 |
INTRODUCTION |
The high affinity receptor for IgE,
Fc
RI,1 is an important
initiator of type I allergic reactions (1) and is associated with the
development of chronic disease because its expression is significantly
increased in atopic individuals (2, 3). Fc
RI is a tetramer
consisting of
,
, and two disulfide-linked
chains (4, 5). The
chain is required for Fc
RI signal transduction and is also
involved in the signaling pathways of Fc
and T cell receptors (6,
7). In addition, FcR
is required for cell surface expression of
Fc
RI, and thus mast cells from
-null mice do not degranulate nor
produce interleukin-4 to an IgE-mediated stimulus (8). Furthermore, the
Fc receptor
chain (FcR
) is important to the pathological
consequences of immune complex deposition and inflammation (9).
The importance of tyrosine phosphorylation of the FcR
to downstream
signaling events is well established (10, 11). After FcR aggregation, a
Src family tyrosine kinase phosphorylates the tyrosines within the
immunoreceptor tyrosine-based activation motif (ITAM) of the
chain.
Tyrosine phosphorylation of the ITAM tyrosines leads to recruitment of
SH2-containing proteins which are involved in subsequent signaling
steps (reviewed in Ref. 12). One such protein is Syk kinase (13) whose
activity is critical to mast cell responses (14-16).
In mast cells, tyrosine phosphorylation of both Fc
RI
and
is
observed upon Fc
RI engagement (10). In addition, the Fc
RI
is
also phosphorylated on serine residues, whereas the Fc
RI
is
phosphorylated on threonine residues (10). In a mast cell line
(RBL-2H3), threonine phosphorylation of the Fc
RI
chain was
demonstrated to be mediated by receptor-associated protein kinase C
(PKC
) (17). The function of threonine phosphorylation of the
Fc
RI
is not known but has been the subject of speculation. Bingham et al. (18) reported that threonine phosphorylation of the Fc
RI
preceded its tyrosine phosphorylation and that both threonine and tyrosine phosphorylation were delayed in a low secreting variant. This suggested the possible functional correlation of threonine phosphorylation with degranulation. In addition, we previously found a correlation between threonine phosphorylation and
the rate of Fc
RI endocytosis as a specific PKC inhibitor inhibited
both processes (17).
In the present study we sought to identify the site of threonine
phosphorylation in the Fc
RI
and to assess the functional significance of this phosphorylation event by transfecting
RBL-2H3-derived
-deficient cells (19) or
-null bone
marrow-derived mast cells (BMMC) with either wild type or variant
chains. Using this approach we found that threonine 60 was
phosphorylated in vivo and that insertion of a negatively
charged amino acid residue at position 60 of the Fc
RI
substituted
for phosphorylation at this site, resulting in the
Fc
RI-dependent activation of Syk.
 |
EXPERIMENTAL PROCEDURES |
Immunoglobulins and Reagents--
Anti-dinitrophenyl
(DNP)-specific mouse monoclonal IgE (20) was purified as described
(21). Dinitrophenylated human serum albumin (DNP30-40-HSA)
was from Sigma. The mouse monoclonal (4G10) antibody to phosphotyrosine
conjugated to horseradish peroxidase and a polyclonal rabbit antibody
to Shc were from Upstate Biotechnology Inc. (Lake Placid, NY). The
mouse monoclonal antibody to PKC
was from Transduction Laboratories
(Lexington, KY). The mouse monoclonal antibody to Syk was as described
(22), and a rabbit polyclonal antibody to Syk was a kind gift from U. Blank (Institut Pasteur, Paris, France). A rabbit polyclonal antibody
to FcR
was kindly provided by R. P. Siraganian (NIDCR, National
Institutes of Health), and a chicken antibody to the FcR
was as
described previously (16). FcR
peptides used in the in
vitro studies were obtained from Quality Controlled Biochemicals
(Hopkinton, MA) or were produced in-house (George Poy, NIDDK, National
Institutes of Health) and analyzed by mass spectrometry and for amino
acid composition by Harvard Microchemistry (Cambridge, MA).
3,3'-Dithiobis[sulfosuccinimidyl propionate] (DTSSP) was purchased
from Pierce. Polyvinylidene difluoride membranes, Tricine and
Tris-glycine sample buffers, Tris-glycine, and Tricine
SDS-polyacrylamide gels were from Novex (San Diego, CA).
Cells and Activation--
RBL-2H3 and the RBL-2H3-derived
-cell lines were cultured as a monolayer in stationary flasks
essentially as described (23, 24). Stable transfectants were generated
by electroporation of the Fc
RI
or mutants thereof as described
previously (25). To obtain cell populations expressing approximately
equal numbers of receptors, stable transfectants were labeled with
FITC-IgE and sorted for 10% of the cells providing the highest
fluorescent signal. Cloning of the stable transfectants was avoided to
minimize potential clonal variation (26). Fc
RI
-null BMMCs were
grown in interleukin-3-containing medium essentially as described (27). Cells were used at the fourth to sixth week where cultures were greater
than 90% mast cells. For degranulation assays, transfected BMMC were
stimulated with 20 ng of DNP-HSA for 10 min at 37 °C, and then the
percent release of
-hexosaminidase was determined (21). For
endocytosis and protein tyrosine phosphorylation, cells were stimulated
with 100-400 ng of DNP-HSA for the indicated times.
