HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Phillips, B. W. Articles by Edwards, D. R. Search for Related Content PubMed PubMed Citation Articles by Phillips, B. W. Articles by Edwards, D. R. Social Bookmarking                      What's this?

J Biol Chem, Vol. 274, Issue 32, 22197-22207, August 6, 1999

A Sequence-selective Single-strand DNA-binding Protein Regulates Basal Transcription of the Murine Tissue Inhibitor of Metalloproteinases-1 (Timp-1) Gene^*

Blaine W. Phillips^§, Renuka Sharma, Pamela A. Leco, and Dylan R. Edwards^¶

From the  Department of Medical Biochemistry, University of Calgary, Calgary T2N 4N1, Canada

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Tissue inhibitor of metalloproteinases-1 (TIMP-1) is important in maintaining the extracellular proteolytic balance during tissue remodeling processes. To allow homeostatic tissue turnover, the murine Timp-1 gene is expressed by most cells at a low basal level, and during acute remodeling its transcription is activated by a variety of stimuli. A non-consensus AP-1-binding site (5'-TGAGTAA-3') that is conserved in mammalian timp-1 genes is a critical element in basal and serum-stimulated transcription. We show here that each strand of this unusual AP-1 site binds a distinct single-stranded DNA-binding protein, although neither strand from a perfect consensus AP-1 site from the human collagenase gene shows similar binding. One of the single-strand binding factors, which we term ssT1, binds to a second upstream Timp-1 region between nucleotides 115 and 100. Deletion analysis demonstrated that this region is important in basal but not serum-inducible transcription. The ssT1 factor was 52-54 kDa by UV cross-linking of electrophoretic mobility shift assays and Southwestern blot analysis. Its binding to DNA shows sequence selectivity rather than specificity, with 5'-CT/ATTN_(4-6)ATC-3' as a favored motif. Multiple ssT1-like activities were found in nuclear extracts from mouse fibroblasts and rat liver and testis, suggesting that these factors may regulate basal Timp-1 transcription in a tissue-specific fashion.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Extracellular matrix turnover is highly regulated at multiple levels, a critical one being the balance between the levels of matrix metalloproteinases (MMPs)¹ and their specific inhibitors, the TIMPs (tissue inhibitors of metalloproteinases (1, 2)). The TIMP family includes four members, designated TIMP-1, -2, -3, and -4, each of which can inactivate the active forms of MMPs by formation of a tight 1:1 non-covalent complex (3). Although the TIMPs are largely interchangeable in their MMP-inhibitory abilities, it has become clear that they have certain properties that are specific to particular family members, supporting the idea that they have unique as well as shared physiological roles. For instance, compared with TIMP-2, -3, and -4, TIMP-1 is a poor inhibitor of the membrane-type MMP group of MMPs, several of which function as cell surface activators of progelatinase-A (MMP-2 (4-7)). TIMP-1 also stands out in its ability to form a complex with pro-gelatinase-B (MMP-9) (8), through which it regulates the rate of pro-MMP-9 activation (9, 10). Finally, TIMPs show highly individual patterns of expression in vivo and in vitro (2, 11), indicating that the use of a particular TIMP may be advantageous in certain tissue remodeling situations.

Of the four timp genes, timp-1 and -3 are both highly inducible in diverse cell types in vitro, in response to stimuli such as serum, phorbol ester, and transforming growth factor- (12-14), whereas timp-2 expression remains largely constitutive under most stimulatory conditions (15). In the developing mouse embryo, strong expression of Timp-1 is restricted to sites where extensive tissue remodeling is occurring, particularly at sites of osteogenesis in the limbs, digits, ribs, vertebrae, and skull (16, 17). Tight spatio-temporal control of expression is also seen in the adult ovary and uterus during pregnancy under the influence of paracrine and endocrine factors (18). However, many tissues express Timp-1 at a low basal level that can only be detected by sensitive techniques such as ribonuclease protection assay, possible reflecting a tissue maintenance function (16).

Previous work from several laboratories has shown that expression of Timp-1 is controlled principally at the level of transcription (19, 20) which therefore dictates that a detailed analysis of its transcriptional regulation be performed. The timp-1 genes from mouse, rat, and human have been cloned and their promoter and regulatory regions analyzed (19, 21-24). In several characteristics Timp-1 resembles a housekeeping gene, including the absence of a canonical TATA box, the presence of Sp1 sites, and multiple transcription start sites (25-28). Additionally, the promoter proximal region contains several cis-acting regulatory elements that have been shown to be important for conveying transcriptional induction in response to stimuli. Most notable is a highly conserved region that has an AP1-(activator protein-1) binding motif in close proximity to a PEA3/Ets domain, an arrangement found in many other AP1-responsive genes (29). Several laboratories have demonstrated the importance of both of these regions, but clearly, the AP1 element is the principal site for conferring stimulatory responses following serum stimulation in vitro (27-29). Interestingly, the AP1-binding site is a non-consensus form (5'-TGAGTAA-3') that differs by a single base from the consensus AP1-binding motif (5'-TGAGTCA-3') found in most AP-1-responsive genes, including inducible MMPs such as human collagenase (mmp-1), stromelysin-1 (mmp-3), and gelatinase-B (mmp-9) (30, 31). We previously showed by electrophoretic mobility shift assay that in addition to the ability of the Timp-1 59/53 AP-1 site to bind complexes containing Fos and Jun proteins, other proteins could bind that showed no affinity for the consensus collagenase AP-1 sequence (otherwise known as the 12-O-tetradecanoylphorbol-13-acetate-responsive element) (28).

We therefore undertook a more detailed investigation of the characteristics of the Timp-1 AP-1 site, in conjunction with a search for further important regulatory elements in the promoter proximal zone of the gene. We report here that single-strand versions of the Timp-1 AP-1 site bind distinct nuclear factors and that the consensus AP-1-binding site does not share this ability. Furthermore, similar single-strand DNA binding activity is also seen at a site further upstream, at 115/100. These interactions affect the basal expression of Timp-1, rather than its induction in response to serum stimulation. We speculate that these promoter-interacting single-stranded DNA-binding proteins may be significant factors in the dual housekeeping/inducible behavior of Timp-1 and other genes.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Cell Culture-- Murine fibroblast C3H10T1/2 cells were cultured in Dulbecco's modified Eagle's medium/Ham's F12 (DMEM/F12) containing 10% fetal bovine serum (FBS, Life Technologies, Inc.). Whereas antibiotics were added for experimental procedures (1% antibiotic/antimycotic, Life Technologies, Inc.), routine maintenance of cells was done free of antibiotics.

