| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 274, Issue 34, 24023-24030, August 20, 1999
From the In humans, mutations in SOX9 result
in a skeletal malformation syndrome, campomelic dysplasia (CD). The
present study investigated two major classes of CD mutations: 1) point
mutations in the high mobility group (HMG) domain and 2) truncations
and frameshifts that alter the C terminus of the protein. We analyzed
the effect of one novel mutation and three other point mutations in the
HMG domain of SOX9 on the DNA binding and DNA bending properties of the
protein. The F12L mutant HMG domain shows negligible DNA binding, the
H65Y mutant shows minimal DNA binding, whereas the A19V mutant shows
near wild type DNA binding and bends DNA normally. Interestingly, the
P70R mutant has altered DNA binding specificity, but also bends DNA
normally. The effects of the point mutations were interpreted using a
molecular model of the SOX9 HMG domain. We analyzed the effects upon
transcription of mutations resembling the truncation and frameshift
mutations in CD patients, and found that progressive deletion of the C
terminus causes progressive loss of transactivation. Maximal
transactivation by SOX9 requires both the C-terminal domain rich in
proline, glutamine, and serine and the adjacent domain composed
entirely of proline, glutamine, and alanine. Thus, CD arises by
mutations that interfere with DNA binding by SOX9 or truncate the
C-terminal transactivation domain and thereby impede the ability of
SOX9 to activate target genes during organ development.
In humans, mutations in SOX9 cause campomelic dysplasia
(CD),1 a skeletal
malformation syndrome that is often associated with XY sex reversal
(1). Other tissues affected include kidney, heart, and brain,
consistent with the expression pattern of Sox9 in developing mouse (2,
3). There are four major classes of mutations causing CD: 1) amino acid
substitutions in the HMG domain (Fig. 1A), 2) truncations or
frameshifts that alter the C terminus of SOX9 (Fig.
1B), 3) mutations at splice
junctions, and 4) chromosomal translocations, of which classes 1 and 2 are investigated here. Most CD patients are heterozygous for wild type
and mutant alleles of SOX9. CD appears to result from
haploinsufficiency; presumably, a critical dose of SOX9 is required to
switch on the appropriate genes during development. The present study
reports the identification in a CD patient of a novel amino acid
substitution mutation (H65Y) in the HMG domain of SOX9. We report the
effects of this and three other point mutations (F12L, A19V, and P70R) on the DNA binding and DNA bending activities of the HMG domain.
SOX proteins represent a large class of transcription factors related
to SRY, the testis-determining factor, through their HMG domains that
bind and bend DNA in a sequence-specific manner. Expression of these
proteins in defined cell types at specific stages of development
appears to govern cell fate decisions. SOX9 activates expression of
type II and type XI collagen in vivo (4-6), consistent with
a role in bone development.
SOX proteins fall within a larger group of HMG domain proteins
comprising two classes: 1) those that bind DNA without sequence specificity (such as HMG1, HMGD) and 2) those that bind DNA with sequence specificity (including the TCF1/LEF1 and SOX transcription factors). An amino acid sequence alignment of the SOX9 HMG domain with
those of SRY and LEF1 is shown in Fig. 2.
Although the three-dimensional structure of the SOX9 HMG domain is not
known, the solution structures of the HMG domains of SRY (7) and LEF1
(8), in complex with DNA, have been determined by NMR. The fold of the
two HMG domains is similar. The three
Functional and Structural Studies of Wild Type SOX9 and Mutations
Causing Campomelic Dysplasia*
§,,
,,, and
Howard Florey Institute of Experimental
Physiology and Medicine, University of Melbourne, Parkville 3052, Australia, the ¶ Australian Genomic Information Centre, C80
University of Sydney, Sydney, New South Wales 2006, Australia,
Incyte Genetics, 214 Cambridge Science Park, Milton Road,
Cambridge CB4 4WA, United Kingdom, the ** Department of Clinical
Genetics, St. George's Hospital Medical School, Tooting, London SW17
0RE, United Kingdom, and the Department of
Medical Genetics, Yorkhill Hospitals National Health Service Trust,
Yorkhill, Glasgow G3 8SJ, United Kingdom
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
View larger version (22K):
[in a new window]
Fig. 1.
