HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Eisenbrandt, R. Articles by Lanka, E. Search for Related Content PubMed PubMed Citation Articles by Eisenbrandt, R. Articles by Lanka, E. Social Bookmarking                      What's this?

J Biol Chem, Vol. 274, Issue 32, 22548-22555, August 6, 1999

Conjugative Pili of IncP Plasmids, and the Ti Plasmid T Pilus Are Composed of Cyclic Subunits^*

Ralf Eisenbrandt, Markus Kalkum, Erh-Min Lai^§, Rudi Lurz, Clarence I. Kado^§, and Erich Lanka^¶

From the Max-Planck-Institut für Molekulare Genetik, Ihnestrasse 73, Dahlem, D-14195 Berlin, Germany and ^§ Davis Crown Gall Group, University of California, Davis, California 95616

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

TrbC propilin is the precursor of the pilin subunit TrbC of IncP conjugative pili in Escherichia coli. Likewise, its homologue, VirB2 propilin, is processed into T pilin of the Ti plasmid T pilus in Agrobacterium tumefaciens. TrbC and VirB2 propilin are truncated post-translationally at the N terminus by the removal of a 36/47-residue leader peptide, respectively. TrbC propilin undergoes a second processing step by the removal of 27 residues at the C terminus by host-encoded functions followed by the excision of four additional C-terminal residues by a plasmid-borne serine protease. The final product TrbC of 78 residues is cyclized via an intramolecular covalent head-to-tail peptide bond. The T pilin does not undergo additional truncation but is likewise cyclized. The circular structures of these pilins, as verified by mass spectrometry, represent novel primary configurations that conform and assemble into the conjugative apparatus.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Horizontal gene transfer mediated by plasmid-borne conjugation from donor to recipient cells is initiated by a cell-to-cell bridging arrangement. These cellular interactions, whose complex is named mating pair formation (Mpf),¹ are initiated by conjugative pili encoded by broad-host range plasmids in Gram-negative bacteria. In the case of Agrobacterium-mediated T-DNA transfer to plant cells, the VirB complex is the Mpf structure (1, 2).

Pili are usually long thin filaments extending from the surface of donor cells and upon close examination appear as tube-like structures with an outer diameter of about 8-10 nm and a central, hydrophilic lumen of 2 nm (3, 4). With both the broad-host range plasmids of the IncP group and the Ti plasmids of the IncRh1 group, promiscuous pilus production requires genes of the Mpf system (5) and the virB operon (6, 7), respectively.

Like the sex pili of F (8), pili of the above plasmids are essential for conjugative DNA transfer. Functional dissection of the Mpf apparatus and the virB genes has shown that DNA transfer is abolished by nonpolar inactivation of the pilin precursor genes or any gene of the pilus assembly machinery (5, 9). Besides DNA transfer, the transport of pilin subunits via the virB-encoded apparatus has been proposed to erect the T pilus (10). It remains unknown, however, if the transmembrane structures of the Mpf system and VirB complex are used as a channel to transfer DNA. Certainly, there exists a close evolutionary relationship between the IncP conjugative apparatus and the T-DNA transfer system (11, 12). In this regard, the bacterial reliance of the pilus for DNA transfer raises a key question on whether or not the conjugative pilus is directly involved not only in bridging the donor to the recipient cell but also serving as a molecular conduit in DNA transmission. This resurrects an earlier key question raised on the possibility that the sex pilus, which appears to be tubular in structure, is used by the donor cell to transfer F-DNA rather than by direct cell-to-cell contact (3, 13). In this regard, the analyses of the structure as well as insights on the mechanism of assembly of the sex pilus will provide valuable clues directed at answering this highly interesting and perplexing question. With both the IncP and Ti plasmid pilus, the pilin subunit represents the critical monomer of the pilus structure. Insights on the physical features of pilin provide the initial step leading to our understanding of the biological role of the sex pilus.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Bacterial Strains-- The Escherichia coli K-12 strain used in this study was JE2571 (leu, thr, fla, pil, str), defective in the production of pili and flagella (14). Bacteria were grown according to (15). Agrobacterium tumefaciens strains C58, A348 (16), and NT1REB (17) were grown according to Lai and Kado (10).

Plasmids-- Plasmids RP4 (18), R751 (19), R388 (20), F (21), pTiC58 (16), pTi15955 (22), pTiA6 (23), pML123 (24), pML123mtrbC45 (5), and pWP471 (25) and the vectors pMS119EH (26) and pGZ119EH/HE (27) have been described previously. A DNA fragment generated by PCR using the synthetic oligodeoxyribonucleotides CGTACTGGTACCTAGAAATAATTTTGTTTAAC and CCGTACGAATTCAGCGATTACAAGGCGTTC, containing recognition sites for KpnI and EcoRI, respectively, was used to introduce the traF gene (RP4 coordinates 46,060-46,591, GenBank^TM accession number M93696) into the KpnI-EcoRI 3.8-kb fragment of pGZ119HE, resulting in plasmid pJH472. For construction of pRE123, an MfeI-PstI 15.5-kb fragment of pMS1756 (27) was ligated to a PstI-XbaI 3.8-kb fragment of vector pGZ119EH. The additional XbaI-MfeI 1.8-kb fragment (R751 nucleotide positions 17,490-19,302, GenBank^TM accession number U67194) was amplified via PCR, creating an XbaI site at the 5'-end, using the following synthetic oligodeoxyribonucleotides: AATCTAGAGTGTAGAATGCGCGAGCA and CAATGGCAATTGCGATTGCTTCGATC. The plasmid encoded the Tra2 core functions of R751. Plasmid pRE178, encoding RP4 trbC, was constructed by ligation of an XbaI-HindIII 3.9-kb fragment of pMS119EH and a PCR-amplified 0.5-kb fragment (RP4 coordinates 19,797-20,244, GenBank^TM accession number M93696) of pDB378 (5). Synthetic oligodeoxyribonucleotides GAGCTCGGTACCCGGGGATCC and ATGGAAGCTTGATTAGGCGAGCCGTCCAGCCGC were used, generating a HindIII site at the 3'-end of the gene. For the expression of virB2 in the absence of the Ti plasmid, the vector pTTQ18 (28) was used. A PCR-amplified 0.4-kb fragment (pTiC58 coordinates 5,748-6,131, GenBank^TM accession number J03320) using synthetic oligodeoxyribonucleotides GGGGTACCCCAAGGAGGTCCGCAATAATG and GGGGTACCCCTTAGCCACCTCCAGTCAGCG, creating a KpnI site at the 5'- and the 3'-end of the gene. The resulting plasmid pUCD4805 containing P_tac-virB2 was further digested by HindIII and ligated to a HindIII 7.6-kb fragment of pUCD1002 (29) to transform A. tumefaciens (30) directly, obtaining the plasmid pUCD4813, which can replicate in both E. coli and A. tumefaciens. Plasmid pUCD4811 is based on the vector pTTQ18 ligated to the HindIII 7.6-kb fragment of pUCD1002 and served as a control. The PCR-amplified regions were verified by nucleotide sequencing (italics in oligodeoxyribonucleotides represent RP4/R751/Ti sequence).