Transient Transfection Analysis of mTIMP-1 Luciferase and CAT Reporter Constructs-- All transient transfections were performed by the Chen and Okayama (32) procedure essentially as described previously (28). Briefly, cells were plated at a density of 5 × 10⁵ cells/ml and grown overnight in DMEM/F12 containing 10% FBS. To transfect the cells, 20 µg of plasmid was brought up to 900 µl of final volume in TE, followed by the addition of 100 µl of CaCl₂ (2.5 M). The mixture was then added dropwise to 1 ml of 2× BES-buffered saline (50 mM BES, 280 mM NaCl, 1.5 mM Na₂HPO₄) with constant vortexing, which enables the formation of DNA-calcium phosphate precipitates. Precipitation proceeded for exactly 20 min, and 1 ml of the mixture was added dropwise to each of two plates of cells. The cells were incubated for 18 h at 37 °C in an atmosphere of 97% (v/v) air, 3% (v/v) CO₂. After the transfection, the medium was exchanged for fresh DMEM/F12 containing 10% FBS medium, and the culture dishes were returned to 95% (v/v) air, 5% CO₂ for 8 h. The medium was then exchanged for serum-free DMEM/F12 overnight. The cells were stimulated for 24 h with serum as described above or given fresh serum-free media for basal conditions. Following stimulation, cell extracts were collected by harvesting with reporter lysis buffer as per manufacturer's instructions (Promega).

Luciferase reporter assays were performed using the luciferase assay system according to manufacturer's instruction (Promega, Madison, WI). Briefly, 20 µl of cell lysate was mixed with 100 µl of luciferase assay reagent, and then light emission was immediately measured on a luminometer (TD-20, Promega, Madison WI). Luciferase transfections were standardized to CAT activity by cotransfection with a cytomegalovirus promoter-driven CAT construct (CMV-CAT).

CAT assays were performed using standard methodology previously described (28). First, 20 µg of protein extract was incubated for 10 min at 37 °C with [¹⁴C]chloramphenicol (0.0002 µCi) in Tris-HCl (pH 7.5), in a final volume of 100 µl. Next, 20 µl of 4 mM acetyl coenzyme A was added and incubated for 1 h at 37 °C. The reaction was terminated by extraction with 900 µl of ethyl acetate. The sample was then lyophilized, resuspended in 20 µl of ethyl acetate, and spotted onto a thin layer chromatography plate. Chromatography was performed in an atmosphere containing 95% chloroform, 5% methanol. Finally, the plates are exposed onto x-ray film (Eastman Kodak Co.).

All transfections were standardized with the Hirt's assay for DNA input as described (33). Nuclear pellets (remaining from the cell lysate extraction) were lysed in 0.5 ml of Hirt's solution (0.6% SDS, 10 mM Tris-HCl (pH 7.5), 10 mM EDTA) for 10 min at room temperature. This was followed by the addition of 60 µl of 5 M NaCl and 20 µl of proteinase K (10 mg/ml), which was then incubated for 3 h at 37 °C. After the protease digestion, the mixture was centrifuged for 5 min at 12,000 rpm, and the supernatant was retained and extracted with 1:1 phenol:chloroform. The samples were then prepared for slot-blot transfer by mixing 50 µl of supernatant with 16.7 µl of 1 M HCl for 5 min to denature, followed by the addition of 117 µl of neutralization solution (0.9 M NaOH, 2.25 M NaCl) for 15 min. The volume was increased to 510 µl with buffer (1.4 M Tris-HCl (pH 7.0), 1.5 M NaCl) and then loaded onto a slot-blot manifold for transfer onto duralon-UV membranes (Stratagene, La Jolla, CA). Following transfer, the samples were fixed by UV cross-linking, hybridized to specific probes (pBLCAT3 or pGL2-basic), and exposed to x-ray film (Kodak). Intensity of signal (measured densitometrically) was then used to standardize the reporter expression to amount of input plasmid.

Constructs-- Inserts for a deletion series of the Timp-1 promoter were generated by the polymerase chain reaction (PCR) using standard protocols with the primers shown in Table I. The constructs, corresponding to 223/+47, 195/+47, 180/+47, 165/+47, 140/+47, 125/+47, and 95/+47, contain 5' XhoI and 3' SacI restriction sites, which enabled directional cloning into the luciferase reporter plasmid, pGL2-basic (Promega).

The 223/+47 CAT constructs (coll.AP1, mutAP1, and mutPEA3) were created using a two-step PCR mutagenesis strategy utilizing the WT 223/+47 construct (in pBluescript) described previously (28) as a template. The first step involves two separate reactions, using sense and antisense primers incorporating specific mutations from the wild-type sequence (Table I) and either T3 or T7 primers. In this manner, T3 and the appropriate antisense primer amplified the upstream half of the fragment (containing the mutation) and T7 and the corresponding sense primer amplified the downstream half. The products were then mixed and used as a template for the second round of PCR, using T3 and T7 only as primers. Full-length constructs will only be amplified if the upstream and downstream halves anneal, thereby generating the mutant constructs. Following PCR, the fragments were digested with HindIII/Sau3A and cloned into pBLCAT3. The constructs were verified by sequencing.

The 115/+47 constructs (WT, coll.AP1 and mutAP1) were produced by PCR using the templates described above for mutant and coll.AP1. In the case where the ssT1 was mutated, the primer contained specific sequence changes to amplify a mutant product (Mut1; see Table I). The PCR fragments were then restricted with HindIII/BamHI and cloned into linearized pBLCAT3.

