| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 274, Issue 32, 22493-22501, August 6, 1999
From the Department of Physiology, University of British Columbia,
Vancouver V6T 1Z3, Canada
Two of the most effective stimuli of gastrin
release from human antral G cells are bombesin and phorbol esters. Both
agonists result in activation of the protein kinase C family of
isozymes, however, the exact contribution of protein kinase C to the
resultant release of gastrin has been difficult to assess, possibly due to the presence of multiple protein kinase C isozymes in the G cells.
The results of the present study demonstrated that the human antral G
cells expressed 6 protein kinase C isozymes The protein kinase C
(PKC)1 enzyme family
represents a group of widely distributed serine/threonine kinases that
play a variety of regulatory roles in cell signaling events (1). Twelve
PKC isozymes, grouped into three major classes, have been identified to
date: the conventional, cPKCs In endocrine cells a number of different PKC isozymes have been
detected and linked to the regulation of hormone secretion. In normal
rat pancreatic We have been investigating the signal transduction pathway activated by
stimulation of human antral G cells by gastrin releasing peptide
(GRP)/bombesin (BN). While we have strong evidence that activation of
the GRP receptor results in the release of intracellular calcium from
phosphatidylinositol 3,4,5-triphosphate-sensitive intracellular stores
(7, 8), the role of PKC in BN-simulated gastrin release has been more
difficult to assess. However, phorbol esters are potent stimulators of
gastrin release in this human antral cell preparation indicating that
activation of DAG-sensitive isozymes can initiate gastrin containing
secretory granule exocytosis (9).
The identification of the PKC family of enzymes suggests that multiple
isozymes may be present in the G cells and inhibition of different
isozymes could explain contradictory results obtained from the use of
non-selective antagonists. In addition, activation of GRP receptors in
the Swiss 3T3 fibroblast cell line stimulates activity of murine PKD
(the homolog of human PKCµ) by a PKC-dependent mechanism
(2). The precise PKC isozyme(s) responsible for stimulation of PKD
activity has yet to be identified and it is unknown whether a similar
effect occurs in our human cell preparation.
The present studies were designed first to determine which PKC isozymes
were expressed by the antral G cells. Second to determine if the
distribution of any of the isozymes could be altered by stimulation of
the G cells with either 1 nM phorbol ester (PMA) or 10 nM BN, and finally to compare the ability of a series of different PKC antagonists to inhibit BN-stimulated gastrin release.
Cell Isolation
Human antrum was obtained from 19 multiple organ donors in
association with the British Columbia Transplant Society with ethical approval of the University of British Columbia Clinical Screening Committee. There were 11 males and 8 females the average age of the
males was 28 years and the females 36 years. A single cell suspension
of mucosal cells was prepared and separated by centrifugal elutriation
as described previously (9). The F1 fraction containing the majority of
the gastrin cells was used in subsequent experiments.
Cell Culture
The cells in the F1 fraction were resuspended at 1 × 106 cells/ml in growth medium comprising: 50:50 Dulbecco's
modified Eagle's medium/Ham's F-10, 1.0 mM
Ca2+, 1 µg/ml hydrocortisone, 8 µg/ml insulin, 5%
heat-inactivated fetal calf serum, 10 µg/ml penicillin, 10 µg/ml
streptomycin, and 10 µg/ml gentamycin. For immunocytochemical studies
1 ml/well was plated on 12-mm round glass coverslips pre-coated with
3-aminopropyltriethoxysilane solution in 24-well Costar plates. After
48 h in culture the cells were either washed in phosphate-buffered
saline and fixed in 4% paraformaldehyde for 15 min at room temperature
or stimulated with 1 nM PMA or 10 nM BN in the
presence or absence of extracellular calcium prior to fixation.
For release studies the cells were plated at 1 ml/well on
uncoated 24-well Costar plates and cultured for 48 h. Prior to
addition of the secretagogues the wells were washed twice in release
medium (Ham's F-10 with 5.5 mM glucose, 0.1% bovine serum
albumin, 1.0 mM Ca2+), to remove any
non-adherent cells and bacteria. Duplicate wells were incubated with
the following: release medium alone, 10 nM BN with or
without the following PKC antagonists; 1 µM
staurosporine, 100 nM calphostin C, 1 µM
bisindolylmaleimide 1 (GF 109203X), 100 nM chelerythrine
chloride, 100 nM Go 6983 and 10 nM Go 6976. After 60 min in 5% CO2 at 37 °C, the medium was
aspirated and centrifuged for 2 min to remove particulate matter. The
supernatant was stored at The cells from control wells were extracted in boiling dH2O
for 10 min, centrifuged to remove cell debris and the supernatant stored at Radioimmunosassay
The radioimmunoassay for gastrin was performed using the CKG-2
polyclonal antibody as described previously (9). The assay detects the
N-terminal region of human gastrin-17 and has a lower sensitivity limit
of 5 fmol. Each sample was assayed in duplicate. The inter- and
intra-assay variations were 10 and 5%, respectively.
Immunocytochemistry
Protein Kinase Isozymes--
Antisera to the PKC isozymes were
obtained from Transduction Laboratories (Lexington, KY). Transduction
Laboratories indicates the optimal concentration for the use of the
antibodies for Western blots in control tissues, in general a 10-fold
higher dilution was required for the immunocytochemical staining of the
antral cells. In each case the optimal concentration of the antibody was determined by completing serial dilution tests ranging from 1:50 to
1:1000 in phosphate-buffered saline containing 5% heat-inactivated horse serum and 0.05% Triton X-100. Table
I gives the details of the final
dilutions of the different antibodies used for the immunostaining. The
antibodies were incubated with the cells for 48 h at 4 °C.
