 |
INTRODUCTION |
Protein kinase C (PKC)1
isozymes are involved in signal transduction pathways controlling
growth, differentiation, and apoptosis (1, 2). In addition, PKCs are
the major cellular receptors for the tumor promoter phorbol esters and
related compounds. Because of this, there has been considerable
interest in the potential role of PKC isozymes in the multistage
process of carcinogenesis. However, isolating the role of the
individual isozymes has proven to be complex due to apparent similarity
in their substrate specificity, at least in vitro, as well
as overlapping sensitivity to activators and inhibitors.
The PKC gene family is divided into three subgroups based on sequence
homology and cofactor requirements: conventional PKC (
,
I,
II,
and
) which are dependent on Ca2+ for activation,
nonconventional PKCs (
,
,
, and
) that are not dependent on
Ca2+ for activation, and atypical PKCs (
,
/
) which
are not stimulated by diacylglycerol or phorbol esters and are
Ca2+ independent (3). Cell signal pathways involving the
PKC family are initiated by binding of a ligand to its respective cell
surface receptor, which triggers the breakdown of phospholipids by
phospholipase C and D producing many products including diacylglycerol
(3, 4). Diacylglycerol binds to and activates most PKC isozymes, which
then relocate to specific subcellular compartments that vary between
the PKC isozymes as well as between cell types (5, 6). This relocation
results from distinct protein-protein interactions, many of which are
likely to be isozyme specific. Jaken, Scott, and collaborators (7-12)
have identified talin, vinculin, a myristoylated protein kinase C
substrate, a
-adducin homolog, AKAP79, as well as gravin/AKAP250 as
PKC-associated proteins that require phosphatidylserine for binding.
The binding of diacylglycerol is believed to lead to activation and
relocalization of the PKCs through conformational changes that expose
the catalytic domain as well as the region involved in binding to the
docking site after translocation. This docking site has been termed
RACK (receptor for activated C kinase), and each isozyme has been
postulated to have its own specific RACK (6, 13), which is thought to
determine the specific cellular location of the activated PKC isozymes.
This property has been exploited for the past few years to develop
isozyme-specific competitive antagonists (for review, see Ref. 14).
In a previous report (15) we describe the use of comparative genomic
hybridization to detect regions of allelic imbalance in thyroid tumors,
including an amplification event on chromosome 2p21 in 28% of the
thyroid neoplasms examined, as well as in the clonal thyroid carcinoma
cell line WRO. Positional cloning and sequencing of a BAC mapping to
the 2p21 amplicon identified a candidate gene, protein kinase C
(PKC
), which was amplified in the WRO cell line. Here we extended
the analysis of this genetic event by describing that the PKC
gene
was not only amplified, but also rearranged in the WRO cells. This
complex genetic aberration leads to the overexpression of a chimeric
and truncated PKC
(Tr-PKC
). The Tr-PKC
protein reported here
is nearly identical to an N-terminal PKC
fragment which has been
demonstrated to specifically inhibit both activation-induced
translocation of wild-type PKC
to its intracellular binding site as
well as the biological effects mediated by this enzyme (16-18). We
provide evidence that this truncated gene product interferes with the
function of the wild-type isozyme in clonal thyroid cell lines and
results in significant alterations in growth and apoptosis. In
addition, we show that the inhibition of apoptosis in cells expressing
Tr-PKC
is associated with impairment of the expected stabilization
of p53 induced by DNA damage, and of the consequent activation of Bax.
These data indicate that PKC
is involved in apoptosis signaling in
thyroid cells, and raise the possibility that that loss of expression
or function of PKC
may participate in thyroid tumorigenesis by
inhibiting programmed cell death.
 |
EXPERIMENTAL PROCEDURES |
Cell Lines and Tissue Sample Collection
The human thyroid carcinoma cell lines NPA, ARO, and WRO were a
gift of G. Juilliard (UCLA), and propagated in RPMI 1640 medium containing 10% fetal calf serum, non-essential amino acids (Irvine Scientific, Irvine, CA), glutamine (286 mg/liter), penicillin, and
streptomycin (Life Technologies, Inc., Gaithersburg, MD), as described
(19). PCCL3 cells were propagated in H6 medium, which consisted of
Coons modification of Ham's F-12 media (Irvine Scientific, Irvine, CA)
containing 5% fetal calf serum, glutamine (286 mg/l), somatostatin (10 ng/ml), glycyl-L-histidyl-L-lysin acetate (10 ng/ml), transferrin (5 µg/ml), hydrocortisone (10 nM),
insulin (10 µg/ml), thyroid stimulating hormone (TSH, 10 mIU/ml),
penicillin, and streptomycin, as described (20).
Demonstration of 2p21 Amplification in WRO Cells by FISH
WRO cell chromosome preparations were hybridized with the
indicated bacterial artificial chromosome (BAC) clone as described previously (21). Briefly, the indicated BACs were biotin-labeled and
hybridized to chromosome slides made from the WRO cell line. The images
were captured using a Photometrics cooled-CCD camera (CH250) and Oncor
image analysis system equipped with a Zeiss 135 Axovert fluorescence microscope.
Southern and Northern Blot Analysis
Southern blots of 10 µg of genomic DNA from the indicated
sources digested with either EcoRI or BamHI were
performed as described (15). Membranes were probed with either the
full-length (2.2 kb) human PKC
cDNA obtained by NheI
digestion of the PKC
/pBluebac expression vector (22) or PCR products
generated from the indicated regions of PKC
cDNA. Probes were
labeled with [32P]dCTP by random priming (Stratagene, San
Diego, CA). Northern blots of 20 µg of total RNA were performed as
described (23, 24) and hybridized with a full-length human
[32P]dCTP-labeled PKC
cDNA.
Total Cell lysates and Cell Fractionation
After washing, cells were scraped from the plate in ice-cold PBS
and collected by centrifugation at 1000 × g for 10 min. The pellet was resuspended in buffer A (10 mM
Tris-HCl, pH 7.5, 5.0 mM EDTA, 100 µg/ml
phenylmethylsulfonyl fluoride, 4.0 mM EGTA, 1 µg/ml
aprotinin, 5 µg/ml E-64, 1 µg/ml leupeptin, and 1 µg/ml pepstatin) containing 1% Triton X-100 and then lysed by passing through a 27-gauge needle 10 times. The lysate was then centrifuged at
10,000 × g for 15 min at 4 °C, the supernatant
collected, and the protein concentration determined. Equal amounts of
protein from each sample was then subjected to SDS-PAGE.