Oligonucleotides-- Oligonucleotides for electromobility shift assays (EMSAs) and Southwestern blotting were synthesized by the UCDNA synthesis laboratory (University of Calgary, Canada) (Tables I and II). If annealing of the DNA was required to produce double-stranded probes, equimolar amounts of sense and antisense strands were diluted to 1 µg/µl in 10 mM Tris-HCl (pH 8.0), 100 mM NaCl and heated to 95 °C. To facilitate annealing, the oligonucleotides were allowed to cool slowly to 4 °C.

Probes-- Single-stranded probes were generated by adding 60 ng of oligonucleotide to a modified T4-polynucleotide kinase (PNK) buffer (0.5 M Tris-HCl (pH 7.6), 0.1 M MgCl₂, 10 mM DTT, 10 mM EDTA, 25% polyethylene glycol, w/v) with 1 µl of [-³²P]ATP, and 5 units of T4-PNK. Reactions were incubated at 37 °C for 30 min and then stopped with 50 µl of 25 mM EDTA. The probes were purified by phenol/chloroform extraction, and unincorporated dNTPs were removed using G-50 spun columns. Duplex fill-in probes were generated by adding 60 ng of annealed oligonucleotide to 0.5 mM dATP, dGTP, dTT, 20 µCi of [-³²P]dCTP (10 mCi/ml), 1× REACT buffer 2 (Life Technologies, Inc.), 0.5 units of large fragment of DNA polymerase I. Reactions were incubated at 15 °C for 15 min and then terminated by phenol/chloroform extraction. Unincorporated dNTPs were removed by running the reaction through a G-50 column.

Nuclear Extract Preparation-- A total of 2 × 10⁷ 10T1/2 cells (either unstimulated or serum-stimulated for 30 min or 3 h) were scraped in 1 ml of phosphate-buffered saline, 0.1% Nonidet P-40. After a brief centrifugation (10 s, 12,000 rpm), the cells were decanted and rinsed in phosphate-buffered saline, 0.1% Nonidet P-40. Cells were visually inspected for lysis, centrifuged briefly again, and the supernatant aspirated. The nuclear pellet was then resuspended in 3 volumes of high salt buffer (25 mM HEPES (pH 7.8), 500 mM KCl, 0.5 mM MgSO₄, and 1 mM DTT) with protease inhibitors (0.1 mg/ml leupeptin, 0.1 mg/ml phenylmethylsulfonyl fluoride, 0.1 mg/ml aprotinin) and extracted on ice for 20 min. Extracts were centrifuged at 12,000 rpm for 2 min (4 °C), and the supernatant was transferred to a new tube. The protein concentration of the nuclear extract was determined by Bradford assay using the Bio-Rad assay kit (Bio-Rad) following the manufacturer's directions.

Electrophoretic Mobility Shift Assay-- Radiolabeled probe (40,000 cpm) was incubated with 4 µg of 10T1/2 cell nuclear extract in 1× binding buffer (10 mM Tris-HCl (pH 7.5), 50 mM NaCl, 0.5 mM DTT, 5 mM MgCl₂, and 5% (v/v) glycerol) in the presence of nonspecific competitors (0.5 µg of Sau3A cut pBluescript plasmid and 0.5 µg of poly(dI-dC)·(dI-dC) (Amersham Pharmacia Biotech)), with a final reaction volume of 20 µl. The binding reaction was electrophoresed on a 7% polyacrylamide gel (38:2 acrylamide:bisacrylamide) in 1× TBE buffer (90 mM Tris-HCl, 90 mM boric acid, 2 mM EDTA) which had been prerun for at least 30 min at 4 °C. The gels were run for 1.5 h at 10 V/cm² at 4 °C to retain the stability of the protein-DNA complexes. Completed gels were dried onto Whatman 3M paper (Bio-Rad, model 583 gel dryer) and exposed to x-ray film (Kodak Biomax).

Southwestern Blotting-- Nuclear extracts (30 µg) were loaded onto a 10% SDS-polyacrylamide gel electrophoresis mini-gel (Bio-Rad) in an equal volume of loading buffer (5% SDS, 5 mM Tris-HCl (pH 6.8), 200 mM DTT, 20% (v/v) glycerol, 0.25% bromphenol blue), using a lane of pre-stained molecular weight markers as a standard (Life Technologies, Inc.). The samples were then transferred to nitrocellulose (Bio-Rad transblot transfer medium) using the mini-trans-blot electrophoretic transfer cell (Bio-Rad) as per manufacturer's directions. The blot was blocked for 1 h at 4 °C in Blotto (50 mM Tris-HCl (pH 7.5), 50 mM NaCl, 1 mM EDTA, 1 mM DTT, 5% skim milk powder) with gentle agitation, followed by soaking overnight at 4 °C in binding buffer (25 mM NaCl, 10 mM Tris-HCl (pH 7.5), 10 mM MgCl₂, 5 mM EDTA, 1 mM DTT). The next day, the samples were soaked in binding buffer with single-stranded, end-labeled probe (100,000 cpm/ml) for 6 h to overnight at 4 °C. Following the probing, the blots were rinsed 4 times in binding buffer for 8 min at 4 °C and air-dried. The washed blots were then exposed to Biomax x-ray film (Kodak).

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

The Unusual 59/53 AP1-binding Site Is the Key Regulatory Element in the Timp-1 Promoter Proximal Region-- We showed previously that the 5'-TGAGTAA-3' motif at 59/53 in the Timp-1 promoter was able to bind AP-1 and activate transcription from a linked promoter (28). Subsequent studies have confirmed the importance of this site in both the human and mouse promoters (29, 34, 35). However, we found that this sequence was able to associate with additional proteins besides Fos/Jun AP-1, which were unable to bind to a consensus collagenase AP-1 site (5'-TGAGTCA-3'), and we speculated that this unusual AP1-binding site might convey additional properties to the Timp-1 promoter (28). To test the involvement of the 59/53 AP-1 site in promoter activity, we incorporated point mutations that either convert the site to a consensus AP1 motif (coll.AP1), or render it non-functional (mut AP1). In addition we introduced an inactivating mutation into the neighboring PEA3/Ets-binding site (Fig. 1). Transient transfection assays were carried out using CAT reporter plasmids carrying these alternative versions of the 223/+47 region of the Timp-1 promoter. The mutAP1 construct confirmed that a functional AP1-binding motif is essential for maximal basal and serum-inducible gene expression. In contrast, mutation of the PEA3/Ets site led to a more modest reduction of activity, to about 60% of the maximum observed with the wild-type promoter. Fig. 1 also shows that the unusual Timp-1 AP1 and the consensus AP1 sites have equivalent abilities to drive both basal and serum-stimulated expression of CAT in the context of the 223/+47 region.

