JBC Avanti Polar Lipids

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Knauf, J. A.
Right arrow Articles by Fagin, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Knauf, J. A.
Right arrow Articles by Fagin, J. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 33, 23414-23425, August 13, 1999


Involvement of Protein Kinase Cepsilon (PKCepsilon ) in Thyroid Cell Death
A TRUNCATED CHIMERIC PKCepsilon CLONED FROM A THYROID CANCER CELL LINE PROTECTS THYROID CELLS FROM APOPTOSIS*

Jeffrey A. KnaufDagger , Rosella EliseiDagger , Daria Mochly-Rosen§, Tamar Liron§, Xiao-Ning Chen, Rivkah Gonskyparallel , Julie R. Korenberg, and James A. FaginDagger **

From the Dagger  Division of Endocrinology and Metabolism, University of Cincinnati, Cincinnati, Ohio 45267-0547, the § Department of Molecular Pharmacology, Stanford University, School of Medicine, Stanford, California 94025, the parallel  Division of Endocrinology and Metabolism, and the  Department of Pediatrics, Medical Genetics Birth Defects Center, Cedars-Sinai Medical Center and UCLA School of Medicine, Los Angeles, California 90048

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The protein kinase C (PKC) family has been implicated in the regulation of apoptosis. However, the contribution of individual PKC isozymes to this process is not well understood. We reported amplification of the chromosome 2p21 locus in 28% of thyroid neoplasms, and in the WRO thyroid carcinoma cell line. By positional cloning we identified a rearrangement and amplification of the PKCepsilon gene, that maps to 2p21, in WRO cells. This resulted in the overexpression of a chimeric/truncated PKCepsilon (Tr-PKCepsilon ) mRNA, coding for N-terminal amino acids 1-116 of the isozyme fused to an unrelated sequence. Expression of the Tr-PKCepsilon protein in PCCL3 cells inhibited activation-induced translocation of endogenous PKCepsilon , but its kinase activity was unaffected, consistent with a dominant negative effect of the mutant protein on activation-induced translocation of wild-type PKCepsilon and/or displacement of the isozyme to an aberrant subcellular location. Cell lines expressing Tr-PKCepsilon grew to a higher saturation density than controls. Moreover, cells expressing Tr-PKCepsilon were resistant to apoptosis, which was associated with higher Bcl-2 levels, a marked impairment in p53 stabilization, and dampened expression of Bax. These findings point to a role for PKCepsilon in apoptosis-signaling pathways in thyroid cells, and indicate that a naturally occurring PKCepsilon mutant that functions as a dominant negative can block cell death triggered by a variety of stimuli.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Protein kinase C (PKC)1 isozymes are involved in signal transduction pathways controlling growth, differentiation, and apoptosis (1, 2). In addition, PKCs are the major cellular receptors for the tumor promoter phorbol esters and related compounds. Because of this, there has been considerable interest in the potential role of PKC isozymes in the multistage process of carcinogenesis. However, isolating the role of the individual isozymes has proven to be complex due to apparent similarity in their substrate specificity, at least in vitro, as well as overlapping sensitivity to activators and inhibitors.

The PKC gene family is divided into three subgroups based on sequence homology and cofactor requirements: conventional PKC (alpha , beta I, beta II, and gamma ) which are dependent on Ca2+ for activation, nonconventional PKCs (delta , epsilon , eta , and theta ) that are not dependent on Ca2+ for activation, and atypical PKCs (zeta , lambda /iota ) which are not stimulated by diacylglycerol or phorbol esters and are Ca2+ independent (3). Cell signal pathways involving the PKC family are initiated by binding of a ligand to its respective cell surface receptor, which triggers the breakdown of phospholipids by phospholipase C and D producing many products including diacylglycerol (3, 4). Diacylglycerol binds to and activates most PKC isozymes, which then relocate to specific subcellular compartments that vary between the PKC isozymes as well as between cell types (5, 6). This relocation results from distinct protein-protein interactions, many of which are likely to be isozyme specific. Jaken, Scott, and collaborators (7-12) have identified talin, vinculin, a myristoylated protein kinase C substrate, a beta -adducin homolog, AKAP79, as well as gravin/AKAP250 as PKC-associated proteins that require phosphatidylserine for binding. The binding of diacylglycerol is believed to lead to activation and relocalization of the PKCs through conformational changes that expose the catalytic domain as well as the region involved in binding to the docking site after translocation. This docking site has been termed RACK (receptor for activated C kinase), and each isozyme has been postulated to have its own specific RACK (6, 13), which is thought to determine the specific cellular location of the activated PKC isozymes. This property has been exploited for the past few years to develop isozyme-specific competitive antagonists (for review, see Ref. 14).

In a previous report (15) we describe the use of comparative genomic hybridization to detect regions of allelic imbalance in thyroid tumors, including an amplification event on chromosome 2p21 in 28% of the thyroid neoplasms examined, as well as in the clonal thyroid carcinoma cell line WRO. Positional cloning and sequencing of a BAC mapping to the 2p21 amplicon identified a candidate gene, protein kinase Cepsilon (PKCepsilon ), which was amplified in the WRO cell line. Here we extended the analysis of this genetic event by describing that the PKCepsilon gene was not only amplified, but also rearranged in the WRO cells. This complex genetic aberration leads to the overexpression of a chimeric and truncated PKCepsilon (Tr-PKCepsilon ). The Tr-PKCepsilon protein reported here is nearly identical to an N-terminal PKCepsilon fragment which has been demonstrated to specifically inhibit both activation-induced translocation of wild-type PKCepsilon to its intracellular binding site as well as the biological effects mediated by this enzyme (16-18). We provide evidence that this truncated gene product interferes with the function of the wild-type isozyme in clonal thyroid cell lines and results in significant alterations in growth and apoptosis. In addition, we show that the inhibition of apoptosis in cells expressing Tr-PKCepsilon is associated with impairment of the expected stabilization of p53 induced by DNA damage, and of the consequent activation of Bax. These data indicate that PKCepsilon is involved in apoptosis signaling in thyroid cells, and raise the possibility that that loss of expression or function of PKCepsilon may participate in thyroid tumorigenesis by inhibiting programmed cell death.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cell Lines and Tissue Sample Collection

The human thyroid carcinoma cell lines NPA, ARO, and WRO were a gift of G. Juilliard (UCLA), and propagated in RPMI 1640 medium containing 10% fetal calf serum, non-essential amino acids (Irvine Scientific, Irvine, CA), glutamine (286 mg/liter), penicillin, and streptomycin (Life Technologies, Inc., Gaithersburg, MD), as described (19). PCCL3 cells were propagated in H6 medium, which consisted of Coons modification of Ham's F-12 media (Irvine Scientific, Irvine, CA) containing 5% fetal calf serum, glutamine (286 mg/l), somatostatin (10 ng/ml), glycyl-L-histidyl-L-lysin acetate (10 ng/ml), transferrin (5 µg/ml), hydrocortisone (10 nM), insulin (10 µg/ml), thyroid stimulating hormone (TSH, 10 mIU/ml), penicillin, and streptomycin, as described (20).

Demonstration of 2p21 Amplification in WRO Cells by FISH

WRO cell chromosome preparations were hybridized with the indicated bacterial artificial chromosome (BAC) clone as described previously (21). Briefly, the indicated BACs were biotin-labeled and hybridized to chromosome slides made from the WRO cell line. The images were captured using a Photometrics cooled-CCD camera (CH250) and Oncor image analysis system equipped with a Zeiss 135 Axovert fluorescence microscope.

Southern and Northern Blot Analysis

Southern blots of 10 µg of genomic DNA from the indicated sources digested with either EcoRI or BamHI were performed as described (15). Membranes were probed with either the full-length (2.2 kb) human PKCepsilon cDNA obtained by NheI digestion of the PKCepsilon /pBluebac expression vector (22) or PCR products generated from the indicated regions of PKCepsilon cDNA. Probes were labeled with [32P]dCTP by random priming (Stratagene, San Diego, CA). Northern blots of 20 µg of total RNA were performed as described (23, 24) and hybridized with a full-length human [32P]dCTP-labeled PKCepsilon cDNA.

Total Cell lysates and Cell Fractionation

After washing, cells were scraped from the plate in ice-cold PBS and collected by centrifugation at 1000 × g for 10 min. The pellet was resuspended in buffer A (10 mM Tris-HCl, pH 7.5, 5.0 mM EDTA, 100 µg/ml phenylmethylsulfonyl fluoride, 4.0 mM EGTA, 1 µg/ml aprotinin, 5 µg/ml E-64, 1 µg/ml leupeptin, and 1 µg/ml pepstatin) containing 1% Triton X-100 and then lysed by passing through a 27-gauge needle 10 times. The lysate was then centrifuged at 10,000 × g for 15 min at 4 °C, the supernatant collected, and the protein concentration determined. Equal amounts of protein from each sample was then subjected to SDS-PAGE.

For preparation of soluble and particulate fractions the cells were homogenized in buffer B consisting of 50 mM Tris-HCl, pH 7.5, 5.0 mM EDTA, 100 µg/ml phenylmethylsulfonyl fluoride, 4.0 mM EGTA, 1 µg/ml aprotinin, 5 µg/ml E-64, 1 µg/ml leupeptin, and 1 µg/ml pepstatin by passing them through a 27-gauge needle 10 times. Soluble and particulate fractions were then separated by ultracentrifugation (100,000 × g for 1 h). The supernatant (soluble fraction) was removed and the pellet resuspended in buffer B with 1% Triton X-100. The Triton X-100-insoluble material was removed by centrifugation at 100,000 × g for 1 h and the supernatant collected (particulate fraction). The distribution of the PKC isozymes in the various fractions was then analyzed by Western blotting.

To better determine the distribution and relocation of PKCepsilon after activation, PCCL3 cells were subfractionated into four parts as follows. The cells were washed and scraped from the plate in ice-cold PBS. The cells were then washed with ice-cold buffer A and collected by centrifugation. The cell pellet was then resuspended in buffer A and the mixture incubated on ice for 10 min, passed through a 27-gauge needle 10 times, and the nuclei pelleted by centrifugation at 1000 × g for 10 min. The supernatant was removed and centrifuged at 100,000 × g at 4 °C for 60 min. The resulting supernatant (fraction F1, cytosol) was collected and the pellet resuspended in buffer A with 1% Triton X-100. The resuspended pellet was centrifuged at 100,000 × g at 4 °C for 60 min and the resulting supernatant collected (fraction F2, particulate extract). The intact nuclei were lysed by resuspending them in buffer A containing 600 mM KCl and centrifuged at 100,000 × g at 4 °C for 60 min and the resulting supernatant collected (fraction F3, nucleoplasm). The pellet was resuspended in buffer A with 1.0% Triton X-100, centrifuged at 100,000 × g at 4 °C for 60 min, and the supernatant collected (fraction F4, Triton-soluble nuclear extract). To remove the KCl from F3, the proteins were precipitated by the addition of trichloroacetic acid to a final concentration of 2%. The precipitated proteins were collected by centrifugation and the pellet resuspended in buffer A. The protein concentration of all fractions was determined using the micro BCA reagent, as directed by manufacturer (Pierce, Rockford, IL).

Western Blot Analysis

The indicated amount of protein from total cell lysates or cellular fractions were subjected to SDS-PAGE and Western blotting as described (25, 26). Blots were hybridized with antibodies to the indicated proteins and then with their corresponding species-specific horseradish peroxidase-conjugated secondary IgG and visualized using the Supersignal CL-HRP system (Pierce) as directed by manufacturer.

Identification of Chimeric Tr-PKCepsilon mRNA using 3' RACE

The 3' RACE reaction was performed as described in Frohman et al. (27), except that the 5' primer was specific for exon 1 of PKCepsilon (TGCCCTCAATGTGGACGACTC). In addition, the second round of PCR amplification was performed under the following conditions: 95 °C for 45 s, 60 °C for 30 s, and 72 °C for 3 min. The PCR products generated were cloned into the pCR-II vector by TA cloning, as directed by the manufacturer (InVitrogen, Carlsbad, CA). Cloned inserts that were confirmed to contain exon 1 of PKCepsilon by Southern blot analysis were sequenced using an ABI 373 automatic sequencer.

Preparation and Screening of the WRO Cell cDNA Library

Poly(A)+ RNA was isolated from the WRO cell line using a PolyATtract mRNA system (Promega, Madison, WI). cDNA was generated from poly(A)+ RNA and then cloned into a lambda  expression vector using a ZAP Express Vector Kit (Stratagene, San Diego, CA). The lambda  cDNA library was then screened as directed by the manufacturer (Stratagene), using a probe labeled by random priming in the presence of [32P]dCTP. The probe used was generated by PCR amplification of a clone obtained by 3' RACE (described above) which contained part of PKCepsilon exon 1 (base 140-364) and a 3' end that did not correspond to either intron 1 or exon 2, and was thought to have resulted from a rearrangement of the PKCepsilon gene. Positive plaques were isolated and the ExAssist helper phage (Stratagene) used to generate a recircularized pBK-CMV phagemid (Stratagene) containing the positive cDNA. DNA isolated from these clones were reconfirmed by Southern blotting to contain exon 1 of PKCepsilon , and then sequenced using an ABI sequencing machine.

Generation of PKCepsilon Expression Constructs

The expression construct containing the Tr-PKCepsilon (amino acids 1-116) was obtained, as described above, from the in vivo excision of a clone isolated from the WRO cDNA library. The expression construct containing the V1 region of PKCepsilon (amino acids 2-142 (16)) was a generous gift from Dr. Robert Messing (University of California, San Francisco) and has been previously described (17).

Generation of Tr-PKCepsilon Stably Transfected Cell Lines

PCCL3 cells were plated (5 × 105 cells/35-mm dish) and grown at 37 °C with 5% CO2. After 24 h the cells were transfected by LipofectAMINE-mediated gene transfer, as directed by the manufacturer (Life Technologies, Inc.). Briefly, 10 µl of LipofectAMINE were incubated with 1.0 µg of plasmid and 200 µl of serum-free medium for 30 min at room temperature. Then 800 µl of serum-free medium was added to the LipofectAMINE-plasmid mixture and the entire solution added to a plate which had been previously washed twice with PBS. Cells were incubated at 37 °C in 5% CO2 for 5-8 h and the transfection mixture replaced with H6 medium. After 24 h the cells were trypsinized and divided into four 100-mm dishes and single clones selected in H6 medium containing 300 µg/ml G418 (Life Technologies, Inc.). The mass-transfected lines were created as above except that after splitting into 100-mm dishes, individual G418 clones were not isolated, but instead, all G418-resistant colonies growing on that dish were pooled. Neomycin-resistant control cell lines were created by transfecting the pBK-CMV vector alone.

PKCepsilon Immunofluorescence

Cells were plated into each of the four wells of a 4-well chamber-slide and incubated with H6 medium. When the cells became confluent, the medium was replaced by H6 medium with or without 100 nM PMA, and the cells incubated for 20 min at 37 °C with 5% CO2. Cells were washed 3 times with ice-cold PBS and fixed by incubating the slides in 50:50 methanol/acetone at -20 °C for 4 min. Nonspecific interaction was blocked by a 30-min incubation in PBS containing 2 mg/ml bovine serum albumin, 10% goat serum, and 0.1% Triton X-100. Cells were then incubated in PBS containing 2 mg/ml bovine serum albumin, 5% goat serum, and polyclonal anti-PKCepsilon IgG (Santa Cruz Biotechnology) for 16 h at 4 °C. The cells were washed with 3 sequential 5-min incubations in PBS containing 2 mg/ml bovine serum albumin, followed by a 2-h incubation at room temperature in PBS containing 2 mg/ml bovine serum albumin, 5% goat serum, and fluorescein isothiocyanate-conjugated goat anti-rabbit IgG (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA). The slides were washed again 3 times and then mounted in Vectorshield (Vector Laboratories Inc., Burlingame, CA). They were viewed under a Zeiss Axiophot microscope. The images were captured onto Kodak 6400 ASA film using an MC100 camera.

PKCepsilon Kinase Assay

Cells were washed and then scraped from the plate in ice-cold PBS, and collected by centrifugation at 1000 × g for 10 min. The cell pellet was resuspended in extraction buffer (20 mM Tris-HCl, pH 7.5, 0.5% Nonidet P-40, 250 mM NaCl, 3 mM EDTA, 1 mM EGTA, 1 mM dithiothreitol, 2 mM Na3VO4, 25 µg/ml aprotinin, 25 µg/ml leupeptin, 100 µg/ml phenylmethylsulfonyl fluoride) and passed through a 27-gauge needle 10 times, and then centrifuged for 15 min at 10,000 × g at 4 °C. The supernatant was collected and the protein concentration determined. Extracts were diluted into extraction buffer (final protein concentration 1 µg/µl) and added to 3 µg of rabbit anti-PKCepsilon IgG (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) which had been preincubated with protein G-agarose overnight at 4 °C. This mixture was then incubated for 4 h at 4 °C. The beads were then washed 3 times with PBS containing 0.1% Triton X-100 and then 3 times with kinase buffer (20 mM HEPES, pH 7.2, 137 mM NaCl, 5.4 mM NaH2PO4, 0.4 mM KH2PO4, 25 mM beta -glycerophosphate, 10 mM MgCl2, 0.5 mM EGTA, and 0.25 mM CaCl2). Beads were resuspended in kinase buffer containing 0.013 µCi/µl [gamma -32P]ATP, 50 µM ATP, 125 ng/µl PKA inhibitor, and 0.4 mg/ml myelin basic protein and incubated at room temperature for 30 min. The reaction was stopped by adding SDS-PAGE loading buffer and then incubating at 95 °C for 5 min. The reaction was then size separated by 15% SDS-PAGE, transferred to a nylon membrane, and phosphorylation of the myelin basic protein quantitated by PhosphorImager analysis. Background was determined by substituting normal rabbit IgG for the rabbit anti-PKCepsilon IgG.

Growth Curves

The plating efficiency (ratio of cells attached to cells plated) of each clone was determined by plating a known number of cells in H6 medium. The plate was incubated for 24 h at 37 °C in 5% CO2 at which time the cells were detached by trypsinization and counted with a Z1 Coulter counter. Plating of each clone for growth curves was done in triplicate, after accounting for differences in plating efficiency, to obtain 50,000 cells per well of a 6-well plate after 24 h. The cells were grown in H6 medium with or without TSH at 37 °C in 5% CO2. At the indicated times the cells were detached by trypsinization and counted using a Z1 Coulter counter.

Assays for Apoptosis

Cells grown in H6 medium were allowed to reach 95% confluency and then the medium replaced with fresh H6 medium containing the indicated amounts of actinomycin D or doxorubicin or alternatively cells were irradiated with the indicated dose of UV. Apoptosis was measured with the following methodologies.

DNA Fragmentation-- Cells were incubated for the indicated times and the attached cells were collected by trypsinization then combined with the detached cells suspended in the medium. DNA was then extracted and 20 µg from each sample was electrophoresed through a 2% agarose-TBE gel and the DNA visualized by staining with ethidium bromide.

Cell Detachment-- The cells were plated and grown as above. At the indicated times the number of cells in the medium was determined using a Z1 Coulter counter. More then 95% of detached cells examined by light microscopy after Diff-Quik staining or fluorescent microscopy after propidium iodide staining were found to have condensed and fragmented nuclei, consistent with death via apoptosis.

TUNEL Analysis-- We also confirmed that cell death was via apoptosis by TUNEL analysis using the Apotag In Situ Apoptosis kit, as directed by the manufacturer (Oncor Inc., Gaithersburg, MD).

MTT Assay-- To determine cell viability an MTT assay was performed as directed by the manufacturer (Sigma). Briefly, H6 medium was removed from cells and replaced with H6 medium containing 0.5 mg/ml 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich, St. Louis, MO) and incubated for 2 h at 37 °C. The medium was removed and the colored precipitate formed by cleavage of MTT in living cells was solubilized with isopropyl alcohol containing 0.05 M HCl. Cell survival was determined by absorbance at 570 nm. Background was determined by absorbance at 660 nm.

Nude Mouse and Soft Agar Assays

Athymic nude/nude mice were purchased from Harlan Sprague-Dawley, Indianapolis, IN. For each cell line tested 1 × 106 cells in 200 µl of sterile PBS were injected into the right flank of 4 nude/nude mice. The animals were followed for 8 weeks with weekly inspection for nodules. To assay for anchorage-independent growth soft agar colony formation assays were performed by suspending 2 × 103 cells in 1.0 ml of 0.5% Bacto-agar (Difco Laboratories, Detroit, MI) in H6 medium, and overlaying the suspension in triplicate onto a layer of 2 ml of 0.6% Bacto-agar in H6 medium in each well of a 6-well plate. The cells were refed every 5th day by overlaying 1 ml of 0.5% Bacto-agar in H6 medium. After 20 days the colonies with more than 50 cells were counted.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Identification of a Chimeric PKCepsilon in the WRO Cell Line-- We have previously reported mapping of the PKCepsilon gene to the 2p21 locus (15), a region found by comparative genomic hybridization to be amplified in 28% of thyroid neoplasms studied. The amplification was mapped to a series of BAC/PAC clones derived from a chromosome 2-specific library (15). One of these, BAC 1D9, was demonstrated by FISH analysis to be amplified 40-70 times in the WRO cell line (Fig. 1), a thyroid cancer cell line that contains double minute chromosomes. Sequencing of the entire BAC 1D9 demonstrated that it contained the first coding exon of the PKCepsilon gene. Hybridization of the full-length human PKCepsilon cDNA to Southern blots containing DNA from the WRO cell line, the anaplastic thyroid carcinoma cell line ARO, and normal tissue demonstrated that the PKCepsilon gene has undergone rearrangement and amplification in the WRO cells, since there were additional bands found in the WRO cell line that were not found present in normal tissue or in ARO cells (Fig. 2). Furthermore, it is clear that only part of the PKCepsilon gene is amplified in the WRO cells, as not all hybridizing bands were over-represented (Fig. 2). To map the location of the amplification and rearrangement, PCR products specific to different regions of the PKCepsilon cDNA were generated and hybridized to Southern blots. This demonstrated that the 5' break point of the internal deletion was between bases 366 and 599 of PKCepsilon cDNA (data not shown), whereas hybridization with probes mapping to bases 1136-2244 showed that all were amplified, indicating that at least part of the 3' end of the gene was within the amplicon. These Southern blot data suggest that the changes in the PKCepsilon gene are a result of an internal deletion followed by an amplification of the rearranged gene.


View larger version (60K):
[in this window]
[in a new window]
 
Fig. 1.   FISH of WRO chromosomes to BAC probes mapping to chromosome 2p21. Top, BAC2B5 detects a single signal on each chromosome 2 (WRO cells are trisomic for this chromosome) in the metaphase shown. Three signals are also detected in the interphase nucleus. Bottom, BAC 1D9 shows a distinct pattern of amplification. In addition to the fluorescein isothiocyanate signals (green spots) detected on the three chromosome 2p21 loci, clusters of signals are detected on the multiple double minute chromosomes. Adjacent interphase nucleus also reveal multiple signals.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 2.   Southern and Northern blots of WRO cells. A, Southern blot containing 10 µg of DNA from ARO and WRO cells and normal tissue, digested with EcoRI or BamHI. The blots were hybridized with the full-length PKCepsilon cDNA. Only some DNA bands from WRO cells are amplified. Top arrow points to a BamHI band present at normal dosage. Middle arrow points to an amplified band of normal size. Lower arrow indicates an aberrantly sized amplified fragment, consistent with amplification of a rearranged PKCepsilon gene in the WRO cell line. B, Northern blot containing 20 µg of total RNA from normal thyroid tissue, NPA cells, and WRO cells. Top, blot hybridized with the full-length PKCepsilon cDNA. The upper arrow (~7.2 kb) indicates the position of the full-length PKCepsilon mRNA and the lower arrow (~2.2 kb) indicates position of the Tr-PKCepsilon mRNA. Bottom, ethidium bromide staining of the gel.

To ascertain what effects the amplification and rearrangement of the PKCepsilon gene has on its expression, Northern blots containing 20 µg of RNA from two clonal thyroid cancer cell lines and normal thyroid tissue were probed with the 2.2-kb PKCepsilon cDNA (Fig. 2). Expression of the full-length PKCepsilon mRNA was slightly lower in WRO, than in normal thyroid tissue. In addition, there was a PKCepsilon hybridizing mRNA of approximately 2.2 kb in the WRO cell line, suggesting this cell line has an abnormal PKCepsilon transcript. The identity of this mRNA was determined by sequencing products generated by 3' RACE, and found to be a chimeric and truncated PKCepsilon (Tr-PKCepsilon ) species that contained exon 1 of PKCepsilon fused to an unrelated sequence.

To obtain the Tr-PKCepsilon cDNA in its entirety, a WRO cDNA library was constructed and screened with the DNA product generated by 3' RACE. Probing duplicate membranes from 5 plates, containing 30,000 plaques each, we identified more than 40 plaques that were positive in both membranes. The positive plaques were isolated and the corresponding pBK-CMV phagemids containing the Tr-PKCepsilon cDNAs were generated by in vivo excision. Sequencing of 6 unique phagemids established that all the cDNAs contained exon 1 of PKCepsilon spliced to 1 of 2 sequence fragments unrelated to PKCepsilon . The non-PKCepsilon sequences extended the PKCepsilon reading frame by either 23 (found in 2/6 clones) or 2 amino acids (found in 4/6 clones) (Fig. 3A). The latter clone was chosen for all further studies since it was the most common. A search of GenBank, EST, and EMBL data bases revealed no significant homology of the non-PKCepsilon sequences. Furthermore, these sequences were not part of the large >55-kb intron 1 sequenced from BAC 1D9. The conservation of exon 1 of PKCepsilon (amino acids 1-116) between the different Tr-PKCepsilon mRNAs suggests that this is likely to be the biologically relevant part of the message. This is further supported by the observation that a N-terminal fragment of PKCepsilon (amino acids 2-142), corresponding to the V1 region of the protein (Fig. 3B), as well as a peptide derived from this fragment (amino acids 14-21), are capable of impairing PKCepsilon function in PC12 cells (17) and cardiac myocytes (16, 28) by selectively inhibiting activation-induced translocation of PKCepsilon .