Preparation of Pili-- F pili were purified according to Helmuth and Achtman (31). T pili were purified according to Lai and Kado (10), followed by CsCl density gradient centrifugation. Therefore 8 ml of sucrose gradient-purified T pili were layered on a 6-step CsCl gradient (1.1-1.5 g/ml) and centrifuged at 120,000 × g for 18 h at 5 °C. Fractions containing pili were pooled, dialyzed 3× 5 h against 1 liter of double-distilled water, concentrated by ultrafiltration (Centriprep-10, Amicon Inc.), and stored at 4 °C. For the purification of RP4 pili, JE2571 cells containing the plasmids pML123 and pWP471 were grown on 80 agar plates (23 × 23 cm) for 16 h. Production of pili was induced by 5 µM isopropyl -D-thiogalactopyranoside, included in the medium. Cells were scraped off the plates (60 g of wet cells) using 2 ml of buffer A (10 mM Tris/HCl, pH 7.6) per plate. All the following steps were done at 4 °C, unless cited otherwise. After gentle stirring of the cells for 3 h in buffer A containing 30% sucrose, the suspension was centrifuged (30,000 × g, 20 min) two times. The combined supernatants were poured through glass wool. After dialysis (3× 3 h) against 1 liter of buffer A each and centrifugation of pili and contaminating cells (100,000 × g, 1 h), the pellet was resuspended in buffer B (10 mM Tris/HCl, pH 8.7, 100 mM NaCl) containing 20% sucrose. The sample was layered on top of a continuous sucrose gradient (25-70%, buffer B) and centrifuged for 4.5 h (130,000 × g). Pili, still contaminated by cell debris, were visible as an opal band at a concentration of 52% sucrose. Fractions containing pili were pooled, and the latter four steps (dialysis against buffer A, centrifugation, dilution of the pellet, and sucrose gradient centrifugation) were repeated. The pooled fractions of the second sucrose gradient were pelleted again (100,000 × g, 1 h) and resuspended in buffer A containing 1.39 g/ml CsCl. The sample was placed between two layers of buffer B, the lower containing 1.43 g/ml CsCl and the upper containing 1.15 g/ml. After centrifugation (150,000 × g, 20 h), a band containing pili was visible at a density of 1.33 g/ml. The CsCl gradient centrifugation was repeated a second time. The pili banded at the same density of 1.33 g/ml. Fractions were pooled and dialyzed 3× 5 h against 1 liter of buffer A each. For tryptic purification, equal volumes of the pilus preparation and 0.1 M (NH₄)HCO₃ were mixed with trypsin (1 mg/ml; sequencing grade, modified, Roche Molecular Biochemicals) in 10 mM HCl. After 1 h of rigorous shaking at 37 °C the pili were concentrated by centrifugation (15,000 × g). The pellet was washed two times with 150 µl of double-distilled water. After CsCl gradient centrifugation (150,000 × g, 20 h), fractions containing pili were dialyzed 3 × 5 h against 1 liter of double-distilled water. The pilus preparation was stored at 4 °C for longer than 1 year without significant degradation of pili.

Electron Microscopy-- The negative stain for electron microscopy of pili was carried out as described in Haase et al. (5).

Protein Expression and Analysis-- Cell extracts of E. coli JE2571 cells and pilus preparation were electrophoresed on tricine-SDS-polyacrylamide gels (17%), electroblotted onto nitrocellulose (BA85, Schleicher & Schuell) or polyvinylidene difluoride (Immobilon-CD, Millipore) membranes, and incubated with the IgG fraction of purified anti-RP4 pilus serum (dilution 1:750) as described previously (32). The IgG fraction of rabbit anti-pilus immune serum was prepared using standard procedures (33).

MALDI-TOF Mass Spectrometry-- Analyses were performed using a Bruker Reflex-II time-of-flight spectrometer (Bruker-Franzen, Bremen, Germany) equipped with an UV-nitrogen laser (337.5 nm) and delayed extraction technology. All procedures were carried out at room temperature. Small amounts of cells (A₆₀₀ = 2) were harvested and washed with 1 ml of 0.1% trifluoroacetic acid (34). After centrifuging at 15,000 × g for 4 min, cell pellets were resuspended in 250 µl of 0.1% trifluoroacetic acid. Matrix-crystal layers were prepared on a stainless steel MALDI-MS target by depositing 0.3 µl of matrix solution/sample. 0.3 µl of either cell suspension or pilus preparation were transferred onto the matrix layers, followed by addition of an equal volume of matrix solution. Either trans-3-indoleacrylic acid (40 mg/ml), 4-hydroxy--cyanocinnamic acid (40 mg/ml), or 2-(4-hydoxyphenylazo)benzoic acid (20 mg/ml) in acetonitrile/isopropanol (1:1 v/v) were used as matrices. The dried samples were washed by covering the crystals with 5 µl of ice-cold 5% trifluoroacetic acid solution for a few seconds. 120 single-shot spectra were accumulated for improved signal-to-noise ratio in reflector mode.

Proteolytic On-target Digestion-- To prevent the loss of highly hydrophobic pilin-derived peptides by adsorption to the walls of reaction tubes or pipette tips, proteolytic cleavage of pilin was performed directly on the surface of the sample plate. 0.5 µl of the trypsinized pilus preparation were transferred onto the MS target and mixed with 0.5 µl of freshly prepared trypsin or chymotrypsin (0.25 mg/ml) in 0.1 M (NH₄)HCO₃. The target and a small strip of wet filter paper (~1 cm²) were enclosed into a plastic box without touching the droplet of the digestion mixture to avoid evaporation of the sample. During the digest a 60-W light bulb was adjusted about 40-50 cm above the target, keeping the temperature on the target at 37 °C. After 1-6 h of digestion the cover was removed, and 0.5 µl of the working matrix solution were added to the liquid sample. The vacuum-dried sample spot was washed shortly with 5% ice-cold trifluoroacetic acid just before MALDI-MS analyses.

Sequencing and Amino Acid Composition Analysis of RP4 and T pilin-- C-terminal (35) and N-terminal sequencing was performed using an ABI 490 series protein sequencer system. For amino acid composition, pili were analyzed using a Beckman 6300 amino acid analyzer utilizing sodium citrate buffer system.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The RP4 Pilus Subunit Originates from trbC-- For identification of the RP4 pilus subunit, two complementing strategies were followed, immunological detection of the pilin and mass spectrometric analysis. A purified pilus preparation was a prerequisite for both of these approaches. The bald E. coli strain JE2571, defective for the production of extracellular, chromosomally encoded filaments, facilitated the purification of conjugative RP4 pili. Pili were detectable only when cells were grown on semi-solid surfaces like agar plates but not in liquid media. Low concentrations (5 µM) of isopropyl -D-thiogalactopyranoside were used to keep an acceptable balance between cell growth inhibition due to expression of the Mpf system and pilus overproduction. A five-step procedure for obtaining purified pili was followed (see "Experimental Procedures"). The purification was based on the detachment of pili from cells in high concentration of sucrose and a combination of two types of gradient centrifugation, sedimentation and equilibrium. The progress of the elimination of contaminants was monitored by electron microscopy and gel electrophoresis. We found that the protein content of purified denatured pili can be stained with silver but not with Coomassie Brilliant Blue or other protein dyes.

Electron microscopy showed that filaments of the purified RP4 pilus preparation tend to aggregate, indicated by the formation of bundles (Fig. 1A). The same observation was made with pili obtained from the IncP plasmid R751 (data not shown). In contrast to F and T pili, RP4 and R751 pili appeared to be rigid and inflexible.

View larger version (119K): [in this window] [in a new window]   Fig. 1.   Pilus morphology. Electron micrographs of purified RP4 (A), T (B), and F pili (C) are shown. Preparations were negatively stained with 1% uranyl acetate.

The T pilus was purified as described previously (10) and subjected to further purification by density gradient centrifugation in CsCl (see "Experimental Procedures"). In contrast to RP4 and R751 pili, the T pilus filaments were long and flexuous structures (Fig. 1B). For comparison, F pili (Fig. 1C) were purified from F⁺ E. coli cells following published protocols (31). Electron microscopic examination of all pilus preparations revealed some pili possessing a knob-like structure at one end (data not shown). Such an observation is reminiscent of the knob-like structure reported previously for the F pilus (36). The pili of RP4, R751, and T measure a diameter of 10 nm, confirming the size of T pilus reported previously (10). The diameter of F pilus is 8 nm with a 2-nm hollow core (21).

The RP4 pilus preparation was used for antiserum production. The antiserum recognized the filaments by immunogold electron microscopy (data not shown). In solid phase immunoassays, the anti-RP4 pilus serum did not cross-react with any other of 10 Tra2-encoded Mpf proteins except with TrbC, when the genes (except trbD) were expressed and tested separately (data not shown). Antisera directed against Tra2 proteins (except against TrbD) did not show significant reactions with the pilus preparation, indicating that the trbC gene encodes the precursor for a major pilus subunit (data not shown). The Tra2 core region of IncP plasmids encode components that are essential for the assemblage of the pilus from pilin subunits (5). However, when the R751 Mpf genes were expressed in a pilus-producing strain, weak cross-reactions of the antiserum were seen that might indicate impurities in the pilus preparation used as an antigen or minor subunits of the pilus (Fig. 2, lane d).

View larger version (15K): [in this window] [in a new window]   Fig. 2.   Processed forms of RP4 TrbC and Ti VirB2. Solid phase immunoassay of pilus preparations (lanes e and j) and E. coli JE2571 (lanes a-d/f) and A. tumefaciens (lanes g-i) cell extracts containing the plasmids indicated. Lane a, pRE178 (trbC+, RP4); lane b, pRE178/pJH472 (trbC+, traF+, RP4); lane c, pML123/pWP471 ([trbB-L]+, traF+, RP4); lane d, pRE123/pWP471 ([trbB-L]+, R751, traF+, RP4); lane e, RP4 pilus preparation; lane f, pMS119EH (vector); lane g, pUCD4810 (vector); lane h, pUCD4813 (virB2+, pTiC58); lane i, pTiC58; lane j, T pilus preparation. The molecular masses for Pre-ProTrbC (15 kDa), ProTrbC (11 kDa), TrbC* (8.5 kDa), TrbC (6.8 kDa), and processed VirB2 (7.2 kDa) were determined with reference to the standard molecular mass markers (Rainbow labeled markers, low range, Amersham Pharmacia Biotech): Car, carbonic anhydrase (30.0 kDa); Try; trypsin inhibitor (21.5 kDa); Lys, lysozyme (14.3 kDa), and Apr, aprotinin (6.5 kDa).

Multiple Processing of TrbC Propilin-- The trbC gene expressed in E. coli strain JE2571(pRE178) yielded two sizes of TrbC product, as judged by solid phase immuno assay using the IgG fraction of anti-RP4 pilus serum (Fig. 2). An 11-kDa ^ProTrbC and an 8.7-kDa TrbC* band are clearly visible (Fig. 2, lane a), whereas these bands are no longer detected when TraF is present. Instead a 6.8-kDa band representing TrbC is observed (Fig. 2, lane b). A notable size reduction from 8.7 kDa to 6.8 kDa suggested an additional processing reaction (see below). The latter peptide is identical in size as that found in the RP4 pilus preparation (Fig. 2, lane e) as well as in cell extracts containing the complete RP4 Mpf system (Fig. 2, lane c). A faint band of 15 kDa (Fig. 2, lane b) corresponds to the unprocessed ^PreProTrbC product of trbC. The anti-RP4 pilus serum cross-reacts with a TrbC preparation from R751, indicating that the four-residue difference of the TrbC core sequence between RP4 and R751 (Fig. 3) has no effect on epitope recognition. The pilins are of identical size (Fig. 2, lanes c and d).

View larger version (55K): [in this window] [in a new window]   Fig. 3.   The core region of TrbC homologues is highly conserved. Sequences of directly related TrbC-like proteins share the same background color. Dark yellow, TrbC of IncP plasmids; yellow, TrbC of the Ti plasmids transfer region; and light yellow, VirB2 analogues of the Ti plasmids virulence region. Identical amino acid residues in all sequences have a red background. Residues that differ in the core sequences of the subfamilies are shown with a blue background. A sequence correction for pTiA6 VirB2 is marked by a green background. The proposed arginine (23) must be changed to an alanine. The amino acid change was deduced from DNA sequence analysis. Numbers indicate the first and the last sequence position of the TrbC homologues corresponding to the position in the whole protein. Trans-membranal helix (TMH) marks the positions of transmembrane helices in RP4 TrbC predicted by the PHDhtm computer program (56). LepB marks the cleavage site of E. coli leader peptidase I (LepB) on RP4 TrbC, whereas TraF indicates the site of maturation of RP4 TrbC by RP4 TraF. The arrow on the C-terminal part marks the cleavage site on RP4 TrbC of the yet unknown host-encoded peptidase. References (GenBankTM/EMBL data base accession numbers are given in parenthesis): TrbCRP4, (57) (M93696); TrbCR751, (19) (U67194); TrbCpTiC58, (58) (AF057718); TrbCpTi15955, (59) (U43675); TrbCpNGR234a, (60) (U00090); VirB2pTiC58, (61) (X53264); VirB2pRiA4, (62) (AB011800); VirB2pTi15955, (22) (P05351); VirB2pTiA6, (23) (P09776).

VirB2 Propilin Processing Is Independent of the Ti Plasmid-- The VirB2 propilin of 12.3-kDa is post-translationally processed into a 7.2-kDa pilin in A. tumefaciens (37). The processing reaction is rapid since only the 7.2-kDa processed form of VirB2 is detected immediately after expression of the virB2 gene (Fig. 2, lane i). The band corresponds to the one emerging from a purified T pilus preparation (Fig. 2, lane j). When the virB2 gene alone is expressed under the control of a tac promoter in vector pTTQ18 and in the absence of other Ti plasmid genes, the 7.2-kDa processed product is still formed, as judged by solid phase immunoassays (Fig. 2, lane h). The 12.3-kDa propilin remains undetectable either in the presence or absence of the Ti plasmid. The VirB2 propilin processing reaction therefore appears to be independent of other Ti plasmid genes, a finding that suggests the presence of a processing enzyme encoded by the Agrobacterium chromosome.

The RP4 and T Pilins Contain a Highly Conserved Core Region-- The sequence alignment of several related potential precursors for pilins indicates the subdivision into three apparent groups: the IncP TrbC proteins (Fig. 3, dark yellow background), the TrbC proteins of the Ti plasmid conjugative transfer system (Fig. 3, yellow background), and the Ti plasmids VirB2 proteins of the tDNA transfer system (Fig. 3, light yellow background). Within each subgroup the primary structure is highly conserved. However, the significance of this alignment becomes evident by the conserved residues in all sequences (Fig. 3, red background).

Verification of the conserved TrbC core peptide was achieved by examining the N and C termini of the RP4 propilin itself and its intermediates. The N-terminal sequence of the 15-kDa ^PreProTrbC was MTTAVPFRL as predicted for unprocessed RP4 propilin. However, the 11-kDa ^ProTrbC revealed the same N-terminal sequence, suggesting that truncation took place from the C terminus. The N terminus of the 8.7-kDa TrbC* peptide started at position 37 with the sequence SEGTGGSLPY. Thus, using a method with a predictive accuracy of 75-80% for identifying secretory signal sequences and for predicting the site of cleavage between a signal sequence and the mature exported protein (38), the clipped portion of ^ProTrbC likely constitutes the signal peptide. TrbC overproduced in the absence of TraF displays an m/z value of 8522.2 in the mass spectrometer. This mass corresponds exactly with the calculated mass of protonated TrbC containing residues from position Ser-37 to Ala-118, with the remaining flanking sequence spanning the core region (Fig. 3). In the presence of TraF, the mature pilin TrbC is formed but it is recalcitrant to N- and C-terminal sequencing, suggesting that these termini are masked within the structure of the pilin. The TrbC processing pathway is ^PreProTrbC  ^ProTrbC  TrbC*  TrbC, the latter product being the mature RP4 pilin.

Processed TrbC of RP4/R751 and VirB2 of Ti-Vir Are Modified-- We used MALDI-TOF-MS (39) for the analysis of pilin in the purified pilus preparations of RP4, Ti-Vir, and F (Fig. 4). The crucial trick in the detection of pilins was the selection of appropriate matrices such as trans-3-indoleacrylic acid. Spectra acquired with trans-3-indoleacrylic acid show a better signal-to-noise ratio and a higher sensitivity in the detection of mature and premature pilins than those that were recorded using 2-(4-hydoxyphenylazo)benzoic acid or 4-hydroxy--cyanocinnamic acid. To evaluate the reliability of the system, we first analyzed F pili with well defined characteristics. The m/z determined for [M+H]⁺ ions of F pilin coincides with the calculated value of 7228.1 Da (40). The molecular mass corresponds to the 70 C-terminal amino acid residues of the F-factor TraA precursor protein, acetylated at the N terminus. The peak at 3614.6 indicated the m/z of the double-charged, double-protonated molecular ion (Fig. 4). The data demonstrate that mass spectrometry is an extremely useful tool for pilus characterization.

View larger version (20K): [in this window] [in a new window]   Fig. 4.   Pilin MALDI-TOF mass spectrometry. The profile indicates a mass to charge ratio of m/z 7228.1 [M+H]+; m/z 3614.6 [M+2H]2+ for the F pilin, an m/z 8119.2 [M+H]+; m/z 4060.1 [M+2H]2+ for the RP4 pilus subunit, and an m/z 7184.3 [M+H]+; m/z 3592.1 [M+2H]2+ for the T pilin. The external standard for calibration of pilus subunits was: cytochrome C, m/z 12361.1 [M+H]+; m/z 6179.7 [M+2H]2+. The inset shows a MALDI-TOF mass spectrum detail of whole bacterial cells containing the R751 (upper curve) and the RP4 (lower curve) Mpf system, respectively. Labeled peaks show the m/z for the corresponding protonated pilus subunits.

To unequivocally identify TrbC as a pilus subunit, we took advantage of the slight sequence difference between the R751 and RP4 pilin. The core regions of both TrbC proteins differ in four amino acids (Fig. 3), which results in an overall molecular mass difference of a single sulfur atom (32 Da). The analysis of both pilins, RP4 and R751, showed R751 pilin to be 32 Da heavier than that of RP4, indicating that the signals recorded indeed originate from TrbC (Fig. 4, inset).

The interpretation of the RP4 and R751 pilus spectra is based on mass calculations of TrbC molecules beginning at position Ser-37 at the N terminus and lacking residues at the C terminus. However, no calculated molecular masses of TrbC [M+H]⁺ corresponding to the detected m/z values of 8119.2 (RP4) and 8151.6 (R751) can be assigned (Fig. 4). For RP4/R751 TrbC, the calculated molecular masses of [M+H]⁺ closest to m/z of 8119.2/8151.6 were those of the molecules ending at position Gly-114, i.e. values of 8137.6/8169.6 Da.

Compositional analysis of the purified pilus preparation was in good correspondence with that of the proposed mature T pilin of 74 C-terminal amino acids when a cleavage reaction takes place between residue Ala-47 and Gln-48 of the VirB2 propilin (37, 41). Previous N-terminal sequencing attempts of the mature pilin failed to release the terminal residue, suggesting that the N-terminal residue Gln-48 is recalcitrant to Edman degradation. MALDI-TOF-MS analysis of the mature pilin produced an m/z value of 7184.3. This value differs from the mass of 7202.3 Da calculated from the primary structure of the protonated T pilin. Like the discrepancies observed for TrbC of RP4 and R751, the difference between the molecular mass derived from mass spectrometry and from the primary sequence of the T pilin was always 18 Da. This difference in mass clearly represents the loss of one molecule of water. Thus, a loss of one molecule of water within the mature pilin TrbC and the T pilin would result from an intramolecular amide linkage or the formation of an ester bond.

Intramolecular Covalent Head to Tail Linkage of TrbC and VirB2-- The RP4 pilus itself generates an m/z signal of 8119.2. Interestingly, the pilus resists protease digestion. The protease-treated pilus appeared indifferent from untreated pilus preparations as judged by electron microscopy, and no signals representing pilin fragments were seen by mass spectrometry (data not shown). An on-target digestion procedure employing trypsin and chymotrypsin (42) was therefore used to generate peptides that were subsequently analyzed by MALDI-TOF-MS (Table I and Fig. 5). Residues Ser-37 and Gly-114 are apparently next to each other in peptides T1, C1, C2, and C4, suggesting that a head-to-tail linkage of these amino acid residues had taken place to generate a circular peptide structure. In addition to the expected [M+H]⁺ masses representing the peptides smaller than the precursor TrbC molecule, a signal at m/z 8136.7 corresponding to a linear TrbC peptide comprised of 78 residues was observed (Fig. 5). This signal increases in intensity after prolonged digestion with trypsin (data not shown). Digestion with chymotrypsin gradually reduced the intensity of this signal with the concomitant increase in the signals of the resultant peptides derived from the linearized TrbC (Table I).

View this table: [in this window] [in a new window]   Table I MALDI-MS peptide mapping analysis of the RP4 pilin The peptides found by MALDI-MS after different times of digestion by either trypsin (T) or chymotrypsin (C) are listed in the table. Amino acid numbering is related to the mature pilin. Characters in italics indicate monoisotopic m/z of [M+H]+, and normal font indicates average m/z. L marks the linearized peptide. Numbering of peptides is arranged by increasing m/z.  describes the deviation from the theoretical m/z value in ppm.

View larger version (29K): [in this window] [in a new window]   Fig. 5.   RP4 pilin has a circular structure. The structure of RP4 pilin was verified by mass spectrometric analysis of tryptic (upper spectrum; blue semicircles) and chymotryptic on-target digests (lower curve; red semicircles). The signals are marked according to the peptide numbering in Table I (blue, tryptic, and red, chymotryptic digest). Due to the purification by tryptic digest prior to analysis, the TrbC peptide marked T2 was found in the chymotryptic on-target digest as well. Peptide TC was the product of a combined, tryptic/chymotryptic digest. The upper left blow-up shows the peak of the doubly charged pilin ions (Mc+2H+, circular molecule; L+2H+, linear molecule), and the upper right blow-up shows the peaks of the singly charged TrbC molecule ions (Mc, circular molecule; L, linear molecule).

The T pilin was likewise digested by the same on-target protocol in trans-3-indoleacrylic acid using trypsin digestion followed by chymotrypsin treatment. Two peptides that were generated showed one began at Thr-69 at the N terminus and ended with Phe-F24 at its C terminus, whereas the other began with residue Gly-62 and ended with Arg-44. In the T pilin, an internal residue Asp-55 and the C-terminal residue Gly-121 are potential residues bearing carboxyl groups that may interact with the amino group of residue Gln-48 located at the N terminus of the T pilin to form a peptide linkage. The resulting chymotryptic peptides ruled out residue Asp-55 and implicated residue Gly-121 as interacting with Gln-Q48 to form the potential peptide linkage. Hence, both TrbC and T pilin appear to be cyclic peptides.

T Pilin Is Cyclized in the Absence of the Ti Plasmid-- Biogenesis of the T pilus takes place when the virB genes of the Ti plasmid are expressed. VirB2 must be processed into the 7.2-kDa T pilin, which is assembled into the T pilus, and the above evidence indicates that the T pilin represents the cyclized subunit of the T pilus. It was not clear however, whether cyclization requires other Ti plasmid genes. Therefore, VirB2 was produced in the presence and absence of the Ti plasmid and analyzed for both processing and cyclization. An m/z signal of 7184.2 is produced when VirB2 alone was analyzed by MALDI-TOF-MS.² The signal is absent in A. tumefaciens cells containing the virB2 cloning vector pTTQ18 only in uninduced cells containing pTiC58 (Fig. 7) and in cells containing no Ti plasmid. Thus, it is apparent that the biogenesis of the T pilin through specific cleavage and cyclization does not require the Ti plasmid. Evidently, Agrobacterium host factors may play a specific role in cyclization since VirB2 undergoes processing but not cyclization in E. coli.²

Whole Bacterial Cells Are Suitable for Pilin Detection by Mass Spectrometry-- Bald E. coli strain JE2571 and bald A. tumefaciens strain NT1REB with and without their respective test plasmids were directly subjected to mass spectrometry. As demonstrated in Fig. 6, m/z signals were clearly recognizable for the protonated pilins of RP4, R751, and F in E. coli. The IncW plasmid R388 was also tested, and its pilin generated an m/z signal at 7173.5 (Fig. 6). Likewise, an m/z signal of 7184.2 representing the T pilin [M+H]⁺ in A. tumefaciens NT1REB(pTiC58) was plainly observed (Fig. 7). A. tumefaciens harboring either the octopine Ti plasmids TiA6 or Ti15955 were analyzed by the intact cell procedure (see "Experimental Procedures"). The predicted amino acid sequences of VirB2 of these plasmids are highly homologous (Fig. 3); thus, an m/z signal equal to that of VirB2 from the nopaline Ti plasmid pTiC58 is expected. Analysis of the strain harboring pTi15955 yielded an m/z peak of 7214.4 (Fig. 7), a value corresponding to the [M+H]⁺ mass of processed pTi15955 VirB2 that has been cyclized by the loss of a water molecule during peptide bond formation. Analysis of pTiA6 produced an m/z peak at 7215.2 (Fig. 7), a value that does not correspond to the [M+H]⁺ mass of processed VirB2 based on published amino acid sequence data, which showed an arginine residue rather than the conserved alanine observed in all other VirB2 polypeptides (Fig. 3). We re-sequenced virB2 of pTiA6 and found the codon was indeed GCT (encoding Ala) rather than the published codon CGT (encoding Arg) (23). Correction of residue 92 into alanine provided uniform agreement that processed VirB2 has a mass lacking the mass of a single water molecule.

View larger version (26K): [in this window] [in a new window]   Fig. 6.   Pilin spectra of whole cells. Extracellular filaments were measured on whole E. coli cells by MALDI-MS. Peaks corresponding to the expected [M+H]+ masses of the respective pilus subunits are indicated by the mass values. JE2571 strains containing, from bottom to top, no plasmid, plasmids R388, F, R751, and RP4 were used.

View larger version (19K): [in this window] [in a new window]   Fig. 7.   Ti pilus spectra of A. tumefaciens cells. Mass spectra of induced (i) A. tumefaciens strains containing either plasmid pTiA6, pTiC58, or pTi15955 are shown in comparison to noninduced (ni) cells containing plasmid pTiC58. Only the induced (i) cells show a signal at the mass to charge ratio, corresponding to the respective protonated T pilin masses (indicated by the mass value).

Upon further analysis, we found that bald strains are not required since the noise level is relatively low. Moreover, it was demonstrated recently that the mass of various proteins from whole bacterial cells can be measured by mass spectrometry (34, 43, 44).

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

We demonstrated that mass spectrometry accurately measures the molecular mass of pilin encoded by IncW/IncF (both acetylated) and IncP/IncRh1 plasmids (both of circular structure). These findings for the first time explain the discrepancy between the measured and the calculated masses of IncP and T pilins. For thin pili of IncI1 plasmids, a mass discrepancy of 259 Da between calculated and measured values was reported (45). These findings might correspond with modifications in analogy to the recently shown covalent addition of phosphate, glycerophosphate, as well as glycosylation for type IV pili in Neisseria (46). Although none of these modifications was found in our investigations, a post-translational modification seems to be a common motif for pilins.

For IncP and T pilins, the water molecule would be lost upon the generation of a peptide bond or more remotely by an ester bond. Pilus subunits resist degradation by acid treatment, including exposure to organic acid matrices, conditions used herein that would destroy ester bonds readily. The formation of a peptide linkage would argue that the mature pilin is likely cyclized. This argument is supported by the mass analyses of the peptides generated from these pilins. In every instance, an intramolecular head-to-tail association is found by the pairing of the N-terminal residue with its C-terminal residue within the mature pilin.

The mechanism of pilin cyclization remains to be elucidated. We have explored several potential mechanisms of peptide bond formation in situ. For example, such bonds can form by peptidyltransferase on ribosomes (47), by nonribosomal catalysis as in the formation of the circular antibiotic gramicidin S (48), by the generation of extein (49), by a reverse reaction of proteolysis, catalyzed by trypsin/chymotrypsin (50, 51), and by a mechanism yet to be described. Whichever mechanism operates, the biogenesis of the mature pilin appears to be a highly efficient reaction involving cleavage and ligation into a circular peptide. The absence of linear peptides supports this notion. Moreover, genetic evidence adds further credence to this idea, whereby analysis of a TrbC bearing a deletion abutted into position Gly-114, the target residue of TraF peptidase, revealed the absence of cyclization either in the presence or absence of TraF. In the absence of TraF, TrbC remains uncyclized, suggesting that the removal of the four amino acid residues (Ala-115Ala-118) by TraF peptidase is an intrinsic step in the cyclization of the pilin by the formation of the peptide bond between residues Ser-37 and Gly-114. At present, however, our data do not exclude the possibility that an enzyme other than the peptidase might be involved in forming the peptide linkage. Strategies to elucidate this mechanism are being explored, including genetic approaches directed against the trbC and traF genes.

The results of parallel studies on the cyclization of the T pilin appear to support the notion that another enzyme is involved in peptide bond formation. We have recently found that the T pilin becomes circularized in A. tumefaciens strains but not in E. coli.² In addition, the present work reported herein shows that VirB2 propilin is processed and is cyclized in the absence of other Ti plasmid genes. Since there is no TraF functional homologue present on the Ti plasmid except for a weak homology between TraF and the Ti plasmid-coded VirD4 (32), the pilin cyclization enzyme appears to be of chromosomal origin. Identification of an Agrobacterium chromosome-encoded specific cyclization enzyme is one of the key aims of the current research.

The recognition target of the putative peptidyl cyclase on the pilin also remains to be explored. Membrane topology studies using TnPhoA fusions have predicted that the N and C termini of VirB2 protein protrude into the periplasm with the remaining two hydrophobic regions or transmembrane helices (Fig. 3, trans-membranal helix (TMH)) anchored to the inner membrane (52). Two trans-membranal helix regions are also present in TrbC propilin (Fig. 3). The location of these propilins may be a prerequisite for the processing and cyclization reactions. Following specific processing reactions, the resultant N- and C-terminal residues (Ser-37/Gly-114 for TrbC and Gln-48/Gly, Ser-121 for VirB2) might be brought into close molecular contact that facilitates peptide bonding leading to the cyclic pilin product.

Clearly, the formation of pilin subunits bearing a cyclic configuration in the biogenesis of the sex pilus is novel for bacterial appendages and represents an evolutionary significant architecture required by bacteria and presumably other higher microorganisms such as Chlamydomonas-bearing appendages similar to pili. We are not arguing that cyclic peptides are absent in microorganisms but present the case for a morphologically visible structure composed of a cyclic monomeric peptide. Biologically active cyclic peptides are known as for example the bacteriocin AS-48 of 70 residues secreted by Enterococcus faecalis A-48 (53). The antibiotic activity of AS-48 is exerted by the insertion of the peptide into the cytoplasmic membrane of the target cell, leading to leakage of the cytoplasm (54, 55). The process of peptide cyclization of AS-48 is unknown.

Because the processed pilin of RP4 and Ti plasmids are highly resistant to generalized proteolytic cleavage, it is tempting to propose that a cyclized peptide provides added stability and integrity of the pilus structure, which must extend into the hostile environment. Moreover, as subunits, a cyclic pilin structure provides neat molecular building blocks, the combination of which generates the long filamentous pilus. Notwithstanding here is the need for such pilus lengths to sequester by the donor distant recipients or, as in the case of the horizontal transmission of the T-DNA, such lengthy filaments are needed to span the cuticular layer, the cell wall, and the cytoplasmic membrane of the plant cell. From the data presented herein, the initial goal of defining the structural moiety of the conjugative P and T pilus has been achieved.

	ACKNOWLEDGEMENTS

We thank Hans Lehrach for generous support. We thank Eberhard Scherzinger for help in preparation of the anti-pilus serum, Christine Gauß for C-terminal sequencing experiments on RP4 TrbC, and the Protein Structure Laboratory of the University of California, Davis, for amino acid composition analysis.

	FOOTNOTES

^* This work was supported by Sonderforschungsbereich Grant 344/A8 of the Deutsche Forschungsgemeinschaft and by National Institute of Health Public Health Services Grant GM45550.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Supported by BMBF Grant 0311018.

^¶ To whom correspondence should be addressed. Tel.: 49-30-8413-1696; Fax: 49-30-8413-1130; E-mail: lanka@mpimg-berlin-dahlem. mpg.de.

² E. Lai, R. Eisenbrandt, M. Kalkum, E. Lanka, and C. I. Kado, unpublished information.

