HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Swann, P. G. Articles by Rivera, J. Search for Related Content PubMed PubMed Citation Articles by Swann, P. G. Articles by Rivera, J. Social Bookmarking                      What's this?

J Biol Chem, Vol. 274, Issue 33, 23068-23077, August 13, 1999

Requirement for a Negative Charge at Threonine 60 of the FcR for Complete Activation of Syk^*

Patrick G. Swann, Sandra Odom, Yong-Jie Zhou^§, Zoltan Szallasi^¶, Peter M. Blumberg, Petr Draber^**, and Juan Rivera

From the Section on Chemical Immunology and the ^§ Section on Lymphocyte Activation, National Institute of Arthritis, Musculoskeletal and Skin Diseases,  Laboratory of Cellular Carcinogenesis and Tumor Promotion, NCI, National Institutes of Health, Bethesda, Maryland 20892, the ^¶ Department of Pharmacology, Uniformed Services University of the Health Sciences, Bethesda, Maryland 20814, and the ^** Institute of Molecular Genetics, Academy of Sciences of the Czech Republic, 14220 Prague 4, Czech Republic

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Aggregation of FcRI on mast cells results in the phosphorylation of the FcRI chain on tyrosine and threonine residues within the immunoreceptor tyrosine-based activation motif. In the present study we sought to identify the site of threonine phosphorylation in FcRI and investigate its functional importance. We found that threonine 60 was phosphorylated in vitro and in vivo. Expression of a mutated FcRI (T60A), in either FcRI-deficient or -null mast cells, resulted in a delay of FcRI endocytosis, inhibition of TNF- mRNA production, and inhibition of degranulation but did not affect FcRI-induced cell adhesion. Tyrosine phosphorylation of the T60A mutant  chain was normal, but Syk phosphorylation was dramatically reduced in these transfectants. This correlated with reduced co-immunoprecipitation of FcRI with Syk. Substitution of an aspartic residue for threonine 60 of the FcRI reconstituted complete activation of Syk and co-immunoprecipitation of FcRI with Syk. We conclude that the negative charge provided by phosphorylation of threonine 60 of the FcRI is required for the appropriate interaction and activation of Syk. This is a likely requirement for immunoreceptor tyrosine-based activation motifs involved in Syk activation.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The high affinity receptor for IgE, FcRI,¹ is an important initiator of type I allergic reactions (1) and is associated with the development of chronic disease because its expression is significantly increased in atopic individuals (2, 3). FcRI is a tetramer consisting of , , and two disulfide-linked  chains (4, 5). The  chain is required for FcRI signal transduction and is also involved in the signaling pathways of Fc and T cell receptors (6, 7). In addition, FcR is required for cell surface expression of FcRI, and thus mast cells from -null mice do not degranulate nor produce interleukin-4 to an IgE-mediated stimulus (8). Furthermore, the Fc receptor  chain (FcR) is important to the pathological consequences of immune complex deposition and inflammation (9).

The importance of tyrosine phosphorylation of the FcR to downstream signaling events is well established (10, 11). After FcR aggregation, a Src family tyrosine kinase phosphorylates the tyrosines within the immunoreceptor tyrosine-based activation motif (ITAM) of the  chain. Tyrosine phosphorylation of the ITAM tyrosines leads to recruitment of SH2-containing proteins which are involved in subsequent signaling steps (reviewed in Ref. 12). One such protein is Syk kinase (13) whose activity is critical to mast cell responses (14-16).

In mast cells, tyrosine phosphorylation of both FcRI and  is observed upon FcRI engagement (10). In addition, the FcRI is also phosphorylated on serine residues, whereas the FcRI is phosphorylated on threonine residues (10). In a mast cell line (RBL-2H3), threonine phosphorylation of the FcRI chain was demonstrated to be mediated by receptor-associated protein kinase C (PKC) (17). The function of threonine phosphorylation of the FcRI is not known but has been the subject of speculation. Bingham et al. (18) reported that threonine phosphorylation of the FcRI preceded its tyrosine phosphorylation and that both threonine and tyrosine phosphorylation were delayed in a low secreting variant. This suggested the possible functional correlation of threonine phosphorylation with degranulation. In addition, we previously found a correlation between threonine phosphorylation and the rate of FcRI endocytosis as a specific PKC inhibitor inhibited both processes (17).

In the present study we sought to identify the site of threonine phosphorylation in the FcRI and to assess the functional significance of this phosphorylation event by transfecting RBL-2H3-derived -deficient cells (19) or -null bone marrow-derived mast cells (BMMC) with either wild type or variant  chains. Using this approach we found that threonine 60 was phosphorylated in vivo and that insertion of a negatively charged amino acid residue at position 60 of the FcRI substituted for phosphorylation at this site, resulting in the FcRI-dependent activation of Syk.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Immunoglobulins and Reagents-- Anti-dinitrophenyl (DNP)-specific mouse monoclonal IgE (20) was purified as described (21). Dinitrophenylated human serum albumin (DNP_30-40-HSA) was from Sigma. The mouse monoclonal (4G10) antibody to phosphotyrosine conjugated to horseradish peroxidase and a polyclonal rabbit antibody to Shc were from Upstate Biotechnology Inc. (Lake Placid, NY). The mouse monoclonal antibody to PKC was from Transduction Laboratories (Lexington, KY). The mouse monoclonal antibody to Syk was as described (22), and a rabbit polyclonal antibody to Syk was a kind gift from U. Blank (Institut Pasteur, Paris, France). A rabbit polyclonal antibody to FcR was kindly provided by R. P. Siraganian (NIDCR, National Institutes of Health), and a chicken antibody to the FcR was as described previously (16). FcR peptides used in the in vitro studies were obtained from Quality Controlled Biochemicals (Hopkinton, MA) or were produced in-house (George Poy, NIDDK, National Institutes of Health) and analyzed by mass spectrometry and for amino acid composition by Harvard Microchemistry (Cambridge, MA). 3,3'-Dithiobis[sulfosuccinimidyl propionate] (DTSSP) was purchased from Pierce. Polyvinylidene difluoride membranes, Tricine and Tris-glycine sample buffers, Tris-glycine, and Tricine SDS-polyacrylamide gels were from Novex (San Diego, CA).

Cells and Activation-- RBL-2H3 and the RBL-2H3-derived -cell lines were cultured as a monolayer in stationary flasks essentially as described (23, 24). Stable transfectants were generated by electroporation of the FcRI or mutants thereof as described previously (25). To obtain cell populations expressing approximately equal numbers of receptors, stable transfectants were labeled with FITC-IgE and sorted for 10% of the cells providing the highest fluorescent signal. Cloning of the stable transfectants was avoided to minimize potential clonal variation (26). FcRI-null BMMCs were grown in interleukin-3-containing medium essentially as described (27). Cells were used at the fourth to sixth week where cultures were greater than 90% mast cells. For degranulation assays, transfected BMMC were stimulated with 20 ng of DNP-HSA for 10 min at 37 °C, and then the percent release of -hexosaminidase was determined (21). For endocytosis and protein tyrosine phosphorylation, cells were stimulated with 100-400 ng of DNP-HSA for the indicated times.

Site-directed Mutagenesis and Constructs-- Individual mutations of the threonine residues at positions 52 and 60 to alanine or aspartic acid were by PCR using mismatched primers and Extend^TM high fidelity polymerase (Roche Molecular Biochemicals). For the T52A mutation the rat FcRI in pSVL was used as a template in a nested PCR using the internal 5' and 3' primers CTGAACGCCCGGAACCAGGAGACA and TGTCTCCTGGTTCCGGGCGTTCAG and the external 5' and 3' primers TGGGATCTCGAGATGATCCCAGCGGTGATCTTGTTC and ATACATACGCGTCTATTGGGGTGGTTTCTCATGTTTCAG that encoded XhoI and MluI restriction sites, respectively. For the T60A and T60D mutations of FcRI, the same 5' external primer shown above was used in combination with CATACGCGTCTATTGGGGTGGTTTCTCATGTTTCAGAGCCT and CATACGCGTCTATTGGGGTGGTTTCTCATGTTTCAGATCCTCATATGT, respectively, both of which encoded an MluI restriction site. The obtained PCR products were cloned in the XhoI/MluI sites of the mammalian expression vector MTH (28).

For competitive PCR detection of TNF-, we constructed a competitor template that contained a fragment of the FcRI and the nucleotide sequence of the respective TNF- primers at the 5' and 3' ends. The competitor was generated by PCR using the rat FcRI in pSVL as the template and the following 5' and 3' primers: CAACTCGAGCAAGGAGGAGAAGTTCCCAAACAGACTTTGACGACGAAGTGC and CTTAAGCTTCGGACTCCGTGATGTCTAAGTCAGCACGGCACTGCAAAAGGC. These primers encoded the following 5' and 3' sequence recognized by the TNF- primers used for reverse transcriptase-PCR: CAAGGAGGAGAAGTTCCCAA and CGGACTCCGTGATGTCTAAG.

Semliki Forest virus constructs were PCR generated for both wild type FcRI and T60A mutated FcRI using as templates the previously generated constructs in the MTH vector as described above and the following 5' and 3' primers: AAAATGCATGCCACCATGATCCCAGCGGTG and AAAGGGCCCCTATTGGGGTGGTTTCTC. The primers encoded NsiI and ApaI restriction sites, respectively. The obtained PCR products were cloned into the NsiI and ApaI sites of the modified pSFV1 vector previously described (29). Fidelity of all constructs used in this study was determined by direct sequencing.

Assays for Ligand-Receptor Binding, Endocytosis, Cell Adhesion, and TNF- mRNA Expression-- Assays to determine cell surface expression of FcRI using ¹²⁵I-labeled IgE were essentially as described previously (30). All transfectants expressed between 2.0 and 3.0 × 10⁵ receptors/cell. Endocytosis of FcRI was defined as amount of ¹²⁵I-labeled IgE not elutable by acid pH treatment of the cell surface and determined essentially as described (31, 32).

Adhesion of cells to fibronectin was determined by measuring the IgE/Agn-stimulated binding to fibronectin-coated plates after loading cells with the fluorescent dye calcein AM as described previously (33, 34). Fibronectin-coated plates (96-well SmartPlastic® plates precoated with ProNectin® F, Protein Polymer Technologies, San Diego, CA) were prepared by blocking with 200 µl of 20 mg/ml bovine serum albumin for 2 h at 37 °C and washing three times with phosphate-buffered saline. The IgE-sensitized, calcein-loaded cells were stimulated with 400 ng/ml DNP-HSA and immediately added to the washed plates in the presence or absence of the competitor peptide, RGD. Plates were incubated in the CO₂ incubator at 37 °C for 60 min and processed essentially as described (34). Fluorescence was measured using a fluorescein filter set (absorbance maximum at 494 nm, emission at 517 nm) and a fluorescent enzyme-linked immunosorbent assay plate reader.

For TNF- mRNA expression, FcRI stably transfected and IgE-sensitized cells were stimulated for 1 h with 0.1 ng of DNP-HSA. Total RNA was isolated and reverse transcribed as described previously (21). To determine TNF- mRNA expression a semiquantitative competitive PCR was used. A known concentration (0.01 pg) of an internal competitive standard (described above), containing the TNF- primer binding sites, was added to the PCR reaction. To maintain linearity in the PCR we used conditions in which the internal standard (348 base pairs), and TNF- mRNA (501 base pairs) gave approximately equal amounts of product. Quantitation of negative images of agarose gels was by densitometry.