For preparation of soluble and particulate fractions the cells were
homogenized in buffer B consisting of 50 mM Tris-HCl, pH
7.5, 5.0 mM EDTA, 100 µg/ml phenylmethylsulfonyl
fluoride, 4.0 mM EGTA, 1 µg/ml aprotinin, 5 µg/ml E-64,
1 µg/ml leupeptin, and 1 µg/ml pepstatin by passing them through a
27-gauge needle 10 times. Soluble and particulate fractions were then
separated by ultracentrifugation (100,000 × g for
1 h). The supernatant (soluble fraction) was removed and the
pellet resuspended in buffer B with 1% Triton X-100. The Triton
X-100-insoluble material was removed by centrifugation at 100,000 × g for 1 h and the supernatant collected (particulate
fraction). The distribution of the PKC isozymes in the various
fractions was then analyzed by Western blotting.
To better determine the distribution and relocation of PKC
after
activation, PCCL3 cells were subfractionated into four parts as
follows. The cells were washed and scraped from the plate in ice-cold
PBS. The cells were then washed with ice-cold buffer A and collected by
centrifugation. The cell pellet was then resuspended in buffer A and
the mixture incubated on ice for 10 min, passed through a 27-gauge
needle 10 times, and the nuclei pelleted by centrifugation at 1000 × g for 10 min. The supernatant was removed and centrifuged
at 100,000 × g at 4 °C for 60 min. The resulting supernatant (fraction F1, cytosol) was collected and the pellet resuspended in buffer A with 1% Triton X-100. The resuspended pellet
was centrifuged at 100,000 × g at 4 °C for 60 min
and the resulting supernatant collected (fraction F2, particulate
extract). The intact nuclei were lysed by resuspending them in buffer A containing 600 mM KCl and centrifuged at 100,000 × g at 4 °C for 60 min and the resulting supernatant
collected (fraction F3, nucleoplasm). The pellet was resuspended in
buffer A with 1.0% Triton X-100, centrifuged at 100,000 × g at 4 °C for 60 min, and the supernatant collected
(fraction F4, Triton-soluble nuclear extract). To remove the KCl from
F3, the proteins were precipitated by the addition of trichloroacetic
acid to a final concentration of 2%. The precipitated proteins were
collected by centrifugation and the pellet resuspended in buffer A. The
protein concentration of all fractions was determined using the micro
BCA reagent, as directed by manufacturer (Pierce, Rockford, IL).
Western Blot Analysis
The indicated amount of protein from total cell lysates or
cellular fractions were subjected to SDS-PAGE and Western blotting as
described (25, 26). Blots were hybridized with antibodies to the
indicated proteins and then with their corresponding species-specific horseradish peroxidase-conjugated secondary IgG and visualized using
the Supersignal CL-HRP system (Pierce) as directed by manufacturer.
Identification of Chimeric Tr-PKC
mRNA using 3' RACE
The 3' RACE reaction was performed as described in Frohman
et al. (27), except that the 5' primer was specific for exon 1 of PKC
(TGCCCTCAATGTGGACGACTC). In addition, the second round of
PCR amplification was performed under the following conditions: 95 °C for 45 s, 60 °C for 30 s, and 72 °C for 3 min.
The PCR products generated were cloned into the pCR-II vector by TA
cloning, as directed by the manufacturer (InVitrogen, Carlsbad, CA).
Cloned inserts that were confirmed to contain exon 1 of PKC
by
Southern blot analysis were sequenced using an ABI 373 automatic sequencer.
Preparation and Screening of the WRO Cell cDNA Library
Poly(A)+ RNA was isolated from the WRO cell line
using a PolyATtract mRNA system (Promega, Madison, WI). cDNA
was generated from poly(A)+ RNA and then cloned into a
expression vector using a ZAP Express Vector Kit (Stratagene, San
Diego, CA). The
cDNA library was then screened as directed by
the manufacturer (Stratagene), using a probe labeled by random
priming in the presence of [32P]dCTP. The probe used was
generated by PCR amplification of a clone obtained by 3' RACE
(described above) which contained part of PKC
exon 1 (base 140-364)
and a 3' end that did not correspond to either intron 1 or exon 2, and
was thought to have resulted from a rearrangement of the PKC
gene.
Positive plaques were isolated and the ExAssist helper phage
(Stratagene) used to generate a recircularized pBK-CMV phagemid
(Stratagene) containing the positive cDNA. DNA isolated from these
clones were reconfirmed by Southern blotting to contain exon 1 of
PKC
, and then sequenced using an ABI sequencing machine.
Generation of PKC
Expression Constructs
The expression construct containing the Tr-PKC
(amino acids
1-116) was obtained, as described above, from the in vivo
excision of a clone isolated from the WRO cDNA library. The
expression construct containing the V1 region of PKC
(amino acids
2-142 (16)) was a generous gift from Dr. Robert Messing (University of
California, San Francisco) and has been previously described (17).
Generation of Tr-PKC
Stably Transfected Cell Lines
PCCL3 cells were plated (5 × 105 cells/35-mm
dish) and grown at 37 °C with 5% CO2. After 24 h
the cells were transfected by LipofectAMINE-mediated gene transfer, as
directed by the manufacturer (Life Technologies, Inc.). Briefly, 10 µl of LipofectAMINE were incubated with 1.0 µg of plasmid and 200 µl of serum-free medium for 30 min at room temperature. Then 800 µl
of serum-free medium was added to the LipofectAMINE-plasmid mixture and
the entire solution added to a plate which had been previously washed
twice with PBS. Cells were incubated at 37 °C in 5% CO2
for 5-8 h and the transfection mixture replaced with H6 medium. After
24 h the cells were trypsinized and divided into four 100-mm
dishes and single clones selected in H6 medium containing 300 µg/ml
G418 (Life Technologies, Inc.). The mass-transfected lines were created as above except that after splitting into 100-mm dishes, individual G418 clones were not isolated, but instead, all G418-resistant colonies
growing on that dish were pooled. Neomycin-resistant control cell lines
were created by transfecting the pBK-CMV vector alone.