View larger version (25K): [in this window] [in a new window]   Fig. 1.   Mutational analysis of the Timp-1 AP1-binding site. The 223/+47 Timp-1 promoter containing the unusual AP1-binding site (WT) was mutated either to convert the AP1 motif to a consensus collagenase AP1-binding site (coll.AP1) or to be unable to interact with AP1 (mutAP1) as indicated in A. The PEA3 site was also mutated (mutPEA3). B shows results of transient transfection analysis of the constructs in C3H10T1/2 fibroblasts. Cells were either stimulated or left unstimulated 24 h prior to harvesting lysates. CAT activities are expressed relative to the ability of the WT Timp-1 promoter in unstimulated cells. Values plotted are the means of 5 separate experiments with the error bars representing the standard deviation.

A Single-stranded Binding Protein Interacts with the Timp-1 Promoter AP-1 Region-- We examined in more detail the nature of the nuclear factors that are able to interact with the 59/53 AP1 and the collagenase AP1 sites. We performed electrophoretic mobility shift assays (EMSA) using an annealed, PNK-labeled double-stranded probe corresponding to sequences from 63 to 49 (Fig. 2). It is important to note that this procedure may produce a mixed population of single- and double-stranded probes if one of the oligonucleotides is present in slight excess over its partner. Two complexes were resolved using 7% polyacrylamide gels. A slow migrating complex labeled A was competed by both unlabeled 63/49 Timp-1 and collagenase AP1 sequences (lanes 3 and 4). Band A was also supershifted when anti-Fos or anti-Jun antibodies were added to the binding reactions (data not shown). These data identify shift A as AP1 bound to the 63/49 probe, confirming our previous data and other reports (28, 29). However, in addition to AP1 binding activity, 63/49 also demonstrated additional specific binding properties (band B) that were not competed by the collagenase AP1 (lane 4). Unlabeled single-stranded 63/49 sequences were effective competitors of complex B formation (lanes 7 and 8). The AP1 shift was not competed by single-stranded 63/49 oligonucleotides, and single-stranded collagenase AP1 cold competitors (top or bottom strands) were unable to compete complexes A or B. These data demonstrate that complex B represents the interaction of a nuclear factor that is not AP1 with the individual strands of the 63/49 region and that this interaction is specific since it could not be competed by a closely related perfect consensus AP1 motif.

View larger version (42K): [in this window] [in a new window]   Fig. 2.   A single-stranded binding protein interacts with the Timp-1 AP1-binding site. A, electrophoretic mobility shift assays were performed on C3H10T1/2 nuclear extracts using an annealed PNK-labeled probe that contains the Timp-1 AP1-binding site. End labeling in this way generates both double-stranded and single-stranded probe. Lane 1, no nuclear extract; lane 2, nuclear extract without added competitor DNA; lanes 3-11, extract plus the indicated single- or double-stranded competitors. In lane 2, two complexes were seen, labeled A and B. As discussed under "Results," complex A corresponds to AP1 and complex B to the interaction of single-stranded 63/49 oligonucleotides with a nuclear factor. A further indication of single-stranded DNA-protein interactions was shown by labeling single-stranded probes for EMSA (B). Top or bottom strands of both 63/49 and the corresponding strands from the collagenase consensus AP1-binding site were labeled and used for EMSA with nuclear extracts from 10T1/2 cells, showing two distinct bands, B and B'. These bands were resolved more compared with A by longer electrophoresis.

To examine whether the complex B shift was attributable to one of the oligonucleotides that comprise the 63/49 probe (i.e. the top or bottom strands), we carried out EMSAs using each labeled oligonucleotide separately, as well as corresponding sequences from the collagenase AP1 (Fig. 2B). The samples were electrophoresed longer for greater resolution of the bands. Both Timp-1 63/49 strands were able to complex with nuclear factors, generating bands with slightly different mobilities that are labeled as B and B' for the top and bottom strand probes, respectively. The corresponding single strands of the collagenase AP1 sequence did not interact with anything in the nuclear extracts. We were unable to carry out competition assays to determine whether both top and bottom 69/43 strands interact with the same protein, since an excess of the complementary strand generated double-stranded DNA, which does not bind the single strand-specific nuclear factor, as will be shown later in Fig. 5. However, other data to be discussed argue that the B and B' complexes involve different nuclear factors.

A Positive Regulatory Element That Affects Basal Timp-1 Transcription Is Located between 125/95-- Whereas the above studies were ongoing, we also aimed to refine the analysis of regulatory elements in the promoter proximal region, since our previous studies had shown that additional positive acting elements must reside within the 223/+47 promoter used in Fig. 1 (28). Constructs with alternative 5'-end points were generated by PCR and subcloned into the luciferase reporter plasmid, pGL2-basic, and then used in transient transfection analyses (Fig. 3). The shortest construct (95/+47) showed an approximate 4-fold reduction in both basal and serum-stimulated expression compared with the longest (223/+47). The principal positive regulatory region was located between 125/95, as its inclusion resulted in a 3-fold increase in luciferase expression in both basal and serum-induced conditions. Since the fold increase from basal to serum-stimulated conditions remained essentially unchanged with inclusion of sequences upstream from 95, we conclude that the primary effect of these sequences is at the level of basal (unstimulated) expression. A minor but consistent increase in serum-stimulated expression from sequences between 223/195 suggests the actions of an additional inducible transcription factor in this region, but these have not been followed up at this time.

View larger version (20K): [in this window] [in a new window]   Fig. 3.   Deletion analysis of the Timp-1 promoter region. Deletions spanning 223 and 95 were produced by the polymerase chain reaction, and the resulting fragments were cloned into pGL2-basic luciferase reporter plasmid (Promega). Following transfection of the deletion constructs, nuclear extracts were prepared from C3H10T1/2 cells cultured in serum-free media (unstimulated) and cells that were serum-stimulated for 24 h. Luciferase reporter activity for each trial was standardized for sample-sample variation by measuring the input DNA using the Hirt's assay (as described under "Methods and Materials"). The graph shows relative activity, with the largest value displayed by the 123/+47 construct in serum-stimulated cells, designated as 1.