A, diagram of the SOX9 HMG domain,
showing amino acid substitution mutations that have been identified in
patients with CD. Mutations identified in XY females are indicated
below and those in XX females (F) or XY males (M)
above. Mutations investigated in the present study are indicated with
filled circles. Amino acid residues are numbered
from the start of the HMG domain, which extends from Asn101
to Asn184 of full-length SOX9. B, diagram of the
entire SOX9 open reading frame showing the different domains of the
protein and the mutations that have been identified in patients with
CD. Mutations identified in patients with sex reversal are indicated
below and those in XX females (F) or XY males (M)
above. SA, splice acceptor mutation; fs,
frameshift; X, stop codon.
-helices of the each HMG
domain come together in an L-shape in which the short arm is formed by
helices 1 and 2 and the long arm by helix 3 and the N-terminal strand.
The concave surface of the "L" contacts the minor groove of the
DNA. We have constructed a model of the SOX9 HMG domain based on the
solution structure of the SRY HMG domain and have used the model to
make interpretations about the effects of point mutations within the HMG domain, on DNA binding. According to the model, three of the SOX9
point mutations studied here (F12L, H65Y, and P70R) occur in residues
that lie on or near the DNA binding surface of the HMG domain, and
might therefore be expected to affect DNA binding. The fourth mutation
(A19V) affects a residue that is not on the DNA binding surface, but
might be important in maintaining the structure of the protein.
View larger version (9K):
[in a new window]
Fig. 2.
Amino acid sequence alignment of the HMG
domain of SOX9 (1) with those of SRY (27) and mouse LEF1 (28). The
point mutations studied here are indicated above.
The determinants of transactivation by SOX9 have not been fully
defined. Many of the mutations that result in CD are truncations or
frameshifts that alter the C terminus of the protein. We hypothesized that these mutations disrupt the transactivation potential of the
protein and we sought to define the limits of the transactivation domain of SOX9 by deletion analysis. At the C terminus of SOX9 lies the
PQS-rich domain (Fig. 1B; residues 386-509), a domain rich
in proline, serine, and glutamine, which is required for transcriptional activation (9). Preceding this is the PQA domain (residues 339-379) that consists entirely of proline, glutamine, and
alanine. We have investigated the effect of truncations of the C
terminus of SOX9 (similar to C-terminal deletions seen in CD patients)
on the transactivation activity of SOX9 and show that both the PQS-rich
and PQA domains are required for maximal transcriptional activation.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
|
|---|
Patient Reports-- Patient 10 is the third child of consanguineous Pakistani parents (half first cousins). One older brother died of congenital heart disease; an older sister and younger brother are both well. At birth the proband had macrocephaly, micrognathia, depressed nasal bridge, short limbs, curved femora, small patellae, bilateral talipes equinovarus, normal male genitalia, and mild thoracic kyphosis. Tracheomalacia caused severe respiratory distress and necessitated tracheostomy with ventilation from birth. Radiological features included hypoplastic scapulae, widely spaced pubic symphysis, vertical, narrow iliac bones, bowed femora, straight tibiae, long fibulae, increased acetabular angle (hips not dislocated). Cytogenetic studies showed a normal male karyotype. Hospitalization was prolonged in infancy due to respiratory problems. The tracheostomy was eventually removed at 6 years of age but a gastrostomy remains, although the patient takes most food by mouth. At age 10 years, height is minus 6.5 S.D.; there is scoliosis, but limbs are short and largely straight; the patellae are malpositioned; and calf muscles have reduced bulk. The proband walked at age 4 years. He has moderate intellectual retardation and hearing impairment. He is a social and communicative child who reads simple text, but he has limited speech and prefers to use Makaton signs. The proband's father is phenotypically normal and has chromosome mosaicism for a clinically insignificant Y:15 rearrangement that translocates Yq heterochromatin on to 15p. The proband's mother has proportionate short stature, mild kyphoscoliosis, and a normal female karyotype. Before the molecular basis of the proband's campomelic dysplasia was discovered, the mother had a another pregnancy where recurrence of the condition was diagnosed by ultrasound and confirmed by radiographic examination of the fetus at 19 weeks' gestation.