PKC
Immunofluorescence
Cells were plated into each of the four wells of a 4-well
chamber-slide and incubated with H6 medium. When the cells became confluent, the medium was replaced by H6 medium with or without 100 nM PMA, and the cells incubated for 20 min at 37 °C with
5% CO2. Cells were washed 3 times with ice-cold PBS and
fixed by incubating the slides in 50:50 methanol/acetone at
20 °C
for 4 min. Nonspecific interaction was blocked by a 30-min incubation in PBS containing 2 mg/ml bovine serum albumin, 10% goat serum, and
0.1% Triton X-100. Cells were then incubated in PBS containing 2 mg/ml
bovine serum albumin, 5% goat serum, and polyclonal anti-PKC
IgG
(Santa Cruz Biotechnology) for 16 h at 4 °C. The cells were washed with 3 sequential 5-min incubations in PBS containing 2 mg/ml
bovine serum albumin, followed by a 2-h incubation at room temperature
in PBS containing 2 mg/ml bovine serum albumin, 5% goat serum, and
fluorescein isothiocyanate-conjugated goat anti-rabbit IgG (Jackson
ImmunoResearch Laboratories, Inc., West Grove, PA). The slides were
washed again 3 times and then mounted in Vectorshield (Vector
Laboratories Inc., Burlingame, CA). They were viewed under a Zeiss
Axiophot microscope. The images were captured onto Kodak 6400 ASA film
using an MC100 camera.
PKC
Kinase Assay
Cells were washed and then scraped from the plate in ice-cold
PBS, and collected by centrifugation at 1000 × g for
10 min. The cell pellet was resuspended in extraction buffer (20 mM Tris-HCl, pH 7.5, 0.5% Nonidet P-40, 250 mM
NaCl, 3 mM EDTA, 1 mM EGTA, 1 mM
dithiothreitol, 2 mM Na3VO4, 25 µg/ml aprotinin, 25 µg/ml leupeptin, 100 µg/ml
phenylmethylsulfonyl fluoride) and passed through a 27-gauge needle 10 times, and then centrifuged for 15 min at 10,000 × g
at 4 °C. The supernatant was collected and the protein concentration
determined. Extracts were diluted into extraction buffer (final protein
concentration 1 µg/µl) and added to 3 µg of rabbit anti-PKC
IgG (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) which had been
preincubated with protein G-agarose overnight at 4 °C. This mixture
was then incubated for 4 h at 4 °C. The beads were then washed
3 times with PBS containing 0.1% Triton X-100 and then 3 times with
kinase buffer (20 mM HEPES, pH 7.2, 137 mM
NaCl, 5.4 mM NaH2PO4, 0.4 mM KH2PO4, 25 mM
-glycerophosphate, 10 mM MgCl2, 0.5 mM EGTA, and 0.25 mM CaCl2). Beads
were resuspended in kinase buffer containing 0.013 µCi/µl
[
-32P]ATP, 50 µM ATP, 125 ng/µl PKA
inhibitor, and 0.4 mg/ml myelin basic protein and incubated at room
temperature for 30 min. The reaction was stopped by adding SDS-PAGE
loading buffer and then incubating at 95 °C for 5 min. The reaction
was then size separated by 15% SDS-PAGE, transferred to a nylon
membrane, and phosphorylation of the myelin basic protein quantitated
by PhosphorImager analysis. Background was determined by substituting
normal rabbit IgG for the rabbit anti-PKC
IgG.
Growth Curves
The plating efficiency (ratio of cells attached to cells plated)
of each clone was determined by plating a known number of cells in H6
medium. The plate was incubated for 24 h at 37 °C in 5%
CO2 at which time the cells were detached by trypsinization and counted with a Z1 Coulter counter. Plating of each clone for growth
curves was done in triplicate, after accounting for differences in
plating efficiency, to obtain 50,000 cells per well of a 6-well plate
after 24 h. The cells were grown in H6 medium with or without TSH
at 37 °C in 5% CO2. At the indicated times the cells
were detached by trypsinization and counted using a Z1 Coulter counter.
Assays for Apoptosis
Cells grown in H6 medium were allowed to reach 95% confluency
and then the medium replaced with fresh H6 medium containing the
indicated amounts of actinomycin D or doxorubicin or alternatively cells were irradiated with the indicated dose of UV. Apoptosis was
measured with the following methodologies.
DNA Fragmentation--
Cells were incubated for the indicated
times and the attached cells were collected by trypsinization then
combined with the detached cells suspended in the medium. DNA was then
extracted and 20 µg from each sample was electrophoresed through a
2% agarose-TBE gel and the DNA visualized by staining with ethidium bromide.
Cell Detachment--
The cells were plated and grown as above.
At the indicated times the number of cells in the medium was determined
using a Z1 Coulter counter. More then 95% of detached cells examined
by light microscopy after Diff-Quik staining or fluorescent microscopy after propidium iodide staining were found to have condensed and fragmented nuclei, consistent with death via apoptosis.
TUNEL Analysis--
We also confirmed that cell death was via
apoptosis by TUNEL analysis using the Apotag In Situ
Apoptosis kit, as directed by the manufacturer (Oncor Inc.,
Gaithersburg, MD).
MTT Assay--
To determine cell viability an MTT assay was
performed as directed by the manufacturer (Sigma). Briefly, H6 medium
was removed from cells and replaced with H6 medium containing 0.5 mg/ml
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)
(Sigma-Aldrich, St. Louis, MO) and incubated for 2 h at 37 °C.
The medium was removed and the colored precipitate formed by cleavage
of MTT in living cells was solubilized with isopropyl alcohol
containing 0.05 M HCl. Cell survival was determined by
absorbance at 570 nm. Background was determined by absorbance at
660 nm.