After washing in phosphate-buffered saline/Triton the bound antibodies
were localized using Cy3-conjugated donkey anti-mouse IgG (Jackson
Laboratories) at 1:1,000 for 1 h at room temperature.
To establish which isozymes were expressed in the gastrin cells
coverslips with positive PKC immunostaining were reincubated in a
rabbit antiserum to gastrin (Dako, Copenhagen) at a dilution of
1:4,000. The bound antibodies were localized using a fluorescein isothiocyanate-conjugated goat anti-rabbit IgG at a dilution of 1:1000
(Jackson Laboratories).
To establish if 1 nM PMA or 10 nM BN resulted
in translocation of any of the PKC isozymes expressed in the gastrin
cells, cells cultured on coverslips were stimulated for 1, 5, 15, or 30 min at 37 °C prior to fixation. The double staining protocol outlined above was completed and the location of the isozymes in
control or stimulated cells compared using digital imaging microscopy
at each time point.
Finally the localization of actin in BN-stimulated and
unstimulated G cells was determined by incubation of
gastrin-immunostained coverslips with ALEXA 488-conjugated
phalloidin (Molecular Probes, Eugene, OR) for 20 min at room
temperature. The coverslips were washed extensively in
phosphate-buffered saline prior to application of coverslips.
Digital Imaging Microscopy--
Cells were examined on the stage
of a Nikon Diaphot 200 inverted microscope in epifluorescent mode, with
a UV-F 100/1.3 glycerin immersion objective and narrow band-pass
filters from Omega Optical for fluorescein isothiocyanate and
tetramethyl-rhodamine isothiocyanate (Brattelboro, VT). A series
of two-dimensional images were acquired of the cells, through focus, at
0.25-µm intervals. The camera was a Photometrics 200 equipped with a
thermoelectrically cooled, back-illuminated, Tektronix TK512CB chip
(Tucson, AZ). Voxel dimensions were 122 nm × 122 nm × 250 nm. Image stacks were transferred to a Silicon Graphics
Indigo2 XZ workstation where they were dark-current and
background subtracted, and corrected for non-uniformities across the
field of view and illumination. For every day on which images were
acquired, the optical transfer function of the microscope was
empirically measured using fluorescently-tagged beads (100 nm diameter)
obtained from Molecular Probes. The measured optical transfer function
was then used to deconvolve the data sets using a constrained,
iterative, deconvolution algorithm based on regularization theory (10). Deconvolutions were performed on a Scanalytics EPR server (Bellerica, MA). Pairs of deconvolved images were then aligned using small fluorescent beads, with broad excitation and emission maxima, which had
been included in the mounting medium as fiduciary markers. The
intensity of a small region of each deconvolved image (5 × 5 × 3 voxels) was selected as representative of the background intensity
of that image and used as the threshold value. Deconvolution of wide
field images, rather than confocal microscopy, was selected for this
phase of the work since for discretely organized objects from which the
emitted fluorescence intensity is low, deconvolving wide field images
produces results superior to those that can be obtained from confocal
microscopes (11).
Western Blots
To confirm the identity of the PKC isozymes detected by the
antibodies in human antral cells, protein was extracted from the cultured cells using the Trizol reagent following the manufacturers (Life Technologies Inc.) instructions. Samples (10 µl) of control (Jurkat cells for isozymes µ and Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR)
The primers were designed to amplify a portion of the mRNA
spanning the variable regions 1 and 2 of the enzyme. The 5' sequence CCCGGCGTAGGCGATTCAGA and reverse 3' sequence TACGTGGATCTCATCTGCTGT. Total RNA was isolated from human antral cells using Trizol (Life Technologies, Inc., Grand Island, NY) following the manufacturers' directions. First strand cDNA was prepared from 3 µg of total RNA
using Superscript II. The RNA was first incubated in first strand
buffer (50 mM Tris-HCl, pH 8.3, 3 mM MgCl, and
75 mM KCl), containing 32 units of RNasin (Pharmacia) and 1 unit of Rnase-free DNase (Promega Corp., Madison, WI) for 45 min at
37 °C, followed by 75 °C for 10 min. A sample of this reaction
was removed and used as template in a subsequent PCR reaction. Random
primers (400 pM), dithiothreitol (to 10 mM) and
16 units of RNasin were added and the samples were incubated for 10 min
at room temperature. Superscript II (200 units, Life Technologies,
Inc.) was added and samples were incubated at 42 °C for 1 h.
The enzyme was inactivated by heating the samples to 75 °C for 15 min.
The PCR reactions were carried out using 2 µl of cDNA in 25 µl
of total volume of PCR buffer (20 mM Tris-HCl, pH 8.4, 50 mM KCl, Life Technologies, Inc.) containing
MgCl2 (1.2 mM), 10 µmol each of the forward
and reverse primers. Taq polymerase (1.25 units, Life
Technologies, Inc.) was added and the samples were overlaid with
mineral oil to prevent evaporation. The amplification reaction was
carried out in a RoboCycler Gradient 96 (Stratagene, La Jolla, CA) for
35 cycles. Each cycle consisted of denaturation for 45 s at
94 °C, annealing for 45 s at 59 °C, and an extension for
45 s at 72 °C. A final extension step at 72 °C for 5 min
terminated the amplification. The PCR products were separated by
electrophoresis through a 1% agarose gel. The DNA was visualized and
photographed using the Eagle Eye II Video System (Stratagene). The DNA
fragment was isolated from the gel and subsequently used for sequence analysis.