View larger version (83K):
[in this window]
[in a new window]
 
Fig. 3.   Sequence and structure of a Tr-PKCepsilon cloned from a WRO cell cDNA library. A, the highlighted sequence is complimentary to the first coding exon of the PKCepsilon gene (as inferred from the intron-exon boundary determined by sequencing genomic DNA from BAC 1D9). The additional sequence is unrelated and extends the open reading frame by 2 amino acids. **, indicates alternative fusion sequence which extends the reading frame by 23 amino acids. B, functional domains of the Wt-PKCepsilon protein. The bar shown below represents the region of Wt-PKCepsilon gene found in the Tr-PKCepsilon . The V and C domains represent regions that are variable or conserved, respectively, between the different PKC isozymes. The V1 region contains the site involved in the interaction of PKCepsilon with its intracellular docking protein, beta '-COP. The V3 region contains the hinge domain and protease cleavage sites, both of which are thought to be important in regulating PKCepsilon function. To date no specific function has been assigned to regions V4 and V5. The C1 region contains the pseudosubstrate site and the phorbol ester and actin-binding sites. Region C3 contains the ATP-binding site and C4 contains the domain involved in phosphate transfer.

To test whether the Tr-PKCepsilon has similar properties in WRO cells, Western blots containing the soluble and particulate fraction from three different clonal thyroid cancer cell lines (ARO, NPA, and WRO) and normal thyroid tissue were probed with an anti-PKCepsilon IgG. Whereas in normal thyroid tissue and the thyroid cancer cell lines ARO and NPA the majority of PKCepsilon is found in the particulate fraction (52.4, 74.3, and 67.3%, respectively), in WRO cells only 22.3% was found in this compartment (Fig. 4). In addition, the total level of PKCepsilon in the WRO cell line was 64% less than that in the other two cell lines. These observations are consistent with a role of the Tr-PKCepsilon in preventing translocation after activation (16, 17, 28). Of note, the antibody used in the Western blots was generated against amino acids 722-726 of the isozyme, and was therefore not expected to recognize the Tr-PKCepsilon or the V1 fragment (amino acids 2-142) of PKCepsilon . In addition, none of the other commercially available antibodies have been demonstrated to recognize the V1 fragment.


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 4.   Western blot of PKCepsilon in human thyroid carcinoma cell lines. Thirty µg of protein from either the soluble (S) or particulate (P) fractions of the indicated cell lines or normal thyroid tissue were electrophoresed in a 7.5% SDS-PAGE and transferred to a nitrocellulose membrane. The blot shown is representative of two separate experiments. PKCepsilon was detected using a rabbit polyclonal anti-PKCepsilon IgG (Santa Cruz) and an horseradish peroxidase-conjugated goat anti-rabbit IgG. The arrow shows the position of the wild-type PKCepsilon (~90 kDa).

Production of PCCL3 Cell Lines Overexpressing Tr-PKCepsilon and the V1 Region of PKCepsilon -- To investigate the function of the Tr-PKCepsilon , the pBK-CMV vector containing Tr-PKCepsilon was stably transfected into PCCL3 cells, a well differentiated rat clonal thyroid cell line that is TSH-dependent for growth, iodide uptake, and expression of thyroglobulin and thyroid peroxidase. Twenty neomycin-resistant clones from Tr-PKCepsilon transfections were isolated and screened for expression of the transfected product, resulting in 6 clones that expressed Tr-PKCepsilon mRNA. PCCL3 cell lines were also mass transfected with a pRc-RSV expression vector containing the V1 fragment of the isozyme (amino acids 2-142), known to inhibit the translocation and function of PKCepsilon in rat cardiac myocytes (16), rat islet cells (18), and PC12 cells (17). Northern blots of the transfected cell lines probed with the various cDNAs demonstrated a 4-6-fold overexpression of the specific PKCepsilon product compared with endogenous PKCepsilon (Fig. 5A). Since no antibody to the V1 region of PKCepsilon was available we also produced an HA-tagged Tr-PKCepsilon cDNA construct and stably transfected it into PCCL3 to demonstrate appropriate expression of the Tr-PKCepsilon protein (Fig. 5B).


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 5.   Expression of Tr-PKCepsilon in PCCL3 cells and impact on PMA-induced PKC translocation. A, Northern blots of 20 µg of total RNA from the indicated cell lines, probed with full-length PKCepsilon cDNA. B, Western blot of PCCL3 cells stably transfected with pPK-RSV or pPK-RSV containing the HA-tagged Tr-PKCepsilon . C, effects of Tr-PKCepsilon expression on PMA-induced translocation of wild-type PKCepsilon . Western blots of Neo-transfected or Tr-PKCepsilon -transfected cells treated with or without 100 nM PMA for 20 min. Tr-PKCepsilon -12 and -14 are clonal lines documented to stably express the mutant isozyme. Cells were harvested, and subjected to a 4-part fractionation. The level of PKCepsilon in each fraction was determined by probing Western blots containing 30 µg of protein from each of the 4 fractions with rabbit polyclonal anti-PKCepsilon IgG. D, the intensity of the PKCepsilon band in each fraction was determined by densitometry and used to calculate the percent change in band intensity of PMA-treated versus untreated cells. The bars represent mean ± S.E. of three independent experiments. *, p < 0.05 versus PC-Neo; **, p < 0.009 versus PC-Neo.

Effect of Tr-PKCepsilon on PMA-induced Relocation of Endogenous PKCepsilon -- To explore relocation of PKCepsilon in PCCL3 cells, lysates were fractionated into four parts: F1, enriched for cytosol; F2, plasma membrane and organelles; F3, nucleoplasm; and F4, nuclear membrane. Endogenous PKCepsilon in untreated, Neo-transfected cells is found mainly in F1 and F3 (Fig. 5, C and D). After treatment with PMA, the PKCepsilon protein is no longer found in F1 and F3, and increases in the membrane-containing fractions F2 and F4. In PKCepsilon -expressing cells PKCepsilon is also almost fully displaced from F1 and F3 after PMA. However, there is no increase in F2 or F4 (Fig. 5, C and D). The presence of PKCepsilon in fractions F2 and F4 in the Tr-PKCepsilon cells under basal conditions may be the result of nonspecific or secondary anchoring sites that are unaffected by the Tr-PKCepsilon , as suggested by Mayne and Murray (29), since they are not altered by treatment with PMA. It is possible that the mistranslocated PKCepsilon is degraded, since we have found that activated PKCs are less stable if their translocation is inhibited (28).2 To explore this possibility, total cell lysates were prepared from cells treated for 0-6 h with PMA. Western blots demonstrated similar levels of PKCepsilon in both controls and Tr-PKCepsilon -expressing cells during the first hour after PMA treatment (data not shown). These results indicate that the lack of appearance of PKCepsilon in F2 and F4 was not due to degradation in vivo, since the fractionation experiment was performed in cells treated with PMA for only 20 min. The most likely explanation is that blocking interaction of PKCepsilon with its RACK renders it more sensitive to nonspecific proteolysis during fractionation. Overexpression of PKCepsilon -V1 resulted in similar effects (not shown). Of note, the PMA-induced translocation of PKCalpha and beta I, and basal levels of PKCzeta were unaffected in the Tr-PKCepsilon expressing cells (not shown). PCCL3 cells had no detectable PKCbeta II, delta , gamma , or eta . The above results are consistent with a model by which Tr-PKCepsilon inhibits interaction of activated wild-type PKCepsilon with its RACK. In support of this conclusion, immunofluorescent staining of PCCL3 cells with anti-PKCepsilon antibody demonstrated immunoreactivity distributed throughout the cytosol under basal conditions. Upon activation with PMA, PKCepsilon localized to the plasma membrane as well as to perinuclear Golgi-like structures. However, in cell lines expressing the Tr-PKCepsilon , PKCepsilon did not localize to either the plasma membrane or the Golgi after PMA treatment (Fig. 6).


View larger version (90K):
[in this window]
[in a new window]
 
Fig. 6.   Localization of PKCepsilon by immunofluorescence in native PCCL3 and Tr-PKCepsilon -14 cells. PKCepsilon localization was detected after incubation with a rabbit polyclonal anti-PKCepsilon IgG and an fluorescein isothiocyanate-conjugated goat anti-rabbit IgG. A, untreated PCCL3 cells. B, PCCL3 cells treated with 100 nM PMA for 20 min. C, untreated Tr-PKCepsilon cells. D, Tr-PKCepsilon cells treated with 100 nM PMA for 20 min. The images shown (× 40 magnification) are representative of three independent experiments.

To determine the impact of translocation inhibition on the enzymatic function of PKCepsilon , we measured the ability of immunoprecipitated PKCepsilon to phosphorylate myelin basic protein in vitro. There was a 3-fold increase in myolin basic protein phosphorylation in both control cells and cells expressing the Tr-PKCepsilon after activation with PMA (data not shown). This indicates that, as expected (6, 17), the Tr-PKCepsilon does not modify PKCepsilon kinase activity, but likely interferes with the function of its wild-type counterpart by displacing it to an inappropriate cell compartment after activation.

Effects of Overexpressing Tr-PKCepsilon on Growth Rate and Saturation Density of PCCL3 Cells-- Removal of TSH for 8 days resulted in a complete inhibition of growth in Neo-transfected cells, as well as those expressing Tr-PKCepsilon or V1-PKCepsilon , indicating that expression of the PKCepsilon fragments did not confer cells with TSH-independent growth. In the presence of TSH, Neo-transfected, Tr-PKCepsilon , and V1-PKCepsilon expressing cells had similar initial doubling times (22.9, 23.0, and 24.4 h, respectively) (Fig. 7). However, Tr-PKCepsilon and V1-PKCepsilon expressing cells grew to a higher saturation density than the Neo-transfected controls (Fig. 7).


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 7.   Growth curve of Neo-transfected PCCL3 and the indicated V1-PKCepsilon or Tr-PKCepsilon -overexpressing cell lines. Data illustrate results of one experiment performed in triplicate, which was similar to those obtained in a second experiment. Open and closed symbols represent cell counts with or without 10 mIU/ml of TSH, respectively. Neo-transfected, Tr-PKCepsilon , and V1-PKCepsilon -transfected cells are indicated by diamonds, circles, and squares, respectively.

Formation of Tumors in Nude Mice and Colonies in Soft Agar-- To determine whether the Tr-PKCepsilon products have transforming properties on PCCL3 cells, Tr-PKCepsilon , or V1-PKCepsilon -expressing cell lines were tested for colony formation in soft agar, and for ability to form subcutaneous tumors in athymic mice. Whereas the human thyroid carcinoma cell lines ARO, FRO, and WRO formed colonies in soft agar, neither PCCL3-Neo, Tr-PKCepsilon -14, Tr-PKCepsilon -12, nor V1-PKCepsilon -expressing cells scored in the assay (not shown). Similarly, all mice injected with the human thyroid cancer cell lines developed tumors within 6 weeks (4/4 each), whereas the Neo control and Tr-PKCepsilon expressing cells did not.

Effects of overexpression of Tr-PKCepsilon on Apoptosis-- Inhibition of macromolecular synthesis results in apoptosis in a variety of cell types (30), including the thyroid (31). To confirm that actinomycin D, an RNA synthesis inhibitor, was also able to induce apoptosis in the PCCL3 cells, they were incubated with various concentrations of actinomycin D for 24 h and the cells harvested. The DNA from the collected cells exhibited a dose-dependent increase in nucleosomal fragmentation, indicative of apoptosis (Fig. 8A). Furthermore, greater than 95% of the detached cells exhibited nuclear condensation or nuclear fragmentation as determined by Diffico blue staining or propidium iodide staining, respectively, confirming that cell detachment could be used as a quantitative indicator of apoptosis under these conditions. The above observations demonstrated that the incubation of PCCL3 cells with actinomycin D induces cell death via an apoptotic pathway.


View larger version (45K):
[in this window]
[in a new window]
 
Fig. 8.   Induction of apoptosis by actinomycin D. A, PCCL3 cells grown in H6 medium were treated with the indicated concentration of actinomycin D for 24 h. At that time all attached and detached cells were combined and the DNA isolated. Twenty µg of DNA was then electrophoresed through a 2% agarose/TBE gel and the DNA detected by ethidium bromide staining. The 1-kb ladder (far right lane) indicates DNA laddering units of 180-200 base pairs, consistent with the nucleosomal fragmentation seen in apoptosis. B, the indicated cells were incubated with 1.0 µg/ml actinomycin D and the number of detached cells were determined by counting cells in the medium. The data shown is an average of a single experiment performed in triplicate and is similar to that obtained in two additional experiments. C, cells from the indicated lines were incubated with 1.0 µg/µl actinomycin D for 16 h, fixed with paraformaldehyde, and the extent of apoptosis determined by TUNEL analysis. The bars represent mean ± S.E. of an experiment performed in triplicate. *, p < 0.0006 versus PC-Neo. D, 20 µg of DNA isolated from cells incubated in H6 medium containing 1.0 µg/ml actinomycin D for the indicated times (h) was electrophoresed through a 2% agarose/TBE gel. The DNA was detected by staining with ethidium bromide. The data illustrated is representative of two separate experiments.