Nude Mouse and Soft Agar Assays
Athymic nude/nude mice were purchased from Harlan
Sprague-Dawley, Indianapolis, IN. For each cell line tested 1 × 106 cells in 200 µl of sterile PBS were injected into the
right flank of 4 nude/nude mice. The animals were followed for 8 weeks
with weekly inspection for nodules. To assay for anchorage-independent growth soft agar colony formation assays were performed by suspending 2 × 103 cells in 1.0 ml of 0.5% Bacto-agar (Difco
Laboratories, Detroit, MI) in H6 medium, and overlaying the suspension
in triplicate onto a layer of 2 ml of 0.6% Bacto-agar in H6 medium in
each well of a 6-well plate. The cells were refed every 5th day by
overlaying 1 ml of 0.5% Bacto-agar in H6 medium. After 20 days the
colonies with more than 50 cells were counted.
 |
RESULTS |
Identification of a Chimeric PKC
in the WRO Cell Line--
We
have previously reported mapping of the PKC
gene to the 2p21 locus
(15), a region found by comparative genomic hybridization to be
amplified in 28% of thyroid neoplasms studied. The amplification was
mapped to a series of BAC/PAC clones derived from a chromosome 2-specific library (15). One of these, BAC 1D9, was demonstrated by
FISH analysis to be amplified 40-70 times in the WRO cell line (Fig.
1), a thyroid cancer cell line that
contains double minute chromosomes. Sequencing of the entire BAC 1D9
demonstrated that it contained the first coding exon of the PKC
gene. Hybridization of the full-length human PKC
cDNA to
Southern blots containing DNA from the WRO cell line, the anaplastic
thyroid carcinoma cell line ARO, and normal tissue demonstrated that
the PKC
gene has undergone rearrangement and amplification in the
WRO cells, since there were additional bands found in the WRO cell line
that were not found present in normal tissue or in ARO cells (Fig.
2). Furthermore, it is clear that only
part of the PKC
gene is amplified in the WRO cells, as not all
hybridizing bands were over-represented (Fig. 2). To map the location
of the amplification and rearrangement, PCR products specific to
different regions of the PKC
cDNA were generated and hybridized
to Southern blots. This demonstrated that the 5' break point of the
internal deletion was between bases 366 and 599 of PKC
cDNA
(data not shown), whereas hybridization with probes mapping to bases
1136-2244 showed that all were amplified, indicating that at least
part of the 3' end of the gene was within the amplicon. These Southern
blot data suggest that the changes in the PKC
gene are a result of
an internal deletion followed by an amplification of the rearranged
gene.

View larger version (60K):
[in this window]
[in a new window]
|
Fig. 1.
FISH of WRO chromosomes to BAC probes mapping
to chromosome 2p21. Top, BAC2B5 detects a single signal
on each chromosome 2 (WRO cells are trisomic for this chromosome) in
the metaphase shown. Three signals are also detected in the interphase
nucleus. Bottom, BAC 1D9 shows a distinct pattern of
amplification. In addition to the fluorescein isothiocyanate signals
(green spots) detected on the three chromosome 2p21 loci,
clusters of signals are detected on the multiple double minute
chromosomes. Adjacent interphase nucleus also reveal multiple
signals.
|
|

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 2.
Southern and Northern blots of WRO
cells. A, Southern blot containing 10 µg of DNA from
ARO and WRO cells and normal tissue, digested with EcoRI or
BamHI. The blots were hybridized with the full-length PKC
cDNA. Only some DNA bands from WRO cells are amplified. Top
arrow points to a BamHI band present at normal dosage.
Middle arrow points to an amplified band of normal size.
Lower arrow indicates an aberrantly sized amplified
fragment, consistent with amplification of a rearranged PKC gene in
the WRO cell line. B, Northern blot containing 20 µg of
total RNA from normal thyroid tissue, NPA cells, and WRO cells.
Top, blot hybridized with the full-length PKC cDNA.
The upper arrow (~7.2 kb) indicates the position of the
full-length PKC mRNA and the lower arrow (~2.2 kb)
indicates position of the Tr-PKC mRNA. Bottom,
ethidium bromide staining of the gel.
|
|
To ascertain what effects the amplification and rearrangement of the
PKC
gene has on its expression, Northern blots containing 20 µg of
RNA from two clonal thyroid cancer cell lines and normal thyroid tissue
were probed with the 2.2-kb PKC
cDNA (Fig. 2). Expression of the
full-length PKC
mRNA was slightly lower in WRO, than in normal
thyroid tissue. In addition, there was a PKC
hybridizing mRNA of
approximately 2.2 kb in the WRO cell line, suggesting this cell line
has an abnormal PKC
transcript. The identity of this mRNA was
determined by sequencing products generated by 3' RACE, and found to be
a chimeric and truncated PKC
(Tr-PKC
) species that contained exon
1 of PKC
fused to an unrelated sequence.
To obtain the Tr-PKC
cDNA in its entirety, a WRO cDNA
library was constructed and screened with the DNA product generated by
3' RACE. Probing duplicate membranes from 5 plates, containing 30,000 plaques each, we identified more than 40 plaques that were positive in
both membranes. The positive plaques were isolated and the
corresponding pBK-CMV phagemids containing the Tr-PKC
cDNAs were
generated by in vivo excision. Sequencing of 6 unique phagemids established that all the cDNAs contained exon 1 of PKC
spliced to 1 of 2 sequence fragments unrelated to PKC
. The
non-PKC
sequences extended the PKC
reading frame by either 23 (found in 2/6 clones) or 2 amino acids (found in 4/6 clones) (Fig.
3A). The latter clone was
chosen for all further studies since it was the most common. A search
of GenBank, EST, and EMBL data bases revealed no significant homology
of the non-PKC
sequences. Furthermore, these sequences were not part
of the large >55-kb intron 1 sequenced from BAC 1D9. The conservation
of exon 1 of PKC
(amino acids 1-116) between the different
Tr-PKC
mRNAs suggests that this is likely to be the biologically
relevant part of the message. This is further supported by the
observation that a N-terminal fragment of PKC
(amino acids 2-142),
corresponding to the V1 region of the protein (Fig. 3B), as
well as a peptide derived from this fragment (amino acids 14-21), are
capable of impairing PKC
function in PC12 cells (17) and cardiac
myocytes (16, 28) by selectively inhibiting activation-induced
translocation of PKC
.

View larger version (83K):
[in this window]
[in a new window]
|
Fig. 3.
Sequence and structure of a
Tr-PKC cloned from a WRO cell cDNA
library. A, the highlighted sequence is complimentary
to the first coding exon of the PKC gene (as inferred from the
intron-exon boundary determined by sequencing genomic DNA from BAC
1D9). The additional sequence is unrelated and extends the open reading
frame by 2 amino acids. **, indicates alternative fusion sequence which
extends the reading frame by 23 amino acids. B, functional
domains of the Wt-PKC protein. The bar shown
below represents the region of Wt-PKC gene found in the
Tr-PKC . The V and C domains represent regions
that are variable or conserved, respectively, between the different PKC
isozymes. The V1 region contains the site involved in the
interaction of PKC with its intracellular docking protein, '-COP.