A Single-stranded DNA-binding Protein Interacts with the Timp-1 Promoter at 115/100-- To investigate the nature of the nuclear factors able to interact with the 125/95 region, a series of probes were made to obtain a detailed EMSA analysis (Fig. 4A). Protein-DNA interactions were observed with the 115/100 probe in addition to the full-length 125/95 probe (lanes 2 and 4). However, no shift was detected for probes corresponding to either the 123/110 or 108/92 regions (lanes 3 and 5). Three bands were seen with the 125/95 probe, although only a single shift was seen for the 115/100, suggesting that the 115/100 region contains a critical binding site for a nuclear factor, but flanking sequences may also influence the nature of the complex that is formed. With this preparation of PNK-labeled 63/49 probe, we observed three bands migrating in the position of the B/B' complexes seen with individual top and bottom 63/49 single-stranded probes in Fig. 2B. The number and intensities of these bands labeled B/B' were somewhat variable with different experiments and nuclear extracts (see also Fig. 5A). The data shown in Fig. 4 were obtained with a nuclear extract from C3H 10T1/2 cells stimulated for 30 min with serum, but there were no qualitative or quantitative changes in band patterns with extracts from unstimulated or 3-h serum-stimulated cells.

View larger version (71K): [in this window] [in a new window]   Fig. 4.   Single-stranded DNA binding factors interact with the Timp-1 promoter at two different locations. Protein-DNA interactions were assayed by EMSA under two conditions as follows: a polynucleotide kinase end-labeled mixed strand (single- and double-stranded) probe population (A) and a Klenow-labeled, double-strand probe (B). Nuclear extracts from C3H10T1/2 cells that had been serum-stimulated for 30 min were used for assays with probes corresponding to 63/49, 125/95, 123/110, 115/100, and 108/92 of the Timp-1 promoter and the consensus AP1 site (coll.AP1). The "B" complex seen previously from the 63/49 probe in Fig. 2 migrated as several bands that are indicated by the bracket in A. The B bands for the 63/49 probe were greatly diminished when the Klenow-labeled probe (B) was used. This was also the case for co-migrating bands seen with PNK-labeled 125/95 and 115/100 (compare A and B).

View larger version (90K): [in this window] [in a new window]   Fig. 5.   Two regions of the Timp-1 promoter, 115/100-top, and 63/49-bottom cross-compete for the same single-stranded DNA binding factor. Single-stranded probes corresponding to the 125/95, 115/100, 63/49, and collagenase AP1-binding site were used for EMSA analysis with C3H10T1/2 cell nuclear extracts (A). Complexes were formed with the 125/95 top and 115/100-top and both strands of the 63/49 region. B, the 115/100-top strand was labeled and used in EMSA with the indicated unlabeled competitor oligonucleotides (100× molar excess).

Since the experiment in Fig. 4A was performed with annealed, PNK-labeled, oligonucleotides that may contain both double-stranded and single-stranded forms (as in Fig. 2), we also carried out an analysis with Klenow-labeled double-stranded probes. The Klenow-labeled, double-stranded 115/100 and 125/95 probes were greatly impaired in their ability to interact with DNA-binding proteins compared with the PNK-labeled probes (Fig. 4B; compare lanes 2 with 7, and 4 with 8). This reduction paralleled the diminished representation of the B/B' shifts seen when the Klenow-labeled 63/49 Timp-1 AP1 probe (Fig. 4B, lane 9) was compared with the same probe labeled with PNK (Fig. 4A, lane 1). These data suggested that as is the case for the B/B' shifts with the 63/49 probes, a single-stranded DNA-binding protein may interact with the 115/100 mTIMP-1 promoter region.

Both 115/100 and 63/49 Promoter Regions Interact with the Same Single-stranded DNA-binding Protein-- We carried out EMSA with single-stranded PNK-labeled probes from the 125/95 region (Fig. 5). Single-stranded probes corresponding to 125/95, 115/100, and 63/49 all show complex patterns of protein interactions (Fig. 5A). Strong shifts were obtained with both the 125/95-top and 115/100-top oligonucleotides but not with corresponding bottom strands (lanes 1-4). No shifts were seen with either top or bottom strands from the 123/110 and 108/92 sequences (data not shown). In contrast, both top and bottom 63/49 strands were able to interact with nuclear proteins, giving B/B' shifts as in Fig. 2. Since all of the probes used had the same additional nucleotides added at the 5'-ends to generate restriction enzyme cloning sites (5'-AGCTT- for the "top" strand probes and 5'-GATCC- for the "bottom"), we also generated and tested additional single-stranded probes lacking these sequences. These probes gave the same results as those shown in Fig. 5 (data not shown), confirming that the sequence-specific DNA binding that we had observed was attributable to the indicated Timp-1 sequences alone.

In order to determine the specificity of the protein-DNA interactions the 115/100-top probe was used for EMSA in competition with various unlabeled oligonucleotides (Fig. 5B). The top strand of 115/100 was competed effectively by 115/100-top and 125/95-top (lanes 10 and 12), demonstrating specificity of the complex. Surprisingly, competition between the 63/49-bottom strand and the 115/100-top strand was also seen (lane 15), although the top strand 63/49 did not compete (lane 14). This competition from the 63/49-bottom strand implies that the B' shift obtained with the 63/49 probe likely involves the same protein that interacts with the 115/100 region or a closely related protein. Moreover, it indicates that the B and B' shifts seen with the 63/49-top and -bottom strands involve different nuclear factors.

The bottom strands of either 125/95 or 115/100 were also effective "competitors" of the 115/100-top shift, but this is misleading. The bottom strand would anneal to the probe to form duplex DNA, which we had established in Fig. 4 has relatively poor binding to the single-stranded DNA binding factor. Such annealing is seen in a slower migration of the free probe at the bottom of the EMSA gel in Fig. 5B in the lanes with either 125/95-bottom or 115/100-bottom as cold competitor. Neither the 63/49-top nor either of the coll.AP1 strands competed for the same nuclear factors that bind to the 115/100-top probe (lanes 14, 16, and 17).