In Vitro Phosphorylation Assays-- A peptide encoding the cytosolic region of the FcRI was synthesized, and in addition other FcRI peptides were synthesized in which either all of the threonines were converted to alanine or threonine-alanine substitutions were limited to defined positions. Protein kinase C was prepared by P. Acs (NCI, National Institutes of Health) and used as described previously (17). After an in vitro kinase reaction using described conditions (17), phosphorylated peptide was isolated by reversed phase HPLC. We found that the background of the assay was significantly reduced if polyetheretherketone was substituted for stainless steel in the HPLC system tubing and column jacket. Radioactivity in the collected peaks was measured by Cerenkov counting, and relevant fractions were then subjected to phosphoamino acid analysis (17).

[³²P]Orthophosphate Labeling of FcRI, Phosphoamino Acid Analysis, and Peptide Maps-- Cells were metabolically labeled with [³²P]orthophosphate essentially as described (10). Cells were then sensitized with anti-DNP-specific IgE at a concentration of 5 µg/ml for 1 h. Radiolabeled, IgE-sensitized cells (2.1 × 10⁷ in 0.7 ml) were stimulated with 400 ng/ml DNP-HSA for 3 min at 37 °C and processed to recover IgE-occupied FcRI as described previously (17). Recovered proteins were resolved, and phosphoamino acid analysis was as described previously (17).

Peptide maps were generated as described (35). Briefly, the identified FcRI was excised from the polyvinylidene difluoride membrane and incubated with polyvinylpyrrolidone 360 kDa (PVP-360, Sigma) to block nonspecific binding of the protease. The excised membrane was then washed with 50 mM ammonium bicarbonate and subsequently incubated with 10 µg of Glu-C V8 protease for 2 h at 37 °C. This was followed by a second addition of Glu-C V8 protease and an overnight incubation at 37 °C. The soluble peptides were recovered by lyophilization and were resuspended in electrophoresis buffer for two-dimensional peptide mapping as described (35).

Chemical Cross-linking, Immunoprecipitations, and Western Blots-- Chemical cross-linking conditions, immunoprecipitations, and Western blots were previously described (36). In some experiments antibody to phosphotyrosine was used to determine Syk activation, PKC phosphorylation (an indication of its translocation), and the presence of FcRI under reducing conditions. In other experiments proteins were identified directly with their respective antibodies.

Transient Expression of FcRI in BMMC from FcR Null Mice and Degranulation Assay-- Generation of recombinant Semliki Forest virus was described previously (29). For infection of BMMC, 4.0 to 7.0 × 10⁶ cells from FcR-null mice were infected with a 1:250 titer of Semliki Forest virus in the presence of 7.5% polyethylene glycol as described (29). After a 30-min incubation, the virus was removed, and cells were incubated for an additional 8 h. During this time one-tenth of the cells were separated and incubated with FITC-IgE (1 µg), whereas the remaining cells were incubated with 5 µg of unlabeled IgE. Cells were then washed with phosphate-buffered saline to remove unbound IgE and either analyzed by FACS (FITC-IgE labeled cells) or in a degranulation assay. Degranulation (-hexosaminidase release (21)) was measured in either 250- or 500-µl volumes using 20 ng/ml of DNP-HSA for 10 min (maximal release) at 37 °C in Tyrodes buffer (32).

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Phosphorylation of FcRI on Threonine 60-- To define the site of threonine phosphorylation of the FcRI, the in vitro studies took advantage of the previous observation that PKC was uniquely able to phosphorylate the FcRI (17). Purified peptides corresponding to the entire cytosolic region of the FcRI (wild type or variants) were incubated with PKC in an in vitro kinase reaction. After incubation, the phosphorylated peptides were isolated by HPLC. The results confirmed our previous study (17) that showed that PKC phosphorylates the wild type FcRI peptide mainly on threonine (Fig. 1) with a minor incorporation of label to serine. Substitution of alanine for all threonines (T48A,T52A,T57A,T60A) in the FcRI peptide resulted in a significant reduction in the overall extent of phosphorylation, and phosphoamino acid analysis indicated that only serine was phosphorylated (Fig. 1A). FcRI peptides in which the threonine residues were sequentially added (T52A,T57A,T60A; T57A,T60A; and T60A) showed minimal to no threonine phosphorylation (Fig. 1, A and B). In contrast, the FcRI peptide variant (T48A,T52A,T57A) that contained only threonine 60, the threonine closest to the C terminus, incorporated similar amounts of radioloabel to that seen for the wild type peptide (Fig. 1B). Furthermore, the overall level of phosphorylation was far greater than that seen for the other threonine-to-alanine variants used in these experiments. In addition, as with the wild type peptide, the amount of threonine phosphorylation was far greater than the amount of serine phosphorylation. Thus, we conclude from these in vitro studies that the target of PKC activity is the threonine closest to the C terminus (Thr⁶⁰) on the FcRI chain.

View larger version (45K): [in this window] [in a new window]   Fig. 1.   FcRI ITAM is phosphorylated on threonine 60 in vitro by PKC. HPLC chromatograms, incorporated radioactivity, and phosphoamino acid analysis of recovered fractions are shown for the peptide encoding the entire cytoplasmic domain of the FcRI (Wild Type), the peptide where all threonines are mutated (T(48, 52, 57, 60)A), the peptide where threonine 48 is not mutated (T(52, 57, 60)A), the peptide where threonine 48 and 52 are not mutated (T(57, 60)A), the peptide where only threonine 60 is mutated (T(60)A), and the peptide where only threonine 60 is not mutated (T(48, 52, 57)A). Note that the distinct pattern where fraction 38 shows high levels of phosphate incorporation in threonine residues is seen only in wild type peptide and in the peptide where threonine 60 is not mutated (T(48, 52, 57)A).

Based on the aforementioned in vitro results, we limited our in vivo analysis to the mutation of T60A but also considered a T52A mutation that was proposed in a previous report by Pribluda et al. (37) as the possible site of threonine phosphorylation. Stable transfectants were generated, in the previously described RBL FcRI-deficient cell line (24), that expressed wild type, T52A, and T60A FcRI. As shown in Fig. 2A, the transfected cell populations expressed receptor numbers similar to those of RBL cells. As compared with the parental RBL  cell line, receptor expression increased approximately 10-fold with all transfectants expressing between 2 and 3 × 10⁵ receptors/cell. Tyrosine phosphorylation of FcRI was analyzed by immunoprecipitation of phosphorylated proteins with antibody to phosphotyrosine followed by immunoblotting with antibodies to FcRI or to Shc (Fig. 2B). The Shc immunoblot served as a control for protein loading as Shc tyrosine phosphorylation is unaffected by FcRI aggregation if the cells were incubated in the presence of serum (38). Although no significant difference in the tyrosine phosphorylation of FcRI wild type (WT) and the FcRI T60A (T60A) was observed, a dramatic increase in the tyrosine phosphorylation of the FcRI T52A (T52A) was found even in nonstimulated cells (Fig. 2B). Phosphorylation of FcRI was not dramatically different among transfectants, although a 30% increase was observed in the FcRI T52A (T52A) transfectant (data not shown). To determine what effect the mutations of the FcRI had on threonine phosphorylation, we isolated the FcRI from FcRI-activated transfectants that were labeled with [³²P]orthophosphate and phosphoamino acid analysis was performed. As shown in Table I, threonine phosphorylation of FcRI was still present in the T52A mutant. In fact, an increase in the ratio of threonine to tyrosine was observed. In contrast, the T60A mutation resulted in a dramatic decrease of threonine phosphorylation, although low levels of threonine phosphorylation were detected consistent with the expression of low levels of wild type FcRI in the transfectants derived from  cells (Fig. 2A). Two-dimensional peptide mapping (using Glu-C V8 protease) of the WT and T60A showed a dramatic reduction in the presence of one radiolabeled peptide that co-migrated with the expected peptide standard (Fig. 2C). We did not expect, nor did we find, complete absence of this phosphorylated peptide, given that low levels of wild type FcRI are present in these transfectants (Fig. 2A). From the collective data we conclude that threonine 60, which is found in the Y+2 position of the FcRI ITAM C-terminal YXXL motif, is the sole threonine modified by phosphorylation in these cells.

View larger version (26K): [in this window] [in a new window]   Fig. 2.   Expression, phosphorylation, and peptide map of wild type and mutant FcRI. A, quantitation of receptor expression of RBL, parental  cell line, and wild type FcRI (wt), FcRIT52A (T52A), and FcRIT60A (T60A) transfectants. Transfectants were FACS sorted and selected for the 10% of highest FcRI expressing cells with FITC-IgE. Recovered cells were grown in culture and receptor expression was quantitated using 125I-labeled IgE as described (30). Data are from four individual experiments. B, tyrosine phosphorylation of wild type (WT) and mutant (T52A and T60A) FcRI. IgE-sensitized cells (5 × 106) were stimulated (+) or not () with 100 ng of DNP-HSA (Agn) for 5 min. Cells were lysed and tyrosine phosphorylated proteins recovered by immunoprecipitation (IP) with antibody to phosphotyrosine (Anti-PY). Immunoblots were probed with a chicken antibody to FcRI follow by stripping and sequential immunoblotting (IB) with antibody to Shc (p46 and p52). The latter was used as a control for loading because no change in the FcRI-induced tyrosine phosphorylation of Shc was seen in cells incubated in the presence of serum (38). C, Glu-C V8 protease peptide map of wild type (WT) and mutant (T60A) FcRI. Labeling of cells, protease digest, and peptide resolution were as described under "Experimental Procedures." A synthesized threonine phosphorylated standard peptide (pTLKHE) was added to the sample to determine the appropriate migration of the expected peptide.

View this table: [in this window] [in a new window]   Table I Ratio of phosphothreonine to phosphotyrosine in wild type and mutant FcRI transfectants Data are from three independent phosphoamino acid analysis experiments of in vivo radio-phospholabeled cells from which the FcRI was isolated prior to and after FcRI aggregation. Tyrosine phosphorylation of the FcRIT60A was similar to FcRIWT, whereas that of FcRIT52A was increased. [32P]Orthophosphate incorporation was quantitated on a Molecular Storm phosphoimager (Molecular Dynamics, Sunnyvale, CA), and the pT:pY ratio was determined. WT, wild type, T52A, threonine 52 mutant; T60A, threonine 60 mutant. For nontransfected RBL cells the pT:pY ratio was 0.35 ± 0.16 (17).

Effects of FcRI T60A Mutation on Mast Cell Function-- We previously reported that the specific PKC inhibitor Ro 31-7549 was able to inhibit both the FcRI-stimulated threonine phosphorylation of the FcRI and the rate of FcRI endocytosis (17). We revisited this topic to determine whether the T60A mutation would mimic our previous results. Fig. 3A shows that mutation of T60A, but not T52A, had a significant effect on the rate of FcRI endocytosis. As much as 50% inhibition of endocytosis was found at early times (5 and 10 min) following FcRI aggregation. However, at later times (40 and 60 min) no significant difference in FcRI endocytosis was observed (Fig. 3A). These results were almost identical to those observed in our previous study where the use of the PKC inhibitor, Ro 31-7549, inhibited the initial rate of endocytosis by as much as 80% (17). In contrast, the FcRI endocytosis of the T52A mutant showed kinetics similar to that of the wild type transfectant, but the overall extent of endocytosis was increased when compared with the wild type transfectant. Because the T52A has a greater level of tyrosine phosphorylation (Fig. 2B), these results are consistent with the importance of tyrosine phosphorylation to endocytosis of FcR-containing receptors (39).

View larger version (11K): [in this window] [in a new window]   Fig. 3.   Endocytosis, adhesion, and TNF- mRNA responses of wild type and mutant FcRI transfectants. A, endocytosis is de layed in the T60A transfectant, but levels are enhanced in the T52A transfectant. The endocytosis assay is outlined under "Experimental Procedures." The percentage of endocytosis is net. Data are from five experiments. B, adhesion assays are described under "Experimental Procedures." The stimulated increase in adhesion for the -cell line was normalized to 1.0 to measure whether significant differences could be found among the transfectants by comparing all experiments. Although an approximate 50% increase in adhesion was found for all transfectants (wt, T52A, and T60A), no significant difference was observed among them. Data are from four individual experiments. C, TNF- mRNA levels are reduced in the T60A transfectants. Detection of TNF- mRNA levels was described previously (21) and briefly detailed under "Experimental Procedures." To compare all experiments, the response observed in the  cell line was normalized to 1.0. Data shown are the response of cells stimulated with 0.1 ng of antigen. Similar results were obtained with 1 ng of antigen. Fold induction is reported as a net value with the response detected in nonstimulated cells subtracted. Data are from five individual experiments.

Increased adhesion of RBL cells in response to FcRI stimulation has been reported (reviewed in Ref. 40). The increased adhesion can be demonstrated by binding of these cells to fibronectin-coated surfaces (41). We analyzed the adhesion based on an integrin-fibronectin interaction, because we could inhibit up to 95% of the FcRI-stimulated adhesion by the concurrent addition of the competing RGD peptide with the cells to the fibronectin-coated wells (data not shown). We utilized this approach to determine whether the T60A mutation would have an effect on FcRI-mediated adhesion. Fig. 3B shows the fibronectin-specific adhesion of FcRI-stimulated -, WT, T52A, and T60A cell lines. Results were normalized to the FcRI-stimulated response of the  cells where little difference in adhesion was observed when compared with nonstimulated cells. Although reconstitution of the  cells with FcRI led to increased adhesion (~1.5-fold), no significant difference was observed among the transfectants. This suggested that the FcRI-stimulated adhesion to fibronectin was unaffected by increased threonine and tyrosine phosphorylation (T52A) or decreased threonine phosphorylation (T60A) of the FcRI. Similar results were obtained when phorbol ester was used as a stimulus for adhesion (data not shown). Collectively, the results demonstrated that some FcRI-dependent events were unaffected by mutation of the threonines in FcRI.

We also analyzed the effect of the T60A mutation on the stimulation of TNF- mRNA production (21, 42). The results shown in Fig. 3C were normalized to the FcRI-stimulated response of the  cells. Both the WT and T52A transfectants showed an additional increase of TNF- mRNA levels of up to 50% following FcRI stimulation when compared with the  cell response. In contrast, the T60A transfectant showed no increase in response, and in most experiments TNF- mRNA levels were below those of the  cells (Fig. 3C). The reduced response was a consistent observation regardless of the concentration of antigen used for stimulation (data not shown). Thus, the threonine phosphorylation of the FcRI is important to the FcRI-mediated induction of TNF- mRNA.

We analyzed the effect of threonine mutation (T60A) of FcRI on degranulation in BMMC derived from FcR-null mice because the stable transfectants, like the parental  cells, secreted poorly, and prior studies showed that reconstitution with wild type FcRI did not induce a degranulation response comparable to the RBL cell line (24). Table II shows that in four independent experiments, reconstitution of FcRI expression with either WT or T60A showed that expression of the latter inhibited degranulation (11-49%). Although all experiments showed inhibition, variable levels of secretion (15 to 38%) and inhibition (11 to 49%) were observed. This is likely due to the inability to control the levels of receptor assembly and expression among experiments because of transient expression of the FcRI. Regardless, expression of the T60A showed inhibition of degranulation in all experiments.

View this table: [in this window] [in a new window]   Table II Mutation of threonine 60 of FcRI inhibits mast cell degranulation FcR-null BMMC were transfected with WT or T60A constructs by infection with Semliki Forest virus as described under "Experimental Procedures." Four independent experiments from two independent cultures of BMMC are shown. Cells were stimulated with 20 ng/ml DNP-HSA for 10 min at 37 °C. Percentage of stimulated degranulation was calculated from the level of hexosaminidase detected in the medium, and the total hexosaminidase of cells expressing FcRI (as determined by FITC-IgE binding and FACS analysis). This was corrected for the levels detected in nonstimulated samples. For the WT percent net degranulation ranged from 15 to 38%.

The FcRIT60A Mutation Inhibits Syk Interaction and Activation-- Because FcRI-mediated endocytosis (43), TNF- production (44), and degranulation (15) have been demonstrated to be dependent on the activation of Syk, we analyzed Syk activation in FcRI transfectants by measuring its tyrosine phosphorylation, because we previously demonstrated that tyrosine phosphorylation is an accurate measure of Syk activity (16). As shown in Fig. 4A, cells expressing the T60A showed a significant defect in the activation of Syk. In contrast, both WT and T52A expressing cells effectively activated Syk with the latter showing increased Syk phosphorylation consistent with the increased levels of tyrosine phosphorylated receptors in this transfectant (Fig. 2B). In some experiments up to a 3-fold increase in Syk activation was observed in the T52A expressing cells when compared with the wild type control, whereas a 60-90% inhibition of Syk activation was observed in the T60A transfectants (Figs. 4A and 5). However, the observed inhibition did not result from a generalized defect in FcRI signal transduction because, as shown in Fig. 4B, the tyrosine phosphorylation of PKC in response to FcRI stimulation was unaffected by either the T52A or T60A mutations. Because tyrosine phosphorylation of PKC requires its translocation to the plasma membrane (45, 46), these results demonstrated that PKC translocation is independent of threonine phosphorylation of FcRI. Thus, threonine phosphorylation of the FcRI is primarily important for the activation of Syk and downstream effector functions.

View larger version (28K): [in this window] [in a new window]   Fig. 4.   Activation of Syk, but not of PKC, is defective in the FcRIT60A transfectant. A, IgE-sensitized FcRIWT, T52A, and T60A transfectants (2.5 × 106 cells) were stimulated (+) or not () with 300 ng of DNP-HSA (Agn). Cells were lysed and Syk was immunoprecipitated (IP) with antibody to Syk (Anti-Syk). Immunoblotting (IB) of resolved proteins with antibody to phosphotyrosine (PY) was followed by stripping and reprobing with antibody to Syk (Syk). B, cells treated as in A were lysed, and PKC was immunoprecipitated (IP) with antibody to PKC (Anti-PKC). Immunoblotting (IB) of resolved proteins with antibody to phosphotyrosine (PY) was followed by stripping and reprobing with antibody to PKC (PKC). Tyrosine phosphorylation of PKC in RBL-2H3 cells was previously shown to require its translocation (45, 46).

View larger version (37K): [in this window] [in a new window]   Fig. 5.   Mutation of FcRI threonine 60 to alanine inhibits its interaction with Syk. IgE-sensitized FcRIWT, T52A, and T60A transfectants (5.0 × 106 cells) were stimulated (+) or not () with DNP-HSA (300 ng) for 5 min at 37 °C. Cells were lysed, and post-nuclear lysates were treated with the chemical cross-linking agent DTSSP. Syk was immunoprecipitated (IP: Anti-Syk), and resolved proteins were identified as Syk and FcRI by immunoblotting. To detect FcRI, the film was subjected to prolonged enhanced chemiluminescence exposure.

We explored the possible mechanism by which the T60A mutation inhibited the activation of Syk. Because Syk activation in mast cells was demonstrated to be dependent on its interaction with the activated FcRI (47, 48), we investigated whether the T52A or the T60A mutations had any effect on the interaction of FcRI with Syk in activated cells. In this series of experiments we immunodepleted Syk from chemically cross-linked (DTSSP) nonactivated and activated cell lysates and determined whether FcRI co-immunoprecipitated by immunoblotting. This approach was used because after chemical cross-linking the antibody to FcRI was not as efficient in immunoprecipitation as the antibody to Syk. As demonstrated in Fig. 5, immunoprecipitation of Syk from chemically cross-linked cell lysates showed that in cells expressing T60A Syk activation was inhibited, whereas those expressing T52A showed increased Syk activation. When immunoblots were probed for co-immunoprecipitated FcRI its presence was detected following FcRI stimulation in both the WT and T52A transfectants with the latter showing greater levels of FcRI. In addition, in most experiments we could detect trace amounts of phosphorylated Syk and FcRI in association with Syk in nonstimulated T52A transfectants (Figs. 4A and 5). In contrast, only minimal amounts of FcRI were found to co-immunoprecipitate with Syk isolated from the activated T60A transfectants (Figs. 5 and 6A). Thus, the results suggested that the absence of threonine phosphorylation of the FcRI in the T60A transfectants inhibited FcRI interaction with Syk.

View larger version (20K): [in this window] [in a new window]   Fig. 6.   Mutation of FcRI threonine 60 to aspartic acid reconstitutes Syk interaction, Syk activation, and the TNF- mRNA response. A, sequence alignment of ITAMs that interact with Syk (dashes represent introduced gaps), introduced mutations, and reconstitution of Syk activation and interaction with FcRI in the T60D mutant. IgE-sensitized FcRIWT, T60A, and T60D transfectants (3.0 × 107 cells) were stimulated (+) or not () with 300 ng of DNP-HSA (Agn). Cells were lysed, and postnuclear lysates were treated with DTSSP. Syk was immunoprecipitated (IP: Anti-Syk), and resolved proteins were identified as Syk and FcRI by immunoblotting (IB). Because of the cell numbers used, we could detect the presence of FcRI with Syk in nonstimulated cells. As compared with Fig. 5, only a short exposure to film was required for detection. PY, phosphotyrosine. B, FcRIT60D reconstitutes the TNF- mRNA response to the level of wild type FcRI. TNF- mRNA assay is described under "Experimental Procedures." The PCR amplified products were resolved on agarose gels and normalized to the internal standard (see "Experimental Procedures"). Quantitation was by densitometry. The TNF- mRNA response of the FcRIT60A was normalized to 1.0 to allow comparison between experiments. Data are from two experiments.

A Negative Charge at FcRI Threonine 60 Is Required for High Affinity Syk Interaction, Efficient Syk Activation, and the TNF- mRNA Response-- We investigated the possible requirement for phosphorylation at threonine 60 in the interaction and activation of Syk. Sequence analysis of receptor ITAMs that interact with Syk revealed the presence of an amino acid residue, at the equivalent location in the ITAMs, that could be phosphorylated or was negatively charged (Fig. 6A). We postulated that a negative charge at threonine 60 would be the equivalent of phosphorylation of threonine and would result in complete activation of Syk in response to FcRI engagement. To test this hypothesis a T60D transfectant was generated that contained a hybrid ITAM (YTGLX₇-YEDL; throughout, dashes in sequences represent introduced gaps) with features of both the B cell receptor Ig/ (YEGLX₇-YEDI) and the FcR (YTGLX₇-YETL). As shown in Fig. 6A, the T60D transfectant showed normal levels of Syk activation, and the association of FcRI with Syk was comparable with that of the WT transfectant. In these chemical cross-linking experiments we used 6-fold more cells (3.0 × 10⁷) than in the experiments shown in Fig. 5. Thus, we could detect FcRI associated with Syk in nonstimulated cells (Fig. 6A), and in darker exposures of the shown phosphotyrosine blot Syk phosphorylation was also detected (data not shown). These results clearly demonstrated that mutation of threonine 60 to a negatively charged aspartic acid, rather than to the more physiochemically related alanine, completely reconstituted FcRI interaction with Syk leading to the activation of the latter. Thus, we would expect that the T60D transfectant would show a TNF- mRNA response similar to that of the WT transfectant. Fig. 6B shows that the mutation T60D reconstituted the TNF- mRNA response to levels comparable with that of wild type FcRI. This demonstrates the requirement of a negative charge at threonine 60 for high affinity interaction of Syk with the FcRI ITAM and activation of Syk to levels that result in "normal" mast cell responses.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

