin Altered Skeletal Muscle Phenotypes in Calcineurin A{alpha} and A{beta} Gene-Targeted Mice Mol. Cell. Biol., June 15, 2003; 23(12): 4331 - 4343. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Horsley and G. K. Pavlath Prostaglandin F2{alpha} stimulates growth of skeletal muscle cells via an NFATC2-dependent pathway J. Cell Biol., April 14, 2003; 161(1): 111 - 118. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. R Chin, R. W Grange, F. Viau, A. R Simard, C. Humphries, J. Shelton, R. Bassel-Duby, R S. Williams, and R. N Michel Alterations in Slow-Twitch Muscle Phenotype in Transgenic Mice Overexpressing the Ca2+ Buffering Protein Parvalbumin J. Physiol., March 1, 2003; 547(2): 649 - 663. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-W. Chen, G. A Nader, K. R Baar, M. J Fedele, E. P Hoffman, and K. A Esser Response of rat muscle to acute resistance exercise defined by transcriptional and translational profiling J. Physiol., November 15, 2002; 545(1): 27 - 41. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Pallafacchina, E. Calabria, A. L. Serrano, J. M. Kalhovde, and S. Schiaffino A protein kinase B-dependent and rapamycin-sensitive pathway controls skeletal muscle growth but not fiber type specification PNAS, July 9, 2002; 99(14): 9213 - 9218. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Haddad and G. R. Adams Exercise Effects on Muscle Insulin Signaling and Action: Selected Contribution: Acute cellular and molecular responses to resistance exercise J Appl Physiol, July 1, 2002; 93(1): 394 - 403. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Horsley and G. K. Pavlath Nfat: ubiquitous regulator of cell differentiation and adaptation J. Cell Biol., March 4, 2002; 156(5): 771 - 774. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. J. Carlson, Z. Fan, S. E. Gordon, and F. W. Booth Time course of the MAPK and PI3-kinase response within 24 h of skeletal muscle overload J Appl Physiol, November 1, 2001; 91(5): 2079 - 2087. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. L. Serrano, M. Murgia, G. Pallafacchina, E. Calabria, P. Coniglio, T. Lomo, and S. Schiaffino Calcineurin controls nerve activity-dependent specification of slow skeletal muscle fibers but not muscle growth PNAS, October 16, 2001; (2001) 231148598. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Liu, Z. Cseresnyes, W. R. Randall, and M. F. Schneider Activity-dependent nuclear translocation and intranuclear distribution of NFATc in adult skeletal muscle fibers J. Cell Biol., October 1, 2001; 155(1): 27 - 40. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. C. Martineau and P. F. Gardiner Insight into skeletal muscle mechanotransduction: MAPK activation is quantitatively related to tension J Appl Physiol, August 1, 2001; 91(2): 693 - 702. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Palmer, N. Groves, A. Schindeler, T. Yeoh, C. Biben, C.-C. Wang, D. B. Sparrow, L. Barnett, N. A. Jenkins, N. G. Copeland, et al. The Small Muscle-specific Protein Csl Modifies Cell Shape and Promotes Myocyte Fusion in an Insulin-like Growth Factor 1-dependent Manner J. Cell Biol., May 21, 2001; 153(5): 985 - 998. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. D Meissner, G. Gros, R. J Scheibe, M. Scholz, and H.-P. Kubis Calcineurin regulates slow myosin, but not fast myosin or metabolic enzymes, during fast-to-slow transformation in rabbit skeletal muscle cell culture J. Physiol., May 15, 2001; 533(1): 215 - 226. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. E. Spangenburg, J. H. Williams, R. R. Roy, and R. J. Talmadge Skeletal muscle calcineurin: influence of phenotype adaptation and atrophy Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2001; 280(4): R1256 - R1260. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Friday and G. Pavlath A calcineurin- and NFAT-dependent pathway regulates Myf5 gene expression in skeletal muscle reserve cells J. Cell Sci., January 1, 2001; 114(2): 303 - 310. [Abstract] [PDF]
|
|
|
|
 |
|
 J. Yang, B. Rothermel, R. B. Vega, N. Frey, T. A. McKinsey, E. N. Olson, R. Bassel-Duby, and R. S. Williams Independent Signals Control Expression of the Calcineurin Inhibitory Proteins MCIP1 and MCIP2 in Striated Muscles Circ. Res., December 8, 2000; 87 (12): e61 - e68. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Dunn, E. Chin, and R. Michel Matching of Calcineurin Activity to Upstream Effectors Is Critical for Skeletal Muscle Fiber Growth J. Cell Biol., October 30, 2000; 151(3): 663 - 672. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. D. Molkentin Calcineurin and Beyond : Cardiac Hypertrophic Signaling Circ. Res., October 27, 2000; 87(9): 731 - 738. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Shimoyama, D. Hayashi, Y. Zou, E. Takimoto, M. Mizukami, K. Monzen, S. Kudoh, Y. Hiroi, Y. Yazaki, R. Nagai, et al. Calcineurin Inhibitor Attenuates the Development and Induces the Regression of Cardiac Hypertrophy in Rats With Salt-Sensitive Hypertension Circulation, October 17, 2000; 102(16): 1996 - 2004. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Rusnak and P. Mertz Calcineurin: Form and Function Physiol Rev, October 1, 2000; 80(4): 1483 - 1521. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. Swoap, R. B. Hunter, E. J. Stevenson, H. M. Felton, N. V. Kansagra, J. M. Lang, K. A. Esser, and S. C. Kandarian The calcineurin-NFAT pathway and muscle fiber-type gene expression Am J Physiol Cell Physiol, October 1, 2000; 279(4): C915 - C924. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. Delling, J. Tureckova, H. W. Lim, L. J. De Windt, P. Rotwein, and J. D. Molkentin A Calcineurin-NFATc3-Dependent Pathway Regulates Skeletal Muscle Differentiation and Slow Myosin Heavy-Chain Expression Mol. Cell. Biol., September 1, 2000; 20(17): 6600 - 6611. [Abstract] [Full Text]
|
|
|
|
|
|
M. W. Berchtold, H. Brinkmeier, and M. Muntener Calcium Ion in Skeletal Muscle: Its Crucial Role for Muscle Function, Plasticity, and Disease Physiol Rev, July 1, 2000; 80(3): 1215 - 1265. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Estrada, J. L. Liberona, M. Miranda, and E. Jaimovich Aldosterone- and testosterone-mediated intracellular calcium response in skeletal muscle cell cultures Am J Physiol Endocrinol Metab, July 1, 2000; 279(1): E132 - E139. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Hill, M. Karimi, W. Kutschke, R. L. Davisson, K. Zimmerman, Z. Wang, R. E. Kerber, and R. M. Weiss Cardiac Hypertrophy Is Not a Required Compensatory Response to Short-Term Pressure Overload Circulation, June 20, 2000; 101(24): 2863 - 2869. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Oie, R. Bjornerheim, O. P. F. Clausen, and H. Attramadal Cyclosporin A inhibits cardiac hypertrophy and enhances cardiac dysfunction during postinfarction failure in rats Am J Physiol Heart Circ Physiol, June 1, 2000; 278(6): H2115 - H2123. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. B. Friday, V. Horsley, and G. K. Pavlath Calcineurin Activity Is Required for the Initiation of Skeletal Muscle Differentiation J. Cell Biol., May 1, 2000; 149(3): 657 - 666. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Rothermel, R. B. Vega, J. Yang, H. Wu, R. Bassel-Duby, and R. S. Williams A Protein Encoded within the Down Syndrome Critical Region Is Enriched in Striated Muscles and Inhibits Calcineurin Signaling J. Biol. Chem., March 17, 2000; 275(12): 8719 - 8725. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. J. Naya, B. Mercer, J. Shelton, J. A. Richardson, R. S. Williams, and E. N. Olson Stimulation of Slow Skeletal Muscle Fiber Gene Expression by Calcineurin in Vivo J. Biol. Chem., February 18, 2000; 275(7): 4545 - 4548. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Carson and L. Wei Integrin signaling's potential for mediating gene expression in hypertrophying skeletal muscle J Appl Physiol, January 1, 2000; 88(1): 337 - 343. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Fluck, M. N. Waxham, M. T. Hamilton, and F. W. Booth Skeletal muscle Ca2+-independent kinase activity increases during either hypertrophy or running J Appl Physiol, January 1, 2000; 88(1): 352 - 358. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. W. Smith, J. D. Smith, and D. S. Criswell Involvement of nitric oxide synthase in skeletal muscle adaptation to chronic overload J Appl Physiol, May 1, 2002; 92(5): 2005 - 2011. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Bigard, H. Sanchez, J. Zoll, P. Mateo, V. Rousseau, V. Veksler, and R. Ventura-Clapier Calcineurin Co-regulates Contractile and Metabolic Components of Slow Muscle Phenotype J. Biol. Chem., June 23, 2000; 275(26): 19653 - 19660. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. E. Dunn, A. R. Simard, R. Bassel-Duby, R. S. Williams, and R. N. Michel Nerve Activity-dependent Modulation of Calcineurin Signaling in Adult Fast and Slow Skeletal Muscle Fibers J. Biol. Chem., November 21, 2001; 276(48): 45243 - 45254. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. L. Serrano, M. Murgia, G. Pallafacchina, E. Calabria, P. Coniglio, T. Lomo, and S. Schiaffino Calcineurin controls nerve activity-dependent specification of slow skeletal muscle fibers but not muscle growth PNAS, November 6, 2001; 98(23): 13108 - 13113. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Horsley and G. K. Pavlath Nfat: ubiquitous regulator of cell differentiation and adaptation J. Cell Biol., March 4, 2002; 156(5): 771 - 774. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. E. Dupont-Versteegden, M. Knox, C. M. Gurley, J. D. Houle, and C. A. Peterson Maintenance of muscle mass is not dependent on the calcineurin-NFAT pathway Am J Physiol Cell Physiol, June 1, 2002; 282(6): C1387 - C1395. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. O. Mitchell, S. T. Mills, and G. K. Pavlath Calcineurin differentially regulates maintenance and growth of phenotypically distinct muscles Am J Physiol Cell Physiol, May 1, 2002; 282(5): C984 - C992. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |