 |
INTRODUCTION |
Identification of the molecular events that ensue in T lymphocytes
following antigen presentation is paramount to understanding the
regulation of the immune response. The signal transduction pathways
triggered by antigen presentation lead to the immediate activation of
transcription factors that further amplify the process of lymphocyte
activation, ultimately leading to cell proliferation and division.
Dysregulation of this process results in T lymphocyte anergy,
autoimmunity, and disruption of T lymphocyte homeostasis (1, 2). Two
additional settings that would benefit from a better understanding of
the molecular events triggered by T cell activation are viral
pathogenesis and drug discovery. For example,
HIV1 integrates in the
chromosome of T lymphocytes where it remains latent. Its reactivation
by transcription factors that are activated following T cell receptor
cross-linking is relevant to the pathogenesis of AIDS (3, 4). Finally,
development of improved immunosuppressive agents that target T cell
function will be accelerated by identifying the exact molecular events
that result from the molecular events regulating T cell activation.
Effective antigen presentation to T lymphocytes involves not only the
engagement of the T cell receptor-CD3 complex but also other receptors
that mediate co-activation signals such as CD28. How these two separate
signal transduction pathways (TCR/CD3 and CD28) converge to result in
the maximal activation of the T lymphocyte is under active study.
Engagement of the T cell receptor (TCR) by its cognate peptide-major
histocompatibility complex induces phospholipase C activation which
hydrolyzes phosphatidylinositol 4,5-bisphosphate to inositol
1,4,5-triphosphate and diacylglycerol (5). Diacylglycerol activates
protein kinases C (PKC), whereas inositol 1,4,5-triphosphate leads to
the release of Ca2+ from intracellular stores (6, 7). The
same cellular events initiated by phospholipase C activation can be
mimicked by treatment with a combination of a Ca2+
ionophore that raises intracellular Ca2+ levels and phorbol
esters that activate PKC isoforms (8). Free intracellular
Ca2+ targets the Ca2+/calmodulin-activated
phosphatase calcineurin which mediates a critical positive signal
necessary for IL-2 induction through its synergy with PKC activation,
synergy that can be reversed by targeting calcineurin with
immunosuppressive drugs such as cyclosporin A or FK506 (9, 10). The
initial studies that investigated the targets of the synergy between
PKC and calcineurin identified the transcription factors, nuclear
factor of activated T cells and nuclear factor of 
B (NF-B) (9,
10, 11), as being activated by the combination of these separate signal
transduction pathways.
NF-B is a heterodimer of transcription factors that belong to the
Rel family of proteins. The canonical NF-B is a heterodimer of p65
(RelA) with p50 or p52 (12, 13, 14). This heterodimer is anchored by a
group of proteins named IB, which function to retain NF-B in the
cytosol by masking its nuclear localization signal (15-18). IB
is a prototype IB molecule known to control the subcellular
localization of NF-B (p50/p65). Following activation of certain
signal transduction pathways, a site-specific hyperphosphorylation of
IB at Ser-32 and Ser-36 renders the inhibitor molecule
susceptible to site-specific ubiquitination and subsequent degradation
by the proteasome complex (19-23). This releases NF-B to undergo nuclear translocation. Two novel IB kinases, IKK (24-26) and IKK
(27, 28), contained within a high molecular weight complex termed the signalsome target the phosphorylation of Ser-32 and Ser-36
of IB and mediate the TNF--induced IB
hyperphosphorylation and NF-B activation. An additional N-terminal
IB kinase, the mitogen-activated ribosomal S6 protein kinase
RSK-1 or p90rsk (29, 30), has been shown to mediate the
activation of NF-B by phorbol esters and to phosphorylate IB
preferentially at Ser-32 both in vivo and in
vitro. However, its functional relevance in vivo is yet
unclear (30).
Previous studies addressing how the PKC- and
calcineurin-dependent signal transduction pathways
triggered by TCR/CD3 cross-linking lead to the synergistic activation
of NF-B identified IB as a target molecule (11). Whereas PKC
activation by phorbol myristate acetate (PMA) resulted in a moderate
degree of IB hyperphosphorylation-degradation and activated
calcineurin alone had no effect on IB, the combined activation of
these two second messengers leads to a synergistic and highly effective
hyperphosphorylation and degradation of IB (31). Moreover,
whereas TCR and TNFR triggered separate signal transduction pathways,
both ultimately target IB, and the use of specific inhibitors of
calcineurin and PKC enabled the separation of the signaling pathways of
TCR and TNFR (31). Despite this novel observation, the mechanisms
whereby two separate second messengers, PKC and calcineurin, lead to
the lymphocyte-specific hyperphosphorylation of IB remains unknown.
The recent identification of the N-terminal IB provides the
opportunity to advance in our understanding of the molecular mechanisms, whereas signal transduction pathways triggered by TCR/CD3
cross-linking, separate from those downstream of CD28, lead to IB
degradation and NF-B activation in T lymphocytes. In this study we
have investigated the synergy between two second messengers of the
TCR/CD3 pathways, PKC and calcineurin, as regulators of the N-terminal
IB kinases. By using primary human T lymphocytes and T lymphocyte
cell lines, we demonstrate that PKC- and
Ca2+-dependent pathways synergistically
activate both the IKK complex and p90rsk. In contrast to the
activation of the IKK complex, p90rsk activation is
calcineurin-independent, and only the IKK complex (IKK) but not
p90rsk mediates IB phosphorylation and NF-B activation
in vivo. Moreover, the synergistic activation of the IKK
signalsome by PKC and calcineurin is inhibited by either calcineurin-
or PKC-specific inhibitors suggesting that either signal transduction
pathway is required and essential for effectively activating the IKK
complex and, hence, NF-B activation in T lymphocytes.
| |
EXPERIMENTAL PROCEDURES |
Plasmids--
The B-luc reporter plasmid consists of three
B concatamers from the HIV-long terminal repeat cloned upstream of a
concanavalin-A minimal promoter driving the expression of luciferase
(32). The pREP4/CAT plasmid, which consists of the Rous sarcoma virus promoter-enhancer driving the transcription of the CAT gene, was used
to control for transfection efficiency (Invitrogen, Carlsbad, CA).
IKK KD (K44A) was obtained from M. Roth (Tularik, South San
Francisco, CA). IKK kinase dead (KD) (D144N) was a kind gift from
Alain Israel, Institute Pasteur, Paris, France. Wild-type PKC
cDNA was kindly provided by Dr. Altman, La Jolla, CA. The expression vector, pSR4
CaM-AI, encoding a constitutively active calcineurin catalytic subunit is similar to the previously described pSR-CaM-AI (9) except that it contains an additional 75 base pairs of 5'-untranslated sequence from CN4a (34).
Cell Culture and Reagents--
Jurkat T cells were obtained from
American Type Tissue Culture Collection, Manassas, VA, and maintained
in RPMI 1640 (BioWhittaker, Walkersville, MD) supplemented with 5%
heat-inactivated fetal bovine serum, 100 units/ml
penicillin/streptomycin, and 2 mM L-glutamine cells were grown to a density of 3-5 × 105/ml at the
time of the different experiments. PMA, sodium orthovanadate, p-nitrophenyl phosphate were purchased from Sigma.
Ionomycin, GF109203X (GF), Gö 6976, -glycerophosphate, PD
098059 were purchased from Calbiochem, and TNF was purchased from
Genzyme (Boston, MA). Leupeptin, aprotinin, and pepstatin A were
obtained from Roche Molecular Biochemicals. Anti-IKK (H-744, M-280),
anti-IKK (H-470), anti-Raf-1 (C-12), anti-Rsk-1 (C-21), and
anti-IB (C-21) antibodies were purchased from Santa Cruz
Biotechnology, Santa Cruz, CA. Anti-human CD3 antibodies were obtained
from Ancell, Bayport, MN. Neutralizing antibodies to TNF were purchased
from R & D Systems (Minneapolis, MN).
To isolate CD3+ T cells, peripheral blood mononuclear cells
from healthy donors were obtained from buffy coats by density gradient centrifugation (Ficoll-Paque, Amersham Pharmacia Biotech). Peripheral blood mononuclear cells were then depleted of monocytes by two cycles
of plastic adherence, and CD3+ T cells were purified by
neuraminidase-treated sheep red blood cell rosetting. The remaining
cell population was repeatedly found to be 98% CD3+ T
cells as determined by flow cytometry analysis. CD3+ T
cells used in the various experiments were maintained in RPMI 1640 supplemented with 10% fetal bovine serum (Invitrogen, Carlsbad, CA), 2 mM L-glutamine, and antibiotics (penicillin 100 units/ml, streptomycin 100 µg/ml) at 0.5 × 106
cells/ml. CD3+ T cells were stimulated and harvested on the
2nd day after isolation.
Where indicated, cells were pretreated with 2 µM
GF109203X and Gö 6976 for 15 min, 30 µM PD 098059 for 20 min. FK506 was used at 20 ng/ml. For Jurkat T cells, PMA was
used at 20 ng/ml, ionomycin at 3.5 µg/ml, and TNF- at 10 ng/ml.
For CD3+ T cell activation, PMA was used at 2.5 ng/ml,
ionomycin at 0.7 µg/ml, and TNF- at 10 ng/ml. TCR/CD3
cross-linking was performed with 3 µg/ml anti-CD3 antibody as
previously demonstrated by our group (34).
Cell Extract Preparation, Immunoblotting Kinase Assay--
To
obtain total cellular proteins, cells were washed with cold
phosphate-buffered saline, resuspended in whole-cell extract PD buffer
adapted with slight modifications from Mercurio et al. (27)
(40 mM Tris-HCl, pH 8, 0.3 M NaCl, 0.1%
Nonidet P-40, 6 mM EDTA, 6 mM EGTA, 10 mM NaF, 10 mM p-nitrophenyl
phosphate, 10 mM -glycerophosphate, 300 µM
sodium orthovanadate, 1 mM dithiothreitol, 2 µM phenylmethylsulfonyl fluoride, aprotinin at 10 µg/ml, leupeptin at 1 µg/ml, pepstatin 1 µg/ml), and centrifuged
at 12,000 × g for 15 min at 4 °C. The resultant
supernatant contained total cellular protein. The amount of cellular
protein present in the clarified supernatant was calculated by using
the Bio-Rad protein assay.
For Western immunoblots, equal amounts of whole cell extract (WCE)
protein were loaded and separated by 10% SDS-polyacrylamide gel
electrophoresis (PAGE) and transferred to Immobilon-P membranes (Millipore, Bedford, MA). Immunoblotting was performed with specific antibodies and visualized by using the ECL Western blotting detection kit (Amersham Pharmacia Biotech, Buckinghamshire, UK).
For the immunocomplex kinase assay, 100 µg of Jurkat WCE and 50 µg
of CD3+ T cell WCE were rotated with specific antibodies
for 1 h and then for an additional 1 h more with protein
A-agarose beads (Life Technologies, Inc.) at 4 °C. The
immunoprecipitations were performed in WCE buffer with high NaCl
concentrations (0.5 M). The beads were washed 3 times with
0.5 M NaCl WCE buffer followed by 1 wash of kinase assay
washing buffer (50 mM Tris-HCl, pH 7.4, 40 mM NaCl). The beads were mixed with 15 µl of kinase buffer (33) (20 mM Hepes, pH 7.4, 2 mM magnesium chloride, 2 mM manganese chloride, 10 µM ATP, 10 mM NaF, 10 mM p-nitrophenyl
phosphate, 10 mM -glycerophosphate, 300 µM
sodium orthovanadate, 2 µM phenylmethylsulfonyl fluoride,
aprotinin at 10 µg/ml, leupeptin at 1 µg/ml, pepstatin at 1 µg/ml, 1 mM dithiothreitol) containing 2 µg of
GST-IB-(1-53) substrate and 1 µCi of
[
-32P]ATP. The 30-min kinase reaction at 30 °C was
stopped by adding 4× SDS-PAGE sample buffer. The proteins were
separated by SDS-PAGE and transferred to Immobilon-P membrane. The top
part of the membrane was used for immunoblots of IKK or Rsk-1; on
the bottom part of the membrane, the amount of GST-IB-(1-53) and
the levels of its phosphorylation were visualized by staining with
Coomassie Blue and autoradiography, respectively.
Preparation of Recombinant IB--
The IB MAD3
cDNA (35) plasmid was obtained from Chiron and used as a template
for subsequent polymerase chain reaction amplification. The N-terminal
IB MAD3 (1-53) sequence was amplified using wild-type primer A
(CGGGATCCATGTTCCAGGCGGCCGAG), as the 5' sense primer, creating a
BamHI site upstream of the coding sequence, and wild-type
primer B (GGAATTCCTCAGCGGATCTCCTGCAGCT) as antisense primer, creating
an EcoRI site downstream of the coding sequence. A double
S32A/S36A mutant was amplified from the full-length cDNA using
polymerase chain reaction primers which created alanines at amino acids
32 and 36. Following digestion with BamHI and
EcoRI, these sequences were ligated into pGEX-KG (derived
from pGEX-2T from Amersham Pharmacia Biotech). These constructs were
transformed into Escherichia coli DH5 cells, which were
grown exponentially, and after 60 min of stimulation with
isopropylthiogalactopyranoside (Sigma) cells were lysed. Proteins were
isolated by affinity chromatography on glutathione-bonded 4%
cross-linked agarose (Sigma). The purity of GST-IB-(1-53) and
GST-IB-(1-53) 32A/36A was analyzed with 10% SDS-PAGE and subsequent Coomassie Blue staining. The purity of both proteins was
greater than 90%.
Gene Transfection and Reporter Assays--
FuGENE6 was used to
express plasmids transiently in Jurkat T cells. In brief, 8 µl of
FuGENE6 (Roche Molecular Biochemicals) were mixed with 92 µl of plain
RPMI 1640 media and incubated for 5 min. FuGENE6/RPMI 1640 solution was
added to sterile tube containing 0.4 µg of B-luc reporter plasmid,
0.6 µg of pREP4/CAT, and 0-1 µg of a plasmid of interest (total is
2 µg) and incubated for 15 min. The DNA/sFuGENE6 solution was added
to 1 × 106 log phase Jurkat T cells.
Jurkat cells were transfected with the indicated plasmids and grown for
40 h. Cells were stimulated for 4 h with PMA (20 ng/ml), ionomycin (3.5 µg/ml), TNF- (10 ng/ml), or PMA and ionomycin together. After stimulation, cells were washed twice in cold
phosphate-buffered saline and lysed with 210 µl lysis solution (100 mM K2PO4, pH 7.8; 0.2% Triton
X-100; 5 mM dithiothreitol, 2 µg/ml aprotinin). Equal
amounts (100 µl) of extract were assayed for luciferase and CAT
expression. CAT expression was determined by the Roche Molecular
Biochemicals CAT enzyme-linked immunosorbent assay kit using the
manufacturer's protocol. Luciferase activity was assayed using the
Promega Luciferin reagent and a Berthold Lumat. Luciferase activity is
normalized to CAT expression. All transfection experiments were
performed in duplicate.
| |
RESULTS |
PKC- and Ca2+-dependent Pathways Synergize
to Activate the IKK Complex in T Cells--
Cross-linking of the
TCR/CD3 results in the activation of PKC- and
Ca2+-dependent pathways that synergize in T
cells to activate NF-B by targeting the phosphorylation and
degradation of its inhibitor, IB (11, 31). To determine whether
TCR cross-linking can lead to IKK activation, we measured the IB
kinase activity of the IKK complex immunoprecipitated from Jurkat T
cells that were activated or not following TCR cross-linking.
Cross-linking of the TCR with anti-CD3 but not IgG antibodies results
in a moderate activation of the IKK complex (Fig.
1A, 2nd lane), which is
inhibited by pretreatment of Jurkat T cells with the
calcineurin-specific inhibitor FK506 (Fig. 1A, lane 3). From
these results, and based on previous studies from our group (11, 31),
we conclude that calcineurin participates in the TCR/CD3-initiated
signal transduction pathway that leads to IKK activation.
View larger version (28K):
[in this window]
[in a new window]
|
Fig. 1.
PKC- and
Ca2+-dependent pathways are required for the
IKK complex activation. A, the activation of the IKK
complex following TCR/CD3 cross-linking is
calcineurin-dependent. Jurkat T cells (2 × 106cells per sample) were incubated with 3 µg/ml anti-CD3
(lanes 2 and 3) or isotype control IgG
(lane 1) antibody for 45 min at 4 °C in 1 ml of media.
Cells were then cross-linked on goat anti-mouse-coated plates for 20 min at 37 °C. Jurkat T cells were pretreated with 20 ng/ml FK506
before incubation with anti-CD3 antibodies (lane 3). IKK
activity was measured in an in vitro kinase assay
(IVK) as described under "Experimental Procedures,"
using GST-IB (1-53 amino acids) as substrate
(IB 32P). Coomassie staining of
the polyvinylidene difluoride membrane containing the IVK
(IB) and immunoblotting (IB) for IKK
(IKK IB) were performed. B, PMA and ionomycin
synergize to activate IKK in Jurkat and CD3+ T cells.
Primary CD3+ (lanes 1-5) and Jurkat T cells
(lanes 6-15) were stimulated (+) or not ( ) for 8 min with
ionomycin (IONO), PMA, or TNF. For CD3+ T cell
activation, PMA was used at 2.5 ng/ml, ionomycin at 0.7 µg/ml for 8 min, and TNF at 10 ng/ml for 4 min; for Jurkat T cell stimulation
PMA was used at 20 ng/ml, ionomycin at 3.5 µg/ml for 8 min, and
TNF- at 10 ng/ml for 8 min. IKK activity was measured in an IVK
using GST-IB-(1-53) as substrate (IB
32P). The specificity of IKK kinase activity
toward to Ser-32/Ser-36 was demonstrated by using GST-IB (1-53
amino acids) with substituted serines for alanines
(IB32A/36A, lanes 11-15). In
parallel, the level of endogenous IB from the same cell extracts
were detected by immunoblotting with anti-IB antibodies
(IB IB in vivo). C, Jurkat T
cells were either untreated (lanes 1-5) or pretreated with
4 µg/ml neutralizing anti-TNF antibody (lanes 6-8) or
with 4 µg/ml isotype control IgG antibody (lanes 9-11)
1 h prior to stimulation. Efficiency of the neutralizing anti-TNF
antibody was demonstrated by using the mixture of recombinant TNF (10 ng/ml) with neutralizing anti-TNF antibody (4 µg/ml) incubated for
1 h at 4 °C before stimulation (lane 5). IKK
activity was measured in IVK as described above. Equal amounts of the
substrate and the immunoprecipitated kinase complex were present in the
assay confirmed by Coomassie staining of the polyvinylidene difluoride
membrane containing the IVK (IB), and immunoblotting
(IB) for IKK (IKK IB), respectively.
|
|
To investigate the role of PKC and calcineurin in the activation of the
IKK complex, an in vitro kinase assay using IKK complex immunoprecipitates from resting freshly isolated peripheral human T
lymphocytes and Jurkat T cells that were or were not stimulated with
ionomycin, PMA, or their combination. Ionomycin stimulation of
CD3+ and Jurkat T cells does not affect the IKK complex
activity (Fig. 1B, lanes 2 and 7), whereas PMA
induces a moderate IB kinase activity (Fig. 1B, lanes
3 and 8). However, stimulation of CD3+ and Jurkat T
cells with the combination of PMA and ionomycin increased the IKK
complex kinase activity beyond that observed in PMA-treated cells (Fig.
1B, lanes 4 and 9). When TNF treatment was used
as a control of IKK activation (24), it was observed that the degree of
TNF activation was similar to that of PMA but significantly lower than
that achieved by the combination of PMA and ionomycin (Fig. 1B,
lanes 5 and 10). The IKK complex kinase activity was
specific for Ser-32/Ser-36, as it was not observed when an IB
substrate in which both serines were substituted with alanines was used
in the in vitro kinase assay (Fig. 1B, lanes
11-15). Equal amount of IB substrate present in the
in vitro kinase assay (Fig. 1B, IB) or the
amount of IKK complex immunoprecipitated (Fig. 1B,
lanes 1-5) confirmed that the increased in vitro
phosphorylation of IB is a function of enhanced IKK complex
kinase activity. Similar results were obtained when the IKK complex was
immunoprecipitated with additional anti-IKK or IKK antibodies
(data not shown). In addition, Raf-1 immunoprecipitates of cell lysates
from PMA, PMA and ionomycin, or TNF-stimulated cells did not result in
the phosphorylation of IB at Ser-32/Ser-36, despite evidence of
Raf-1 activation following PMA treatment (data not shown).
To determine whether the qualitative differences in the IKK activation
triggered by PMA or PMA and ionomycin correlated with the in
vivo IB hyperphosphorylation, the same cell lysates used for
immunoprecipitation of cell kinases were separated by SDS-PAGE and
immunoblotted for endogenous IB using anti-IB-specific antibodies. Hyperphosphorylation of IB, determined by the slower migrating form of IB, was mainly observed in the PMA- and
ionomycin-treated cells (Fig. 1B, IB IB in
vivo, lanes 4 and 9). This observation establishes a direct correlation between the qualitative activation of
the IKK complex by PKC- and Ca2+-dependent
pathways and IB hyperphosphorylation in vivo.
To demonstrate that the observed synergistic activation of the IKK
complex is the direct effect of PMA and ionomycin co-stimulation, and
not due to their secondary induction of TNF, we measured the IB
kinase activity of the IKK complex from PMA- and ionomycin-treated Jurkat T cells in the presence or not of neutralizing anti-TNF antibodies (Fig. 1C). Pretreatment of Jurkat T cells with
such antibodies abrogates the activation of the IKK complex by
recombinant TNF (Fig. 1C, lanes 4 and 8) but has
no effect on the IKK complex activation by the combination of PMA and
ionomycin (Fig. 1C, lanes 2, 3 and 6, 7). The
specificity of the neutralizing anti-TNF antibodies was confirmed by
their preincubation with recombinant TNF (Fig. 1C, lane 5)
and by using IgG isotype antibodies as control (Fig. 1C, lanes
9-11).
p90rsk Is Synergistically Activated by PKC- and
Ca2+-dependent Pathways--
The
mitogen-activated p90rsk phosphorylates IB at Ser-32 (29,
30), and it is questioned whether it directly results in IB
phosphorylation and degradation in vivo (20-23, 36).
Because p90rsk is a second messenger that is activated by PKC
(37), we investigated whether Ca2+-dependent
pathways synergistically activated the presumed IB kinase
activity of p90rsk that would be induced following PKC stimulation.
Jurkat T cells and freshly isolated peripheral blood CD3+ T
lymphocytes were treated with PMA and/or ionomycin, and p90rsk
and IKK complexes were subsequently immunoprecipitated and analyzed for
their ability to phosphorylate IB at Ser-32/Ser-36. In Jurkat T
cells, PMA alone significantly induces the p90rsk IB
activity (Fig. 2A,
p90rsk IP, lane 2). However, the
combination of PMA and ionomycin only weakly increased the kinase
activity of p90rsk beyond that induced by the stimulation with
PMA alone (Fig. 2A, p90rsk IP, lane
3) suggesting that at this concentration of PMA, p90rsk is
already fully activated. In primary CD3+ T cells, and in
contrast to that observed in Jurkat T cells, strong synergistic
activation of p90rsk toward the IB substrate by the
combination of PMA and ionomycin was observed (Fig. 2B,
p90rsk IP, lane 4). Again, stimulation by
ionomycin alone does not induce p90rsk activation (Fig.
2B, p90rsk IP, lane 2).
View larger version (32K):
[in this window]
[in a new window]
|
Fig. 2.
Calcineurin mediates synergistic IKK
activation, but not p90rsk, in T cells. A,
Jurkat T cells were pretreated (+) or not () with 20 ng/ml specific
calcineurin inhibitor FK506 1 h before stimulation with PMA and/or
ionomycin. Immunoprecipitated p90rsk (p90rsk
IP) and the IKK complex (IKK IP) were analyzed
in IVK. IVK and IB are as described in Fig. 1.
B, same as A except that primary CD3+
T cells were used. Lymphocytes were pretreated with 100 ng/ml FK506
1 h before stimulation.
|
|
Calcineurin Is Required for Synergistic Activation of the IKK
Complex but Not p90rsk in T Lymphocytes--
The role of
Ca2+-dependent signaling and of calcineurin on
the activation of the IKK complex and p90rsk kinase activity
was investigated in the presence or absence of the calcineurin-specific
inhibitor FK506 (38). Jurkat T cells and freshly isolated T lymphocytes
were pretreated with FK506 for 1 h followed by their stimulation
with PMA, ionomycin, or their combination. As shown in Fig. 2, FK506
reverses the synergistic activation of the IKK complex by PMA and
ionomycin in both Jurkat T cells (Fig. 2A, IKK IP,
lanes 3 and 5) and in primary CD3+ T
cells (Fig. 2B, IKK IP, lanes 3, 4, and 8, 9) and
has no effect on p90rsk activation (Fig. 2A,
p90rsk IP, lanes 2-5; Fig. 2B,
p90rsk IP, lanes 3, 4 and 8, 9). The
reduction of IKK kinase activity in vitro by FK506
correlates with the decrease of the in vivo IB
hyperphosphorylation (Fig. 2A, in vivo IB IB, lanes 3 and 5; and Fig. 2B, in vivo
IB IB, lanes 4 and 9). The specificity of
FK506 as an inhibitor of the T cell receptor-initiated signaling leading to IKK activation was tested in the TNF-mediated IKK activation and in vivo IB phosphorylation. TNF-induced IKK
activation and IB-induced hyperphosphorylation in vivo
was not affected by the pretreatment of T lymphocytes with FK506 (Fig.
2B, in vivo IB, lanes
5 and 10). Altogether, these results demonstrate a direct correlation between the degree of IKK activation and the in vivo IB hyperphosphorylation. Moreover, they
point to the necessary role of calcineurin in mediating the
hyperphosphorylation of IB by IKK following the activation of
PKC- and Ca2+-dependent signaling that is
triggered by TCR cross-linking.
The IKK Complex and Not p90rsk Controls Inducible IB
Phosphorylation and NF-B Activation in T Cells--
To evaluate the
in vivo role of p90rsk as an IB kinase
involved in the NF-B activation following T cell activation, we used the specific MEK-1 inhibitor PD 098059 (PD) (39) to block
p90rsk activation (40). In Jurkat T cells a strong activation
of p90rsk IB activity by PMA was reversed by PD (Fig.
3A, IB
32P, lanes 2 and 5). The combination
of PMA and ionomycin only moderately increased the kinase activity of
p90rsk (Fig. 3A, IB 32P,
lane 3). Interestingly, PD did not completely eliminate the PMA-
and ionomycin-induced activation of the p90rsk IB kinase
activity, allowing the detection of a degree of synergy when compared
with PMA and PD-treated cells (Fig. 3A, IB
32P, lane 6). This residual effect was
completely blocked by PD treatment for a longer time (1 h) (data not
shown), suggesting that MEK-1 mediates both PKC- and
Ca2+-dependent signaling. The specificity of PD
as a p90rsk inhibitor in this model was further evaluated by
measuring its inhibitory activity on the IKK complex kinase activity
from the same lysates. The synergy between PKC- and
Ca2+-dependent pathways that results in the
activation of the IKK complex as an IB kinase (Fig. 3A,
lane 11) was minimally modified by PD (Fig. 3A, lane
14), confirming that PD inhibits p90rsk activation but not
the IKK complex.
View larger version (26K):
[in this window]
[in a new window]
|
Fig. 3.
PD 098059 inhibits PMA/ionomycin-induced
p90rsk activation but does not affect
IB phosphorylation
and degradation in vivo. A, Jurkat T cells were
pretreated (+) or not () for 20 min with 30 µM PD
098059 (PD) and subsequently stimulated (+) or not () with
PMA and/or ionomycin. Immunoprecipitates of p90rsk
(p90rsk IP) or of IKK (IKK
IP) were analyzed in the in vitro kinase assay
(IVK). IVK and IB are as described in
Fig. 1B. B, same as in A except that
primary CD3+ T cells were used. C, Jurkat T
cells (1 × 106) were transfected with B-luc- (0.4 µg) and REP4/CAT (0.6 µg) reporter plasmids. Forty hours later
cells were pretreated with 30 µM inhibitor PD 098059 for
20 min and then stimulated (+) or not () with PMA and/or ionomycin
for 4 h. Equal amounts (100 µl) of extracts were assayed for
luciferase and CAT expression. Luciferase activity is normalized to CAT
expression (relative luciferase activity). All transfection experiments
were performed in duplicate.
|
|
In primary CD3+ T cells, the IB kinase activity of
p90rsk toward IB substrate was synergistically increased
by the combination of PMA and ionomycin (Fig. 3B, IB
32P, lane 4), an effect that was reversed when
cells were treated with PD (Fig. 3B, lane 9). The increased
p90rsk kinase activity was independent of the amount of
IB substrate present in the in vitro kinase assay or
the amount of p90rsk immunoprecipitated (Fig. 3B,
p90rsk IP, IB, and
p90rsk IB, respectively). As expected,
TNF did not increase the IB kinase activity of p90rsk
(Fig. 3B, IB 32P, lane
5). The specificity of PD was once again verified in primary CD3+ T cells by determining whether the synergistic
activation of the IKK complex activity by PMA and ionomycin was
PD-insensitive. As shown in Fig. 3B (IKK IP,
lanes 4 and 9), PMA and ionomycin resulted in the
synergistic activity of IKK that was not modified by pretreatment of
cells with PD. Similarly, TNF-induced IKK activity was
PD-insensitive (Fig. 3B, IKK IP, lanes 5 and
10).
The specificity of PD as an inhibitor of the in vitro
IB kinase activity of p90rsk but not of the IKK complex
allowed us to address the relative role of each IB kinase in
mediating the PMA or PMA- and ionomycin-dependent IB
hyperphosphorylation and subsequent degradation in primary T cells
in vivo. The same cytosolic extracts from purified
CD3+ T cells that were used for the p90rsk and IKK
immunoprecipitations experiments were subjected to SDS-PAGE analysis
and immunoblotting with anti-IB-specific antibodies. PMA and
ionomycin combined, but not PMA, or ionomycin alone, induced a slower
migration form of IB that was not reversed in the presence of PD
(Fig. 3B, in vivo IB IB, lanes 4 and
9).
To test the in vivo relevance of the regulation of IB
phosphorylation in vitro and in vivo by these two
kinases, Jurkat T cells were transfected with a
B-dependent reporter gene, and cells were treated or not
with PMA alone and combination of PMA and ionomycin in the presence or
absence of PD. As shown in Fig. 3C, the synergistic
activation of NF-B transcriptional activity by combination of PMA
and ionomycin was minimally sensitive to PD. Altogether, while these
results indicate that PMA and ionomycin synergize to activate in
vitro the IB kinase activity of both the IKK complex and of
p90rsk, the latter is not regulated by calcineurin and does not
appear to play a role in the activation of NF-B in
vivo.
Conventional PKC Isoforms Are Required for the Activation of the
IKK Complex in T Lymphocytes--
Recent studies demonstrated that
both the conventional isoform, PKC, and the novel isoform, PKC
,
may be potentially involved in NF-B activation (41, 42). PKC
associates with and phosphorylates IKK (41) suggesting that the
activation of PKC following TCR/CD3 cross-linking could result in
the activation of the IKK complex. PKC, a novel PKC isoform was
recently identified as the PKC isoform that synergizes with calcineurin
leading to JNK activation (42) and that is recruited to the TCR at the
antigen-presenting cells docking region during antigen presentation
(43).
To characterize the type of PKC isoform that synergizes with
calcineurin to activate the IKK complex, a series of pharmacological inhibitors of PKC were utilized (44). GF109203X (GF) inhibits the
conventional and novel isoforms, whereas Gö 6976 (Gö)
inhibits only the conventional isoforms (45). The specificity of the PKC inhibitors was verified by using TNF as a PKC-independent stimulus
that leads to IB hyperphosphorylation through the activation of
the IKK complex (46). Jurkat T cells and freshly isolated CD3+ T cells were pretreated with GF followed by cell
stimulation with PMA, ionomycin, or the combination of PMA and
ionomycin, followed by the analysis of the IB kinase of
immunoprecipitated IKK. GF abrogated the IKK complex kinase activation
triggered by PMA or the combination of PMA with ionomycin in both
Jurkat T cells (Fig. 4A,
IB IVK, lanes 2-4, 6, and
7) and in primary CD3+ T lymphocytes (Fig.
4B, IB IVK, lanes 3, 4, and 8, 9).
TNF-induced IKK activation was not reversed by GF pretreatment of
Jurkat T cells (Fig. 4A, IB IVK, lanes 4 and 8) or of primary CD3+ T cells (Fig.
4B, IB IVK, lanes 5 and 10). As
expected from previous results, the loss of IKK complex kinase activity
in PMA and ionomycin, but not in TNF-treated cells preincubated with GF
directly, correlates with the lack of IB hyperphosphorylation in vivo observed in IB immunoblots of the same
cytosolic samples (Fig. 4, A and B, in
vivo IB IB). These observations confirm the
requirement for a conventional or novel isoform of PKC for the
synergistic IKK activity.
View larger version (22K):
[in this window]
[in a new window]
|
Fig. 4.
Conventional PKC isoforms are required for
IKK and NF-B activation. A,
Jurkat T cells were pretreated (+) or not () with 2 µM
GF and 2 µM Gö 6976 (Gö) for 15 min before stimulation with PMA, ionomycin, or TNF. Same legends as in
Fig. 1. B, same as A except that CD3+
T cells were used. C, Jurkat T cells (1 × 106) were transfected with B-luc- (0.4 µg) and
REP4/CAT (0.6 µg) reporter plasmids using FuGENE6 method. Forty hours
later, cells were pretreated with 2 µM GF or Gö for
15 min and then stimulated (+) or not () with PMA and/or ionomycin
for 4 h. Equal amounts (100 µl) of extracts were assayed for
luciferase and CAT expression. Luciferase activity is normalized to CAT
expression.
|
|
Because GF can inhibit both conventional (, , ) and novel
(
, , 
, 
, µ) PKC isoforms (44), we sought to identify
which subgroup of the PMA-responsive PKC isoforms was mediating the synergy with calcineurin. We predicted that if PKC would be the PKC
isoform that synergized with calcineurin in T cells, pretreatment with
Gö would not inhibit the PMA and ionomycin-induced activation of
the IKK complex kinase activity and, hence, the in vivo
IB hyperphosphorylation. To test this, Jurkat T lymphocytes and
freshly isolated primary CD3+ T cells were preincubated
with Gö, followed by their stimulation with PMA, ionomycin, or
the combination of PMA and ionomycin and analysis of the IKK complex
activity. Gö selectively inhibited the synergistic activation of
the IKK complex kinase activity mediated by the combination of PMA and
ionomycin in both Jurkat T cells (Fig. 4A, IB IVK,
lanes 2, 3 and 10, 11) and in primary CD3+ T cells (Fig. 4B, IB IVK lanes 3, 4 and 13, 14). Gö pretreatment did not affect the
TNF-induced IKK complex kinase activation in Jurkat T cells (Fig.
4A, IB IVK, lanes 4 and 12) or
in primary CD3+ T cells (Fig. 4B, IB IVK, lanes
5 and 15). The Gö-dependent inhibition of IKK complex activity triggered by PMA and ionomycin directly correlated with the abrogation of the PMA- and
ionomycin-induced IB hyperphosphorylation in vivo in
both types of T cells (Fig. 4, A and B, in
vivo IB IB). As expected, TNF-mediated IB
hyperphosphorylation in vivo was not reversed by Gö
treatment (Fig. 4, A and B, in vivo
IB IB).
The functional relevance of these observations was evaluated in Jurkat
T cells that were transfected with a B reporter gene and stimulated
or not with PMA or PMA and ionomycin in the presence or not of GF and
Gö. As shown in Fig. 4C, both GF and Gö
specifically inhibited the PMA and PMA- and ionomycin-induced but not
the basal NF-B-dependent transcriptional activity,
suggesting that the conventional PKC isoforms mediate the PMA effects
on the activation of IKK.
To confirm the contribution of this subfamily of PKC isoforms to the
synergistic activation of NF-B by calcineurin, wild-type of PKC
was overexpressed alone or in combination with the constitutively active form of calcineurin Cam-AI (Fig.
5). Overexpression of PKC-wt or
Cam-AI alone has no effect on NF-B. However, stimulation of
PKC-wt-transfected Jurkat T cell with PMA resulted in NF-B activation to a degree similar to that induced by PMA and ionomycin co-stimulation in mock-transfected cells (Fig. 5). Furthermore, co-expression of PKC-wt and Cam-AI resulted in a synergistic NF-B activation (Fig. 5).
View larger version (25K):
[in this window]
[in a new window]
|
Fig. 5.
PKC synergizes with
calcineurin to activate NF-B. Jurkat T
cells (1 × 106) were transfected with B-luc- (0.4 µg) and REP4/CAT (0.6 µg) reporter plasmids,
pME18S-PKC-wild-type (PKC-wt) (0.5 µg), and
pSR4CaM-AI (CaM-AI) encoding a constitutively
active calcineurin catalytic subunit (0.5 µg). Forty hours later
cells were stimulated or not with PMA and/or ionomycin
(IONO) for 4 h as described above. Equal amounts (100 µl) of cytosolic extracts were assayed for luciferase and CAT
expression. Luciferase activity is normalized to CAT expression
(relative luciferase activity). All transfection experiments were
performed in duplicate.
|
|
These results indicate that, different from the activation of another
cellular kinase, JNK, conventional PKC isoforms such as PKC can
mediate the synergistic interaction with calcineurin following TCR/CD3
cross-linking that results in the activation of the IKK complex kinase
activity in T cells.
A Dominant Negative Form of IKK Blocks NF-B Activation
Triggered by PKC- and Calcineurin-dependent
Pathways--
By having demonstrated that calcineurin synergizes with
PKC to activate the IKK complex, we next investigated the effect of dominant negative forms of IKK and IKK on the NF-B activation that follows PMA-ionomycin cell stimulation. Jurkat T cells were transiently co-transfected with expression vectors of dominant negative
IKK genes and luciferase reporter genes driven by NF-B concatamers.
Rous sarcoma virus-CAT was used as a control of transfection efficiency
and cell toxicity. Overexpression of IKK kinase dead (KD), but not
the wild-type isoforms of IKK or - (data not shown), selectively
impaired both PMA and PMA/ionomycin-induced up-regulation of
NF-B-driven transcription (Fig. 6).
Interestingly, overexpression of the IKK-DN alone did not inhibit
the NF-B activation by PMA and ionomycin, and its combination with
the IKK-DN did not enhance the inhibition achieved by IKK-DN
alone (Fig. 6). These observations extend and confirm the involvement
of the IKK complex in the convergence of the PKC and calcineurin signal
transduction pathways to mediate IB
hyperphosphorylation-degradation and NF-B activation.
View larger version (34K):
[in this window]
[in a new window]
|
Fig. 6.
Dominant negative form of
IKK inhibits NF-B
activation triggered by conventional PKCs and calcineurin.
A, Jurkat T cells were transfected with the B-luc
reporter plasmid and the following plasmids: pcDNA3-IKK-kinase
dead (IKK KD) and pRK5-C-Flag-IKK-kinase dead
(IKK KD) using FuGENE6 method. The total DNA amount was
normalized up to 2 µg with pcDNA3. Forty hours after
transfection, cells were stimulated for 4 h prior to harvest with
PMA and ionomycin (IONO). Luciferase activity was normalized
to CAT expression of the pREP4/CAT plasmid.
|
|
| |
DISCUSSION |
The results presented in this study identify the molecular targets
and mechanisms whereby two TCR/CD3-dependent second
messengers, PKC and calcineurin, lead to the activation of NF-B in T
lymphocytes. The identification that cyclosporin A or FK506 are
effective inhibitors of IKK activation advances our knowledge as to the
function of these commonly used immunosuppressive agents. Moreover, our
results highlight the essential role that conventional PKC isoforms
play in the TCR-mediated NF-B activation, molecules that should be considered as targets for future drug development with the aim of
interfering with T cell activation.