	ABBREVIATIONS

The abbreviations used are: Mpf, mating pair formation; MALDI, matrix-assisted laser desorption/ionization; MS, mass spectrometry; TOF, time of flight; m/z, mass to charge ratio; kb, kilobase; PCR, polymerase chain reaction.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				S. Kutter, R. Buhrdorf, J. Haas, W. Schneider-Brachert, R. Haas, and W. Fischer Protein Subassemblies of the Helicobacter pylori Cag Type IV Secretion System Revealed by Localization and Interaction Studies J. Bacteriol., March 15, 2008; 190(6): 2161 - 2171. [Abstract] [Full Text] [PDF]

				C. K. L. Wang, Q. Kaas, L. Chiche, and D. J. Craik CyBase: a database of cyclic protein sequences and structures, with applications in protein discovery and engineering Nucleic Acids Res., January 11, 2008; 36(suppl_1): D206 - D210. [Abstract] [Full Text] [PDF]

				S.-P. Nuccio and A. J. Baumler Evolution of the Chaperone/Usher Assembly Pathway: Fimbrial Classification Goes Greek Microbiol. Mol. Biol. Rev., December 1, 2007; 71(4): 551 - 575. [Abstract] [Full Text] [PDF]

				K. A. Aly and C. Baron The VirB5 protein localizes to the T-pilus tips in Agrobacterium tumefaciens Microbiology, November 1, 2007; 153(11): 3766 - 3775. [Abstract] [Full Text] [PDF]

				J. Zupan, C. A. Hackworth, J. Aguilar, D. Ward, and P. Zambryski VirB1* Promotes T-Pilus Formation in the vir-Type IV Secretion System of Agrobacterium tumefaciens J. Bacteriol., September 15, 2007; 189(18): 6551 - 6563. [Abstract] [Full Text] [PDF]

				J. Andrzejewska, S. K. Lee, P. Olbermann, N. Lotzing, E. Katzowitsch, B. Linz, M. Achtman, C. I. Kado, S. Suerbaum, and C. Josenhans Characterization of the Pilin Ortholog of the Helicobacter pylori Type IV cag Pathogenicity Apparatus, a Surface-Associated Protein Expressed during Infection. J. Bacteriol., August 1, 2006; 188(16): 5865 - 5877. [Abstract] [Full Text] [PDF]

				A. Paschos, G. Patey, D. Sivanesan, C. Gao, R. Bayliss, G. Waksman, D. O'Callaghan, and C. Baron Dimerization and interactions of Brucella suis VirB8 with VirB4 and VirB10 are required for its biological activity PNAS, May 9, 2006; 103(19): 7252 - 7257. [Abstract] [Full Text] [PDF]

				A. Karnholz, C. Hoefler, S. Odenbreit, W. Fischer, D. Hofreuter, and R. Haas Functional and Topological Characterization of Novel Components of the comB DNA Transformation Competence System in Helicobacter pylori J. Bacteriol., February 1, 2006; 188(3): 882 - 893. [Abstract] [Full Text] [PDF]

				A. Carle, C. Hoppner, K. Ahmed Aly, Q. Yuan, A. den Dulk-Ras, A. Vergunst, D. O'Callaghan, and C. Baron The Brucella suis Type IV Secretion System Assembles in the Cell Envelope of the Heterologous Host Agrobacterium tumefaciens and Increases IncQ Plasmid pLS1 Recipient Competence Infect. Immun., January 1, 2006; 74(1): 108 - 117. [Abstract] [Full Text] [PDF]

				J. P. Mulvenna, C. Wang, and D. J. Craik CyBase: a database of cyclic protein sequence and structure Nucleic Acids Res., January 1, 2006; 34(suppl_1): D192 - D194. [Abstract] [Full Text] [PDF]

				C. Hoppner, A. Carle, D. Sivanesan, S. Hoeppner, and C. Baron The putative lytic transglycosylase VirB1 from Brucella suis interacts with the type IV secretion system core components VirB8, VirB9 and VirB11 Microbiology, November 1, 2005; 151(11): 3469 - 3482. [Abstract] [Full Text] [PDF]

				K. Daehnel, R. Harris, L. Maddera, and P. Silverman Fluorescence assays for F-pili and their application Microbiology, November 1, 2005; 151(11): 3541 - 3548. [Abstract] [Full Text] [PDF]

				P. K. Judd, R. B. Kumar, and A. Das Spatial location and requirements for the assembly of the Agrobacterium tumefaciens type IV secretion apparatus PNAS, August 9, 2005; 102(32): 11498 - 11503. [Abstract] [Full Text] [PDF]

				Q. Yuan, A. Carle, C. Gao, D. Sivanesan, K. A. Aly, C. Hoppner, L. Krall, N. Domke, and C. Baron Identification of the VirB4-VirB8-VirB5-VirB2 Pilus Assembly Sequence of Type IV Secretion Systems J. Biol. Chem., July 15, 2005; 280(28): 26349 - 26359. [Abstract] [Full Text] [PDF]

				H.-H. Hwang and S. B. Gelvin Plant Proteins That Interact with VirB2, the Agrobacterium tumefaciens Pilin Protein, Mediate Plant Transformation PLANT CELL, November 1, 2004; 16(11): 3148 - 3167. [Abstract] [Full Text] [PDF]

				R. L. Harris and P. M. Silverman Tra Proteins Characteristic of F-Like Type IV Secretion Systems Constitute an Interaction Group by Yeast Two-Hybrid Analysis J. Bacteriol., August 15, 2004; 186(16): 5480 - 5485. [Abstract] [Full Text] [PDF]

				H.-J. Yeo, Q. Yuan, M. R. Beck, C. Baron, and G. Waksman Structural and functional characterization of the VirB5 protein from the type IV secretion system encoded by the conjugative plasmid pKM101 PNAS, December 23, 2003; 100(26): 15947 - 15952. [Abstract] [Full Text] [PDF]

				D. J. Craik, N. L. Daly, I. Saska, M. Trabi, and K. J. Rosengren Structures of Naturally Occurring Circular Proteins from Bacteria J. Bacteriol., July 15, 2003; 185(14): 4011 - 4021. [Full Text] [PDF]

				S. B. Gelvin Agrobacterium-Mediated Plant Transformation: the Biology behind the "Gene-Jockeying" Tool Microbiol. Mol. Biol. Rev., March 1, 2003; 67(1): 16 - 37. [Abstract] [Full Text] [PDF]

				C. Rabel, A. M. Grahn, R. Lurz, and E. Lanka The VirB4 Family of Proposed Traffic Nucleoside Triphosphatases: Common Motifs in Plasmid RP4 TrbE Are Essential for Conjugation and Phage Adsorption J. Bacteriol., February 1, 2003; 185(3): 1045 - 1058. [Abstract] [Full Text] [PDF]

