| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 274, Issue 31, 22033-22040, July 30, 1999
From the Imperial Cancer Research Fund, 44 Lincoln's Inn Fields,
London WC2A 3PX, United Kingdom
The involvement of Ras in the activation of
multiple early signaling pathways is well understood, but it is less
clear how the various Ras effectors interact with the cell cycle
machinery to cause G1 progression. Ras-mediated
activation of extracellular-regulated kinase/mitogen-activated protein
kinase has been implicated in cyclin D1 up-regulation, but
there is little extracellular-regulated kinase activity during the
later stages of G1, when cyclin D1 expression
becomes maximal, implying that other effector pathways may also be
important in cyclin D1 induction. We have addressed the
involvement of Ras effectors from the phosphatidylinositol (PI)
3-kinase and Ral-GDS families in G1 progression and
compared it to that of the Raf/mitogen-activated protein kinase
pathway. PI 3-kinase activity is required for the expression of
endogenous cyclin D1 and for S phase entry following serum
stimulation of quiescent NIH 3T3 fibroblasts. Activated PI 3-kinase
induces cyclin D1 transcription and E2F activity, at least
in part mediated by the serine/threonine kinase Akt/PKB, and to a
lesser extent the Rho family GTPase Rac. In addition, both activated
Ral-GDS-like factor and Raf stimulate cyclin D1
transcription and E2F activity and act in synergy with PI 3-kinase.
Therefore, multiple cooperating pathways mediate the effects of Ras on
progression through the cell cycle.
Upon reentry of cells into the cell cycle and throughout the
G1 phase, mitogenic signals are integrated through the
GTPase Ras. Inhibition of Ras function by microinjection of
Ras-neutralizing antibodies or by inducible expression of dominant
negative Ras arrests cycling cells in G1 and prevents
growth factor stimulated cells from leaving G0 to reenter
the cell cycle (1-4). The requirement of Ras function during the
G0/G1 transition seems to be conserved from
yeast, in which it is necessary for spore germination (5). Microinjection of anti-Ras antibodies has demonstrated a requirement for Ras up to 2 h prior to S phase entry (6, 7).
Overexpression of mutationally activated Ras leads to cellular
transformation and a shortening of the G1 phase of the cell cycle (8). However, transformation of cells by activated Ras requires
other genetic changes, as only immortal cells that have lost cell cycle
checkpoints, such as those imposed by cyclin-dependent kinase (cdk)1 inhibitors,
retinoblastoma protein, and p53, can be transformed by Ras alone. The
expression of activated Ras in primary cells leads to cell cycle arrest
via up-regulation of cdk inhibitors and p53. The resulting phenotype
resembles that of cellular senescence (9). In mouse embryo fibroblasts
(10, 11) and rat Schwann cells (12), the Ras effector Raf appears to be
sufficient to mediate this effect via induction of
p21Waf1/Cip1. Thus, Ras exerts both positive and negative
effects on cell growth, depending on cellular context.
Recent work from this and other laboratories has shown that Ras is able
to interact with multiple effector enzymes, including the Raf protein
kinases, the Ral-GDS family of guanine nucleotide exchange factors for
Ral, and type I phosphoinositide 3-kinases (13). The functions of
multiple Ras effectors are required for cellular transformation; in
addition to Raf, both the PI 3-kinase and the Ral-GDS pathways
cooperate to achieve efficient transformation of immortalized cells
(14, 15). Therefore, several Ras effector pathways may interface with
the cell cycle machinery.
Ras has been implicated in the positive regulation of the cyclin
D1 promoter. The conditional expression of oncogenic Ras induces cyclin D1 protein production in growth
factor-deprived cells (16). However, the resulting cyclin
D1/cdk4 complexes may remain inactive in the absence of
growth factors (17). Activation of Raf-ER, a conditionally active
fusion of Raf to the hormone binding domain of the estrogen receptor,
and conditional expression of an activated form of the MAP/ERK kinase,
MEK, reproduce the effect of oncogenic Ras on cyclin D1,
and under certain conditions this signal can be blocked by
co-expression of a MAP kinase phosphatase or dominant-interfering
mutants of ERK. Therefore, these Ras effects have been attributed to
the sequential activation of Raf kinase, MEK, and ERK (18-20).
However, there are circumstances under which ERK activity may be
dispensable for cyclin D1 production as the MEK inhibitor
PD 98059 does not inhibit serum-induced cyclin D1 expression in IIC9 fibroblasts (21).
It has been suggested that low levels of Raf kinase activity promote
proliferation by inducing cyclin D1 and strong Raf activity inhibits cell cycle progression through production of cdk inhibitors (9-12). However, it is also possible that the divergent effects of Ras
on proliferation are mediated by distinct effector proteins, which
could be subject to independent regulation by cross-talk with other
signaling pathways. Therefore, we investigated which of the known Ras
effectors would interface with the G1 cell cycle machinery.
We find that activation of PI 3-kinase is required for cyclin
D1 protein expression and S phase entry in fibroblasts. The
PI 3-kinase pathway also contributes to the activation of E2F-dependent transcription underlining its importance for
progression through G1. An activated form of Ral-GDS-like
factor (Rlf), which has recently been implicated in the transcriptional
induction of the c-fos proto-oncogene, also strongly
activated cyclin D1 transcription. Thus, multiple pathways
in addition to Raf/MAP kinase mediate the effects of Ras on cyclin
D1 expression and E2F transcriptional activity in order to
drive G1 progression.
Plasmids--
The reporter plasmid E2ACAT and has been described
previously (31). The luciferase reporter pGL2-lucD1
contains 1.8 kilobase pairs of the human cyclin D1
promoter, including the TATA box inserted into the SmaI site
of pGL2 (Promega) and was provided by R. Assoian. Expression vectors
for Ral-GDS-like factor (52) and RalA (53) have been described. RalA
F39L was generated using the mutagenic oligonucleotide primer
CATGTACGATGAGCTCGTGGAGGACTATG on pMT3-RalA using standard procedures.
The activated pSG5 gag-Akt/PKB (54) and dominant-negative Akt/PKB (55)
constructs were kindly provided by B. Burgering. Expression plasmids
for activated PI 3-kinase (25), V12 Ras, V12 Rac, and V12 Cdc42 have
been described (15). Raf CAAX DD is an activated form of
c-Raf-1 in which Raf is localized to the membrane by a farnesylation
sequence from H-Ras and also by mutation of two tyrosine residues, 340 and 341, to aspartic acids; it was kindly provided by Raichard Marais
and Chris Marshall.