Immunocytochemistry
Protein Kinase C Isozymes--
To establish which PKC isozymes
were expressed in the cultured antral cells single immunostainings were
completed. These demonstrated the presence of PKC isozymes Translocation Experiments--
The major focus of the present
studies was to determine which PKC isozymes were involved in
BN-stimulated gastrin release. Once the isozymes expressed in the G
cells had been established the next series of experiments evaluated if
BN or PMA treatment caused the translocation of specific isozymes.
Stimulation of the G cells with 10 nM BN resulted in the
translocation of PKC
In addition to altering the intracellular distribution of PKC isoforms
the morphological appearance of the G cells was significantly modified
by BN treatment. The increased resolution and sensitivity of wide field
microscopy coupled with the use of a deconvolution algorithm and image
analysis was utilized to examine these alterations. Within 1 min of
addition of BN the gastrin cells developed structures resembling
lamellipodia on their lateral margins (Fig.
3, B and C). The
lamellipodia were outlined by PKC
Previous studies had indicated that activation of GRP receptors with BN
resulted in the activation of PKD in Swiss 3T3 cells (2). In the human
cell preparation, PKCµ (the human homolog of PKD) was localized to
the Golgi complex of all the cells. Deconvolution of wide field images
was used to determine if BN or PMA treatment altered the distribution
of this isozyme specifically in the gastrin cells. The immunostainings
demonstrated that neither BN nor PMA had any effect on the distribution
of PKCµ (Fig. 3, E and F). In addition, a
minimal overlap between PKCµ- and gastrin-immunoreactive structures
was observed.
Of the remaining PKC isozymes the distribution of
To determine whether the structures observed after BN stimulation were
indeed lamellipodia the cells were incubated with ALEXA 488-conjugated
phalloidin. In control cells the actin was observed as a complete ring
around the cortical surface of the cells (data not shown). However,
after BN stimulation distinct breaks in the cortical actin were
observed that were concentrated to the region adjacent to the secretory
granules (Fig. 4). In addition,
concentrations of actin were observed on the lateral margins of the
cells consistent with the formation of lamellipodia in these regions
(Fig. 4).
Western Blots--
Of the seven antibodies used for the Western
blot analysis five gave positive results showing bands of the expected
size (Fig. 5). The exceptions were PKC Reverse Transcription-Polymerase Chain Reaction--
In view of
the lack of expression of PKC Release Experiments
In all experiments BN addition resulted in a
concentration-dependent increase in gastrin release
(n = 16). Addition of 1 µM staurosporine, a
broad spectrum inhibitor of protein kinases, resulted in a significant
inhibition of BN-stimulated gastrin release (Fig.
7). The structurally similar compound,
bisindolylmalemide, that acts as a competitive inhibitor for the
ATP-binding site of PKC and is relatively selective for the isozymes
The Role of Protein Kinase C Isozymes in Bombesin-stimulated
Gastrin Release from Human Antral Gastrin Cells*
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
, 
, 
, 
, 
,
and µ. Of these protein kinase C, and were translocated by
stimulation of the cells by either 10 nM bombesin or
1 nM phorbol ester. Inhibition of protein kinase Cµ
(localized to the Golgi complex) did not decrease bombesin-stimulated
gastrin release indicating that this isozyme was not involved in the
secretory process. The use of selective antagonists of the
calcium-sensitive conventional protein kinase C subgroup resulted in an
increase in bombesin-stimulated gastrin release and indicated that
protein kinase C was involved in the desensitization of the bombesin response.
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
, 
(which exists in two splice variants I and II), and ; the novel, nPKCs 
, , 
, µ,
and ; and the atypical, aPKCs and 
/
( is the human
homologue of the mouse isoform ). The latest isozyme identified,
PKCµ, shares extensive sequence homologies with the newly described murine protein kinase D (PKD (2)). The cPKCs are activated by calcium
and diacylglycerol (DAG), while the nPKCs, lacking C2 regions, require
only DAG for activation. The last group, the aPKCs, with only one zinc
finger motif in the C1 region and lacking C2 regions, are the least
well characterized. The aPKCs are not activated by either calcium or
DAG, but respond to phosphatidylinositol 3,4,5-triphosphate and
arachidonic acid (1).
cells and bovine parathyroid cells the predominant
isozymes expressed are PKC , , and with detectable levels of
and but not (3). The pancreatic cell line, MIN6,
expressed the same isozymes as normal cells with the addition of
and µ (4). In thyroid cell lines PKC isoforms , , , and
were detected (5), while AtT20 cells express , , , and (6). It appears that the majority of endocrine cells share the
expression of the isozymes , , and but differ with respect to
, , , and µ. In functional studies activation of the
isozymes ( cells) and (thyroid cells) have been linked to
hormone release (4, 5).
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
20 °C until the gastrin content was
determined by radioimmunoassay.
20 °C. The data for the gastrin release experiments were
expressed as a percentage of total gastrin cell content and presented
as mean ± S.E. Statistical significance was determined using an
analysis of variance (ANOVA) followed by the unpaired Student's
t test; values of p < 0.05 were considered
significant. The n values refer to the number of individual
primary cell cultures used for each experiment.
Antibody dilutions
or rat brain for , , and ) and antral proteins were added to a 10% SDS-polyacrylamide gel.
After electrophoresis the separated proteins were transferred onto
nitrocellulose membrane and nonspecific protein binding blocked by an
overnight incubation in 2% milk powder in Tris-buffered saline with
0.05% Triton X-100 (TBST). The membrane was rinsed 3 times in TBST
prior to incubation with one of the seven PKC isozyme-specific antisera
employed for the Western blots diluted in TBST and 5% horse serum (for
the relevant dilutions see Table I). After washing 3 times in TBST the
membranes were incubated in horseradish peroxidase-conjugated goat
anti-mouse IgG diluted 1:1000 in TBST for 1 h at room temperature.