The V3 region contains the hinge domain and protease
cleavage sites, both of which are thought to be important in regulating
PKC function. To date no specific function has been assigned to
regions V4 and V5. The C1 region contains the
pseudosubstrate site and the phorbol ester and actin-binding sites.
Region C3 contains the ATP-binding site and C4 contains the domain
involved in phosphate transfer.
|
|
To test whether the Tr-PKC
has similar properties in WRO cells,
Western blots containing the soluble and particulate fraction from
three different clonal thyroid cancer cell lines (ARO, NPA, and WRO)
and normal thyroid tissue were probed with an anti-PKC
IgG. Whereas
in normal thyroid tissue and the thyroid cancer cell lines ARO and NPA
the majority of PKC
is found in the particulate fraction (52.4, 74.3, and 67.3%, respectively), in WRO cells only 22.3% was found in
this compartment (Fig. 4). In addition,
the total level of PKC
in the WRO cell line was 64% less than that in the other two cell lines. These observations are consistent with a
role of the Tr-PKC
in preventing translocation after activation (16,
17, 28). Of note, the antibody used in the Western blots was generated
against amino acids 722-726 of the isozyme, and was therefore not
expected to recognize the Tr-PKC
or the V1 fragment (amino acids
2-142) of PKC
. In addition, none of the other commercially
available antibodies have been demonstrated to recognize the V1
fragment.

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 4.
Western blot of PKC
in human thyroid carcinoma cell lines. Thirty µg of
protein from either the soluble (S) or particulate
(P) fractions of the indicated cell lines or normal thyroid
tissue were electrophoresed in a 7.5% SDS-PAGE and transferred to a
nitrocellulose membrane. The blot shown is representative of two
separate experiments. PKC was detected using a rabbit polyclonal
anti-PKC IgG (Santa Cruz) and an horseradish peroxidase-conjugated
goat anti-rabbit IgG. The arrow shows the position of the
wild-type PKC (~90 kDa).
|
|
Production of PCCL3 Cell Lines Overexpressing Tr-PKC
and the V1
Region of PKC
--
To investigate the function of the Tr-PKC
,
the pBK-CMV vector containing Tr-PKC
was stably transfected into
PCCL3 cells, a well differentiated rat clonal thyroid cell line that is
TSH-dependent for growth, iodide uptake, and expression of
thyroglobulin and thyroid peroxidase. Twenty neomycin-resistant clones
from Tr-PKC
transfections were isolated and screened for expression
of the transfected product, resulting in 6 clones that expressed
Tr-PKC
mRNA. PCCL3 cell lines were also mass transfected with a
pRc-RSV expression vector containing the V1 fragment of the isozyme
(amino acids 2-142), known to inhibit the translocation and function of PKC
in rat cardiac myocytes (16), rat islet cells (18), and PC12
cells (17). Northern blots of the transfected cell lines probed with
the various cDNAs demonstrated a 4-6-fold overexpression of the
specific PKC
product compared with endogenous PKC
(Fig. 5A). Since no antibody to the
V1 region of PKC
was available we also produced an HA-tagged
Tr-PKC
cDNA construct and stably transfected it into PCCL3 to
demonstrate appropriate expression of the Tr-PKC
protein (Fig.
5B).

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 5.
Expression of Tr-PKC
in PCCL3 cells and impact on PMA-induced PKC translocation.
A, Northern blots of 20 µg of total RNA from the indicated
cell lines, probed with full-length PKC cDNA. B,
Western blot of PCCL3 cells stably transfected with pPK-RSV or pPK-RSV
containing the HA-tagged Tr-PKC . C, effects of Tr-PKC
expression on PMA-induced translocation of wild-type PKC . Western
blots of Neo-transfected or Tr-PKC -transfected cells treated with or
without 100 nM PMA for 20 min. Tr-PKC -12 and -14 are
clonal lines documented to stably express the mutant isozyme. Cells
were harvested, and subjected to a 4-part fractionation. The level of
PKC in each fraction was determined by probing Western blots
containing 30 µg of protein from each of the 4 fractions with rabbit
polyclonal anti-PKC IgG. D, the intensity of the PKC
band in each fraction was determined by densitometry and used to
calculate the percent change in band intensity of PMA-treated
versus untreated cells. The bars represent
mean ± S.E. of three independent experiments. *,
p < 0.05 versus PC-Neo; **,
p < 0.009 versus PC-Neo.
|
|
Effect of Tr-PKC
on PMA-induced Relocation of Endogenous
PKC
--
To explore relocation of PKC
in PCCL3 cells, lysates
were fractionated into four parts: F1, enriched for cytosol; F2, plasma membrane and organelles; F3, nucleoplasm; and F4, nuclear membrane. Endogenous PKC
in untreated, Neo-transfected cells is found mainly in F1 and F3 (Fig. 5, C and D). After treatment
with PMA, the PKC
protein is no longer found in F1 and F3, and
increases in the membrane-containing fractions F2 and F4. In
PKC
-expressing cells PKC
is also almost fully displaced from F1
and F3 after PMA. However, there is no increase in F2 or F4 (Fig. 5,
C and D). The presence of PKC
in fractions F2
and F4 in the Tr-PKC
cells under basal conditions may be the result
of nonspecific or secondary anchoring sites that are unaffected by the
Tr-PKC
, as suggested by Mayne and Murray (29), since they are not
altered by treatment with PMA. It is possible that the mistranslocated PKC
is degraded, since we have found that activated PKCs are less
stable if their translocation is inhibited
(28).2 To explore this
possibility, total cell lysates were prepared from cells treated for
0-6 h with PMA. Western blots demonstrated similar levels of PKC
in
both controls and Tr-PKC
-expressing cells during the first hour
after PMA treatment (data not shown). These results indicate that the
lack of appearance of PKC
in F2 and F4 was not due to degradation
in vivo, since the fractionation experiment was performed in
cells treated with PMA for only 20 min. The most likely explanation is
that blocking interaction of PKC
with its RACK renders it more
sensitive to nonspecific proteolysis during fractionation.