Cell Culture and Transfections--
NIH 3T3 cells were
maintained in 10% calf serum and starved for 48 h in 0.15% calf
serum where indicated. LY294002 was used at 20 µM unless
indicated otherwise. The final concentration of PD 98059 (Biomol) was
30 µM, and rapamycin was used at 50 nM. Cells
were preincubated with inhibitors for 10 min prior to addition of calf
serum to 10%. LipofectAMINE was used to transfect 1.5 105
cells with 0.5 µg of each plasmid. Cells were lysed 36 h after transfection. Chloramphenicol acetyltransferase activity was determined by enzyme-linked immunosorbent assay (Roche Molecular Biochemicals), and luciferase activity was measured using Promega luciferin as substrate. The results were corrected using CH110-expressed (Amersham Pharmacia Biotech) Cell Cycle Analysis--
In order to determine cell cycle
distribution, NIH 3T3 cells were trypsinized washed with
phosphate-buffered saline and fixed in 70% ethanol at 4 °C while
vortexing and stored at Antisera--
The cyclin D1 polyclonal antiserum was
a gift from G. Peters. An anti-RB monoclonal antibody was used for
immunoprecipitation (Pharmingen), and Rb was detected using a
polyclonal serum (Santa Cruz). Anti-phospho-ERK was purchased from
Promega. Ras was detected using anti-pan Ras antibody-4 (Calbiochem).
Raf-Ras Binding Domain Pull-out Assays--
GST-Raf-Ras binding
domain (56) was expressed in Escherichia coli BL21, and
bacteria were lysed in 1% Triton X-100, 50 mM HEPES-NaOH,
pH 7.5, 100 mM NaCl, 5% glycerol, 0.2 µM
phenylmethylsulfonyl fluoride, 10 µg/ml aprotinin, and 1 mM benzamidine. The suspension was aliquoted, snap-frozen,
and stored at Akt/PKB Kinase Assays--
Akt/PKB kinase was immunoprecipitated
from NIH 3T3 cell lysates, and immune complex kinase assays were
performed using histone H2B as a substrate as described previously
(25).
Sustained Ras and Akt/PKB Activation during
G1--
Ras function has been shown to be required
throughout G1 up to the restriction point, after which
cells become committed to enter S phase. In order to determine Ras
activity at later stages in G1, we made use of the high
affinity interaction of the active GTPase with the Ras binding domain
of Raf kinase (22). Quiescent NIH 3T3 cells were stimulated with serum,
and GTP-bound Ras was purified based on its ability to bind to
recombinant fusion protein containing the Ras binding domain of Raf.
Ras activation was found to be biphasic with a strong second
mid-G1 peak of activity that was maximal at about 2-4 h
after exit from quiescence (Fig.
1A). Whereas the first peak of
Ras activity up to about 30 min after stimulation correlated with ERK
phosphorylation, little ERK activity could be detected at 4 h
(Fig. 1B) (see also Ref. 22). This is likely to be due to
the induction of MAP kinase phosphatases as a result of the early phase
of growth factor receptor and Ras activation (23).
One of the functions in cell cycle progression attributed to Ras in
cells released from quiescence is the induction of cyclin D1 protein as a consequence of ERK activation. However,
cyclin D1 expression became detectable only at 4 h
after stimulation and became maximal at 6-8 h (see Fig. 3,
A and B), consistent with previous reports (24).
Thus, cyclin D1 induction correlates with the second phase
of Ras activity, which is not associated with ERK activation.
The serine/threonine kinase Akt/PKB is activated by
phosphatidylinositol 3,4,5-trisphosphate (PIP3), which is
generated upon activation of the Ras effector PI 3-kinase. In order to
determine whether the time course of Akt/PKB activation is consistent
with a role in G1 progression, its kinase activity was
determined at various times during the G1 phase. As shown
in Fig. 1C, Akt/PKB activity was sustained during
G1, and its period of activity encompassed the second peak
of Ras activation.
PI 3-kinase Is Required for G1 Progression--
In
order to determine which Ras effector pathways are required for
G1 progression, we made use of chemical inhibitors for MEK
(PD 98059) and PI 3-kinase (LY 294002). Because it is known that LY
294002 also inhibits some relatives of PI 3-kinase, such as TOR, the
specific TOR inhibitor rapamycin was also used. Quiescent NIH 3T3 cells
were preincubated with inhibitor and then stimulated with serum in the
presence of inhibitor.
Fig. 2A shows the cell cycle
distribution at 14 and 20 h after serum treatment. Whereas both PD
98059 and rapamycin caused delays in S phase entry, many cells treated
with either inhibitor were able to initiate DNA synthesis by 14 h.
However, in the presence of LY 294002, cells had not progressed into S
phase at all after 14 h. At 20 h, more than 75% of the LY
294002-treated cells were still in G0/1, compared with well
under for 50% for control cells and those treated with PD 98059 or
rapamycin. In order to determine the effectiveness of the drug
treatments, cell lysates were immunoblotted with anti-phospho-Akt or
anti-phospho-ERK antibodies. Levels of the activity of these downstream
effectors of PI 3-kinase and Raf were less than 5% of untreated serum
controls for Akt in the presence of 20 µM LY294002 or
15% for ERK in the presence of 30 µM PD98059 at all time
points (data not shown).
Fig. 2B shows the effect of the PI 3-kinase inhibitor on
unsynchronized cells. The presence of LY 294002 for 48 h induced a
level of arrest similar to that observed in growth factor deprived cells. The half-maximal inhibition of G1 progression was
achieved at 4 µM LY 294002, which is similar to the
IC50 for inhibition of insulin stimulated Akt/PKB activity
(Fig. 2C) (25). These results suggest that PI 3-kinase
activity is essential for the progression of cells through the
G1 phase of the cell cycle.
Effect of PI 3-kinase and MEK Inhibition on Endogenous Cyclin
D1 Expression--
One of the earliest effects of serum
stimulation leading to cell cycle reentry in fibroblasts is the
expression of cyclin D1 protein. In order to determine the
effects of the various inhibitors on cyclin D1 expression,
NIH 3T3 cells were treated with inhibitors as above, and the expression
of cyclin D1 was analyzed. Fig.
3A shows that the presence of
the PI 3-kinase inhibitor LY 294002 severely inhibited cyclin
D1 expression at all time points studied. The presence of
the MEK inhibitor PD 98059 led to a slightly reduced expression of
cyclin D1 relative to uninhibited cells at 7 h, but
there was no effect at later time points. The TOR inhibitor rapamycin
caused some decrease in cyclin D1 expression at 7 and 14 h, but by 20 h, this effect was negligible. At all times,
rapamycin was less inhibitory for cyclin D1 expression than
was LY 294002, suggesting that the effects of the PI 3-kinase inhibitor
were not connected with inhibition of the target of rapamycin. The PI
3-kinase inhibitor LY 294002 thus inhibits one of the earliest events
in G1.
In order to determine the length of time in G1 during which
PI 3-kinase activity is required for cyclin D1 expression,
the inhibitor was added at different times after release of cells from
starvation by serum treatment. Fig. 3B shows that about
8 h after serum treatment, cyclin D1 expression
becomes independent of PI 3-kinase activity but that inhibition of PI
3-kinase at any time during the first 6 h of serum treatment
results in inhibition of cyclin D1 expression. Inhibition
of MEK through the use of PD98059 has only a small effect on cyclin
D1 expression, which is lost if inhibitor treatment is
delayed until 4 h after serum addition, suggesting that the low
levels of ERK activity in late G1 are not important for
cyclin D1 expression.
Fig. 3C shows that the concentration of rapamycin used in
this experiment was sufficient to inhibit phosphorylation of
p70S6K, the downstream target of TOR activity. The presence
of LY 294002 did not lead to detectable p70S6K inhibition,
reflecting the fact that although PI 3-kinase contributes to the
regulation of p70S6K, there are multiple pathways involved
including some utilizing protein kinase C that are not sensitive to
inhibition of PI 3-kinase. Therefore, p70S6K does not seem
to be required for S phase entry in fibroblasts, in agreement with
previous observations (26). The effects of drug treatments on earlier
time points after serum stimulation were also studied (Fig.
3D). In agreement with the data shown in Fig. 3A,
LY 294002 caused a profound delay in induction of cyclin
D1, whereas PD 98059 causes only a slight delay.
Akt/PKB Activation Increases Levels of Endogenous Cyclin
D1--
The Akt/PKB kinase is believed to be activated by
PI 3-kinase generated PIP3 through a sequential mechanism.
The binding of the lipid to its PH domain recruits the enzyme to the
plasma membrane, where it is phosphorylated at Thr-308 and Ser-473. A
kinase, termed PDK1, that can phosphorylate Thr-308 only when Akt/PKB
is bound to PIP3 has been purified and cloned. PDK1 is
itself dependent on PIP3 for its activity (27, 28). The
identity of the Ser-473 kinase is not known at present. Thus,
PIP3 is required for at least two steps in the Akt/PKB
activation mechanism, the first of which can be overcome by
constitutively targeting the kinase to the membrane, as is observed in
its viral counterpart v-Akt, in which the viral gag sequence is
myristylated. Constitutively membrane-localized Akt/PKB is thus
partially, but not completely, resistant to the effects of PI 3-kinase inhibitors.
Several stable cell lines expressing gag-Akt/PKB were generated and
pooled to investigate the regulation of cyclin D1
expression in the presence of enhanced Akt/PKB activity. Fig.
4A demonstrates that
gag-Akt/PKB expression results in a partial rescue of cyclin D1 expression in the presence of LY 294002 (compare with
Fig. 3A). At 7 h of serum treatment, LY 294002 did
reduce cyclin D1 expression, but the effect was much less
marked at 14 h, and by 20 h the amount of cyclin
D1 was not much different to that in uninhibited cells.
Intriguingly, the gag-Akt/PKB transfected cells expressed low levels of
cyclin D1 in the absence of growth factors. Therefore, we
determined the levels of cyclin D1 expression in individual
clones expressing gag-Akt/PKB. All cell lines showed cyclin
D1 expression in the absence of growth factors, albeit at
lower levels than serum-starved V12 Ras-expressing cells (Fig. 4B). Thus, Akt/PKB activity may mediate some, but not all,
of the effects of V12 Ras on cyclin D1 expression.
Cyclin D1 Transcription Is Controlled by Multiple Ras
Effectors--
Previous work on the regulation of cyclin
D1 transcription has shown that the promoter is growth
factor-regulated and can be activated by oncogenic mutants of Ras (16,
17, 29). As we were unable to detect any differences in cyclin
D1 protein stability in the presence of LY 294002 or upon
expression of activated Akt/PKB (data not shown), we investigated the
regulation of cyclin D1 transcription in response to the
expression of various Ras effectors. We used a reporter construct
encompassing 1.8 kilobases proximal to the transcriptional start site
of human cyclin D1. As shown in Fig.
5A, V12 Ras induced
transcription from the reporter 4-fold. Various dominant negative
alleles of Ras effectors were used to determine their contribution to
this effect. Dominant negative mutants of Ral (N28 Ral) and Akt/PKB
(PKB-CAAX, dn Akt) both strongly reduced activated Ras
induction of the cyclin D1 reporter. Although activated Rac
(V12 Rac), a putative PI 3-kinase target, was also able to activate the
cyclin D1 reporter construct as described previously (30),
a dominant negative form of the Rac (N17 Rac) gave only a minor
inhibition of V12 Ras-induced transcription, suggesting that Rac does
not function downstream of Ras in cyclin D1 regulation. The
level of V12 Ras expression was checked and found not to vary when
cells were co-transfected with dominant negative effectors. In
addition, as a control, c-Jun N-terminal kinase activity was checked in
transfections done in parallel to Fig. 5A: N17 Rac caused
70% inhibition of the activity of epitope tagged c-Jun N-terminal
kinase-1 co-expressed with V12 Ras. This compares well with the level
of inhibition of c-Jun N-terminal kinase activity by N17 Rac reported
by others, indicating that the dominant negative Rac was effective on
other pathways.
Activated forms of the various effectors of Ras were used to determine
their effects on cyclin D1 transcription. On their own,
activated PI 3-kinase as well as gag-Akt/PKB both gave signals of
comparable strength to that observed upon expression of an activated
form of Raf kinase (Fig. 5). Because the different Ras effectors
activate distinct downstream signaling cascades, we investigated
whether they would cooperate to activate cyclin D1 transcription. Another distinct Ras effector, Rlf, was also included in
this analysis. Whereas expression of activated forms of Raf, Rlf, and
PI 3-kinase on their own gave 2.5-3-fold inductions, the combined
effect of Raf and Rlf was additive (Fig. 5B). Combined expression of PI 3-kinase and Raf as well as PI 3-kinase and Rlf synergized in cyclin D1 induction, suggesting that they use
independent pathways to activate D1 transcription.
Different Ras Effectors Can Activate E2F-dependent
Transcription--
Because the presence of the PI 3-kinase inhibitor
LY 294002 delayed cyclin D1 expression (Fig. 3) and Rb
hyperphosphorylation (data not shown) we reasoned that the PI 3-kinase
activity may be required for the release of E2F activity from
Rb-mediated repression. Therefore, we used an E2F reporter derived from
the adenovirus E2 promoter to assess E2F transcriptional activity (31).
Fig. 6 shows that the V12 Ras-induced
increase of E2F activity can be partially suppressed by co-expression
of dominant-negative constructs that block the function of the Ras
effectors Ral-GDS (N28 Ral) and PI 3-kinase (
As dominant negative Ral (N28 Ral) was able to partially suppress the
V12 Ras-induced E2F induction, activated forms of Ral as well as Rlf
were also tested. L72 Ral, an activated form of Ral, only led to a
minor induction. A mutant of Ral with a decreased affinity for
nucleotide that retained GTPase activity, L39 Ral was also examined.
The increased exchange of hydrolyzed GDP leads to a rapid reactivation
of this mutant; this approach has recently been shown to lead to strong
activation of Cdc42 (32). L39 Ral led to a small but reproducible
increase in E2F activity, comparable to that observed upon expression
of activated Raf. These results suggest that part of the activation
mediated by V12 Ras is mediated by a pathway involving Ral function,
but that a greater contribution comes from the PI 3-kinase and Akt/PKB pathway.
Expression of oncogenic forms of Ras proteins leads to induction
of cell cycle progression, causing exit of quiescent cells from
G0 and passage through at least G1 and S phases
in most cell types (4). In recent years, it has become clear that
activated Ras proteins are capable of engaging a number of families of
downstream effector proteins, thereby triggering in parallel the
activation of several signaling systems, most notably the Raf/MAP
kinase pathway, the Ral-GDS pathway, and the PI 3-kinase pathway (13). The best characterized of these, the Raf/MAP kinase pathway, has been
known for some time to influence the expression of cell cycle regulatory proteins, but the possible involvement of the other two
pathways in cell cycle control is much less well understood. This paper
explores the influence of the different Ras effector systems on cell
cycle regulation, in particular attempting to determine whether the
function of particular Ras pathways can be correlated with the control
of different check points, or whether the activity of the different
pathways is integrated at each check point.
One of the earliest changes that can been seen in the expression of
cell cycle regulatory proteins following release of fibroblasts from
quiescence using serum is an increase in the expression of cyclin
D1. Expression of activated Ras will cause this in the absence of serum (8, 16, 17). At least in part, this is caused by
activation of the Raf/MAP kinase pathway: in a variety of cell types,
specific activation of Raf or MEK alone has been reported to stimulate
expression of cyclin D1 (11, 18, 19, 33). The data in Fig.
5 show that in NIH 3T3 cells, activated Raf is able to induce cyclin
D1 reporter transcription, albeit less strongly than
activated Ras. Perhaps surprisingly, activated forms of the other two
Ras effectors studied here, Rlf and PI 3-kinase Studying endogenous cyclin D1 expression in NIH 3T3 cells
released from serum starvation appears to support this hypothesis (Fig.
3). Treatment of quiescent cells with the PI 3-kinase inhibitor LY
294002 results in a considerable delay in the expression of cyclin
D1 following serum stimulation. This effect is noticeable if the inhibitor is added up to 6 h after the addition of serum. By contrast, inhibition of the Raf/MAP kinase pathway by the use of the
MEK inhibitor PD 98059 results in a much more modest delay, if any, in
cyclin D1 expression. This indicates that the function of
PI 3-kinase signaling pathways is more important in the serum regulation of cyclin D1 protein levels than is the Raf/MAP
kinase pathway. Others have reported that LY 294002 inhibits the
ability of insulin-like growth factor I to induce cyclin D1
expression in MCF-7 cells (34), but that PD 98059 inhibits
platelet-derived growth factor-induced cyclin D1 induction
in Chinese hamster embryo fibroblasts (21). However, certain caveats
exist: although PD 98059 is thought to be a highly specific inhibitor
of MEK, LY 294002 is known to inhibit several enzymes other than PI
3-kinase, particularly the more distant relatives of this kinase
superfamily such as TOR and DNA-dependent protein kinase
(35, 36). No highly specific inhibitors of PI 3-kinase have been
identified. It is therefore important that the inhibitory effects of LY
294002 on cyclin D1 expression and cell cycle progression
occur at doses that correlate with inhibition of PI 3-kinase activity
(Fig. 2) and that the specific TOR inhibitor, rapamycin does not have
strongly inhibitory effects on cyclin D1 expression (Fig.
3). As well as being regulated at the transcriptional level, cyclin
D1 expression may also be controlled posttranscriptionally,
allowing for other factors to influence the endogenous protein level
that are not apparent in reporter transcription assays. Indeed, it has
recently been reported that Akt/PKB is required for up-regulation of
translation of cyclin D mRNA (37) and that Akt/PKB acts through
GSK-3 A number of signaling pathways have been characterized downstream of PI
3-kinase, including the Rho-family GTPase Rac and the serine/threonine
kinase Akt/PKB. Activated forms of both these proteins are able to
induce cyclin D1 reporter expression, and dominant negative
Akt/PKB, and to a lesser extent dominant negative Rac, inhibits
activated Ras-induced cyclin D1 expression. Rac induction
of cyclin D1 transcription has been reported previously (30). There is therefore evidence that multiple pathways acting downstream of PI 3-kinase can contribute to cyclin D1
induction. When endogenous cyclin D1 levels are studied in
cells stably expressing activated Ras or activated Akt/PKB, it is clear
that whereas V12 Ras causes strong serum-independent expression of
cyclin D1, activated Akt/PKB is capable of only a weak
induction (Fig. 4), and Rlf-CAAX and V12 Rac do not cause any
detectable induction (data not shown). In the case of expression of
endogenous cyclin D1, multiple synergizing pathways acting
downstream of Ras may therefore be particularly important, again
emphasizing the possibility that regulation of cyclin D1
protein levels occurs at a number of levels in addition to the
regulation of cyclin D1 gene transcription. Stable
expression of gag-Akt/PKB, a membrane-localized activated form of
Akt/PKB, can only partially abrogate the inhibitory effect of LY
294002: this may indicate that other pathways downstream of PI
3-kinase, such as Rac, play an important role here or that gag-Akt/PKB
is not fully independent of PI 3-kinase activity. Although the need for
PIP3 to translocate Akt/PKB to the membrane is supplanted by the myristylation signal on the gag fusion, gag-Akt/PKB still requires phosphorylation by the upstream kinases PDK1 and PDK2, which
are at least in part dependent on PI 3-kinase activity themselves (39).
Cyclin D1 is only the earliest of the cell cycle regulators
to be affected by Ras. Many other points of regulation of the cell
cycle by Ras are possible at later times. A later event that is studied
here is the regulation of E2F transcription factors released from Rb
following its phosphorylation. When an E2F target sequence derived from
the adenovirus E2 promoter was used as a reporter of E2F activity
following activation of different Ras pathways, a pattern related to,
but distinct from, that found for cyclin D1 transcription
was seen (Fig. 6). What is especially noticeable is that activated
Akt/PKB and PI 3-kinase are particularly strong inducers of E2F
activity, more so than Ras itself. Because Akt/PKB and PI 3-kinase
induction of cyclin D1 expression is less strong than Ras,
this suggests that Akt/PKB may act through other pathways in addition
to cyclin D1 to control E2F activity. A very likely
candidate is the regulation of the cyclin-dependent kinase inhibitor p27Kip1, the expression of which is suppressed
following serum treatment of quiescent cells in a manner requiring Ras
activity and is also down-regulated in Ras transformed cells. There is
lack of agreement as to whether the Raf/MAP kinase pathway can lead to
reduction in p27 expression, with some reports indicating that it can
(11, 33) and others that it cannot (19). LY 294002 has been found to
reduce the ability of growth factors to reduce p27 levels (40, 41),
although others report that PD 98059 can inhibit the ability of
activated Ras to down-regulate p27 expression (42). Further investigation will be required to determine the signaling connections between activated Ras and induction of p27 degradation.
The picture emerging of Ras regulation of the cell cycle is one in
which multiple signaling pathways are activated by Ras, which then act
together synergistically at several different control points. Broadly
similar conclusions were reached by Yang et al. (43), using
effector loop mutants of activated Ras, Ser-35, Gly-37, and Cys-40,
which show some selectivity in the downstream effector pathways that
they activate (14). In addition, activation of PI 3-kinase alone has
been shown to promote cell cycle entry in some cell lines (44). In this
scheme, it is important to distinguish between the situation in which
transformed cells express a constitutively activated Ras oncogene and
that of normal cells that use endogenous wild type Ras protein to
transduce signals from various extracellular growth stimuli. Strong
activation of the Raf, Ral-GDS, PI 3-kinase, Akt/PKB, or Rac pathways
by overexpression of the activated effectors, or of oncogenic Ras
itself, may be sufficient to stimulate events that would not normally
be activated by physiological activation of each pathway. As shown in
Fig. 1, serum stimulation of NIH 3T3 cells leads to biphasic activation of endogenous Ras protein, as has been reported previously (22). Activation of endogenous MAP kinase and Akt/PKB does not correlate at
all well with the time course of Ras activation; this is presumably because several other pathways are involved in the regulation of both
these enzymes, including protein kinase C and
calcium-dependent pathways in MAP kinase activation (45),
induction of specific phosphatases in MAP kinase inactivation (46), and
tyrosine kinases in the control of PI 3-kinase upstream of Akt/PKB
(47). Under normal physiological conditions, endogenous Ras is only one
of several signaling molecules influencing the activities of these enzymes, although complete removal of Ras function through the expression of dominant negative Ras protein or introduction of neutralizing antibodies may cause catastrophic failure of the pathway.
Similar considerations hold true for the influence of the pathways
downstream of Ras on the regulation of cell cycle check points.
During normal regulation of the cell cycle, early activation of the MAP
kinase pathway, in part through endogenous Ras, may initiate events
leading to induction of cyclin D expression. At later points in
progression through G1, other pathways also controlled in
part by endogenous Ras, such as Ral-GDS, PI 3-kinase, Akt/PKB, and Rac,
may continue to provide stimulatory signals to cyclin D expression,
even after MAP kinase activity has returned to basal levels. This
requirement for activation of multiple pathways during normal growth
regulation may ensure that a cell has been exposed to range of growth
stimuli before it is able to progress through the cell cycle (48, 49).
A key to the potent oncogenicity of mutant Ras is that it can activate
multiple pathways continuously that may well normally contribute to
cell cycle progression in a sequential manner. Multicellular organisms
may guard against the oncogenic potential of Ras by mounting an
anti-proliferative response to continuous strong activation of Ras;
this can be in the form of induction of expression of
cyclin-dependent kinase inhibitors p21Waf1/Cip1
and p16INK4A (9, 11, 12) or the induction of apoptosis in
some cell types (50, 51).
We thank Hans Bos, Boudewijn Burgering,
Gordon Peters, and Richard Assoian for providing reagents and
Derek Davies for assistance with FACS. Thanks are also due to Gordon
Peters, Doreen Cantrell, and Paul Brennan for helpful discussions.
*
This work was supported by the Imperial Cancer Research
Fund.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§
To whom correspondence should be addressed. Tel.: 44-171-269-3533;
Fax: 44-171-269-3092; E-mail: downward@icrf.icnet.uk.
The abbreviations used are:
cdk, cyclin-dependent kinase;
MAP, mitogen-activated protein;
ERK, extracellular-regulated kinase;
MEK, MAP/ERK kinase;
PI, phosphatidylinositol;
PIP3, PI 3,4,5-trisphosphate;
Rb, retinoblastoma;
Rlf, Ral-GDS-like factor;
Ral-GDS, Ral guanine
nucleotide dissociation stimulator;
PKB, protein kinase B;
TOR, target
of rapamycin.
Multiple Ras Effector Pathways Contribute to G1
Cell Cycle Progression*
and
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
-galactosidase activity. Figs. 5 and 6 show the
means of four to seven experiments, and error bars represent S.E. The
expression of all constructs were confirmed by immunoblotting: in the
data presented in Figs. 5 and 6, any given construct was expressed at
similar levels in different assay points in the same experiment.
20 °C. Cells were washed twice in
phosphate-buffered saline and treated with 100 µg/ml ribonuclease for
5 min at room temperature. Cells were stained with propidium iodide (50 µg/ml) and analyzed by flow cytometry using 488 nm excitation.
70 °C. Prior to use, aliquots were thawed and
sonicated. The fusion protein was then purified on
glutathione-Sepharose beads. NIH 3T3 cells were lysed in the same lysis
buffer containing 10 mM MgCl2 but lacking
glycerol. The cleared lysates were incubated with beads in lysis buffer containing 10 mM MgCl2 for 20 min at 4 °C.
Beads were washed once in cold phosphate-buffered saline containing 5 mM MgCl2 and 0.1% Triton X-100. Bound Ras was
quantified by Western blotting.
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
View larger version (27K):
[in a new window]
Fig. 1.
Activation of Ras and Akt/PKB during
G1. NIH 3T3 cells were serum-starved for 36 h and
released from quiescence by addition of calf serum to 10%.
A, activation state of endogenous Ras. The level of
GTP-bound Ras was measured by extracting lysates from various stages
during G1 on a GST-Raf Ras binding domain (RBD)
affinity matrix. B, the activation state of ERK/MAP kinase
from cell lysates from various stages during G1 was
assessed by analyzing its phosphorylation state using a phosphospecific
antiserum. C, the activity of Akt/PKB was analyzed by
immunoprecipitation from NIH 3T3 cell lysates and measurement of kinase
activity using histone H2B as a substrate.
View larger version (27K):
[in a new window]
Fig. 2.
LY294002 prevents S phase entry.
A, At 0, 14, and 20 h after serum stimulation of
quiescent NIH 3T3 cells in the presence of the indicated inhibitors of
PI 3-kinase (LY294002), MEK (PD98059), or TOR (rapamycin), cells were
fixed and stained with propidium iodide, and their position in the cell
cycle was determined by FACS analysis. B, LY294002 was added
to unsynchronized cells in the presence of serum and the cell cycle
distribution was determined after 24 h and 48 h. The
distribution of untreated (cells in the presence of serum) and
serum-deprived cells was analyzed in parallel. C,
unsynchronized cells were grown for 24 h in serum in the presence
of different concentrations of LY294002. The arrest observed after
48 h in the presence of 20 µM was plotted as
100%.
View larger version (46K):
[in a new window]
Fig. 3.
PI 3-kinase is required for cyclin
D1 expression. Quiescent NIH 3T3 cells were either
left unstimulated (left lanes) or treated with growth
factors for the indicated times. A, endogenous cyclin
D1 expression in the presence of inhibitors was analyzed at
various times after growth factor stimulation. B, endogenous
cyclin D1 expression in quiescent cells treated with serum
at time zero, and then with LY294002 or PD98059 after the indicated
interval. Cells were lysed 12 h after serum addition.
C, the ratio of p70S6K phosphorylated species in
the presence of the various inhibitors was analyzed by their
differential mobility after growth factor stimulation. Shown is an
immunoblot of p70S6K species in whole cell lysates.
D, endogenous cyclin D1 expression in the
presence of inhibitors was analyzed at shorter times after growth
factor stimulation.
View larger version (26K):
[in a new window]
Fig. 4.
Cyclin D1 expression in cells
expressing activated Ras and gag-Akt/PKB. A, a pool of
activated Akt/PKB (gag-Akt/PKB) expressing NIH 3T3 cells was
serum-starved for 36 h and then stimulated with serum in the
presence of the different inhibitors. Cyclin D1 expression
was then analyzed by immunoblot of whole cell lysates. B,
cyclin D1 expression in wild type, V12 Ras, and
gag-Akt/PKB-expressing NIH 3T3 cell clones growing in the presence of
10% calf serum or serum-starved for 36 h.
View larger version (29K):
[in a new window]
Fig. 5.
Cyclin D1 transcription is
induced by multiple Ras effectors. A, regulation of
cyclin D1 transcription was analyzed by transfection of a
cyclin D1 reporter construct (pGL2
D1-luciferase) along with various Ras effectors into NIH
3T3 cells. Reporter activity was analyzed 24-36 h after transfection.
N28 Ral, dominant-negative Ral; dnAKT,
dominant-negative AKT/PKB. B, cooperation between Ras
effectors. Cyclin D1 reporter was expressed with activated
forms of PI 3-kinase, Rlf, and Raf, either alone or in combination.
Data are expressed as the fold induction of luciferase activity
relative to the amount in cells that have been transfected only with
the reporter construct under identical conditions.
p85). Co-expressing a
dominant-interfering construct of Akt/PKB also reduced V12
Ras-dependent induction of E2F. Activated forms of PI
3-kinase and gag-Akt/PKB led to a pronounced response. The PI 3-kinase
response was reduced upon co-expression of dominant-interfering Akt/PKB
indicating that Akt/PKB is the predominant PI 3-kinase effector
required for cell cycle progression; dominant negative Akt/PKB did not
reverse the effects of activated Raf or Rlf. The observation that the
Akt/PKB-mediated increase in E2F activity could be largely suppressed
by co-expression of cdk inhibitor p16 suggests that PI 3-kinase acts by
up-regulating cyclin D1 to affect E2F.
View larger version (47K):
[in a new window]
Fig. 6.
E2F transcriptional activity is elevated by
Ras signaling pathways. Regulation of E2F activity was analyzed by
transfection of a reporter containing the adenovirus E2 promoter E2F
binding site along with various Ras effectors into NIH 3T3 cells.
Reporter activity was analyzed 24-36 h after transfection. Data are
expressed as the fold induction of luciferase activity relative to the
amount in cells that have been transfected only with the reporter
construct under identical conditions.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
catalytic subunit
(p110), both induce cyclin D1 transcription at least as
efficiently as does Raf. Furthermore, some combinations of effectors,
especially those involving PI 3-kinase, appear to act synergistically.
It is therefore likely that transcription of the cyclin D1
gene can be induced via a number of different pathways downstream of
Ras and that high efficiency induction, particularly in response to
physiological stimuli, may require the function of more than one
pathway, with PI 3-kinase possibly being particularly important.
to stabilize cyclin D1 protein (38).
ACKNOWLEDGEMENTS
FOOTNOTES
Supported in part by an International Human Frontier Science
Program Organization long-term fellowship. Current address: Dept. of
Cardiovascular Biology, Genentech Inc., 460 Point San Bruno Blvd.,
South San Francisco, CA 94080.
ABBREVIATIONS
REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
1.
Cai, H.,
Szeberenyi, J.,
and Cooper, G. M.
(1990)
Mol. Cell. Biol.
10,
5314-5323 2.
Feig, L. A.,
and Cooper, G. M.
(1988)
Mol. Cell. Biol.
8,
3235-3243 3.
Mulcahy, L. S.,
Smith, M. R.,
and Stacey, D. W.
(1985)
Nature
313,
241-243[CrossRef][Medline]
[Order article via Infotrieve]
4.
Downward, J.
(1997)
Curr. Biol.
7,
258-260
5.
Herman, P. K.,
and Rine, J.
(1997)
EMBO J.
16,
6171-6181[CrossRef][Medline]
[Order article via Infotrieve]
6.
Dobrowolski, S.,
Harter, M.,
and Stacey, D. W.
(1994)
Mol. Cell. Biol.
14,
5441-5449 7.
Aktas, H.,
Cai, H.,
and Cooper, G. M.
(1997)
Mol. Cell. Biol.
17,
3850-3857[Abstract]
8.
Liu, J. J.,
Chao, J. R.,
Jiang, M. C.,
Ng, S. Y.,
Yen, J. J.,
and Yang-Yen, H. F.
(1995)
Mol. Cell. Biol.
15,
3654-3663[Abstract]
9.
Serrano, M.,
Lin, A. W.,
McCurrach, M. E.,
Beach, D.,
and Lowe, S. W.
(1997)
Cell
88,
593-602[CrossRef][Medline]
[Order article via Infotrieve]
10.
Sewing, A.,
Wiseman, B.,
Lloyd, A. C.,
and Land, H.
(1997)
Mol. Cell. Biol.
17,
5588-5597[Abstract]
11.
Woods, D.,
Parry, D.,
Cherwinski, H.,
Bosch, E.,
Lees, E.,
and McMahon, M.
(1997)
Mol. Cell. Biol.
17,
5598-5611[Abstract]
12.
Lloyd, A. C.,
Obermuller, F.,
Staddon, S.,
Barth, C.,
McMahon, M.,
and Land, H.
(1997)
Genes Dev.
11,
663-677 13.
Marshall, C. J.
(1996)
Curr. Opin. Cell Biol.
8,
197-204[CrossRef][Medline]
[Order article via Infotrieve]
14.
White, M. A.,
Nicolette, C.,
Minden, A.,
Polverino, A.,
Van Aelst, L.,
Karin, M.,
and Wigler, M. H.
(1995)
Cell
80,
533-541[CrossRef][Medline]
[Order article via Infotrieve]
15.
Rodriguez-Viciana, P.,
Warne, P. H.,
Khwaja, A.,
Marte, B. M.,
Pappin, D.,
Das, P.,
Waterfield, M. D.,
Ridley, A.,
and Downward, J.
(1997)
Cell
89,
457-467[CrossRef][Medline]
[Order article via Infotrieve]
16.
Filmus, J.,
Robles, A. I.,
Shi, W.,
Wong, M. J.,
Colombo, L. L.,
and Conti, C. J.
(1994)
Oncogene
9,
3627-3633[Medline]
[Order article via Infotrieve]
17.
Winston, J. T.,
Coats, S. R.,
Wang, Y. Z.,
and Pledger, W. J.
(1996)
Oncogene
12,
127-134[Medline]
[Order article via Infotrieve]
18.
Lavoie, J. N.,
L'Allemain, G.,
Brunet, A.,
Müller, R.,
and Pouysségur, J.
(1996)
J. Biol. Chem.
271,
20608-20616 19.
Cheng, M.,
Sexl, V.,
Sherr, C. J.,
and Roussel, M. F.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
1091-1096 20.
Weber, J. D.,
Hu, W.,
Jefcoat, S. C., Jr.,
Raben, D. M.,
and Baldassare, J. J.
(1997)
J. Biol. Chem.
272,
32966-32971 21.
Weber, J. D.,
Raben, D. M.,
Phillips, P. J.,
and Baldassare, J. J.
(1997)
Biochem. J.
326,
61-68
22.
Taylor, S. J.,
and Shalloway, D.
(1996)
Curr. Biol.
6,
1621-1627[CrossRef][Medline]
[Order article via Infotrieve]
23.
Frost, J. A.,
Xu, S.,
Hutchison, M. R.,
Marcus, S.,
and Cobb, M. H.
(1996)
Mol. Cell. Biol.
16,
3707-3713[Abstract]
24.
de Vries-Smits, A. M.,
Pronk, G. J.,
Medema, J. P.,
Burgering, B. M.,
and Bos, J. L.
(1995)
Oncogene
10,
919-925[Medline]
[Order article via Infotrieve]
25.
Marte, B. M.,
Rodriguez-Viciana, P.,
Wennström, S.,
Warne, P. H.,
and Downward, J.
(1997)
Curr. Biol.
7,
63-70[CrossRef][Medline]
[Order article via Infotrieve]
26.
Yao, R.,
and Cooper, G. M.
(1996)
Oncogene
13,
343-351[Medline]
[Order article via Infotrieve]
27.
Alessi, D. R.,
James, S. R.,
Downes, C. P.,
Holmes, A. B.,
Gaffney, P.,
Reece, C.,
and Cohen, P.
(1997)
Curr. Biol.
7,
261-269[CrossRef][Medline]
[Order article via Infotrieve]
28.
Stokoe, D.,
Stephens, L. R.,
Copeland, T.,
Gaffney, P. R.,
Reese, C. B.,
Painter, G. F.,
Holmes, A. B.,
McCormick, F.,
and Hawkins, P. T.
(1997)
Science
277,
567-570 29.
Herber, B.,
Truss, M.,
Beato, M.,
and Muller, R.
(1994)
Oncogene
9,
1295-1304[Medline]
[Order article via Infotrieve]
30.
Westwick, J. K.,
Lambert, Q. T.,
Clark, G. J.,
Symons, M.,
Van Aelst, L.,
Pestell, R. G.,
and Der, C. J.
(1997)
Mol. Cell. Biol.
17,
1324-1335[Abstract]
31.
Murthy, S. C.,
Bhat, G. P.,
and Thimmappaya, B.
(1985)
Proc. Natl. Acad. Sci. U. S. A.
82,
2230-2234 32.
Lin, R.,
Bagrodia, S.,
Cerione, R.,
and Manor, D.
(1997)
Curr. Biol.
7,
794-797[CrossRef][Medline]
[Order article via Infotrieve]
33.
Kerkhoff, E.,
and Rapp, U. R.
(1997)
Mol. Cell. Biol.
17,
2576-2586[Abstract]
34.
Dufourny, B.,
Alblas, J.,
van Teeffelen, H. A.,
van Schaik, F. M.,
van der Burg, B.,
Steenbergh, P. H.,
and Sussenbach, J. S.
(1997)
J. Biol. Chem.
272,
31163-31171 35.
Brunn, G. J.,
Williams, J.,
Sabers, C.,
Wiederrecht, G.,
Lawrence, J. C., Jr.,
and Abraham, R. T.
(1996)
EMBO J.
15,
5256-5267[Medline]
[Order article via Infotrieve]
36.
Hartley, K. O.,
Gell, D.,
Smith, G. C.,
Zhang, H.,
Divecha, N.,
Connelly, M. A.,
Admon, A.,
Lees-Miller, S. P.,
Anderson, C. W.,
and Jackson, S. P.
(1995)
Cell
82,
849-856[CrossRef][Medline]
[Order article via Infotrieve]
37.
Muise-Helmericks, R. C.,
Grimes, H. L.,
Bellacosa, A.,
Malstrom, S. E.,
Tsichlis, P. N.,
and Rosen, N.
(1998)
J. Biol. Chem.
273,
29864-29872 38.
Diehl, J. A.,
Cheng, M.,
Roussel, M. F.,
and Sherr, C. J.
(1998)
Genes Dev.
12,
3499-3511 39.
Downward, J.
(1998)
Science
279,
673-674 40.
Brennan, P.,
Babbage, J. W.,
Burgering, B. M.,
Groner, B.,
Reif, K.,
and Cantrell, D. A.
(1997)
Immunity
7,
679-689[CrossRef][Medline]
[Order article via Infotrieve]
41.
Takuwa, N.,
and Takuwa, Y.
(1997)
Mol. Cell. Biol.
17,
5348-5358[Abstract]
42.
Kawada, M.,
Yamagoe, S.,
Murakami, Y.,
Suzuki, K.,
Mizuno, S.,
and Uehara, Y.
(1997)
Oncogene
15,
629-637[CrossRef][Medline]
[Order article via Infotrieve]
43.
Yang, J. J.,
Kang, J. S.,
and Krauss, R. S.
(1998)
Mol. Cell. Biol.
18,
2586-2595 44.
Klippel, A.,
Escobedo, M. A.,
Wachowicz, M. S.,
Apell, G.,
Brown, T. W.,
Giedlin, M. A.,
Kavanaugh, W. M.,
and Williams, L. T.
(1998)
Mol. Cell. Biol.
18,
5699-5711 45.
Burgering, B. M. T.,
de Vries-Smits, A. M. M.,
Medema, R. H.,
van Weeren, P. C.,
Tertoolen, L. G. J.,
and Bos, J. L.
(1993)
Mol. Cell. Biol.
13,
7248-7256 46.
Sun, H.,
Charles, C. H.,
Lau, L. F.,
and Tonks, N. K.
(1993)
Cell
75,
487-493[CrossRef][Medline]
[Order article via Infotrieve]
47.
Stephens, L. R.,
Jackson, T. R.,
and Hawkins, P. T.
(1993)
Biochim. Biophys. Acta
1179,
27-75[Medline]
[Order article via Infotrieve]
48.
Pardee, A. B.
(1974)
Proc. Natl. Acad. Sci. U. S. A.
71,
1286-1290 49.
Pledger, W. J.,
Stiles, C. D.,
Antoniades, H. N.,
and Scher, C. D.
(1978)
Proc. Natl. Acad. Sci. U. S. A.
75,
2839-2843 50.
Kauffman-Zeh, A.,
Rodriguez-Viciana, P.,
Ulrich, E.,
Gilbert, C.,
Coffer, P.,
Downward, J.,
and Evan, G.
(1997)
Nature
385,
544-548[CrossRef][Medline]
[Order article via Infotrieve]
51.
Downward, J.
(1998)
Curr. Opin. Genet. Dev.
8,
49-54[CrossRef][Medline]
[Order article via Infotrieve]
52.
Wolthuis, R. M.,
de Ruiter, N. D.,
Cool, R. H.,
and Bos, J. L.
(1997)
EMBO J.
16,
6748-6761[CrossRef][Medline]
[Order article via Infotrieve]
53.
Urano, T.,
Emkey, R.,
and Feig, L. A.
(1996)
EMBO J.
15,
810-816[Medline]
[Order article via Infotrieve]
54.
Burgering, B. M. T.,
and Coffer, P. J.
(1995)
Nature
376,
599-602[CrossRef][Medline]
[Order article via Infotrieve]
55.
van Weeren, P. C.,
de Bruyn, K. M.,
de Vries-Smits, A. M.,
van Lint, J.,
and Burgering, B. M.
(1998)
J. Biol. Chem.
273,
13150-13156 56.
Herrmann, C.,
Martin, G. A.,
and Wittinghofer, A.
(1995)
J. Biol. Chem.
270,
2901-2905
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  T. Bachleitner-Hofmann, M. Y. Sun, C.-T. Chen, L. Tang, L. Song, Z. Zeng, M. Shah, J. G. Christensen, N. Rosen, D. B. Solit, et al. HER kinase activation confers resistance to MET tyrosine kinase inhibition in MET oncogene-addicted gastric cancer cells Mol. Cancer Ther., November 1, 2008; 7(11): 3499 - 3508. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Inoue-Narita, K. Hamada, T. Sasaki, S. Hatakeyama, S. Fujita, K. Kawahara, M. Sasaki, H. Kishimoto, S. Eguchi, I. Kojima, et al. Pten Deficiency in Melanocytes Results in Resistance to Hair Graying and Susceptibility to Carcinogen-Induced Melanomagenesis Cancer Res., July 15, 2008; 68(14): 5760 - 5768. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Toualbi-Abed, F. Daniel, M. C. Guller, A. Legrand, J.-L. Mauriz, A. Mauviel, and D. Bernuau Jun D cooperates with p65 to activate the proximal {kappa}B site of the cyclin D1 promoter: role of PI3K/PDK-1 Carcinogenesis, March 1, 2008; 29(3): 536 - 543. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K.-K. Ho, A. A. Anderson, E. Rosivatz, E. W.-F. Lam, R. Woscholski, and D. J. Mann Identification of Cyclin A2 as the Downstream Effector of the Nuclear Phosphatidylinositol 4,5-Bisphosphate Signaling Network J. Biol. Chem., February 29, 2008; 283(9): 5477 - 5485. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. He, J. Jiang, M. Kokkinaki, N. Golestaneh, M.-C. Hofmann, and M. Dym Gdnf Upregulates c-Fos Transcription via the Ras/Erk1/2 Pathway to Promote Mouse Spermatogonial Stem Cell Proliferation Stem Cells, January 1, 2008; 26(1): 266 - 278. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 |