Protein bands detected by the antibodies were identified using the ECL
Western blotting Detection system (Amersham Pharmacia Biotech,
Piscataway, NJ) using Kodak diagnostic film processed in a Kodak
M35A-OMAT processor.
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
, ,
, , , , and µ. Their location in unstimulated cells was
isozyme specific: and were associated with the plasma membrane
(Fig. 1 A and C),
while and were localized to intracellular vesicles (Fig. 1,
E and G), and were present throughout the
cytoplasm (Fig. 1, I and K) while µ was
confined to the Golgi complex (Fig. 1M). Double
immunostaining demonstrated that isozymes , , , , and were expressed in the gastrin cells (Fig. 1, B, F, H, J, and
L), was expressed in non-gastrin cells (Fig.
1D) and µ was expressed in all the cultured cells.
View larger version (91K):
[in a new window]
Fig. 1.
A, unstimulated cells immunostained with
the PKC antibody. Note the concentration of immunoreactivity at the
plasma membrane (arrows). B, the same cell
cluster immunostained for gastrin demonstrating that PKC
immunoreactivity was restricted to the G cells (arrows).
C, unstimulated cells immunostained for PKC. Note that
the immunoreactivity is concentrated at the plasma membrane of non-G
cells (small arrows). D, the same group of cells
immunostained for gastrin showing a PKC negative cell (large
arrow). E, a group of unstimulated cells immunostained
using the PKC antibody. Note that only the G cell (arrow)
shows a small group of immunoreactive vesicles. F, the same
group of cells immunostained using the gastrin antibody. Note that the
PKC immunoreactivity was confined to the G cell (arrow).
G, an unstimulated group of cells immunostained using the
PKC antibody. Note that the immunoreactivity is limited to a cluster
of vesicles around the nucleus of gastrin-immunoreactive cells
(arrow). H, the same group of cells immunostained
for gastrin, note that the PKC immunoreactivity is limited to the G
cells (arrow). I, a group of cells immunostained
by the PCK antibody. Note that the immunoreactivity appears to be
associated with small vesicles distributed throughout the cytoplasm.
J, the same group of cells immunostained for gastrin
demonstrating that gastrin immunoreactivity was concentrated to one end
of the cells while PKC immunoreactivity was present throughout the
cells. K, a group of cells immunostained using the PKC
antibody. Note that one of the cells is a G cell (large
arrow) the other is a non-gastrin (somatostatin) cell (small
arrow). L, the same group of cells immunostained for
gastrin showing the gastrin immunoreactive cell (large
arrow). M, a group of cells immunostained with the
PKCµ antibody showing that the immunostaining is confined to the
Golgi complex of all cells in the cultures. N, the same
group of cells immunostained for gastrin. Note the immunostaining of
the Golgi complex (arrows) is distinct from the localization
of the gastrin immunoreactive secretory granules. All scale
bars represent 10 µm.
from a predominantly intracellular localization
to the plasma membrane (Fig. 2,
A and B). Interestingly, although somatostatin cells in the culture preparation also contain PKC the location of
the isozyme in these cells was not affected by BN treatment (see Fig.
2). These data indicated the specificity of the translocatory effect to
the gastrin cells known to express the GRP receptor. The translocation
occurred within 1 min of the addition of BN and within 5 min PKC had
returned to the cytosol.
View larger version (45K):
[in a new window]
Fig. 2.
A, two cells immunostained using the
antibody to PKC . Note that only the G cell (small arrow)
shows translocation of the protein to the cell membrane. B,
the same cell group immunostained for gastrin. Note that the lower cell
shows no gastrin immunoreactivity (large arrow). Scale
bar, 10 µm
immunoreactivity but did not
contain gastrin-immunoreactive secretory granules. Addition of 1 nM PMA also resulted in translocation of PKC at all time points examined, however, no lamellipodia-like structures were observed
(Fig. 3D).
View larger version (45K):
[in a new window]
Fig. 3.
The images are three-dimensional
reconstructions of the deconvolved, aligned, and thresholded image
pairs. Gastrin granules are pseudocolored green, and
the indicated PKC isoform is pseudocolored red. If both
proteins occupied the same voxel, then that voxel became
white. For display of the three-dimensional image, the
opacity of a given voxel is directly proportional to its intensity.
Scale bar is 2.44 µm. A, in an unstimulated
cell PKG immunoreactivity was restricted to a population of randomly
distributed vesicles within the cytoplasm (red). These
vesicles showed a minimal overlap with the gastrin-immunoreactive
secretory granules (green). B, a gastrin cell 1 min after stimulation with 10 nM BN. Note that the majority
of the PKC immunoreactivity is now associated with the plasma
membrane and the presence of membrane protrusions (arrows).
C, 5 min after stimulation with BN some PKC
immunoreactivity remains at the plasma membrane associated with
membrane protrusions (arrows). D, an example of
PKC immunostaining in a G cell 15 min after stimulation with 1 nM PMA. Note that the majority of the PKC
immunoreactivity is still associated with the plasma membrane and the
lack of membrane protrusions. E, in an unstimulated G cell
PKCµ immunoreactivity was limited to the Golgi complex with minimal
overlap with the gastrin-immunoreactive secretory granules.
F, in a PMA-stimulated cell, PKCµ immunoreactivity remains
confined to the Golgi complex and shows minimal overlap with
gastrin-immunroeactive secretory granules. G, an
unstimulated gastrin cell immunostained for PKC. Note that patchy
immunoreactivity for PKC is associated with the plasma membrane in
the apical region (arrow). In addition, there is little
overlap with the gastrin-immunoreactive secretory granules.
H, after a 5-min stimulation with 1 nM PMA the
immunoreactivity for PKC covers regions of the plasma membrane
directly overlying gastrin immunoreactive secretory granules at the
basal membrane of the G cell. In addition, PKC is concentrated to a
ring around the apical zone of the cell (arrow).
I, after a 10-min incubation in 1 nM PMA PKC
immunoreactivity appears to be concentrated over the microvilli at the
apical pole of the G cell (arrow). In addition, there in an
increased overlap of PKC and gastrin immunoreactivity at the basal
pole of the cell (white vesicles).
and was not
affected by the addition of either of the secretagogues (data not
shown). However, the distribution of the nPKC was altered by
stimulation with 1 nM PMA. In unstimulated cells
deconvolved images demonstrated that PKC had a patchy distribution
on the plasma membrane of the gastrin cells (Fig. 3G). After
stimulation with PMA, PKC immunoreactivity was concentrated over the
presumptive apical pole of the cells, either in a ring around the top
of the cells or over the entire surface of the microvilli (Fig. 3,
H and I).
View larger version (19K):
[in a new window]
Fig. 4.
A stereo pair showing the distribution of
fluorescent phalloidin in a gastrin immunoreactive cell after BN
stimulation. Note the absence of cortical actin around the base of
the cells adjacent to the secretory granules (small arrows)
and the concentration of actin at the lateral surface of the cell
(large arrow) consistent with the formation of lamellipodia
in this region. Scale bar = 2.44 µm.
and where no band was detected in the antral cells. This was most
probably due to the low levels of the isozymes expressed in the cells
as determined by the immunocytochemical results. In addition to bands
of the expected size the Western blots for PKCµ, , and showed
additional bands at smaller molecular weights consistent with
degredation of the mature protein. The Western blot for one isozyme,
PKC, showed a band of a larger size than the control band, however,
the control protein was obtained from rat tissue and the human protein
may be of a larger molecular weight.
View larger version (21K):
[in a new window]
Fig. 5.
Western blots of the different isozymes
present in the antral cell lysate .
outside the nervous system we
confirmed the expression of the isozyme by RT-PCR. Primers specific to
PKC amplified a band of the expected size by RT-PCR but not from a
negative control (Fig. 6). Subsequent sequence analysis confirmed that the amplified DNA was part of the
sequence of the PKC gene.
View larger version (38K):
[in a new window]
Fig. 6.
PCR product showing the presence of
PKC in the antral cell culture.
, , , , and was added to the medium at 1 µM 15 min prior to and during stimulation with BN. This
compound resulted in a significant increase in BN-stimulated gastrin
release at 0.1-1 nM but not at the highest concentration
of BN (10 nM) (Fig.
8A). The final two compounds in this group were Go 6983 and Go 6976, again structurally similar to
staurosporine, but are selective inhibitors of different PKC isozymes.
The more selective is Go 6976 that at nanomolar concentrations inhibits
isozymes , , , and µ whereas, nanomolar concentrations of
Gö 6983 inhibit , , , , and . Addition of either
10 nM Gö6976 or 100 nM Gö6983
resulted in a significant stimulation of BN-stimulated gastrin release
(Fig. 8B).
View larger version (39K):
[in a new window]
Fig. 7.
Addition of staurosporine to the cell
cultures resulted in a significant inhibition of BN-stimulated
gastrin.
View larger version (29K):
[in a new window]
Fig. 8.
A and B, addition of
bisindolylmalemide I, Go 6976, and Go 6983 resulted in a significant
increase in BN-stimulated gastrin release.
The plant alkaloid, chelerythrine chloride, does not have a documented selectivity for individual isozymes but is a competitive inhibitor at the phosphate acceptor site of PKCs and a noncompetitive inhibitor at the ATP-binding site. Addition of 100 nM chelerythrine chloride both 15 min before and during stimulation with BN had no effect on gastrin release at any BN concentration tested (data not shown).
Calphostin C is structurally distinct from the first group of PKC
antagonists and competes for binding at the diacylglycerol/phorbol ester-binding site of the enzymes. This compound will not affect the
aPKCs and requires light for activation. In order to complete these
experiments the culture plates were removed from the incubator and
maintained on a 37 °C heated stage in a humid plexiglass chamber for
the 1-h incubation period. Addition of 100 nM calphostin C resulted in a significant inhibition of BN-stimulated gastrin release
at the higher concentrations (Fig.
9).
|
| |
DISCUSSION |
|---|
|
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
Immunocytochemical staining identified the presence of 6 distinct
PKC isozymes in human antral G cells: , , , , , and µ.
Each isozyme demonstrated a different localization within the G cells.
The two cPKC isozymes and were diffusely distributed throughout
the cytoplasm of unstimulated cells with PKC being the more
abundant. No evidence was found for the presence of the third cPKC,
, although the antibody was capable of detecting the protein in rat
cardiomyocytes fixed using an identical
protocol.2
The expression of PKC has been thought to be limited to the nervous
system, therefore, we confirmed the immunocytochemical results using
RT-PCR and Western blot analysis. Both additional techniques confirmed
that the antral cells expressed the isozyme.
If either cPKC were to be involved with the regulation of gastrin
secretion we expected that stimulation of the cells with BN or PMA
would result in a translocation of the active isozyme from an
intracellular location to the cell membrane. Stimulation of the G cells
with both agonists resulted in a translocation of PKC from a
predominantly intracellular location to the plasma membrane. The time
course of the BN-stimulated translocation paralleled that previously
determined for the increase in intracellular calcium in the G cells
after stimulation with BN (8). The parallel time course of these events
indicates that the mobilization of intracellular calcium by activation
of the GRP receptor provided the calcium required to activate PKC.