Site-directed Mutagenesis and Constructs--
Individual
mutations of the threonine residues at positions 52 and 60 to alanine
or aspartic acid were by PCR using mismatched primers and
ExtendTM high fidelity polymerase (Roche Molecular
Biochemicals). For the T52A mutation the rat Fc
RI
in pSVL was
used as a template in a nested PCR using the internal 5' and 3' primers
CTGAACGCCCGGAACCAGGAGACA and TGTCTCCTGGTTCCGGGCGTTCAG and the external
5' and 3' primers TGGGATCTCGAGATGATCCCAGCGGTGATCTTGTTC and
ATACATACGCGTCTATTGGGGTGGTTTCTCATGTTTCAG that encoded XhoI
and MluI restriction sites, respectively. For the T60A and
T60D mutations of Fc
RI
, the same 5' external primer shown above
was used in combination with CATACGCGTCTATTGGGGTGGTTTCTCATGTTTCAGAGCCT and CATACGCGTCTATTGGGGTGGTTTCTCATGTTTCAGATCCTCATATGT, respectively, both of which encoded an MluI restriction site. The obtained
PCR products were cloned in the XhoI/MluI sites
of the mammalian expression vector
MTH (28).
For competitive PCR detection of TNF-
, we constructed a competitor
template that contained a fragment of the Fc
RI
and the nucleotide
sequence of the respective TNF-
primers at the 5' and 3' ends. The
competitor was generated by PCR using the rat Fc
RI
in pSVL as the
template and the following 5' and 3' primers: CAACTCGAGCAAGGAGGAGAAGTTCCCAAACAGACTTTGACGACGAAGTGC and
CTTAAGCTTCGGACTCCGTGATGTCTAAGTCAGCACGGCACTGCAAAAGGC. These primers
encoded the following 5' and 3' sequence recognized by the TNF-
primers used for reverse transcriptase-PCR: CAAGGAGGAGAAGTTCCCAA and CGGACTCCGTGATGTCTAAG.
Semliki Forest virus constructs were PCR generated for both wild type
Fc
RI
and T60A mutated Fc
RI
using as templates the previously generated constructs in the
MTH vector as described above
and the following 5' and 3' primers:
AAAATGCATGCCACCATGATCCCAGCGGTG and AAAGGGCCCCTATTGGGGTGGTTTCTC.
The primers encoded NsiI and ApaI
restriction sites, respectively. The obtained PCR products were cloned
into the NsiI and ApaI sites of the modified
pSFV1 vector previously described (29). Fidelity of all constructs used
in this study was determined by direct sequencing.
Assays for Ligand-Receptor Binding, Endocytosis, Cell Adhesion,
and TNF-
mRNA Expression--
Assays to determine cell surface
expression of Fc
RI using 125I-labeled IgE were
essentially as described previously (30). All transfectants expressed
between 2.0 and 3.0 × 105 receptors/cell. Endocytosis
of Fc
RI was defined as amount of 125I-labeled IgE not
elutable by acid pH treatment of the cell surface and determined
essentially as described (31, 32).
Adhesion of cells to fibronectin was determined by measuring the
IgE/Agn-stimulated binding to fibronectin-coated plates after loading
cells with the fluorescent dye calcein AM as described previously (33,
34). Fibronectin-coated plates (96-well SmartPlastic® plates precoated
with ProNectin® F, Protein Polymer Technologies, San Diego, CA) were
prepared by blocking with 200 µl of 20 mg/ml bovine serum albumin for
2 h at 37 °C and washing three times with phosphate-buffered
saline. The IgE-sensitized, calcein-loaded cells were stimulated with
400 ng/ml DNP-HSA and immediately added to the washed plates in the
presence or absence of the competitor peptide, RGD. Plates were
incubated in the CO2 incubator at 37 °C for 60 min and
processed essentially as described (34). Fluorescence was measured
using a fluorescein filter set (absorbance maximum at 494 nm, emission
at 517 nm) and a fluorescent enzyme-linked immunosorbent assay plate reader.
For TNF-
mRNA expression, Fc
RI
stably transfected and
IgE-sensitized cells were stimulated for 1 h with 0.1 ng of
DNP-HSA. Total RNA was isolated and reverse transcribed as described
previously (21). To determine TNF-
mRNA expression a
semiquantitative competitive PCR was used. A known concentration (0.01 pg) of an internal competitive standard (described above), containing
the TNF-
primer binding sites, was added to the PCR reaction. To maintain linearity in the PCR we used conditions in which the internal
standard (348 base pairs), and TNF-
mRNA (501 base pairs) gave
approximately equal amounts of product. Quantitation of negative images
of agarose gels was by densitometry.
In Vitro Phosphorylation Assays--
A peptide encoding the
cytosolic region of the Fc
RI
was synthesized, and in addition
other Fc
RI
peptides were synthesized in which either all of the
threonines were converted to alanine or threonine-alanine substitutions
were limited to defined positions. Protein kinase C
was prepared by
P. Acs (NCI, National Institutes of Health) and used as described
previously (17). After an in vitro kinase reaction using
described conditions (17), phosphorylated peptide was isolated by
reversed phase HPLC. We found that the background of the assay was
significantly reduced if polyetheretherketone was substituted for
stainless steel in the HPLC system tubing and column jacket.
Radioactivity in the collected peaks was measured by Cerenkov counting,
and relevant fractions were then subjected to phosphoamino acid
analysis (17).
[32P]Orthophosphate Labeling of Fc
RI
,
Phosphoamino Acid Analysis, and Peptide Maps--
Cells were
metabolically labeled with [32P]orthophosphate
essentially as described (10). Cells were then sensitized with
anti-DNP-specific IgE at a concentration of 5 µg/ml for 1 h.
Radiolabeled, IgE-sensitized cells (2.1 × 107 in 0.7 ml) were stimulated with 400 ng/ml DNP-HSA for 3 min at 37 °C and
processed to recover IgE-occupied Fc
RI as described previously (17).
Recovered proteins were resolved, and phosphoamino acid analysis was as
described previously (17).
Peptide maps were generated as described (35). Briefly, the identified
Fc
RI
was excised from the polyvinylidene difluoride membrane and
incubated with polyvinylpyrrolidone 360 kDa (PVP-360, Sigma) to block
nonspecific binding of the protease. The excised membrane was then
washed with 50 mM ammonium bicarbonate and subsequently incubated with 10 µg of Glu-C V8 protease for 2 h at 37 °C.
This was followed by a second addition of Glu-C V8 protease and an overnight incubation at 37 °C. The soluble peptides were recovered by lyophilization and were resuspended in electrophoresis buffer for
two-dimensional peptide mapping as described (35).
Chemical Cross-linking, Immunoprecipitations, and Western
Blots--
Chemical cross-linking conditions, immunoprecipitations,
and Western blots were previously described (36). In some experiments antibody to phosphotyrosine was used to determine Syk activation, PKC
phosphorylation (an indication of its translocation), and the
presence of Fc
RI
under reducing conditions. In other experiments proteins were identified directly with their respective antibodies.
Transient Expression of Fc
RI
in BMMC from FcR
Null Mice
and Degranulation Assay--
Generation of recombinant Semliki Forest
virus was described previously (29). For infection of BMMC, 4.0 to
7.0 × 106 cells from FcR
-null mice were infected
with a 1:250 titer of Semliki Forest virus in the presence of 7.5%
polyethylene glycol as described (29). After a 30-min incubation, the
virus was removed, and cells were incubated for an additional 8 h.
During this time one-tenth of the cells were separated and incubated with FITC-IgE (1 µg), whereas the remaining cells were incubated with
5 µg of unlabeled IgE. Cells were then washed with phosphate-buffered saline to remove unbound IgE and either analyzed by FACS (FITC-IgE labeled cells) or in a degranulation assay. Degranulation
(
-hexosaminidase release (21)) was measured in either 250- or
500-µl volumes using 20 ng/ml of DNP-HSA for 10 min (maximal release)
at 37 °C in Tyrodes buffer (32).
 |
RESULTS |
Phosphorylation of Fc
RI
on Threonine 60--
To define the
site of threonine phosphorylation of the Fc
RI
, the in
vitro studies took advantage of the previous observation that
PKC
was uniquely able to phosphorylate the Fc
RI
(17). Purified
peptides corresponding to the entire cytosolic region of the Fc
RI
(wild type or variants) were incubated with PKC
in an in
vitro kinase reaction. After incubation, the phosphorylated peptides were isolated by HPLC. The results confirmed our previous study (17) that showed that PKC
phosphorylates the wild type Fc
RI
peptide mainly on threonine (Fig.
1) with a minor
incorporation of label to serine. Substitution of alanine for all
threonines (T48A,T52A,T57A,T60A) in the Fc
RI
peptide resulted in
a significant reduction in the overall extent of phosphorylation, and
phosphoamino acid analysis indicated that only serine was
phosphorylated (Fig. 1A). Fc
RI
peptides in which the
threonine residues were sequentially added (T52A,T57A,T60A; T57A,T60A;
and T60A) showed minimal to no threonine phosphorylation (Fig. 1,
A and B). In contrast, the Fc
RI
peptide
variant (T48A,T52A,T57A) that contained only threonine 60, the
threonine closest to the C terminus, incorporated similar amounts of
radioloabel to that seen for the wild type peptide (Fig.
1B). Furthermore, the overall level of phosphorylation was far greater than that seen for the other threonine-to-alanine variants
used in these experiments. In addition, as with the wild type peptide,
the amount of threonine phosphorylation was far greater than the amount
of serine phosphorylation. Thus, we conclude from these in
vitro studies that the target of PKC
activity is the threonine
closest to the C terminus (Thr60) on the Fc
RI
chain.


View larger version (45K):
[in this window]
[in a new window]
|
Fig. 1.
Fc RI ITAM is
phosphorylated on threonine 60 in vitro by
PKC . HPLC chromatograms, incorporated
radioactivity, and phosphoamino acid analysis of recovered fractions
are shown for the peptide encoding the entire cytoplasmic domain of the
Fc RI (Wild Type), the peptide where all threonines are
mutated (T(48, 52, 57, 60)A), the peptide where threonine 48 is not mutated (T(52, 57, 60)A), the peptide where threonine
48 and 52 are not mutated (T(57, 60)A), the peptide where
only threonine 60 is mutated (T(60)A), and the peptide where
only threonine 60 is not mutated (T(48, 52, 57)A). Note that
the distinct pattern where fraction 38 shows high levels of phosphate
incorporation in threonine residues is seen only in wild type peptide
and in the peptide where threonine 60 is not mutated (T(48, 52, 57)A).
|
|
Based on the aforementioned in vitro results, we limited our
in vivo analysis to the mutation of T60A but also considered a T52A mutation that was proposed in a previous report by Pribluda et al. (37) as the possible site of threonine
phosphorylation. Stable transfectants were generated, in the previously
described RBL Fc
RI
-deficient cell line (24), that expressed wild
type, T52A, and T60A Fc
RI
. As shown in Fig.
2A, the transfected cell populations expressed receptor numbers similar to those of RBL cells.
As compared with the parental RBL
cell line, receptor expression
increased approximately 10-fold with all transfectants expressing
between 2 and 3 × 105 receptors/cell. Tyrosine
phosphorylation of Fc
RI
was analyzed by immunoprecipitation of
phosphorylated proteins with antibody to phosphotyrosine followed by
immunoblotting with antibodies to Fc
RI
or to Shc (Fig.
2B). The Shc immunoblot served as a control for protein
loading as Shc tyrosine phosphorylation is unaffected by Fc
RI
aggregation if the cells were incubated in the presence of serum (38).
Although no significant difference in the tyrosine phosphorylation of
Fc
RI
wild type (
WT) and the Fc
RI
T60A (
T60A) was
observed, a dramatic increase in the tyrosine phosphorylation of the
Fc
RI
T52A (
T52A) was found even in nonstimulated cells (Fig.
2B). Phosphorylation of Fc
RI
was not dramatically
different among transfectants, although a 30% increase was observed in
the Fc
RI
T52A (
T52A) transfectant (data not shown). To
determine what effect the mutations of the Fc
RI
had on threonine
phosphorylation, we isolated the Fc
RI
from Fc
RI-activated
transfectants that were labeled with [32P]orthophosphate
and phosphoamino acid analysis was performed. As shown in Table
I, threonine phosphorylation of
Fc
RI
was still present in the T52A mutant. In fact, an increase
in the ratio of threonine to tyrosine was observed. In contrast, the T60A mutation resulted in a dramatic decrease of threonine
phosphorylation, although low levels of threonine phosphorylation were
detected consistent with the expression of low levels of wild type
Fc
RI in the transfectants derived from
cells (Fig.
2A). Two-dimensional peptide mapping (using Glu-C V8
protease) of the
WT and
T60A showed a dramatic reduction in the
presence of one radiolabeled peptide that co-migrated with the expected
peptide standard (Fig. 2C). We did not expect, nor did we
find, complete absence of this phosphorylated peptide, given that low
levels of wild type Fc
RI
are present in these transfectants (Fig.
2A). From the collective data we conclude that threonine 60, which is found in the Y+2 position of the Fc
RI
ITAM C-terminal
YXXL motif, is the sole threonine modified by
phosphorylation in these cells.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 2.
Expression, phosphorylation, and peptide map
of wild type and mutant
Fc RI .
A, quantitation of receptor expression of RBL, parental cell line, and wild type Fc RI ( wt), Fc RI T52A
( T52A), and Fc RI T60A ( T60A)
transfectants. Transfectants were FACS sorted and selected for the 10%
of highest Fc RI expressing cells with FITC-IgE. Recovered cells were
grown in culture and receptor expression was quantitated using
125I-labeled IgE as described (30). Data are from four
individual experiments. B, tyrosine phosphorylation of wild
type ( WT) and mutant ( T52A and
T60A) Fc RI . IgE-sensitized cells (5 × 106) were stimulated (+) or not ( ) with 100 ng of DNP-HSA
(Agn) for 5 min. Cells were lysed and tyrosine
phosphorylated proteins recovered by immunoprecipitation
(IP) with antibody to phosphotyrosine (Anti-PY).
Immunoblots were probed with a chicken antibody to Fc RI follow by
stripping and sequential immunoblotting (IB) with antibody
to Shc (p46 and p52). The latter was used as a control for loading
because no change in the Fc RI-induced tyrosine phosphorylation of
Shc was seen in cells incubated in the presence of serum (38).
C, Glu-C V8 protease peptide map of wild type
( WT) and mutant ( T60A) Fc RI . Labeling
of cells, protease digest, and peptide resolution were as described
under "Experimental Procedures." A synthesized threonine
phosphorylated standard peptide (pTLKHE) was added to the sample to
determine the appropriate migration of the expected peptide.
|
|
View this table:
[in this window]
[in a new window]
|
Table I
Ratio of phosphothreonine to phosphotyrosine in wild type and mutant
Fc RI transfectants
Data are from three independent phosphoamino acid analysis experiments
of in vivo radio-phospholabeled cells from which the
Fc RI was isolated prior to and after Fc RI aggregation.
Tyrosine phosphorylation of the Fc RI T60A was similar to
Fc RI WT, whereas that of Fc RI T52A was increased.
[32P]Orthophosphate incorporation was quantitated on a
Molecular Storm phosphoimager (Molecular Dynamics, Sunnyvale, CA), and
the pT:pY ratio was determined. WT, wild type, T52A, threonine 52 mutant; T60A, threonine 60 mutant. For nontransfected RBL cells the
pT:pY ratio was 0.35 ± 0.16 (17).
|
|
Effects of Fc
RI
T60A Mutation on Mast Cell Function--
We
previously reported that the specific PKC inhibitor Ro 31-7549 was able
to inhibit both the Fc
RI-stimulated threonine phosphorylation of the
Fc
RI
and the rate of Fc
RI endocytosis (17). We revisited this
topic to determine whether the T60A mutation would mimic our previous
results. Fig. 3A shows that mutation of T60A, but not T52A, had a significant effect on the rate of
Fc
RI endocytosis. As much as 50% inhibition of endocytosis was
found at early times (5 and 10 min) following Fc
RI aggregation. However, at later times (40 and 60 min) no significant difference in
Fc
RI endocytosis was observed (Fig. 3A). These results
were almost identical to those observed in our previous study where the
use of the PKC inhibitor, Ro 31-7549, inhibited the initial rate of
endocytosis by as much as 80% (17). In contrast, the Fc
RI
endocytosis of the T52A mutant showed kinetics similar to that of the
wild type transfectant, but the overall extent of endocytosis was
increased when compared with the wild type transfectant. Because the
T52A has a greater level of tyrosine phosphorylation (Fig.
2B), these results are consistent with the importance of tyrosine phosphorylation to endocytosis of FcR
-containing receptors (39).

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 3.
Endocytosis, adhesion, and
TNF- mRNA responses of wild type and
mutant Fc RI transfectants. A,
endocytosis is de layed in the T60A transfectant, but levels are enhanced in the
T52A transfectant. The endocytosis assay is outlined under
"Experimental Procedures." The percentage of endocytosis is net.
Data are from five experiments. B, adhesion assays are
described under "Experimental Procedures." The stimulated increase
in adhesion for the -cell line was normalized to 1.0 to measure
whether significant differences could be found among the transfectants
by comparing all experiments. Although an approximate 50% increase in
adhesion was found for all transfectants ( wt,
T52A, and T60A), no significant difference
was observed among them. Data are from four individual experiments.
C, TNF- mRNA levels are reduced in the T60A
transfectants. Detection of TNF- mRNA levels was described
previously (21) and briefly detailed under "Experimental
Procedures." To compare all experiments, the response observed in the
cell line was normalized to 1.0. Data shown are the response of
cells stimulated with 0.1 ng of antigen. Similar results were obtained
with 1 ng of antigen. Fold induction is reported as a net value with
the response detected in nonstimulated cells subtracted. Data are from
five individual experiments.
|
|
Increased adhesion of RBL cells in response to Fc
RI stimulation has
been reported (reviewed in Ref. 40). The increased adhesion can be
demonstrated by binding of these cells to fibronectin-coated surfaces
(41). We analyzed the adhesion based on an integrin-fibronectin interaction, because we could inhibit up to 95% of the
Fc
RI-stimulated adhesion by the concurrent addition of the competing
RGD peptide with the cells to the fibronectin-coated wells (data not
shown). We utilized this approach to determine whether the T60A
mutation would have an effect on Fc
RI-mediated adhesion. Fig.
3B shows the fibronectin-specific adhesion of
Fc
RI-stimulated
-,
WT,
T52A, and
T60A cell lines.
Results were normalized to the Fc
RI-stimulated response of the
cells where little difference in adhesion was observed when compared
with nonstimulated cells. Although reconstitution of the
cells with
Fc
RI
led to increased adhesion (~1.5-fold), no significant
difference was observed among the transfectants. This suggested that
the Fc
RI-stimulated adhesion to fibronectin was unaffected by
increased threonine and tyrosine phosphorylation (T52A) or decreased
threonine phosphorylation (T60A) of the Fc
RI
. Similar results
were obtained when phorbol ester was used as a stimulus for adhesion
(data not shown). Collectively, the results demonstrated that some
Fc
RI-dependent events were unaffected by mutation of the
threonines in Fc
RI
.
We also analyzed the effect of the T60A mutation on the stimulation of
TNF-
mRNA production (21, 42). The results shown in Fig.
3C were normalized to the Fc
RI-stimulated response of the
cells. Both the
WT and
T52A transfectants showed an
additional increase of TNF-
mRNA levels of up to 50% following
Fc
RI stimulation when compared with the
cell response. In
contrast, the
T60A transfectant showed no increase in response, and
in most experiments TNF-
mRNA levels were below those of the
cells (Fig. 3C). The reduced response was a consistent
observation regardless of the concentration of antigen used for
stimulation (data not shown). Thus, the threonine phosphorylation of
the Fc
RI
is important to the Fc
RI-mediated induction of
TNF-
mRNA.
We analyzed the effect of threonine mutation (T60A) of Fc
RI
on
degranulation in BMMC derived from FcR
-null mice because the stable
transfectants, like the parental
cells, secreted poorly, and prior
studies showed that reconstitution with wild type Fc
RI
did not
induce a degranulation response comparable to the RBL cell line (24).
Table II shows that in four independent experiments, reconstitution of Fc
RI expression with either
WT or
T60A showed that expression of the latter inhibited degranulation (11-49%). Although all experiments showed inhibition, variable levels
of secretion (15 to 38%) and inhibition (11 to 49%) were observed.
This is likely due to the inability to control the levels of receptor
assembly and expression among experiments because of transient
expression of the Fc
RI
. Regardless, expression of the
T60A
showed inhibition of degranulation in all experiments.
View this table:
[in this window]
[in a new window]
|
Table II
Mutation of threonine 60 of Fc RI inhibits mast cell degranulation
FcR -null BMMC were transfected with WT or T60A constructs by
infection with Semliki Forest virus as described under "Experimental
Procedures." Four independent experiments from two independent
cultures of BMMC are shown. Cells were stimulated with 20 ng/ml DNP-HSA
for 10 min at 37 °C. Percentage of stimulated degranulation was
calculated from the level of hexosaminidase detected in the medium, and
the total hexosaminidase of cells expressing Fc RI (as determined by
FITC-IgE binding and FACS analysis). This was corrected for the levels
detected in nonstimulated samples. For the WT percent net
degranulation ranged from 15 to 38%.
|
|
The Fc
RI
T60A Mutation Inhibits Syk Interaction and
Activation--
Because Fc
RI-mediated endocytosis (43), TNF-
production (44), and degranulation (15) have been demonstrated to be dependent on the activation of Syk, we analyzed Syk activation in
Fc
RI
transfectants by measuring its tyrosine phosphorylation, because we previously demonstrated that tyrosine phosphorylation is an
accurate measure of Syk activity (16). As shown in Fig. 4A, cells expressing the
T60A showed a significant defect in the activation of Syk. In
contrast, both
WT and
T52A expressing cells effectively activated
Syk with the latter showing increased Syk phosphorylation consistent
with the increased levels of tyrosine phosphorylated receptors in this
transfectant (Fig. 2B). In some experiments up to a 3-fold
increase in Syk activation was observed in the
T52A expressing cells
when compared with the wild type control, whereas a 60-90% inhibition
of Syk activation was observed in the
T60A transfectants (Figs.
4A and 5). However, the
observed inhibition did not result from a generalized defect in Fc
RI
signal transduction because, as shown in Fig. 4B, the
tyrosine phosphorylation of PKC
in response to Fc
RI stimulation
was unaffected by either the
T52A or
T60A mutations. Because
tyrosine phosphorylation of PKC
requires its translocation to the
plasma membrane (45, 46), these results demonstrated that PKC
translocation is independent of threonine phosphorylation of
Fc
RI
. Thus, threonine phosphorylation of the Fc
RI
is
primarily important for the activation of Syk and downstream effector
functions.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 4.
Activation of Syk, but not of PKC ,
is defective in the
Fc RI T60A
transfectant. A, IgE-sensitized Fc RI WT, T52A,
and T60A transfectants (2.5 × 106 cells) were
stimulated (+) or not ( ) with 300 ng of DNP-HSA (Agn).
Cells were lysed and Syk was immunoprecipitated (IP) with
antibody to Syk (Anti-Syk). Immunoblotting (IB)
of resolved proteins with antibody to phosphotyrosine (PY)
was followed by stripping and reprobing with antibody to Syk
(Syk). B, cells treated as in A were
lysed, and PKC was immunoprecipitated (IP) with antibody
to PKC (Anti-PKC ). Immunoblotting (IB) of
resolved proteins with antibody to phosphotyrosine (PY) was
followed by stripping and reprobing with antibody to PKC
(PKC ). Tyrosine phosphorylation of PKC in RBL-2H3
cells was previously shown to require its translocation (45, 46).
|
|

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 5.
Mutation of
Fc RI threonine 60 to
alanine inhibits its interaction with Syk. IgE-sensitized
Fc RI WT, T52A, and T60A transfectants (5.0 × 106 cells) were stimulated (+) or not ( ) with DNP-HSA
(300 ng) for 5 min at 37 °C. Cells were lysed, and post-nuclear
lysates were treated with the chemical cross-linking agent DTSSP. Syk
was immunoprecipitated (IP: Anti-Syk), and resolved proteins
were identified as Syk and Fc RI by immunoblotting. To detect
Fc RI , the film was subjected to prolonged enhanced
chemiluminescence exposure.
|
|
We explored the possible mechanism by which the
T60A mutation
inhibited the activation of Syk. Because Syk activation in mast cells
was demonstrated to be dependent on its interaction with the activated
Fc
RI (47, 48), we investigated whether the
T52A or the
T60A
mutations had any effect on the interaction of Fc
RI
with Syk in
activated cells. In this series of experiments we immunodepleted Syk
from chemically cross-linked (DTSSP) nonactivated and activated cell
lysates and determined whether Fc
RI
co-immunoprecipitated by
immunoblotting. This approach was used because after chemical cross-linking the antibody to Fc
RI
was not as efficient in
immunoprecipitation as the antibody to Syk. As demonstrated in Fig. 5,
immunoprecipitation of Syk from chemically cross-linked cell lysates
showed that in cells expressing
T60A Syk activation was inhibited,
whereas those expressing
T52A showed increased Syk activation. When
immunoblots were probed for co-immunoprecipitated Fc
RI
its
presence was detected following Fc
RI stimulation in both the
WT
and
T52A transfectants with the latter showing greater levels of
Fc
RI
. In addition, in most experiments we could detect trace
amounts of phosphorylated Syk and Fc
RI
in association with Syk in
nonstimulated
T52A transfectants (Figs. 4A and 5). In
contrast, only minimal amounts of Fc
RI
were found to
co-immunoprecipitate with Syk isolated from the activated
T60A
transfectants (Figs. 5 and
6A). Thus, the results
suggested that the absence of threonine phosphorylation of the
Fc
RI
in the
T60A transfectants inhibited Fc
RI interaction with Syk.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 6.
Mutation of
Fc RI threonine 60 to
aspartic acid reconstitutes Syk interaction, Syk activation, and the
TNF- mRNA response. A,
sequence alignment of ITAMs that interact with Syk (dashes
represent introduced gaps), introduced mutations, and
reconstitution of Syk activation and interaction with Fc RI in the
T60D mutant. IgE-sensitized Fc RI WT, T60A, and T60D
transfectants (3.0 × 107 cells) were stimulated (+)
or not ( ) with 300 ng of DNP-HSA (Agn). Cells were lysed,
and postnuclear lysates were treated with DTSSP. Syk was
immunoprecipitated (IP: Anti-Syk), and resolved proteins
were identified as Syk and Fc RI by immunoblotting
(IB). Because of the cell numbers used, we could detect the
presence of Fc RI with Syk in nonstimulated cells. As compared
with Fig. 5, only a short exposure to film was required for detection.
PY, phosphotyrosine. B, Fc RI T60D
reconstitutes the TNF- mRNA response to the level of wild type
Fc RI . TNF- mRNA assay is described under "Experimental
Procedures." The PCR amplified products were resolved on agarose gels
and normalized to the internal standard (see "Experimental
Procedures"). Quantitation was by densitometry. The TNF- mRNA
response of the Fc RI T60A was normalized to 1.0 to allow
comparison between experiments. Data are from two experiments.
|
|
A Negative Charge at Fc
RI
Threonine 60 Is Required for High
Affinity Syk Interaction, Efficient Syk Activation, and the TNF-
mRNA Response--
We investigated the possible requirement for
phosphorylation at threonine 60 in the interaction and activation of
Syk. Sequence analysis of receptor ITAMs that interact with Syk
revealed the presence of an amino acid residue, at the equivalent
location in the ITAMs, that could be phosphorylated or was negatively
charged (Fig. 6A). We postulated that a negative charge at
threonine 60 would be the equivalent of phosphorylation of threonine
and would result in complete activation of Syk in response to Fc
RI
engagement. To test this hypothesis a
T60D transfectant was
generated that contained a hybrid ITAM
(YTGLX7-YEDL; throughout, dashes in sequences represent introduced gaps) with features of both the B cell receptor Ig
/
(YEGLX7-YEDI) and the FcR
(YTGLX7-YETL). As shown in Fig. 6A,
the
T60D transfectant showed normal levels of Syk activation, and
the association of Fc
RI
with Syk was comparable with that of the
WT transfectant. In these chemical cross-linking experiments we used
6-fold more cells (3.0 × 107) than in the experiments
shown in Fig. 5. Thus, we could detect Fc
RI
associated with Syk
in nonstimulated cells (Fig. 6A), and in darker exposures of
the shown phosphotyrosine blot Syk phosphorylation was also detected
(data not shown). These results clearly demonstrated that mutation of
threonine 60 to a negatively charged aspartic acid, rather than to the
more physiochemically related alanine, completely reconstituted
Fc
RI
interaction with Syk leading to the activation of the
latter. Thus, we would expect that the
T60D transfectant would show
a TNF-
mRNA response similar to that of the
WT transfectant.
Fig. 6B shows that the mutation T60D reconstituted the
TNF-
mRNA response to levels comparable with that of wild type
Fc
RI
. This demonstrates the requirement of a negative charge at
threonine 60 for high affinity interaction of Syk with the Fc
RI
ITAM and activation of Syk to levels that result in "normal" mast
cell responses.
 |
DISCUSSION |
In this study, we present direct evidence identifying the site of
threonine phosphorylation on the Fc
RI
. Specifically, results from
both our in vitro and in vivo experiments
demonstrated that threonine 60 is the site of phosphorylation on the
Fc
RI
and that phosphorylation at threonine 60 is important for
complete activation of Syk. In addition, our findings provide evidence of a general mechanism for Syk activation because we found that a
negative charge at the equivalent position of threonine 60 substitutes for threonine phosphorylation at this site and is in common to all
ITAMs interacting with and activating Syk (Fig. 6A). This requirement is likely to extend to other cells like platelets, where
collagen activation of Syk requires the complexing of glycoprotein VI
(collagen receptor) with FcR
(49, 50).
Pribluda and colleagues (37) used HPLC and peptide standards to
identify products of protease reactions with in vivo labeled Fc
RI
. The evidence presented suggested that threonine 52 was a
site of phosphorylation. In our hands, mutation of threonine 52 to
alanine resulted in a "gain of function" because more Fc
RI
was tyrosine phosphorylated, and high levels of Fc
RI
phosphorylation occurred in nonstimulated cells. This resulted in
increased endocytosis (Fig. 3A), and in several
experiments higher levels of nonstimulated degranulation were observed
(data not shown). Furthermore, an increased ratio of threonine to
tyrosine phosphorylation was observed in the
T52A transfectants
(Table I), clearly demonstrating that a site for threonine
phosphorylation was still present. A possible explanation for the
observed increased phosphorylation is that a conformational change of
the Fc
RI
is induced by the T52A mutation that allows
receptor-associated Lyn and PKC
to phosphorylate both
cis- and trans-molecularly (51). In contrast,
mutation of threonine 60 led to a "loss of function" and ablated
threonine phosphorylation with no effect on tyrosine phosphorylation.
The importance of in vivo phosphorylation of threonine 60 was demonstrated by the finding that substitution of a negatively
charged amino acid provided full functionality in Syk activation.
It has been reported that ITAMs are not functionally redundant and that
specificity of binding to SH2 domains is based on the residues
surrounding the tyrosines (52). Furthermore, tandem SH2 domains showed
an increased binding specificity to their biologically relevant ITAM
such that another ITAM can bind a tandem SH2 domain but with up to
10,000-fold weaker affinity (53). Because the linker region (where
threonine 52 resides) between paired YXXL motifs does not
significantly contribute to the binding affinity of the Syk SH2 domain
tandem with the Fc
RI
ITAM (54), this suggested that residues in
the paired YXXL motifs might contribute to the high affinity
interaction and specificity. Binding of both Syk SH2 domains to the
Fc
RI
ITAM is required for high affinity interaction (54, 55), and
the N-terminal SH2 domain of Syk binds the
ITAM C-terminal
phosphotyrosine (54). Our findings that the threonine 60 localized in
the C-terminal YETL motif was solely phosphorylated in response to
Fc
RI stimulation prompted us to look at the effects of its mutation
(T60A) on Syk activation and downstream events. The loss of Syk binding
with the Fc
RI
T60A ITAM and its recovery with the Fc
RI
T60D
ITAM demonstrated the importance of threonine phosphorylation in the
Fc
RI
ITAM for high affinity interaction. Because the T60D
mutation (YED60L) mimics the dual negative charge that
would result from phosphorylation of Thr60 in the YETL
motif, this suggests that a dual negative charge is important for the
high affinity interaction of Syk. This dual negative charge pre-exists
in the equivalent motif of the B cell receptor Ig
/
(YEDI).
The crystal structures of both the C-terminal Syk SH2 by itself and the
tandem SH2 domains complexed with phosphotyrosine ITAM peptides are
available (56, 57). However, the information provided by resolving the
N-terminal SH2 domain interaction with a C-terminal phosphotyrosine of
the CD3
ITAM does not likely reflect the interaction of Syk with the
B cell receptor Ig
/
or with Fc
RI
ITAMs, because binding of
the latter two occurs with at least a log fold higher affinity (54,
58). Nevertheless, some insights are gained from these studies with
regard to the interaction of a FcR
ITAM with the N-terminal SH2
domain of Syk. First, it appears that the C-terminal Y+2 amino acid
residue (the threonine equivalent, but a glycine residue in the CD3
ITAM) does not make significant contacts with Syk. For the Fc
RI
ITAM, a phosphorylated threonine would likely provide contact with a highly conserved histidine that is present in both the N- and C-terminal SH2 domains of Syk and ZAP-70. In addition, provided that
the interactions of the Fc
RI
ITAM with Syk might result in a
slightly different conformation than that of the CD3
ITAM, a highly
conserved arginine residue (which is also found in the N-terminal SH2
domain of ZAP-70) could also provide potential charge interactions.
Thus, these possible interactions may fulfill the requirements for a
high affinity interaction. In vitro, threonine phosphorylation does not appear to be a requirement for Syk activation because tyrosine biphosphorylated ITAMs can activate Syk and in vitro measurement of affinities demonstrated a high affinity
interaction (54, 55). We also found (in vitro experiments)
that the introduction of a phosphorylated threonine in the tyrosine
biphosphorylated Fc
RI
ITAM peptide had no effect on the affinity
of interaction with the Syk SH2 domain tandem (data not shown).
Although at the moment we cannot explain the difference in requirements
for in vivo versus in vitro activation
of Syk, it is interesting to note that the mutation of T52A also did
not affect the affinity of interaction of the tyrosine biphosphorylated
ITAM with Syk. However, in vivo this mutation results in a
gain of function (including phosphorylation of the Fc
RI
in the
absence of its aggregation) presumably from a conformational change
that increases phosphorylation of Fc
RI
and thus Syk interaction
(Fig. 5). Although to date there is no direct evidence for an in
vivo structural conformation of the Fc
RI
cytoplasmic domain,
this possibility is presently raised and has been suggested in a prior
study (59).
Of physiological interest is the finding that even small amounts of
activated Syk are sufficient to drive low levels of mast cell
responses. In particular, degranulation was not ablated in the
T60A
transfectant although it was reduced. Furthermore, a reduced induction
of TNF-
mRNA could still be detected. This suggests that the
level of activated Syk required to promulgate downstream signals is
small, and thus engagement of a few receptors may likely be sufficient
for some cytokine production and degranulation. Interestingly, it has
been reported (60) that aggregation of Fc
RI with a low affinity
ligand causes the complete tyrosine phosphorylation of the receptor but
only weakly activates Syk and downstream effectors. Thus, one might
speculate that receptor aggregation by high affinity ligands induces
additional events (such as threonine phosphorylation of Fc
RI
)
required for complete Syk activation and engagement of downstream
effectors. Engagement of downstream effectors may also require the
movement of receptor and associated components to
glycosphingolipid-enriched microdomains (61),2 a process that may not
occur as efficiently with low affinity ligands.3
Finally, the present study provides a possible explanation of why the
Fc
RI
functions as an amplifier of Fc
RI-mediated responses (62). Because PKC
binds to the Fc
RI
ITAM (17), absence of the
Fc
RI
may ablate threonine phosphorylation of the Fc
RI
, resulting in a low affinity interaction with and weak activation of
Syk. Tyrosine phosphorylation of Fc
RI (
2)
receptors in the absence of the Fc
RI
and constitutively
associated Lyn (63) may still occur because of the movement of these
receptors to the Lyn-containing glycosphingolipid-enriched microdomains
(61) where they can be phosphorylated. The present study demonstrates that maximal mast cell responses are dependent on the phosphorylation of threonine 60 of the Fc
RI
ITAM, which mediates a high affinity interaction with Syk resulting in greater amounts of active Syk.