Overexpression of PKC
-V1 resulted in similar effects (not shown). Of
note, the PMA-induced translocation of PKC
and
I, and basal
levels of PKC
were unaffected in the Tr-PKC
expressing cells (not
shown). PCCL3 cells had no detectable PKC
II,
,
, or
. The
above results are consistent with a model by which Tr-PKC
inhibits
interaction of activated wild-type PKC
with its RACK. In support of
this conclusion, immunofluorescent staining of PCCL3 cells with
anti-PKC
antibody demonstrated immunoreactivity distributed
throughout the cytosol under basal conditions. Upon activation with
PMA, PKC
localized to the plasma membrane as well as to perinuclear
Golgi-like structures. However, in cell lines expressing the Tr-PKC
,
PKC
did not localize to either the plasma membrane or the Golgi
after PMA treatment (Fig. 6).

View larger version (90K):
[in this window]
[in a new window]
|
Fig. 6.
Localization of PKC
by immunofluorescence in native PCCL3 and
Tr-PKC -14 cells. PKC localization was
detected after incubation with a rabbit polyclonal anti-PKC IgG and
an fluorescein isothiocyanate-conjugated goat anti-rabbit IgG.
A, untreated PCCL3 cells. B, PCCL3 cells treated
with 100 nM PMA for 20 min. C, untreated
Tr-PKC cells. D, Tr-PKC cells treated with 100 nM PMA for 20 min. The images shown (× 40 magnification)
are representative of three independent experiments.
|
|
To determine the impact of translocation inhibition on the enzymatic
function of PKC
, we measured the ability of immunoprecipitated PKC
to phosphorylate myelin basic protein in vitro. There
was a 3-fold increase in myolin basic protein phosphorylation in both control cells and cells expressing the Tr-PKC
after activation with
PMA (data not shown). This indicates that, as expected (6, 17), the
Tr-PKC
does not modify PKC
kinase activity, but likely interferes
with the function of its wild-type counterpart by displacing it to an
inappropriate cell compartment after activation.
Effects of Overexpressing Tr-PKC
on Growth Rate and Saturation
Density of PCCL3 Cells--
Removal of TSH for 8 days resulted in a
complete inhibition of growth in Neo-transfected cells, as well as
those expressing Tr-PKC
or V1-PKC
, indicating that expression of
the PKC
fragments did not confer cells with TSH-independent growth.
In the presence of TSH, Neo-transfected, Tr-PKC
, and V1-PKC
expressing cells had similar initial doubling times (22.9, 23.0, and
24.4 h, respectively) (Fig. 7).
However, Tr-PKC
and V1-PKC
expressing cells grew to a higher
saturation density than the Neo-transfected controls (Fig. 7).

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 7.
Growth curve of Neo-transfected PCCL3 and the
indicated V1-PKC or
Tr-PKC -overexpressing cell lines. Data
illustrate results of one experiment performed in triplicate, which was
similar to those obtained in a second experiment. Open and
closed symbols represent cell counts with or without 10 mIU/ml of TSH, respectively. Neo-transfected, Tr-PKC , and
V1-PKC -transfected cells are indicated by diamonds,
circles, and squares, respectively.
|
|
Formation of Tumors in Nude Mice and Colonies in Soft Agar--
To
determine whether the Tr-PKC
products have transforming properties
on PCCL3 cells, Tr-PKC
, or V1-PKC
-expressing cell lines were
tested for colony formation in soft agar, and for ability to form
subcutaneous tumors in athymic mice. Whereas the human thyroid
carcinoma cell lines ARO, FRO, and WRO formed colonies in soft agar,
neither PCCL3-Neo, Tr-PKC
-14, Tr-PKC
-12, nor V1-PKC
-expressing cells scored in the assay (not shown). Similarly, all mice injected with the human thyroid cancer cell lines developed tumors within 6 weeks (4/4 each), whereas the Neo control and Tr-PKC
expressing cells did not.
Effects of overexpression of Tr-PKC
on
Apoptosis--
Inhibition of macromolecular synthesis results in
apoptosis in a variety of cell types (30), including the thyroid (31). To confirm that actinomycin D, an RNA synthesis inhibitor, was also
able to induce apoptosis in the PCCL3 cells, they were incubated with
various concentrations of actinomycin D for 24 h and the cells
harvested. The DNA from the collected cells exhibited a dose-dependent increase in nucleosomal fragmentation,
indicative of apoptosis (Fig.
8A). Furthermore, greater than
95% of the detached cells exhibited nuclear condensation or nuclear
fragmentation as determined by Diffico blue staining or propidium
iodide staining, respectively, confirming that cell detachment could be
used as a quantitative indicator of apoptosis under these conditions. The above observations demonstrated that the incubation of PCCL3 cells
with actinomycin D induces cell death via an apoptotic pathway.

View larger version (45K):
[in this window]
[in a new window]
|
Fig. 8.
Induction of apoptosis by actinomycin D. A, PCCL3 cells grown in H6 medium were treated with the
indicated concentration of actinomycin D for 24 h. At that time
all attached and detached cells were combined and the DNA isolated.
Twenty µg of DNA was then electrophoresed through a 2%
agarose/TBE gel and the DNA detected by ethidium bromide
staining. The 1-kb ladder (far right lane) indicates DNA
laddering units of 180-200 base pairs, consistent with the nucleosomal
fragmentation seen in apoptosis. B, the indicated cells were
incubated with 1.0 µg/ml actinomycin D and the number of detached
cells were determined by counting cells in the medium. The data shown
is an average of a single experiment performed in triplicate and is
similar to that obtained in two additional experiments. C,
cells from the indicated lines were incubated with 1.0 µg/µl
actinomycin D for 16 h, fixed with paraformaldehyde, and the
extent of apoptosis determined by TUNEL analysis. The bars
represent mean ± S.E. of an experiment performed in triplicate.