The rapidity of the PKC translocation was similar to that reported in
HEK cells transfected with a green fluorescent protein-PKC
(GFP-PKC) construct and the green fluorescent protein-tagged
N-terminal cysteine-rich region of PKC (12, 13).
When G cells were stimulated with BN (but not PMA) the cells developed protrusions at both lateral and basal surfaces. These structures resemble lamellipodia that are specialized membrane regions known to be generated in cells after stimulation of the Rac signaling pathway (14). In the Swiss 3T3 cell line stimulation of GRP/BN receptors with BN results in activation of the Rac signaling pathway resulting in the reorganization of the actin cytoskeleton and the generation of lamellipodia (15).
In antral cells stained using fluorescent phalloidin we observed a thin
cortical layer of actin underlying the plasma membrane with no stress
fibers or lamellipodia. In stimulated cells the cortical actin showed
distinct gaps at the basal pole of the cells underlying the secretory
granules, whereas regions at the lateral sides of the cells showed
accumulations of actin. The accumulation of actin in these regions is
consistent with the formation of lamellipodia. Interestingly, 1 min
after addition of BN these structures could be identified in the G
cells by the concentration of PKC immunoreactivity in the
presumptive lamellipodia indicating that this isozyme may be involved
in their formation.
Three nPKC isozymes were localized to the G cells, PKC, , and
µ. However, their distribution within the cells was quite distinct.
The isozyme was associated with a small group of vesicular structures adjacent to the nucleus and this distribution was not affected by stimulation of the cells by either BN or PMA. Depending on
the cell type investigated the reported intracellular localization of
PKC differs. In NIH 3T3 cells overexpressing epitope-tagged PKC
the isozyme was localized to the Golgi complex (16). Whereas, in
hippocampal neurons and gastric parietal cells PKC was associated with filamentous actin (17, 18). Finally in pancreatic cells PKC
had a predominantly cytosolic location in unstimulated cells relocating
to the plasma membrane after stimulation with glucose (19). The
localization of the isozyme in the antral gastrin cells did not
correspond with any of those previously reported indicating that the
intracellular distribution of PKC is cell-specific.
The second nPKC, , was clearly localized to the plasma membrane of
unstimulated G cells and did not overlap with gastrin-immunoreactive secretory granules. In cells stimulated with PMA, PKC
immunoreactivity was found to concentrate in regions overlying the
gastrin-immunoreactive secretory granules and at the apical pole of the
G cells. In the human lung carcinoma cell line, A549, stimulation of
the cells with 25 nM PMA resulted in the translocation of
PKC from the cytosol to the cell membrane and nucleus (20). In the
present study we have no evidence for the presence of PKC in the
nucleus of either control or stimulated cells.
The significance of the translocation of PKC to the apical region of
the plasma membrane in the PMA stimulated cells is uncertain, however,
PKC plays a role in the phosphorylation of proteins associated with the
tight junction complex at the apical region of epithelial cells (21).
The pattern of immunostaining observed with the PKC antibody was
distinct from that seen using an antibody to the tight junction
protein, ZO-1, that forms a ring around the apical membrane of the
cultured cells.3 In the
majority of G cells the immunoreactivity for PKC in the PMA-stimulated cells appeared to be associated with the plasma membrane
of the microvilli at the apical region, rather than being limited to
the tight junction zone itself. Whether this translocation has any
involvement in PMA-stimulated gastrin secretion cannot be determined in
the absence of specific isozyme antagonists.
The final nPKC, µ, was clearly localized to the Golgi compartment of
all of the cultured cells confirming earlier studies in the human
hepatocellular carcinoma cell line, HepG2 (22). The circumscribed
distribution of PKCµ suggests that it may be important in the
processing of progastrin in the Golgi stack. Analysis of the structure
of PKCµ has demonstrated the presence of a PH-domain capable of
binding the subunit complex of heterotrimeric G proteins (22).
This fact, coupled with the ability of subunits to regulate
vesicular transport processes in the Golgi complex, implies that PKCµ
may be involved in mediating the transport of proteins through the
Golgi stack.
Previous studies of the activation of GRP receptors in Swiss 3T3 fibroblasts have demonstrated a PKC-dependent phosphorylation of murine PKD, a homolog of human PKCµ (2). In the present study we obtained no evidence indicating that the location of PKCµ in the Golgi complex could be altered by stimulation of the cells by either BN or PMA nor was there an appreciable overlap between gastrin- and PKCµ-immunoreactive structures. These results indicated that while stimulation of the GRP receptor in the G cells may activate PKCµ this was unlikely to influence exocytosis of gastrin containing secretory granules.
The only atypical PKC isoform localized to the gastrin cells was
PKC. This isozyme was localized to perinuclear vesicles that were
clearly distinct from the gastrin-immunoreactive secretory granules.
The localization of this isozyme was not affected by addition of either
BN or PMA to the cell cultures and indicated that PKC was unlikely
to be involved in the exocytotic process.
The morphological studies established which PKC isozymes were present in the gastrin cells but could not determine if any of the isozymes were directly involved in the secretory response. To evaluate if any of the PKC isozymes localized to the G cells played a role in BN-stimulated gastrin release the effect of a number of different PKC antagonists was examined. The majority of these antagonists are based on the sequence of the broad spectrum kinase inhibitor, staurosporine, and are directed to the ATP-binding site of the enzymes (23). Modifications to the basic structure of staurosporine have produced a number of antagonists with increasing isozyme specificity (24-26).
Addition of staurosporine itself decreased BN-stimulated gastrin release at all concentrations investigated, indicating that activation of PKC was capable of stimulating secretory granule exocytosis. However, staurosporine did not return BN-stimulated gastrin release to basal levels suggesting that additional signaling pathways were activated by the GRP receptor. These data coupled with the fact that the morphological studies demonstrated the presence of lamellipodia-like structures suggests that activation of the Rac signaling pathway may contribute to the observed gastrin secretion. The structurally related compounds, bisindolylmaleimide 1, Go 6976, and Gö 6983, inhibitors of c- and nPKCs (24-26), all resulted in a significant increase in BN-stimulated gastrin release, although in parallel experiments PMA-stimulated gastrin release was inhibited as expected.4
Previous studies in Swiss 3T3 and CHO-K1 cells have demonstrated that the GRP receptor is phosphorylated on Ser and Thr residues after the addition of either BN or PMA (27, 28). Inhibition of c- and nPKCs by either PMA-mediated down-regulation or addition of bisindolylmaleimide resulted in an increased phosphorylation of the receptor on Ser and Thr residues after ligand (BN) binding. In the present studies inhibition of cPKCs resulted in a significant stimulation of gastrin release thus it is unlikely that additional Ser/Thr kinases capable of phosphorylating the BN receptor were activated in the G cells. If such enzymes were present bisindolylmaleimide would have resulted in increased BN receptor phosphorylation resulting in desensitization of the receptor and an inhibition of gastrin release.
Of the cPKC isozymes expressed in the antral cell cultures only PKC
was translocated to the plasma membrane after BN stimulation. The time
course of this translocation paralleled that reported for
phosphorylation of the GRP/BN receptor. Translocation was detectable
after 1 min and PKC remained associated with the membrane for up to
5 min after addition of BN. Receptor phosphorylation in the cell lines
was detected 2 min after BN addition (26, 27). These data imply that
PKC in the antral G cells was involved in phosphorylation and
desensitization of the BN receptor.
The results of the experiments with Gö 6983 and 6976 also support the lack of importance of PKCµ in BN-stimulated gastrin release. These two inhibitors can be used to isolate effects due to activation of PKCµ as Gö 6976 inhibits the isozyme with an IC50 of 10 nM whereas Gö 6983 is ineffective at nanomolar concentrations (26). In the present study inhibition of PKC isozymes with both compounds resulted in an increase in gastrin release, if PKCµ activation was involved in the exocytotic process treatment with Gö 6976 should have had an inhibitory effect.
Apart from staurosporine, calphostin C, a chemically unrelated compound
that blocks the DAG-binding site (29, 30), was the only PKC antagonist
that inhibited BN-stimulated gastrin release. Of the isozymes expressed
in the G cells not inhibited by bisindolylmalemide and related
compounds, calphostin C should inhibit PKC but not the aPKC, .
The fact that inhibition of cPKCs resulted in a stimulation of gastrin
release, suggested that inactivation of the nPKC, , was responsible
for the observed decrease in gastrin release in the presence of
calphostin C (and possibly staurosporine).
The data obtained during the present study demonstrated that at least 6 PKC isozymes are expressed in the antral G cells. Of these only PKC
and showed marked translocation in gastrin cells stimulated by
either BN or PMA. The precise role of PKC in BN-stimulated gastrin
release cannot be determined due to the lack of specific inhibitors of
the novel PKC isozymes. Inhibition of cPKC isozymes resulted in an
increase in BN-stimulated gastrin release implicating PKC in the
reported down-regulation of GRP receptor function by PKC. The confined
localization of PKCµ to the Golgi complex and the fact that its
inhibition failed to decrease BN-stimulated gastrin release indicated
that this isozyme was not involved in secretory granule exocytosis.
| |
ACKNOWLEDGEMENT |
|---|
The technical assistance of D. Sidpra for the gastrin radioimmunoassays is gratefully acknowledged.
| |
FOOTNOTES |
|---|
* This work was supported by grants from the Medical Research Council of Canada and the Heart and Stroke Foundation (to A. M. J. B. and E. D. W. M.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of Physiology,
University of British Columbia, 2146 Health Sciences Mall, Vancouver,
British Columbia V6T 1Z3, Canada. Tel.: 604-822-2083; Fax:
604-822-6048; E-mail:buchan@cs.ubc.ca.
2 E. D. W. Moore, unpublished data.
3 A. M. J. Buchan unpublished data.
4 A. M. J. Buchan, unpublished observations.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: PKC, protein kinase C; PKD, protein kinase D; DAG, diacylglycerol; GRP, gastrin releasing peptide; BN, bombesin; PMA, phorbol 12-myristate 13-acetate; RT-PCR, reverse transcriptase-polymerase chain reaction.
| |
REFERENCES |
|---|
|
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
| 1. | Blobe, G. C., Stribling, S., Obeid, L. M., and Hannun, Y. A. (1996) Cancer Surv. 27, 213-248[Medline] [Order article via Infotrieve] |
| 2. |
Zugaza, J. L.,
Wladron, R. T.,
Sinnett-Smith, J.,
and Rozengurt, E.
(1997)
J. Biol. Chem.
272,
23952-23960 |
| 3. | Knutson, K. L., and Hoenig, M. (1994) Endocrinology 135, 881-886[Abstract] |
| 4. | Tian, Y-M., Urquidi, V., and Ashcroft, S. J. H. (1996) Mol. Cell. Endocrinol. 119, 185-193[CrossRef][Medline] [Order article via Infotrieve] |
| 5. | Matowe, W. C., Gupta, S., and Ginsberg, J. (1996) Thyroid 6, 53-58[Medline] [Order article via Infotrieve] |
| 6. | Mc Ferran, B. W., MacEwan, D. J., and Guild, S. B. (1995) Br. J. Pharmacol. 115, 307-315[Medline] [Order article via Infotrieve] |
| 7. | Buchan, A. M. J., and Meloche, R. M. (1994) Can. J. Physiol. Pharmacol. 72, 1060-1065[Medline] [Order article via Infotrieve] |
| 8. |
Squires, P. E.,
Meloche, R. M.,
and Buchan, A. M. J.