These data establish that a nuclear single-stranded DNA binding factor, hereafter called ssT1, that is unrelated to AP1 interacts with both the 63/49 AP1-bottom and the 115/100-top sequences.

The Single-stranded DNA-binding Protein Shows Relaxed Specificity-- The sequence of 115/100-top is 5'-agcttATCTTTGGGTTTATC-3' and 63/49-bottom is 5'-gatccGCATTACTCATCCA3-'. There is minimal similarity between these sequences, the two commonalities being 5'-C(T/A)TT motif and a 5'-ATC sequence toward the 3'-side. This prompted us to analyze further the specificity of the sequences in which the protein binds. Mutations were produced in which the first 8 bases of the 115/100-top sequence were replaced with the first 8 bases of the consensus coll.AP1-top sequence that was shown earlier to not bind to ssT1 (2B) (mutant 1). Similarly, the last 8 bases of the 115/100 were replaced with the last bases of the coll.AP1-top (mutant 2). Both single-stranded mutants were labeled and used as probes for EMSA (6B-left) and also used as cold competitors against the wild-type 115/100-top probe (6B-right). When end-labeled and used to probe nuclear extracts, both mutants were impaired in their interaction with ssT1 compared with the wild-type sequence. However, disruption of the upstream 7 bases (mut1) had a far greater effect, greatly reducing complex formation compared with mut2. This observation is mimicked by cold competition experiments, where both mut1 and mut2 were not as effective a competitor as wild-type sequences, with mut2 being a slightly better competitor compared with mut1. These results show that both halves of the 115/100 sequence contribute to protein-DNA interaction, with a greater contribution of the upstream half.

We also tested competitor oligonucleotides in which 3 bases at a time in the 115/100-top sequence were varied. Quantification of the abilities of these DNAs to compete with the wild-type sequence in EMSA is shown in Fig. 6C. None of these mutations completely eliminated competition ability, although disruption of the 5'-CTT at 113/111 as well as the 5'-ATC at 102/100 were the most deleterious. These data suggest that both of these sequences may contribute to the ssT1 showing sequence selectivity for a consensus 5'-CA/TTTN_4-6ATC motif. The data also indicate that there are likely many sequences that will interact with the ssT1 nuclear factor.

View larger version (38K): [in this window] [in a new window]   Fig. 6.   The single-stranded DNA-binding protein displays sequence selectivity. The specificity of interaction of the nuclear factors with the 115/100-top probe was characterized by EMSA using various competitor oligonucleotides (listed in A). B, fusion oligonucleotides were made combining the 5'-half of the collagenase AP1-binding site to the 3'-half of the 115/100-top binding sequence (mut1) or the 5'-half of 115/100-top to the 3'-half of collagenase AP1 (mut2). These mutants were used for EMSA analysis both as probes with C3H10T1/2 nuclear extracts and as cold competitors against 115/100-top probes (B). Both mut1 and mut2 oligonucleotides were less efficient at complex formation than the WT 115/100-top. Cold competitor oligonucleotides were used at 5×, 25×, and 125× molar excesses. Both mut1 and mut2 oligonucleotides competed for binding to the factor and the overall competitor effectiveness was WT > mut2 > mut1. C, another set of mutants was designed such that the regions of mutation were more refined. Purine/pyrimidine switches were constructed within the 115/100-top sequence corresponding to the numerical name of the oligonucleotide (for example, bases 115 and 114 were mutated in the 115/114 oligonucleotide). This mutant series was used as cold competitors in EMSAs, and the resulting shifted bands were measured densitometrically using NIH ImageTM. The resulting plots shows level of competition relative to the wild-type oligonucleotide sequence.

The ssT1 Nuclear Factor Is a Positive Regulator of the 63/49 Region of the Timp-1 Promoter-- To analyze further the role of ssT1 in basal promoter activity, we assessed the impact of mutation of the ssT1 site in the context of 115/+47 constructs with either a normal 63/49 AP1 site or with the site replaced by a consensus coll.AP1 motif or mutant AP1 as in Fig. 1. Since both the mutant AP1 and the coll.AP1 sequences do not interact with ssT1, this allowed us to discriminate the contributions of the 115/100 and 63/49 ssT1 sites in basal promoter activity. Incorporation of the mut1 sequence used in Fig. 6 into the 115/+47 reporter caused a 15-20% reduction in promoter activity (Fig. 7). However, this mutation had greater impact in the reporter carrying the coll.AP1 site, reducing expression by 40%. Elimination of AP1 binding ability had a dramatic effect on promoter activity, as we had seen previously with the 223/47 constructs used in Fig. 1, with the mutant AP1 construct yielding only 20% of the expression seen with the 115/+47 wild-type Timp-1 promoter region. However, this low basal level could be further reduced to approximately 10% that of the wild-type promoter by inclusion of the mut1 sequence at 115/100. These data argue that both ssT1-binding sites at 63/49 and 115/100 contribute to the basal activity of the Timp-1 promoter. We suspect that the effect of mutating the ssT1 site is not as severe as deleting it (compare Fig. 7 with Fig. 3) because the mut1 mutation still retains some ability to interact with ssT1 (Fig. 6).

View larger version (13K): [in this window] [in a new window]   Fig. 7.   ssT1 interactions at both promoter regions (115/100 and 63/49) positively affect reporter activity. Mutations of the ssT1 site at 115/100 and the 63/49 AP1 site were introduced into the 115/+47 Timp-1 promoter region. The Timp-1 AP1 motif (WT) was converted to a consensus collagenase or mutant AP1 site (coll.AP1 and mutAP1, respectively, as in Fig. 1) and placed in the context of wild-type or mutant ssT1 (mut1, Fig. 6). Relative basal CAT activities following transient transfection of C3H10T1/2 cells are displayed. Mutation of the 115/100 ssT1 site reduced basal expression relative to the wild-type promoter, and this reduction was exacerbated with either a canonical coll.AP1 site or mutated AP1 at 63/49.