The other patients studied here have been reported elsewhere and are summarized in Table I.
|
PCR Amplification and SSCP-- To screen for the H65Y mutation among the family of patient 10, a portion of the SOX9 open reading frame was amplified from genomic DNA from blood lymphocytes by PCR, using primers F and G, and analyzed by SSCP as described previously (10).
Parental Haplotyping-- Paternity and maternity of patient 10 were confirmed by DNA profiling using 12 fluorescently labeled PCR primer pairs that amplify microsatellite markers (heterozygosity >70%) located on human chromosome 8, as described previously (10). The parental haplotypes were concordant with those of the proband.
Mutagenesis-- DNA sequences encoding mutant SOX9 HMG domains bearing point mutations were produced by PCR, with the mutation incorporated into one of the primers, or by amplification of patient DNA. Forward and reverse primers also bore NdeI and HindIII sites, respectively, to allow the PCR products to be inserted between the NdeI and HindIII sites in pT7-7. The sequences of all mutants were verified by DNA sequencing.
Deletion mutant SOX9(1-485) was produced by digestion of
SOX9-pcDNA3 with PpuMI and BstXI,
removal of single-stranded termini with mung bean nuclease, and
religation with T4 DNA ligase. With the aim of producing a series of
nested deletion mutants, a PpuMI and BstXI double
digest of pcDNA3-SOX9 was treated with mung bean nuclease to remove single-stranded termini, and then with exonuclease III. Only mutant SOX9(1-410) was isolated in this manner, and it
appears to have resulted fortuitously from exonuclease digestion by
mung bean nuclease past the single-stranded overhang, removing 347 nucleotides upstream of the BstXI site. Other deletion
mutants were created by digestion with restriction endonucleases and
religation. Mutant SOX9(1-248) was produced by removal of a
ApaI restriction fragment from pcDNA3-SOX9.
This deletion closely mimics a CD mutation that results from a missense
mutation at codon 251. Removal of a SfiI-EcoRV restriction
fragment produced deletion mutant SOX9(1-437), which closely mimics a
CD mutation resulting from a missense mutation at codon 440. Mutant
SOX9(1-454) was produced by removal of sequences between the most 5'
RsaI site of SOX9 and the EcoRV site
in the multiple cloning site of pcDNA3. Mutant SOX9(1-465) was
produced by removal of sequences between the most 5'BstUI
site in SOX9 and the same EcoRV site.
SOX9(
PQA) was produced by removal of a PmlI and
PvuII restriction fragment from SOX9.
Production of Mutant and Wild Type HMG Domains-- The plasmids (pT7-7-SOX9box) were transformed into Escherichia coli BL21 and expression of the SOX9 HMG domain was induced by IPTG and soluble protein extracts prepared (11). The HMG domains were expressed in E. coli at a level of approximately 15-45 mg/liter. The HMG domain used in this study extends from residue Asn101 to Asn184 of full-length SOX9, with the addition of a Met residue at the N terminus.
Production of Mutant and Wild Type Full-length SOX9-- Full-length SOX9 was produced in vitro by coupled transcription and translation of SOX9 (wild type and deletion mutants) in pcDNA3, using a TNT kit (Promega), with incorporation of [35S]methionine.
Electrophoretic Mobility Shift Assays--
Oligonucleotide
probes were synthesized on an Applied Biosystems 394 DNA/RNA
synthesizer. The sequences of the upper strands are given below. S9WT
sequence is
GGGTTAACAGAACAATGGAATCTGGTAGA. The
high affinity SOX9 binding site is shown in bold. It comprises the high
affinity SOX binding site (SOXCON) flanked by four residues that
enhance binding of SOX9 (underlined) (12). SOXCORE sequence is
GGGTTAACGCAACAATCTAATCTGGTAGA.
The high affinity SOX binding site is shown in bold. The four
flanking residues (underlined) are those that are least preferred for
binding of SOX9 in vitro (12). Col2c1 sequence is
GGGCCCCTCTCCCACAATGCCCCCCTGTC; Col2c2 sequence is
GGGTCGAGAAAAGCCCCATTCATGAGAGC. Col2c1 and Col2c2 are SOX-binding sequences from the Col2a1
enhancer that are required for chondrocyte-specific expression.
In vivo, SOX proteins appear to tolerate considerable
sequence variation in their binding sites. The sites conform loosely to
the HMG consensus binding site (A/T)(A/T)CAA(A/T)G. The residues that
correspond to this consensus are shown in bold. To prepare probes,
complementary oligonucleotides were annealed and radiolabeled by
end-filling with Superscript reverse transcriptase in the presence of
[-32P]dCTP and purified on Biogel-P4 spin columns.
E. coli cell lysates containing SOX9 HMG domain were mixed
with 32P-labeled probe (0.25 nM) in a total
volume of 16 µl of binding buffer (13) and kept on ice for 15 min
before electrophoresis. Protein-DNA complexes were resolved from free
DNA on non-denaturing 6% polyacrylamide gels (40:1 (w/w)
acrylamide:bisacrylamide) in 0.5× TBE for 3.5 h at 10 V/cm. Prior
to sample loading, the gel was prerun for 2 h at 150V. Shifted and
free probe were quantitated by PhosphorImager analysis.
Circular Permutation Assay--
Pairs of oligonucleotides were
annealed to give linkers bearing SOXCON (upper strand:
TCGACTGATAACAATGCGCTCT; lower strand:
CTAGAGAGCGCATTGTTATCAG) or S9WT (upper strand:
TCGACTGATAGAACAATGGGCGCTCT; lower strand:
CTAGAGAGCGCCCATTGTTCTATCAG). The binding sites are shown in bold.
pBEND2-SOXCON and pBEND2-S9WT were created by insertion of these
linkers between the XbaI and SalI sites of pBEND2
(14). Seven circularly permuted probes bearing the binding sites were isolated by digestion of these plasmids with BamHI (A),
RsaI (B), StuI (C), EcoRV (D),
SpeI (E), NheI (F), or EcoRI and
SalI (G) and excision of the bands after agarose gel
electrophoresis. The probes were then treated with shrimp alkaline
phosphatase and labeled with [
-32P]ATP using T4
polynucleotide kinase. Probes (0.2-0.8 ng) were mixed with extract
containing 180 ng of wild type or 600 ng of A19V or P70R mutant SOX9
HMG domain in binding buffer (13), in a total volume of 16 µl, and
kept for 15 min on ice. Products were resolved by electrophoresis
through 6.5% polyacrylamide non-denaturing gels (40:1 (w/w)
acrylamide:bisacrylamide) as described above. Bend parameters were
calculated as described previously (15).
Molecular Modeling--
Homology modeling by Modeller (16) was
used to generate model structures of SOX9 and the P70R mutant, using
the NMR structure of human SRY (PDB code 1HRY; Ref. 7) as template. The
models were subjected to iterative molecular dynamics refinement using in-built simulated annealing protocols, to improve the structural quality as computed by PROCHECK (17). GRASP (18) was used to map
residue contributions to the molecular surface. MOLSCRIPT was used to
create the C- traces.
Cell Types and Culture-- COS-7 cells were cultured as a monolayer in RPMI 1640, supplemented with 1% (v/v) penicillin/streptomycin, 1% L-glutamine, and 10% (v/v) fetal calf serum, at 37 °C under 5% CO2.
Transient Transfections--
COS-7 cells were transfected by
DEAE-dextran-assisted electroporation (19). Transactivation by SOX9 was
measured in transfection assays, using the reporter plasmid,
pS10E1bCAT, in which the CAT gene is
under the control of the E1b promoter, downstream of 10 SOX core
binding sites (AACAAT). Cells (1 × 106) in log growth
phase were transfected with 1 µg of
pS10E1bCAT, 26 ng of pcDNA3 or
pcDNA3-SOX9 (wild type or deletion mutant), and 20 ng of
pCMV-lac, in a volume of 600 µl of RPMI 1640 containing 10 µg/ml DEAE-dextran. Pulse conditions were 960 microfarads and 250 mV
using a Gene Pulser apparatus (Bio-Rad). Cells from each transfection
were seeded into two flasks after addition of 6 ml of RPMI, and grown
for 48 h before being harvested. Protein concentrations, in cell
lysates, were determined by Bradford assay. CAT expression was determined by enzyme-linked immunosorbent assay, using a CAT enzyme-linked immunosorbent assay kit (Roche Molecular Biochemicals). To correct for varying transfection efficiencies, 
-galactosidase levels were assayed and CAT levels were normalized for
-galactosidase expression. -Galactosidase expression was assayed
using the -galactosidase enzyme assay system (Promega).
| |
RESULTS |
|---|
|
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
|
|---|
Detection of a Novel CD Mutation--
In a screen of the
SOX9 open reading frame from CD patients (13), we identified
a novel missense mutation (H65Y; CAC 
TAC) in the SOX9 HMG domain
from one patient. Curiously, the father of this patient appears
phenotypically normal, but carries the H65Y mutation in his blood
lymphocytes (and presumably germ cells). In contrast, the mother has a
kyphoscoliosis and does not appear to carry the mutation (Fig.
3). These findings raised the possibility that the mutation inherited from the father was a rare polymorphism that was not responsible for the CD phenotype and that another mutation, inherited from the mother, was responsible for the CD phenotype. Using SSCP, we screened for the polymorphism in the DNA from
62 phenotypically normal individuals of Pakistani descent, and failed
to find another instance of the polymorphism.
|
DNA Binding and Bending Activities of Mutant HMG Domains from
Patients with CD--
The wild type and mutant HMG domains were
expressed in E. coli upon induction with IPTG. The proteins
were soluble and stably expressed as judged by SDS-PAGE (Fig.
4). The affinities of wild type and
mutant HMG domains for DNA probes S9WT, SOXCORE, and two sequences from
the Col2a1 enhancer, Col2c1 and Col2c2, were compared by
EMSA (Fig. 5). The probe, S9WT, bears the
high affinity SOX9-binding site selected in vitro
(AGAACAATGG). This sequence includes the high affinity
binding site defined for other SOX proteins ((A/T)(A/T)CAA(A/T), shown
in bold and termed SOXCON here; Ref. 20-22), flanked on either end by
two residues preferred by SOX9 (12). SOXCORE bears the sequence
GCAACAATCT, in which the four
flanking residues of S9WT are mutated to those selected by SOX9 at
lowest frequency in these positions (underlined). The wild type SOX9
HMG domain bound S9WT (relative binding 100%) more strongly than the
other probes. Binding of SOXCORE, was about 8-fold lower. These results
are consistent with our previous finding that the 5'-AG and 3'-GG in
S9WT enhance binding of SOX9 (12). Interestingly, binding of the wild
type HMG domain to Col2c1 and Col2c2 was about 5- and 3-fold lower than
to S9WT. Note that Col2c1 has a single HMG binding site, which includes
the 3'-flanking G in S9WT, whereas Col2c2 has two sites, one of which
includes the 3'-flanking G and the other of which includes both
3'-flanking G nucleotides in S9WT. Presumably only one of the two sites
on Col2c2 can be occupied at a time, as only a single shifted band is
seen, even with high concentrations of SOX9 HMG domain.
|
|
Binding of the F12L mutant to any of the four probes was not detectable (relative binding <0.01%), suggesting that Phe12 is essential for DNA binding. The H65Y mutant showed barely detectable binding to S9WT, Col2c1, and Col2c2 (relative binding of 0.07%, 0.01%, and 0.01%, respectively), and undetectable binding to SOXCORE. Thus the H65Y mutation has a drastic effect on sequence-specific DNA binding. Binding of the A19V mutant to each of the four probes was only 3-5-fold lower than wild type, suggesting that Ala19 is not essential for DNA binding and that the A19V mutation does not drastically disrupt the structure of the HMG domain.
Interestingly, the P70R mutant showed altered DNA binding specificity compared with the wild type HMG domain. As stated above, binding of the wild type HMG domain to S9WT was about 8-fold higher than to SOXCORE. In comparison, whereas binding of the P70R mutant HMG domain to S9WT was only 7-fold lower than the wild type HMG domain, its binding to SOXCORE was undetectable (<0.01% relative binding). Thus, the four residues in S9WT that flank the core SOX consensus site appear to be essential for binding of the P70R mutant to DNA, whereas they enhance binding of the wild type SOX9 HMG domain only moderately. This suggests that the P70R mutant is missing some of the key contacts that contribute to binding to the core SOX consensus site. Finally, we found binding of the P70R mutant to the Col2c1 and Col2c2 probes to be barely detectable. The presence of at least one of the flanking residues of S9WT in the binding sites on these probes is presumably responsible for the small amount of binding observed.
Some point mutations in the HMG domain of SRY in patients with XY
gonadal dysgenesis alter the DNA bending properties of the protein
(23). Therefore, we determined the bend angles induced upon binding of
the wild type and mutant HMG domains to S9WT and SOXCON, using a
circular permutation assay. The bend angle induced upon binding of the
wild type HMG domain to S9WT was 71 ± 0.4°. The A19V and P70R
mutants bent this probe similarly (Fig.
6A). The bend angle induced
upon binding of the wild type HMG domain to SOXCON was 78 ± 0.6° (Fig. 6B). This is similar to the angle induced upon
binding of the SRY HMG domain to SOXCON (results not shown). The A19V
mutant bent the SOXCON probe similarly (Fig. 6B). Thus, the
A19V and P70R mutations do not appear to alter the DNA bending
properties of SOX9.
|
Molecular Modeling--
To investigate further the function of
specific amino acid residues in the SOX9 HMG domain, we built a model
of the structure of the HMG domain of SOX9, based on the known solution
structure of the HMG domain of SRY in complex with DNA. The SRY and
SOX9 HMG domains differ at 39 of the 77 amino acids in the SRY
structure. The homology model of the SOX9 HMG domain fits closely to
the structure of the SRY HMG domain; 72 of the 77 C- carbons have been aligned (root mean square deviation = 0.72 Å; Fig.
7A).
|
The DNA binding surfaces of the SRY and SOX9 HMG domains are depicted
in Fig. 8 (A and
B). Of the four mutated residues of SOX9 studied here,
Phe12 (cyan), His65
(magenta), and Pro70 (yellow) are
located on or near the DNA binding surface in similar positions to the
homologous residues in SRY. Ala19 of SOX9 is not part of
the DNA binding surface; it faces away from the DNA, into the solvent.
In the SOX9 model, as in the SRY structure, the side chain of
Phe12 interacts with the base of T12. Pro70
lies at the end of helix 3 of both SRY and SOX9 HMG domains and is
likely to be important in determining the orientation of the C-terminal
tail that includes residues Lys73 (blue) and
Tyr74 (green). These residues are thought to be
instrumental in DNA binding and bending by SRY, and the present model
of the SOX9 HMG domain suggests that their positions on the DNA binding
surface are conserved in the SOX9 HMG domain.
|
Inspection of the model of the SOX9 HMG domain allows us to speculate on how the SOX9 mutations studied here affect DNA binding. The F12L mutation affects a key aromatic contact between the HMG domain and the DNA; in the F12L mutant, the Leu12 side chain is unlikely to interact with the bases in the same way that Phe12 does in the wild type HMG domain. In the A19V mutant, the larger hydrophobic side chain of Val19 is likely to be stabilized by interaction with Phe12, Tyr15, and Tyr43. These interactions could alter the interaction of Phe12 with the DNA.
His65 of SOX9 lies in a hollow on the DNA binding surface, with most of its side chain accessible to solvent, away from the DNA binding surface. Replacement of this residue with tyrosine would replace a positively charged or hydrophilic neutral residue with a larger and more hydrophobic side chain, which would prefer to be buried, with a consequent change of conformation. In this changed conformation, Tyr65 might protrude further into the DNA binding pocket, thus diminishing DNA binding. Furthermore, examination of the model suggests that the H65Y mutation is likely to affect the conformation of residues near the N terminus of the SOX9 HMG domain, where important contacts are made with the DNA. Arg4 of SRY interacts with the phosphate group of nucleotide C4, whereas Arg7 points out into the solvent. However, in the SOX9 HMG domain, Arg4 is replaced with His, which being shorter appears to be unable to interact with the DNA (Fig. 7A). Instead, the two nitrogens of Arg7 coordinate with the N2 of G13. In the model of the wild type SOX9 HMG domain, Pro8 interacts with His65. However, in the H65Y mutant, Pro8 is too close to Tyr65 to allow the bulkier side chain of tyrosine to be accommodated in this position. Thus in the H65Y mutant, Tyr65 is likely to cause Pro8 to relocate, which could, in turn, affect the interaction of Arg7 with the DNA.