(1999)
Am. J. Physiol.
276,
G227-G237 |
| 9. | Campos, R. V., Buchan, A. M. J., Meloche, R. M., Pederson, R. A., Kwok, Y. N., and Coy, D. H. (1990) Gastoenterology 99, 36-44[Medline] [Order article via Infotrieve] |
| 10. |
Carrington, W. A.,
Lynch, R. M.,
Moore, E. D. W.,
Isenberg, G.,
Fogarty, K. E.,
and Fay, F. S.
(1995)
Science
268,
1483-1487 |
| 11. | Carrington, W. A., Fogarty, K. E., and Fay, F. S. (1989) in The Handbook of Confocal Microscopy (Pauley, J., ed) , Plenum Press, New York |
| 12. |
Feng, X.,
Zhang, J.,
Barak, L. S.,
Meyer, T.,
Caron, M. G.,
and Hannun, Y. A.
(1998)
J. Biol. Chem.
273,
10755-10762 |
| 13. |
Oancea, E.,
Teruel, M. N.,
Quest, A. F. G.,
and Meyer, T.
(1998)
J. Cell Biol.
140,
485-498 |
| 14. |
Hall, A.
(1998)
Science
279,
509-514 |
| 15. | Nobes, C. D., Hawkins, P., Stephens, L., and Hall, A. (1995) J. Cell Sci. 108, 225-233[Abstract] |
| 16. |
Lehel, C.,
Olah, Z.,
Jakab, G.,
and Anderson, W. B.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
1406-1410 |
| 17. |
Prekeris, R.,
Mayhew, M. W.,
Cooper, J. B.,
and Terrian, D. M.
(1996)
J. Cell Biol.
132,
77-90 |
| 18. | Chew, C. S., Zhou, C-J., and Parente, J. A. (1977) Am. J. Physiol. 272, G246-G256 |
| 19. |
Yedovistzky, M.,
Mochly-Rosen, D.,
Johnson, J. A.,
Gray, M. O.,
Ron, D.,
Abramovitch, E.,
Cerasi, E.,
and Nesher, R.
(1997)
J. Biol. Chem.
272,
1417-1420 |
| 20. | Jones, T., Courage, C., Hubbard, A, and Gescher, A. (1997) Biochem. Pharmacol. 53, 1413-1418[CrossRef][Medline] [Order article via Infotrieve] |
| 21. | Denker, B. M., and Nigam, S. K. (1998) Am. J. Physiol. 274, F1-F9 |
| 22. |
Prestle, J.,
Pfizenmaier, K.,
Brenner, J.,
and Johannes, F-J.
(1996)
J. Cell Biol.
134,
1401-1410 |
| 23. | Davis, P. D., Hill, C. H., Keech, E., Lawton, G., Nixon, J. S., Sedgwick, A. D., Wadsworth, J., Westmacott, D., and Wilkinson, S. E. (1989) FEBS Lett. 259, 61-63[CrossRef][Medline] [Order article via Infotrieve] |
| 24. | Gekeler, V., Boer, R., Uberall, F., Ise, W., Schubert, C., Utz, I., Hofmann, J., Sanders, K. H., Schachtele, C., Klemm, K., and Grunicke, H. (1996) Br. J. Cancer 74, 897-905[Medline] [Order article via Infotrieve] |
| 25. | Harris, T. E., Persaud, S. J., and Jones, P. M. (1996) Biochem. Biophys. Res. Commun. 227, 672-676[CrossRef][Medline] [Order article via Infotrieve] |
| 26. | Gschwendt, M., Dieterich, S., Rennecke, J., Kittstein, W., Mueller, H. J., and Johannes, F. J. (1996) FEBS Lett. 392, 77-80[CrossRef][Medline] [Order article via Infotrieve] |
| 27. | Williams, B. Y., Wang, Y., and Schonbrunn, A. (1996) Mol. Pharmacol. 50, 716-727[Abstract] |
| 28. |
Kroog, G. S.,
Sainz, E.,
Worland, P. J.,
Akeson, M. A.,
Benya, R. V.,
Jensen, R. T.,
and Battey, J. F.
(1995)
J. Biol. Chem.
270,
8217-8224 |
| 29. | Tamaoki, T. (1991) Methods Enzymol. 201, 340-347[Medline] [Order article via Infotrieve] |
| 30. | Bruns, R. F., Miller, F. D., Merriman, R. L., Howbert, J. J., Heath, W. F., Kobayashi, E., Takahashi, I., Tamaoki, T., and Nakano, H. (1991) Biochem. Biophys. Res. Commun. 176, 288-293[CrossRef][Medline] [Order article via Infotrieve] |
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  J. Li, L. A. Chen, C. M. Townsend Jr., and B. M. Evers PKD1, PKD2, and Their Substrate Kidins220 Regulate Neurotensin Secretion in the BON Human Endocrine Cell Line J. Biol. Chem., February 1, 2008; 283(5): 2614 - 2621. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Li and B. M. Wice Bombesin and nutrients independently and additively regulate hormone release from GIP/Ins cells Am J Physiol Endocrinol Metab, January 1, 2005; 288(1): E208 - E215. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