Both Regions, 115/100-Top and 63/49-Bottom, Interact with a Protein of Approximate Molecular Mass of 50-55 kDa-- To characterize further the ssT1 factor, EMSA binding reactions with the 115/100-top probe were UV cross-linked and then separated on a 10% SDS-polyacrylamide electrophoresis gel (Fig. 8A). A complex pattern of bands was observed migrating between 40 and 65 kDa; however, two major bands at approximately 50 and 55 kDa were detected. Specificity of these interactions is demonstrated by competition from excess unlabeled 115/100-top oligonucleotides. The complexes were not competed by cold coll.AP1 single strands, but they were competed by 63/49-bottom as expected (data not shown).

View larger version (33K): [in this window] [in a new window]   Fig. 8.   Two regions of the Timp-1 promoter interact with a single-stranded binding protein of approximately 54 kDa. Samples from an EMSA binding reaction were UV cross-linked and then separated on a 7% SDS-polyacrylamide electrophoresis gel (A). The 115/100 was used as a probe and was run without competitors or against 100-fold molar excess of cold 115/100-top or 115/100-bottom. As a control, the reaction was run without UV cross-linking. Additionally, Southwestern blots were performed on nuclear extracts from C3H10T1/2 cells, rat liver, and rat testes (B). Blots were probed with 115/100-top and then stripped and probed with 63/49-bottom. Four primary bands were seen, labeled 1-4.

As further characterization of the ssT1 factor, Southwestern blots were performed (Fig. 8B). The 115/100-top and 63/49-bottom oligonucleotides both interact with proteins from nuclear extracts of 10T1/2 cells and rat liver, and different binding activities were revealed. All of the bands labeled 1-4 were specific since they were eliminated by adding excess unlabeled oligonucleotide competitor to the binding solution (data not shown). The 115/100-top strand interacted strongly with a protein of approximately 54 kDa in nuclei from mouse 10T1/2 fibroblasts, identified as band 2 (Fig. 8B). There are, however, additional weaker interactions with bands 1 and 3 at 90 and 32 kDa, respectively. When using the 63/49-bottom probe with 10T1/2 nuclear extracts, we observed a similar banding pattern; however, there is an approximately equal distribution of signal between bands 1 and 3, with an additional band 4 at 22 kDa being detected. Band 2 co-migrated for both 63/49 and 115/100 probes, which likely accounts for the cross-competitions we have observed. We suggest that the band-2 54-kDa nuclear binding activity identified by this Southwestern analysis is the ssT1 factor. At this time, we do not know the identity of any of the bands. It is possible that the lower molecular weight bands (labeled 3 and 4 in Fig. 8B) are breakdown products of the higher molecular weight species. The band 2 signal is the only significant binding activity detected in liver nuclear extracts with either the 115/100-top or the 63/49-bottom probes; in the case of the weak signal with the 63/49-bottom this resolved into a doublet. Both probes interacted with proteins of approximately 54 kDa in liver nuclear extracts; however, 115/100-top gave a much stronger response. Alternatively, only 115/100-top interacted with nuclear factors from rat testes, giving a series of 4-5 bands of approximately 58, 54, 48, 40, and 36 kDa, which may represent a distinct family of testis-specific single-stranded binding proteins or different isoforms of the ssT1 factor.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

The mechanisms involved in the tissue-specific and stimulus-responsive transcription of Timp-1 are not fully understood. Several groups have now demonstrated that the AP1-binding site in the promoter of mammalian timp-1 genes is of critical importance in serum-inducible transcription in fibroblastic cells (27-29). We show here that this site, which differs from a consensus AP1-binding motif by a single base (5'-TGAGTAA-3'), confers additional protein binding properties on single-stranded versions of the sequence covering 63/49 of Timp-1. Our data indicate that the top and bottom strands of the sequence bind distinct nuclear single-stranded DNA binding factors. Double-stranded 63/49 AP1 probes either do not bind these factors or bind them very inefficiently. Likewise single- or double-strand versions of a consensus collagenase AP1 site with core motif 5'-TGAGTCA-3' do not bind either factor. The bottom strand of the sequence binds a 54-kDa protein that we have termed ssT1. The ssT1 factor binds to a second site in the Timp-1 promoter between 115/100, deletion of which results in a 3-fold decrease of both basal and serum-stimulated transcription from the promoter. These data argue that ssT1 may be involved in maintaining efficient transcription of Timp-1 in unstimulated basal conditions in mouse fibroblasts, which in turn may affect the overall level of gene activity that can be attained following stimulation.

The binding of ssT1 to ssDNA shows clear sequence preferences. Although the 63/49 AP1-bottom strand and the 115/100-top strand were able to cross-compete effectively for binding of the ssT1 factor, and they both detected a 54-kDa protein by Southwestern blot analysis, the 63/49 sequence bound strongly to other proteins at 90, 32, and 22 kDa that were only weakly bound (if at all) by the further upstream site. Thus ssT1 may be one of a family of factors, each of which may prefer particular sequence motifs. The distinction between ssT1 and the factor that binds the 63/49 AP1-top strand was shown by both competition data and UV cross-linking studies analogous to those of Fig. 7A, which revealed bands at approximately 35, 41, and 50 kDa (data not shown).

Comparison of the 63/49 AP1-bottom and the 115/100-top sequences suggests a possible consensus motif for ssT1 binding as 5-CA/TTTN_4-6ATC-3'. Within this motif the 5'-sequences may be the most critical for several reasons. First, the underlined T residue indicates the distinguishing difference between the unusual Timp-1 AP1 site and the consensus collagenase AP1. Second, mutational analysis involving fusing either half of the 115/100 sequence to the inactive collagenase AP1 site indicated the loss of the first half containing the 5'-CTTT was somewhat more deleterious (Fig. 6B), and this was supported by additional mutations involving triplet replacements through the sequence (Fig. 6C). Third, this sequence is most conserved between mouse and rat (5'-CTTTGGGTTTATC-3' versus 5'-CTTTGGGCTCAGC, respectively (24)). However, these mutational studies also show that multiple sequences participate since disruption of the 5'-CTTT still allowed some binding. Furthermore, either half of the 115/100-top sequence alone was insufficient to confer ssT1 binding, as shown by the failure of the 123/110-top and the 108/92-top sequences to bind. Thus sequences around the motif may also contribute to binding preferences, and as a consequence we prefer to term the binding of ssT1 "sequence-selective" rather than sequence-specific.