In this study, we present direct evidence identifying the site of threonine phosphorylation on the FcRI. Specifically, results from both our in vitro and in vivo experiments demonstrated that threonine 60 is the site of phosphorylation on the FcRI and that phosphorylation at threonine 60 is important for complete activation of Syk. In addition, our findings provide evidence of a general mechanism for Syk activation because we found that a negative charge at the equivalent position of threonine 60 substitutes for threonine phosphorylation at this site and is in common to all ITAMs interacting with and activating Syk (Fig. 6A). This requirement is likely to extend to other cells like platelets, where collagen activation of Syk requires the complexing of glycoprotein VI (collagen receptor) with FcR (49, 50).

Pribluda and colleagues (37) used HPLC and peptide standards to identify products of protease reactions with in vivo labeled FcRI. The evidence presented suggested that threonine 52 was a site of phosphorylation. In our hands, mutation of threonine 52 to alanine resulted in a "gain of function" because more FcRI was tyrosine phosphorylated, and high levels of FcRI phosphorylation occurred in nonstimulated cells. This resulted in increased endocytosis (Fig. 3A), and in several experiments higher levels of nonstimulated degranulation were observed (data not shown). Furthermore, an increased ratio of threonine to tyrosine phosphorylation was observed in the T52A transfectants (Table I), clearly demonstrating that a site for threonine phosphorylation was still present. A possible explanation for the observed increased phosphorylation is that a conformational change of the FcRI is induced by the T52A mutation that allows receptor-associated Lyn and PKC to phosphorylate both cis- and trans-molecularly (51). In contrast, mutation of threonine 60 led to a "loss of function" and ablated threonine phosphorylation with no effect on tyrosine phosphorylation. The importance of in vivo phosphorylation of threonine 60 was demonstrated by the finding that substitution of a negatively charged amino acid provided full functionality in Syk activation.

It has been reported that ITAMs are not functionally redundant and that specificity of binding to SH2 domains is based on the residues surrounding the tyrosines (52). Furthermore, tandem SH2 domains showed an increased binding specificity to their biologically relevant ITAM such that another ITAM can bind a tandem SH2 domain but with up to 10,000-fold weaker affinity (53). Because the linker region (where threonine 52 resides) between paired YXXL motifs does not significantly contribute to the binding affinity of the Syk SH2 domain tandem with the FcRI ITAM (54), this suggested that residues in the paired YXXL motifs might contribute to the high affinity interaction and specificity. Binding of both Syk SH2 domains to the FcRI ITAM is required for high affinity interaction (54, 55), and the N-terminal SH2 domain of Syk binds the ITAM C-terminal phosphotyrosine (54). Our findings that the threonine 60 localized in the C-terminal YETL motif was solely phosphorylated in response to FcRI stimulation prompted us to look at the effects of its mutation (T60A) on Syk activation and downstream events. The loss of Syk binding with the FcRIT60A ITAM and its recovery with the FcRIT60D ITAM demonstrated the importance of threonine phosphorylation in the FcRI ITAM for high affinity interaction. Because the T60D mutation (YED⁶⁰L) mimics the dual negative charge that would result from phosphorylation of Thr⁶⁰ in the YETL motif, this suggests that a dual negative charge is important for the high affinity interaction of Syk. This dual negative charge pre-exists in the equivalent motif of the B cell receptor Ig/ (YEDI).

The crystal structures of both the C-terminal Syk SH2 by itself and the tandem SH2 domains complexed with phosphotyrosine ITAM peptides are available (56, 57). However, the information provided by resolving the N-terminal SH2 domain interaction with a C-terminal phosphotyrosine of the CD3 ITAM does not likely reflect the interaction of Syk with the B cell receptor Ig/ or with FcRI ITAMs, because binding of the latter two occurs with at least a log fold higher affinity (54, 58). Nevertheless, some insights are gained from these studies with regard to the interaction of a FcR ITAM with the N-terminal SH2 domain of Syk. First, it appears that the C-terminal Y+2 amino acid residue (the threonine equivalent, but a glycine residue in the CD3 ITAM) does not make significant contacts with Syk. For the FcRI ITAM, a phosphorylated threonine would likely provide contact with a highly conserved histidine that is present in both the N- and C-terminal SH2 domains of Syk and ZAP-70. In addition, provided that the interactions of the FcRI ITAM with Syk might result in a slightly different conformation than that of the CD3 ITAM, a highly conserved arginine residue (which is also found in the N-terminal SH2 domain of ZAP-70) could also provide potential charge interactions. Thus, these possible interactions may fulfill the requirements for a high affinity interaction. In vitro, threonine phosphorylation does not appear to be a requirement for Syk activation because tyrosine biphosphorylated ITAMs can activate Syk and in vitro measurement of affinities demonstrated a high affinity interaction (54, 55). We also found (in vitro experiments) that the introduction of a phosphorylated threonine in the tyrosine biphosphorylated FcRI ITAM peptide had no effect on the affinity of interaction with the Syk SH2 domain tandem (data not shown). Although at the moment we cannot explain the difference in requirements for in vivo versus in vitro activation of Syk, it is interesting to note that the mutation of T52A also did not affect the affinity of interaction of the tyrosine biphosphorylated ITAM with Syk. However, in vivo this mutation results in a gain of function (including phosphorylation of the FcRI in the absence of its aggregation) presumably from a conformational change that increases phosphorylation of FcRI and thus Syk interaction (Fig. 5). Although to date there is no direct evidence for an in vivo structural conformation of the FcRI cytoplasmic domain, this possibility is presently raised and has been suggested in a prior study (59).