				T. D. Lawley, M. W. Gilmour, J. E. Gunton, D. M. Tracz, and D. E. Taylor Functional and Mutational Analysis of Conjugative Transfer Region 2 (Tra2) from the IncHI1 Plasmid R27 J. Bacteriol., January 15, 2003; 185(2): 581 - 591. [Abstract] [Full Text] [PDF]

				L. Krall, U. Wiedemann, G. Unsin, S. Weiss, N. Domke, and C. Baron Detergent extraction identifies different VirB protein subassemblies of the type IV secretion machinery in the membranes of Agrobacteriumtumefaciens PNAS, August 20, 2002; 99(17): 11405 - 11410. [Abstract] [Full Text] [PDF]

				T. Murata, M. Ohnishi, T. Ara, J. Kaneko, C.-G. Han, Y. F. Li, K. Takashima, H. Nojima, K. Nakayama, A. Kaji, et al. Complete Nucleotide Sequence of Plasmid Rts1: Implications for Evolution of Large Plasmid Genomes J. Bacteriol., June 15, 2002; 184(12): 3194 - 3202. [Abstract] [Full Text] [PDF]

				A. Tauch, S. Schneiker, W. Selbitschka, A. Puhler, L. S. van Overbeek, K. Smalla, C. M. Thomas, M. J. Bailey, L. J. Forney, A. Weightman, et al. The complete nucleotide sequence and environmental distribution of the cryptic, conjugative, broad-host-range plasmid pIPO2 isolated from bacteria of the wheat rhizosphere Microbiology, June 1, 2002; 148(6): 1637 - 1653. [Abstract] [Full Text] [PDF]

				N. K. Williams, P. Prosselkov, E. Liepinsh, I. Line, A. Sharipo, D. R. Littler, P. M. G. Curmi, G. Otting, and N. E. Dixon In Vivo Protein Cyclization Promoted by a Circularly Permuted Synechocystis sp. PCC6803 DnaB Mini-intein J. Biol. Chem., March 1, 2002; 277(10): 7790 - 7798. [Abstract] [Full Text] [PDF]

				E.-M. Lai, R. Eisenbrandt, M. Kalkum, E. Lanka, and C. I. Kado Biogenesis of T Pili in Agrobacterium tumefaciens Requires Precise VirB2 Propilin Cleavage and Cyclization J. Bacteriol., January 1, 2002; 184(1): 327 - 330. [Abstract] [Full Text] [PDF]

				E. Sagulenko, V. Sagulenko, J. Chen, and P. J. Christie Role of Agrobacterium VirB11 ATPase in T-Pilus Assembly and Substrate Selection J. Bacteriol., October 15, 2001; 183(20): 5813 - 5825. [Abstract] [Full Text] [PDF]

				V. T. Lee and O. Schneewind Protein secretion and the pathogenesis of bacterial infections Genes & Dev., July 15, 2001; 15(14): 1725 - 1752. [Full Text] [PDF]

				V. Sagulenko, E. Sagulenko, S. Jakubowski, E. Spudich, and P. J. Christie VirB7 Lipoprotein Is Exocellular and Associates with the Agrobacterium tumefaciens T Pilus J. Bacteriol., June 15, 2001; 183(12): 3642 - 3651. [Abstract] [Full Text]

				R. Eisenbrandt, M. Kalkum, R. Lurz, and E. Lanka Maturation of IncP Pilin Precursors Resembles the Catalytic Dyad-Like Mechanism of Leader Peptidases J. Bacteriol., December 1, 2000; 182(23): 6751 - 6761. [Abstract] [Full Text]

				S. Hapfelmeier, N. Domke, P. C. Zambryski, and C. Baron VirB6 Is Required for Stabilization of VirB5 and VirB3 and Formation of VirB7 Homodimers in Agrobacterium tumefaciens J. Bacteriol., August 15, 2000; 182(16): 4505 - 4511. [Abstract] [Full Text]

				S. Rashkova, X.-R. Zhou, J. Chen, and P. J. Christie Self-Assembly of the Agrobacterium tumefaciens VirB11 Traffic ATPase J. Bacteriol., August 1, 2000; 182(15): 4137 - 4145. [Abstract] [Full Text]

				J. Zhu, P. M. Oger, B. Schrammeijer, P. J. J. Hooykaas, S. K. Farrand, and S. C. Winans The Bases of Crown Gall Tumorigenesis J. Bacteriol., July 15, 2000; 182(14): 3885 - 3895. [Full Text]

				E.-M. Lai, O. Chesnokova, L. M. Banta, and C. I. Kado Genetic and Environmental Factors Affecting T-Pilin Export and T-Pilus Biogenesis in Relation to Flagellation of Agrobacterium tumefaciens J. Bacteriol., July 1, 2000; 182(13): 3705 - 3716. [Abstract] [Full Text]

				M. Llosa, J. Zupan, C. Baron, and P. Zambryski The N- and C-Terminal Portions of the Agrobacterium VirB1 Protein Independently Enhance Tumorigenesis J. Bacteriol., June 15, 2000; 182(12): 3437 - 3445. [Abstract] [Full Text]

				A. L. Samuels, E. Lanka, and J. E. Davies Conjugative Junctions in RP4-Mediated Mating of Escherichia coli J. Bacteriol., May 15, 2000; 182(10): 2709 - 2715. [Abstract] [Full Text]

				C. M. Hamilton, H. Lee, P.-L. Li, D. M. Cook, K. R. Piper, S. B. von Bodman, E. Lanka, W. Ream, and S. K. Farrand TraG from RP4 and TraG and VirD4 from Ti Plasmids Confer Relaxosome Specificity to the Conjugal Transfer System of pTiC58 J. Bacteriol., March 15, 2000; 182(6): 1541 - 1548. [Abstract] [Full Text]

				A. M. Grahn, J. Haase, D. H. Bamford, and E. Lanka Components of the RP4 Conjugative Transfer Apparatus Form an Envelope Structure Bridging Inner and Outer Membranes of Donor Cells: Implications for Related Macromolecule Transport Systems J. Bacteriol., March 15, 2000; 182(6): 1564 - 1574. [Abstract] [Full Text]

				H. Schmidt-Eisenlohr, N. Domke, C. Angerer, G. Wanner, P. C. Zambryski, and C. Baron Vir Proteins Stabilize VirB5 and Mediate Its Association with the T Pilus of Agrobacterium tumefaciens J. Bacteriol., December 15, 1999; 181(24): 7485 - 7492. [Abstract] [Full Text]

This Article Abstract Full Text (PDF) Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Eisenbrandt, R. Articles by Lanka, E. Search for Related Content PubMed PubMed Citation Articles by Eisenbrandt, R. Articles by Lanka, E. Social Bookmarking                      What's this?