NF-B is a ubiquitous transcription factor that is involved in
multiple immune and inflammatory responses (47). T cell cross-linking results in NF-B activation (48-51) and together with NF-AT, AP-1, and octomer leads to IL-2 expression in in vitro
experimental settings (52-54). However, NF-B may play a more
significant role in regulating T cell function in vivo than
that inferred from studies analyzing the transcriptional regulation of
the IL-2 promoter. The fact that IL-2 production is greatly impaired in
c-Rel-deficient lymphocytes (55) and in T cells with constitutive
repression of NF-B activity (56) suggests that NF-B, rather than
only the nuclear factor of activated T cells, is required for an
adequate T cell function. Hence, the identification of calcineurin as a necessary component in the activation of IKK by TCR engagement and the
complete inhibition of NF-B activation by cyclosporin A and FK506
may explain the effectiveness of such drugs as NF-B-specific T cell
activation inhibitors.
The relevance of NF-B as a target of TCR engagement is not
restricted to understanding the immune response but to other relevant areas such as HIV pathogenesis. Recent studies indicate that T lymphocytes serve as a reservoir of latent HIV provirus in patients effectively responding to highly active antiretroviral therapy. The
fact that NF-B is a key transcription factor in reactivating HIV
from latency in T lymphocytes explains the HIV reactivation and
viral production that ensues following T cell receptor activation of
latent HIV-infected T cells (57). Identification of calcineurin or of
conventional PKC isoform as potential targets of this process could be of future value in the study of HIV reactivation.
In the present study, we find that the IKK complex, and not
p90rsk, mediates IB hyperphosphorylation at Ser-32 and
Ser-36 and thus NF-B activation in vivo following PMA and
ionomycin stimulation. This observation highlights that while both
kinases are activated by PKC-dependent pathways and further
amplified in a synergistic manner by
Ca2+-dependent pathways, only the IKK complex
appears to be responsible for NF-B activation via IB. Although
IB Ser-32 and Ser-36 may prove to be a good in vitro
substrate to measure p90rsk activity, its in vivo
extrapolation to NF-B activation may be less certain. We conclude
this from the fact that p90rsk and IKK do not
co-immunoprecipitate (data not shown) and, more importantly, that a MEK
inhibitor (PD) does not affect IKK activation or IB
phosphorylation in vivo followed by PMA and ionomycin treatment, whereas it completely inhibits p90rsk activation.
The observation that the MEK inhibitor spares the signal transduction
pathway leading to NF-B activation from the mitogen-activated
protein kinase pathway may be of future value in selectively inhibiting
and differentiating specific target functions of T cell activation,
such as NF-B versus AP1 mitogen-activated protein
kinase-dependent activation.
IKK and - are contained within a high molecular weight complex
with multiple components (24, 27). The inhibitory effect of dominant
negative forms of IKK on NF-B activation suggests that this
kinase is relevant in mediating the synergistic activation of NF-B
by the combination of PKC and calcineurin. The role of IKK in this
process is less clear. Although overexpression of dominant negative
forms of IKK had little effect on the PMA and ionomycin-induced
NF-B activity, both endogenous IKK and IKK become in
vivo hyperphosphorylated following T cell activation (data not
shown), thus suggesting that activation of both kinases may be needed
for full signalsome activity. Prior studies (27, 28) demonstrated that
IKK rather then IKK played a major role in IB
phosphorylation by TNF, potentially explaining the stronger effect of
overexpressed IKK-DN on induced NF-B activation observed in these
studies (25).
The mechanism whereby calcineurin converges with
PKC-dependent pathways to activate the IKK complex is
unknown. Previous studies from our group indicated that calcineurin
alone had no effect on the activation of NF-B in T lymphocytes (11).
However, its presence was required in order for
PKC-dependent pathways to induce a maximal level of NF-B
activation (11, 31). Results presented here extend and confirm those
observations by documenting that the level of IKK activation triggered
by PKC-dependent pathways is only moderate and that
increased (Ca2+) levels alone are not sufficient to
activate IKK. Rather, increased (Ca2+) levels need to be
present at the time of PKC activation to result in maximum IKK activity
and hence in vivo IB phosphorylation. The fact that
calcineurin alone does not activate IKK does not exclude that it does
not target the IKK complex. Potentially, calcineurin may modify the
composition or interaction of proteins with the signalsome. This could
allow for a more effective activation of the signalsome by
PKC-dependent pathways. Alternatively, calcineurin may
function upstream of the signalsome by modifying transducers of the
PKC-dependent pathway resulting in a more effective
downstream activation of IKK by PKC. Future studies need to address
these and other possibilities, which should ultimately lead to the
identification of potential targets of new immunosuppressive agents.
The identification of conventional PKC isoforms in the activation of
the IKK complex activation is of potential relevance. By using specific
pharmacological inhibitors in primary CD3+ T cells, we
conclude that T cell-specific classical PKC isoforms such as or
I must be involved in this process (58-62). Identification of which
of these PKC isoforms that mediate the activation of IKK needs to be
pursued. The recent observation that PKC can directly interact and
activate IKK but not IKK (41) suggests that PKC can directly
mediate TCR/CD3-generated signals to the IKK complex. On the contrary,
whereas PKC is activated during antigen presentation (43) and
involved in the induction of AP-1 transcriptional activity (42, 63),
its lack of cytoplasmic membrane translocation following TCR/CD3
activation, together with results presented here, suggests that this T
lymphocyte-specific PKC isoform may participate in signal transduction
pathways activated following antigen presentation, separate from those
initiated from TCR/CD3. Antigen presentation requires not only the
activation of TCR/CD3, but also of other co-stimulatory receptors such
as CD28. The recent report (64) demonstrating that the combination of
CD3- and CD28-generated signals converge on the mitogen-activated protein 3-type kinase, Cot, suggests that the process of antigen presentation that leads to NF-B activation may require the separate but coordinated activation of at least TCR/CD3 and CD28 signaling pathways, each one with distinct but necessary second messages. Future
studies should address how two necessary components of the
TCR/CD3-initiated pathways, conventional PKC isoforms and calcineurin,
interact with the CD28-dependent second messengers to
effectively activate NF-B.
B
Kinase and NF-
,
TOP
ABSTRACT
INTRODUCTION