Of physiological interest is the finding that even small amounts of activated Syk are sufficient to drive low levels of mast cell responses. In particular, degranulation was not ablated in the T60A transfectant although it was reduced. Furthermore, a reduced induction of TNF- mRNA could still be detected. This suggests that the level of activated Syk required to promulgate downstream signals is small, and thus engagement of a few receptors may likely be sufficient for some cytokine production and degranulation. Interestingly, it has been reported (60) that aggregation of FcRI with a low affinity ligand causes the complete tyrosine phosphorylation of the receptor but only weakly activates Syk and downstream effectors. Thus, one might speculate that receptor aggregation by high affinity ligands induces additional events (such as threonine phosphorylation of FcRI) required for complete Syk activation and engagement of downstream effectors. Engagement of downstream effectors may also require the movement of receptor and associated components to glycosphingolipid-enriched microdomains (61),² a process that may not occur as efficiently with low affinity ligands.³

Finally, the present study provides a possible explanation of why the FcRI functions as an amplifier of FcRI-mediated responses (62). Because PKC binds to the FcRI ITAM (17), absence of the FcRI may ablate threonine phosphorylation of the FcRI, resulting in a low affinity interaction with and weak activation of Syk. Tyrosine phosphorylation of FcRI (₂) receptors in the absence of the FcRI and constitutively associated Lyn (63) may still occur because of the movement of these receptors to the Lyn-containing glycosphingolipid-enriched microdomains (61) where they can be phosphorylated. The present study demonstrates that maximal mast cell responses are dependent on the phosphorylation of threonine 60 of the FcRI ITAM, which mediates a high affinity interaction with Syk resulting in greater amounts of active Syk.

	ACKNOWLEDGEMENTS

We thank Drs. P. Acs, U. Blank, and R. P. Siraganian for providing reagents. We acknowledge George Poy for the synthesis of several peptides used in this study and Dr. H. Metzger for helpful discussions and critical review of the manuscript.

	FOOTNOTES

^* This work was supported in part by Howard Hughes Medical Institute and Grants 312-98-K205 and 204/97/0239 from the Grant Agency of the Czech Republic (to P. D.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Present address: FDA-CBER, Division of Monoclonal Antibodies, HFM-555, 1401 Rockville Pike, Rockville, MD 20852-1448.

To whom correspondence should be addressed: Bldg. 10, Rm. 9N228, 10 Center Dr., MSC 1820, Bethesda, MD 20892-1820. Tel.: 301-496-7592; Fax: 301-402-0012; E-mail: Juan_Rivera@nih.gov.

² R. Arudchandran, M. J. Brown, M. J. Peirce, J. S. Song, J. Zhang, R. P. Siraganian, U. Blank, and J. Rivera, manuscript submitted.

³ R. Arudchandran and J. Rivera, unpublished observation.

	ABBREVIATIONS

The abbreviations used are: FcRI, high affinity IgE receptor; FcR, Fc receptor gamma chain; FcRI, high affinity IgE receptor  chain; FcRI, high affinity IgE receptor  chain; Ig/, B cell receptor-associated ITAM containing signaling chains; PKC, protein kinase C  isozyme; TNF-, tumor necrosis factor ; FITC, fluorescein isothiocyanate; BMMC, bone marrow-derived mast cells; DNP, dinitrophenylated; HSA, human serum albumin; DTSSP, 3,3'-dithiobis[sulfosuccinimidyl propionate]; ITAM, immunoreceptor tyrosine-based activation motif; Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine; PCR, polymerase chain reaction; FACS, fluorescence-activated cell sorter; HPLC, high pressure liquid chromatography.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				I. Halova, L. Draberova, and P. Draber A novel lipid raft-associated glycoprotein, TEC-21, activates rat basophilic leukemia cells independently of the type 1 Fc{varepsilon} receptor Int. Immunol., February 1, 2002; 14(2): 213 - 223. [Abstract] [Full Text] [PDF]

				P. Tolar, R. Arudchandran, L. Draberova, J. Rivera, and P. Draber Structure-Function Analysis of Lyn Kinase Association with Lipid Rafts and Initiation of Early Signaling Events after Fcvarepsilon Receptor I Aggregation Mol. Cell. Biol., December 15, 2001; 21(24): 8318 - 8328. [Abstract] [Full Text] [PDF]

				T. S. Manetz, C. Gonzalez-Espinosa, R. Arudchandran, S. Xirasagar, V. Tybulewicz, and J. Rivera Vav1 Regulates Phospholipase C{gamma} Activation and Calcium Responses in Mast Cells Mol. Cell. Biol., June 1, 2001; 21(11): 3763 - 3774. [Abstract] [Full Text]

				Y. Liu, C. Graham, V. Parravicini, M. J. Brown, J. Rivera, and S. Shaw Protein kinase C {theta} is expressed in mast cells and is functionally involved in Fc{varepsilon} receptor I signaling J. Leukoc. Biol., May 1, 2001; 69(5): 831 - 840. [Abstract] [Full Text]

This Article Abstract Full Text (PDF) Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Swann, P. G. Articles by Rivera, J. Search for Related Content PubMed PubMed Citation Articles by Swann, P. G. Articles by Rivera, J. Social Bookmarking                      What's this?