The DNA-ssT1 interaction data from EMSA studies complement the functional analysis of promoter activity from transient transfection studies of the various deletions of the Timp-1 promoter. Loss of the 125/95 region lowered basal activity from the promoter without a profound effect on the fold induction following serum stimulation. Mutation of the ssT1 site located at either 115/100 or 63/49 are both associated with a decrease in promoter activity under basal conditions. Likewise, ssT1 was present at equal levels in nuclei isolated from unstimulated and serum-stimulated mouse fibroblasts. This supports the idea that ssT1 may function to maintain the housekeeping level of Timp-1 promoter activity.

The involvement of sequence-selective DNA-binding proteins in transcriptional regulation has been documented for other genes. The muscle factor 3 (MF3) single-stranded binding activity (36) binds to three individual sequences that show few significant regions of identity as follows: the cARG motif of muscle regulatory element (CC(A/T)₆GG), the E box of creatine kinase (TCAGGCAGCAGGTGTTGGGGG), and MCAT (CATTCCT), which is found in many muscle gene promoters. However, the relevance of these interactions remains unknown.

At present, we can only speculate about the function of the ssT1-DNA interaction. A number of genes are regulated in part by interactions with single-stranded DNA binding activity through a number of different mechanisms. Control of the adipsin gene bears similarity to what we have found for Timp-1, as it is regulated by two factors each specific for single-stranded DNA, with little double-stranded DNA binding activity (37). One of the two single-stranded DNA-binding proteins is expressed in a differentiation-dependent fashion and is thought to play a role in establishment or maintenance of the differentiated state. A 40-base pair regulatory region upstream of the gelatinase-A (MMP-2) promoter is involved in high level expression of the gene in glomerular mesangial cells (38). It has recently been shown that this site binds transcription factors AP2 and YB-1 (39), with YB-1 showing preferential binding to the isolated single strands of the response element (38).

Other identified single-stranded DNA-binding proteins provide additional possible modes of action. The ssDNA-BP, DNA binding stimulatory factor interacts with purified estrogen receptor, enabling it to bind to its response element (40), which implicates transcription factor recruitment as a mechanism of transcriptional activation. Such recruitment is also seen for the A core protein, which is involved in regulation of the A fibrinogen gene. The A core protein, which is related to the mitochondrial ssDNA-BP, P16 (41), has been shown in overexpression studies to be involved in interleukin-6-induced transcription, possibly through recruitment of STAT signaling molecules (42). Work on the rat timp-1 promoter identified the sequences between the AP1 and PEA3/Ets sites (which are precisely conserved in the mouse promoter, corresponding to 53/45) as an oncostatin-M/interleukin-6-responsive element that binds STAT3 (24). It will be interesting to determine if ssT1 is in any way involved in STAT3 recruitment.

Another mechanism of activity for ssDNA-BP activity is through a direct recruitment of RNA polymerase (RNAP), as shown by the coliphage protein N₄SSB, which activates 70, and does not bind to double-stranded DNA (43). It has been demonstrated that the protein interacts directly with the RNAP B' subunit, which has relevance to eukaryotic transcription because the region of interaction is conserved in the largest subunit of the eukaryotic RNAP II. There are several possible functions of interaction with RNAP subunits. The protein could act as a tether to link the RNAP to a promoter (44, 45). Alternatively, subsequent steps of RNAP function could be targeted (43). Another mechanism of action, as demonstrated by the EcoSSB single-stranded binding protein is the enhancement of transcription by establishing adequate DNA secondary structure (46). Finally, a single-stranded DNA-BP might be involved in establishment of single-stranded regions at sites of transcription. Such activity might serve to enable open DNA complex formation during initiation by the RNAP or, alternatively, to maintain an open state in order to relieve torsional stresses during the act of transcription itself (47, 48). It is possible that ssT1 induces some conformational change in DNA once bound, since this may explain why the EMSA complex of ssT1 with the 125/95-top probe migrates faster than the corresponding complex with the 115/100 oligonucleotide, despite the larger size of the former.

The inability of ssT1 to bind to double-stranded DNA appears to rule out a function in denaturation of the promoter region. However, the possibility remains that the proteins may stabilize a single-stranded conformation. Other possibilities exist for preinitiation complex recruitment and binding being aided by the ssDNA-BP. Such a function is seen for PC4, which is a positive transcription cofactor (49-51). PC4 interacts with both free and bound VP16 activation domains and also with TFIIA. However, there is no interaction with TATA-binding protein. Similar to ssT1, PC4 interacts with single-stranded DNA (52).

Conversion of the unusual timp-1 AP1 motif to a consensus collagenase AP1 site did not affect basal or serum-inducible expression from the promoter in transient transfection assays with a reporter driven by the 223/+47 promoter. This may be due to compensation via the presence of the 115/100 ssT1-binding site. However, it is clear that the 223/+47 Timp-1 region does not recapitulate the full range of expression of the endogenous gene; for instance, expression from these constructs is unresponsive to phorbol ester stimulation.² Thus the 63/49 AP-1-bottom ssT1 binding may be more important in the context of other regulatory elements upstream or downstream from the promoter. It is also possible that the full effects of ssT1 function will only be evident with a chromatin template, rather than the naked DNA format generated in the transient transfections. Another potential area of involvement of ssT1-like factors is tissue-specific expression. Only one cell line (fibroblastic) and two tissue types (liver and testes) were analyzed by Southwestern blot, yet significant differences in binding activities were seen. The 54-kDa ssT1 that is recognized by both the 115/100-top and the 63/49 AP1-bottom probes is present in fibroblasts and liver, but the testis pattern was more complex. It will be important to determine the relationships between these various binding activities.

In conclusion, we have identified a 54-kDa nuclear single-stranded binding activity that is involved in establishing basal expression of Timp-1 through interaction with at least two regions of the promoter. The ssT1 factor and related molecules may be involved in the regulation of a number of genes. Therefore, efforts at purifying the protein are presently under way.