To characterize the effects of overexpressing Tr-PKCepsilon and V1-PKCepsilon on apoptosis, the different cell lines were incubated with actinomycin D and the number of detached cells determined. Greater than 90% of the untransfected and Neo-transfected cells detached from the dish after 16 h of incubation with actinomycin D (Fig. 8B). In contrast, there was less than 20% detachment in cell lines overexpressing Tr-PKCepsilon or V1-PKCepsilon . The resistance of the cells expressing the Tr-PKCepsilon or V1-PKCepsilon to apoptosis was confirmed by TUNEL analysis (Fig. 8C) and DNA fragmentation (Fig. 8D). The protective effects of Tr-PKCepsilon and V1-PKCepsilon were also apparent when apoptosis was triggered through alternative mechanisms, such as exposure to UV irradiation or to doxorubicin (Fig. 9).


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 9.   Induction of apoptosis by doxorubicin and UV irradiation. A, survival of the indicated cell lines treated with 0.5-2.0 µM doxorubicin at 37 °C for 48 h. The bars represent mean ± S.E. of two experiments performed in duplicate. *, p < 0.0004 versus PC-Neo. B, survival of the indicated cell lines irradiated with 40-200 J/m2 and then incubated at 37 °C for 24 h. The bars represent mean ± S.E. of two experiments performed in duplicate. *, p < 0.005 versus PC-Neo. Cell survival was determined using an MTT assay. Bars represent the mean from three independent experiments.

Effects of Overexpression of Tr-PKCepsilon on p53-- Doxorubicin has been reported to induce apoptosis via a p53-mediated mechanism (32). Indeed, doxorubicin increased p53 levels within 6 h in Neo-transfected PCCL3 cells, with maximal induction at 12 h (Fig. 10, A and B). By contrast there was only a slight increase in p53 after addition of doxorubicin in cell lines expressing the Tr-PKCepsilon , suggesting that the mutant isozyme may inhibit DNA damage-induced activation of p53. As predicted, p53 mRNA was unchanged 6 h after addition of doxorubicin, and actually declined at 12 and 18 h (data not shown), demonstrating that the increase in p53 protein was a result of post-translational changes, most likely stabilization. MDM2, a nuclear protein induced by p53, binds to the p53 trans-activation domain and promotes its proteasome-mediated degradation (33, 34). After exposure to doxorubicin, MDM2 levels increased transiently in PCCL3-Neo cells, but did so more robustly and persistently in cell lines expressing Tr-PKCepsilon (Fig. 10A). p53 has been reported to lead to apoptosis in part by its ability to transactivate expression of Bax (35, 36). In accordance with these reports, doxorubicin increased Bax protein levels in Neo-transfected PCCL3 cells, an effect that was markedly inhibited by expression of Tr-PKCepsilon (Fig. 10, A and C). Finally, whereas doxorubicin decreased abundance of the anti-apoptotic factor Bcl-2 in both Neo- and Tr-PKCepsilon -expressing cells, absolute levels of Bcl-2 were 2-5-fold higher in cells expressing the Tr-PKCepsilon at all time points (Fig. 11). Of note, levels of Bcl-XL, Bcl-XS, or Bad were not affected by expression of the Tr-PKCepsilon or treatment with doxorubicin (data not shown).


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 10.   Effects of Tr-PKCepsilon on induction of p53, Bax, and MDM2 after treatment with doxorubicin. A, representative Western blot of Neo- or Tr-PKCepsilon -transfected cells treated with 1.5 µM doxorubicin for the indicated time, probed with an anti-p53, anti-Bax, or anti-MDM2. B, the intensity of the p53 band at each time point was determined by densitometry. Data represent the relative change in band intensity of doxorubicin-treated versus untreated cells. The bars represent mean ± S.E. of three separate experiments. *, p < 0.05 versus PC-Neo. C, the intensity of the bax band at each time point was determined by densitometry. Data represent the relative change in band intensity of doxorubicin-treated versus untreated cells. The bars represent mean ± S.E. of three separate experiments. *, p < 0.05 versus PC-Neo.


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 11.   Effect of Tr-PKCepsilon on expression of Bcl-2. A, Western blot of Neo- or Tr-PKCepsilon -transfected cells treated with 1.5 µM doxorubicin for the indicated time, probed with an anti-Bcl-2 IgG. B, the intensity of the Bcl-2 band at each time point was determined by densitometry. Data represent the relative change in band intensity of doxorubicin-treated versus untreated cells. The bars represent mean ± S.E. of three separate experiments. *, p < 0.05 versus PC-Neo.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Whereas activation of PKCs is important in regulating cell proliferation, differentiation, and apoptosis of most cell types, the contribution of individual PKC isozymes in these processes is not well understood. Our interest in the function of PKCepsilon in thyroid cells resulted from our characterization of a rearrangement and amplification of the PKCepsilon gene in WRO thyroid carcinoma cells (15). This complex mutation was identified by positional cloning of a defect initially detected by comparative genomic hybridization, and as such, is to our knowledge the first previously unmapped candidate tumor-promoting gene uncovered with this methodology. The WRO cell line lacked identifiers, and it was not possible to determine whether the PKCepsilon rearrangement was also present in the original tumor. Moreover, further manipulation of PKCepsilon in this cell line is unlikely to be informative, since it has a number of other genetic defects including inactivating mutations of p53 and p16 (37, 38). The 2p21 amplicon gave rise to double minute chromosomes. The double minute chromosomes containing the rearranged PKCepsilon gene have persisted through serial passaging for several years, despite the fact that double minute chromosomes are known to be unstable structures, suggesting that their presence conferred WRO cells with a selective advantage. As a result of this chromosomal abnormality, WRO cells display high level expression of a chimeric gene product, consisting of the first coding exon of the PKCepsilon gene fused to one of two unrelated fragments, the most common of which codes for a 2 amino acid C-terminal tail. Exon 1 of PKCepsilon codes for part of the V1 region of the protein, that contains the domain involved in the interaction of the activated isozyme with its intracellular docking protein(s) (16, 17, 28), one of which was recently identified as beta '-COP (39).