*, p < 0.0006 versus PC-Neo. D,
20 µg of DNA isolated from cells incubated in H6 medium containing
1.0 µg/ml actinomycin D for the indicated times (h) was
electrophoresed through a 2% agarose/TBE gel. The DNA was detected by
staining with ethidium bromide. The data illustrated is representative
of two separate experiments.
|
|
To characterize the effects of overexpressing Tr-PKC
and V1-PKC
on apoptosis, the different cell lines were incubated with actinomycin
D and the number of detached cells determined. Greater than 90% of the
untransfected and Neo-transfected cells detached from the dish after
16 h of incubation with actinomycin D (Fig. 8B). In
contrast, there was less than 20% detachment in cell lines overexpressing Tr-PKC
or V1-PKC
. The resistance of the cells expressing the Tr-PKC
or V1-PKC
to apoptosis was confirmed by TUNEL analysis (Fig. 8C) and DNA fragmentation (Fig.
8D). The protective effects of Tr-PKC
and V1-PKC
were
also apparent when apoptosis was triggered through alternative
mechanisms, such as exposure to UV irradiation or to doxorubicin (Fig.
9).

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 9.
Induction of apoptosis by doxorubicin and UV
irradiation. A, survival of the indicated cell lines
treated with 0.5-2.0 µM doxorubicin at 37 °C for
48 h. The bars represent mean ± S.E. of two
experiments performed in duplicate. *, p < 0.0004 versus PC-Neo. B, survival of the indicated cell
lines irradiated with 40-200 J/m2 and then incubated at
37 °C for 24 h. The bars represent mean ± S.E.
of two experiments performed in duplicate. *, p < 0.005 versus PC-Neo. Cell survival was determined using an
MTT assay. Bars represent the mean from three independent
experiments.
|
|
Effects of Overexpression of Tr-PKC
on p53--
Doxorubicin has
been reported to induce apoptosis via a p53-mediated mechanism (32).
Indeed, doxorubicin increased p53 levels within 6 h in
Neo-transfected PCCL3 cells, with maximal induction at 12 h (Fig.
10, A and B). By
contrast there was only a slight increase in p53 after addition of
doxorubicin in cell lines expressing the Tr-PKC
, suggesting that the
mutant isozyme may inhibit DNA damage-induced activation of p53. As
predicted, p53 mRNA was unchanged 6 h after addition of
doxorubicin, and actually declined at 12 and 18 h (data not
shown), demonstrating that the increase in p53 protein was a result of
post-translational changes, most likely stabilization. MDM2, a nuclear
protein induced by p53, binds to the p53 trans-activation domain and
promotes its proteasome-mediated degradation (33, 34). After exposure
to doxorubicin, MDM2 levels increased transiently in PCCL3-Neo cells,
but did so more robustly and persistently in cell lines expressing
Tr-PKC
(Fig. 10A). p53 has been reported to lead to
apoptosis in part by its ability to transactivate expression of Bax
(35, 36). In accordance with these reports, doxorubicin increased Bax
protein levels in Neo-transfected PCCL3 cells, an effect that was
markedly inhibited by expression of Tr-PKC
(Fig. 10, A
and C). Finally, whereas doxorubicin decreased abundance of
the anti-apoptotic factor Bcl-2 in both Neo- and Tr-PKC
-expressing
cells, absolute levels of Bcl-2 were 2-5-fold higher in cells
expressing the Tr-PKC
at all time points (Fig.
11). Of note, levels of
Bcl-XL, Bcl-XS, or Bad were not affected by
expression of the Tr-PKC
or treatment with doxorubicin (data not
shown).

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 10.
Effects of Tr-PKC
on induction of p53, Bax, and MDM2 after treatment with
doxorubicin. A, representative Western blot of Neo- or
Tr-PKC -transfected cells treated with 1.5 µM
doxorubicin for the indicated time, probed with an anti-p53, anti-Bax,
or anti-MDM2. B, the intensity of the p53 band at each time
point was determined by densitometry. Data represent the relative
change in band intensity of doxorubicin-treated versus
untreated cells. The bars represent mean ± S.E. of
three separate experiments. *, p < 0.05 versus PC-Neo. C, the intensity of the bax band
at each time point was determined by densitometry. Data represent the
relative change in band intensity of doxorubicin-treated
versus untreated cells. The bars represent
mean ± S.E. of three separate experiments. *, p < 0.05 versus PC-Neo.
|
|

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 11.
Effect of Tr-PKC on
expression of Bcl-2. A, Western blot of Neo- or
Tr-PKC -transfected cells treated with 1.5 µM
doxorubicin for the indicated time, probed with an anti-Bcl-2 IgG.
B, the intensity of the Bcl-2 band at each time point was
determined by densitometry. Data represent the relative change in band
intensity of doxorubicin-treated versus untreated cells. The
bars represent mean ± S.E. of three separate
experiments. *, p < 0.05 versus
PC-Neo.
|
|
 |
DISCUSSION |
Whereas activation of PKCs is important in regulating cell
proliferation, differentiation, and apoptosis of most cell types, the
contribution of individual PKC isozymes in these processes is not well
understood. Our interest in the function of PKC
in thyroid cells
resulted from our characterization of a rearrangement and amplification
of the PKC
gene in WRO thyroid carcinoma cells (15). This complex
mutation was identified by positional cloning of a defect initially
detected by comparative genomic hybridization, and as such, is to our
knowledge the first previously unmapped candidate tumor-promoting gene
uncovered with this methodology. The WRO cell line lacked identifiers,
and it was not possible to determine whether the PKC
rearrangement
was also present in the original tumor. Moreover, further manipulation
of PKC
in this cell line is unlikely to be informative, since it has
a number of other genetic defects including inactivating mutations of
p53 and p16 (37, 38). The 2p21 amplicon gave rise to double minute chromosomes. The double minute chromosomes containing the rearranged PKC
gene have persisted through serial passaging for several years,
despite the fact that double minute chromosomes are known to be
unstable structures, suggesting that their presence conferred WRO cells
with a selective advantage. As a result of this chromosomal abnormality, WRO cells display high level expression of a chimeric gene
product, consisting of the first coding exon of the PKC
gene fused
to one of two unrelated fragments, the most common of which codes for a
2 amino acid C-terminal tail. Exon 1 of PKC
codes for part of the V1
region of the protein, that contains the domain involved in the
interaction of the activated isozyme with its intracellular docking
protein(s) (16, 17, 28), one of which was recently identified as
'-COP (39).