A powerful approach to determine the role of individual PKC isozymes is to specifically inhibit their function by preventing translocation and binding to their respective anchoring proteins (i.e. their isozyme-specific RACK) using peptides or protein fragments containing the domain involved in the interaction. This strategy has been used successfully to dissect the specific function of the classical PKC isozymes alpha  and beta  (18, 40, 41), PKCepsilon (16-18, 28, 29), and PKCdelta (17) in different cell types. As there are no antibodies available that recognize the V1 region of PKCepsilon , we could not directly verify the in vivo location of the Tr-PKCepsilon . However, transfection of PCCL3 cells with an HA-tagged Tr-PKCepsilon resulted in expression of a protein that was distributed throughout the cell, perhaps due to saturation of the anchoring protein. The following observations strongly suggest that Tr-PKCepsilon interacts with a PKCepsilon -specific RACK and antagonizes binding of activated wild-type PKCepsilon . 1) The Tr-PKCepsilon protein contains the domain demonstrated to be important in the binding of PKCepsilon with beta '-COP, a protein demonstrated to act as a PKCepsilon -specific RACK in cardiomyocytes (16, 39). 2) Unlike other thyroid cells, where greater than 50% of the isozyme is in the particulate fraction, the majority of wild-type PKCepsilon is found in the soluble fraction in WRO cells (i.e. not bound to its RACK). 3) Transfection of PCCL3 rat thyroid cells with a Tr-PKCepsilon -expression vector (containing amino acids 1-116 of the wild-type isozyme) inhibits the PMA-induced translocation of PKCepsilon to membrane fractions that contain the activated protein. Similar results were obtained in PCCL3 cells overexpressing the V1 fragment of PKCepsilon (amino acids 2-142). 4) Translocation of wild-type PKCepsilon to Golgi-like structures and plasma membrane after PMA treatment is not seen in cell lines expressing the Tr-PKCepsilon , or the V1 region of PKCepsilon . 5) Expression of Tr-PKCepsilon had selective effects on the homologous wild-type enzyme, and did not affect the abundance or subcellular distribution of other PKC isozymes, consistent with experiments in PC12 cells (17) and cardiac myocytes (28) after overexpression of the V1 fragment of PKCepsilon , or introduction of the V1 fragment by transient permeabilization (16).

Although we favor the interpretation that Tr-PKCepsilon functions as a competitive antagonist of the activation-induced binding of the wild-type protein to its intracellular anchoring protein, we cannot exclude the possibility that it may also have other independent effects. For example, inhibiting the interaction of PKCepsilon with its RACK, which has been demonstrated to bind the majority of the activated enzyme (13), may promote the association of PKCepsilon with other proteins such as Raf (42), 14-3-3 proteins (43), caveolin (44), AKAP79 (8, 9), or actin (45, 46). Given that the kinase activity of PKCepsilon is still intact in cells expressing the Tr-PKCepsilon , and that PKCs have a relatively relaxed substrate specificity, it is possible that the displaced PKCepsilon may aberrantly phosphorylate alternative substrates, and thus disrupt their function. Whether the phenotype of cells containing Tr-PKCepsilon is a result of a disruption in binding to RACK, or secondary effects on alternative substrates by the displaced kinase remains to be determined.

Cell lines expressing the V1-PKCepsilon or Tr-PKCepsilon grew to a higher saturation density, implying that wild-type PKCepsilon may play a role in contact inhibition, or as a negative regulator of thyroid cell growth. Although this observation contrasts with published data that PKC activation stimulates thyroid cell growth (47, 48), the results are not mutually exclusive, since previous investigators used PKC activators and inhibitors that are not specific to an individual PKC isozyme. Thus, it is possible that their observations result from the activation or inhibition of PKC isozyme(s) other than PKCepsilon , and that the outcome of activation of the latter was not apparent in the context of a more comprehensive stimulation of the whole PKC signaling repertoire.

Many reports have suggested a role for individual PKC isozymes in cell transformation (reviewed in Ref. 49). PKCs can exert both positive and negative effects on cell growth, depending on the isozyme and the cell type involved. Of all PKC isozymes, PKCepsilon has proven to be the most consistently transforming when transfected into murine fibroblasts (50, 51). When overexpressed in rat 6 cells, PKCepsilon evoked malignant transformation in the absence of treatment with phorbol esters. In the presence of 12-O-tetradecanoylphorbol-13-acetate, PKCepsilon -transfected cells exhibited a rearranged actin cytoskeleton and were growth inhibited, probably due in part to interference of the overexpressed isozyme with the translocation and activation of other PKC isozymes. Overexpression of PKCepsilon also results in transformation of colonic epithelial (52), but not rat hepatoma cells (53).

The most significant phenotypic change introduced by expression of Tr-PKCepsilon or V1-PKCepsilon was protection from apoptosis. Disruptions in cellular control of programmed cell death are now recognized as common events in tumorigenesis (54, 55), by creating a permissive environment for the accumulation of genetic damage. There is relatively scant information on the physiological signals that trigger apoptosis in thyroid cells. Growth factor or TSH deprivation and protein synthesis inhibitors can trigger apoptosis in thyrocytes (31). The role of interleukin-1beta and Fas is more controversial (56, 57). Downstream of these initiating events are a variety of intermediates that either positively or negatively regulate apoptosis. The particular pathways used vary according to the cell type and the triggering event, and include, but are not limited to, signaling through the PKC and PKA families, hydrolysis of sphingomyelin, and activation of mitogen-activated protein kinase (for review, see Refs. 30, 58, and 59). We opted to explore the role of apoptosis by exposing cells to adverse conditions or well recognized DNA damaging agents: i.e. actinomycin D, UV irradiation, and doxorubicin. The protective effects of Tr-PKCepsilon and V1-PKCepsilon in response to these various treatments were consistent and of significant magnitude. Broad based PKC activation has been reported to have diverse effects on programmed cell death, including both anti-apoptotic and pro-apoptotic effects (for review see, Refs. 1 and 60). Recent studies using strategies to explore the role of individual isozymes suggests that activation of PKCepsilon may have a pro-apoptotic (61) or an anti-apoptotic (62) effect which is presumably dependent on cell type or apoptosis inducing agent. For example, down-regulation of PKCepsilon and alpha  by chronic exposure to a phorbol ester in human prostatic carcinoma cells was associated with resistance to VP-16- or melphalan-induced apoptosis. These effects were not abrogated in the presence of the PKC antagonist UCN-01 at concentrations that inhibited PKCalpha , but not PKCepsilon , indirectly implicating the latter in the control of p