A powerful approach to determine the role of individual PKC isozymes is
to specifically inhibit their function by preventing translocation and
binding to their respective anchoring proteins (i.e. their
isozyme-specific RACK) using peptides or protein fragments containing
the domain involved in the interaction. This strategy has been used
successfully to dissect the specific function of the classical PKC
isozymes
and
(18, 40, 41), PKC
(16-18, 28, 29), and PKC
(17) in different cell types. As there are no antibodies available that
recognize the V1 region of PKC
, we could not directly verify the
in vivo location of the Tr-PKC
. However, transfection of
PCCL3 cells with an HA-tagged Tr-PKC
resulted in expression of a
protein that was distributed throughout the cell, perhaps due to
saturation of the anchoring protein. The following observations
strongly suggest that Tr-PKC
interacts with a PKC
-specific RACK
and antagonizes binding of activated wild-type PKC
. 1) The Tr-PKC
protein contains the domain demonstrated to be important in the binding
of PKC
with
'-COP, a protein demonstrated to act as a
PKC
-specific RACK in cardiomyocytes (16, 39). 2) Unlike other
thyroid cells, where greater than 50% of the isozyme is in the
particulate fraction, the majority of wild-type PKC
is found in the
soluble fraction in WRO cells (i.e. not bound to its RACK).
3) Transfection of PCCL3 rat thyroid cells with a Tr-PKC
-expression
vector (containing amino acids 1-116 of the wild-type isozyme)
inhibits the PMA-induced translocation of PKC
to membrane fractions
that contain the activated protein. Similar results were obtained in
PCCL3 cells overexpressing the V1 fragment of PKC
(amino acids
2-142). 4) Translocation of wild-type PKC
to Golgi-like structures
and plasma membrane after PMA treatment is not seen in cell lines
expressing the Tr-PKC
, or the V1 region of PKC
. 5) Expression of
Tr-PKC
had selective effects on the homologous wild-type enzyme, and
did not affect the abundance or subcellular distribution of other PKC
isozymes, consistent with experiments in PC12 cells (17) and cardiac
myocytes (28) after overexpression of the V1 fragment of PKC
, or
introduction of the V1 fragment by transient permeabilization (16).
Although we favor the interpretation that Tr-PKC
functions as a
competitive antagonist of the activation-induced binding of the
wild-type protein to its intracellular anchoring protein, we cannot
exclude the possibility that it may also have other independent
effects. For example, inhibiting the interaction of PKC
with its
RACK, which has been demonstrated to bind the majority of the activated
enzyme (13), may promote the association of PKC
with other proteins
such as Raf (42), 14-3-3 proteins (43), caveolin (44), AKAP79 (8, 9),
or actin (45, 46). Given that the kinase activity of PKC
is still
intact in cells expressing the Tr-PKC
, and that PKCs have a
relatively relaxed substrate specificity, it is possible that the
displaced PKC
may aberrantly phosphorylate alternative substrates,
and thus disrupt their function. Whether the phenotype of cells
containing Tr-PKC
is a result of a disruption in binding to RACK, or
secondary effects on alternative substrates by the displaced kinase
remains to be determined.
Cell lines expressing the V1-PKC
or Tr-PKC
grew to a higher
saturation density, implying that wild-type PKC
may play a role in
contact inhibition, or as a negative regulator of thyroid cell growth.
Although this observation contrasts with published data that PKC
activation stimulates thyroid cell growth (47, 48), the results are not
mutually exclusive, since previous investigators used PKC activators
and inhibitors that are not specific to an individual PKC isozyme.
Thus, it is possible that their observations result from the activation
or inhibition of PKC isozyme(s) other than PKC
, and that the outcome
of activation of the latter was not apparent in the context of a more
comprehensive stimulation of the whole PKC signaling repertoire.
Many reports have suggested a role for individual PKC isozymes in cell
transformation (reviewed in Ref. 49). PKCs can exert both positive and
negative effects on cell growth, depending on the isozyme and the cell
type involved. Of all PKC isozymes, PKC
has proven to be the most
consistently transforming when transfected into murine fibroblasts (50,
51). When overexpressed in rat 6 cells, PKC
evoked malignant
transformation in the absence of treatment with phorbol esters. In the
presence of 12-O-tetradecanoylphorbol-13-acetate, PKC
-transfected cells exhibited a rearranged actin cytoskeleton and
were growth inhibited, probably due in part to interference of the
overexpressed isozyme with the translocation and activation of other
PKC isozymes. Overexpression of PKC
also results in transformation
of colonic epithelial (52), but not rat hepatoma cells (53).
The most significant phenotypic change introduced by expression of
Tr-PKC
or V1-PKC
was protection from apoptosis. Disruptions in
cellular control of programmed cell death are now recognized as common
events in tumorigenesis (54, 55), by creating a permissive environment
for the accumulation of genetic damage. There is relatively scant
information on the physiological signals that trigger apoptosis in
thyroid cells. Growth factor or TSH deprivation and protein synthesis
inhibitors can trigger apoptosis in thyrocytes (31). The role of
interleukin-1
and Fas is more controversial (56, 57). Downstream of
these initiating events are a variety of intermediates that either
positively or negatively regulate apoptosis. The particular pathways
used vary according to the cell type and the triggering event, and
include, but are not limited to, signaling through the PKC and PKA
families, hydrolysis of sphingomyelin, and activation of
mitogen-activated protein kinase (for review, see Refs. 30, 58, and
59). We opted to explore the role of apoptosis by exposing cells to
adverse conditions or well recognized DNA damaging agents:
i.e. actinomycin D, UV irradiation, and doxorubicin. The
protective effects of Tr-PKC
and V1-PKC
in response to these
various treatments were consistent and of significant magnitude. Broad
based PKC activation has been reported to have diverse effects on
programmed cell death, including both anti-apoptotic and pro-apoptotic
effects (for review see, Refs. 1 and 60). Recent studies using
strategies to explore the role of individual isozymes suggests that
activation of PKC
may have a pro-apoptotic (61) or an anti-apoptotic
(62) effect which is presumably dependent on cell type or apoptosis inducing agent. For example, down-regulation of PKC
and
by chronic exposure to a phorbol ester in human prostatic carcinoma cells
was associated with resistance to VP-16- or melphalan-induced apoptosis. These effects were not abrogated in the presence of the PKC
antagonist UCN-01 at concentrations that inhibited PKC
, but not
PKC
, indirectly implicating the latter in the control of p