To investigate the effect of the P70R mutation on the structure of the
SOX9 HMG domain, we built a model of the P70R mutant HMG domain, in
which 71 of the 77 C- carbons have been aligned with those of the
wild type SOX9 HMG domain (root mean square deviation = 0.69 Å;
Fig. 7B). The DNA binding surface of the P70R mutant HMG
domain is depicted in Fig. 8C. Comparison of the models of
wild type and P70R mutant SOX9 HMG domains allows us to speculate on
how the P70R mutation affects the interaction of the HMG domain with
DNA. The major difference between the model of the P70R mutant and that
of the wild type HMG domain is that the C-terminal tail is oriented
differently in the P70R mutant (Fig. 7B). This tail includes
residues Lys73 and Tyr74, which appear to be
important DNA-contact residues. In the NMR structure of SRY,
Tyr74 interacts hydrophobically with base A3 (closest
distance = 3.2 Å). In the model of the SOX9 HMG domain,
Tyr74 is not close enough to this base to make hydrophobic
contact (closest distance = 6.9 Å), but its side chain is able to
flip over so that the phenolic hydroxyl group can interact with base C16 by hydrogen bonding. Two contacts with C16 are possible: one with
N1 of C16 (closest distance = 3.3 Å) and the other with the sugar
oxygen of C16 (closest distance = 2.7 Å). In the SOX9 model, Lys73 is able to interact with the phosphate group of C16
(closest distance = 2.7 Å). Thus, the present model of the wild
type SOX9 HMG domain suggests that the side chains of Lys73
and Tyr74 are likely to help to stabilize the interaction
of the SOX9 HMG domain with one of the residues flanking the 5' end of
the core SOX binding site in S9WT. This might explain the preference of SOX9 for the 5'-flanking G in S9WT. According to the models, a consequence of the altered orientation of the C-terminal tail of the
P70R mutant is that Lys73 is no longer oriented toward the
DNA binding surface, and Tyr74, while still on the DNA
binding surface, is also unable to make contact with the DNA (closest
distance = 5.5 Å). Thus, some of the key contacts that the wild
type SOX9 HMG domain makes with the DNA appear to be lost in the P70R
mutant. However, a compensating interaction is possible; in the model
of P70R mutant, the altered orientation of the C-terminal tail may
allow Arg77 (Fig. 7C; red) to
interact with one of the residues flanking the core SOX binding site in
S9WT. In conclusion, the models are consistent with the hypothesis that
the reduced DNA binding affinity and altered DNA binding specificity of
the P70R mutant are, at least in part, due to a different orientation
of the C-terminal tail of the HMG domain from that of the wild type protein.
The PQS-rich and PQA Domains of SOX9 Both Contribute to Transactivation-- Many CD mutations result in truncation of the C terminus of SOX9. We constructed a series of mutants with successively larger deletions of their C termini. These mutants mimic mutant SOX9 proteins seen in CD, and by assaying their transactivation activity we have defined the transactivation domain of SOX9.
Transfection of COS-7 cells with full-length SOX9 gave a 31-fold
induction of CAT transcription compared with transfection of
cells with the vector, pcDNA3. SOX9 mutants with successively larger deletions of their C termini gave successively lower levels of
CAT activation (Fig.
9A). Transactivation by the
deletion mutant SOX9 1-454 (which lacks the C-terminal 55 amino acids)
was 4.4-fold lower than wild-type SOX9 (Sceffé, p < 0.05). Transactivation by mutant SOX9 1-248 was reduced another
9.5-fold (Sceffé, p < 0.05), to levels that are
near background. A mutant lacking only the PQA domain gave 1.5-fold
lower CAT activation than wild type SOX9, and this
difference was significant (Sceffé, p < 0.05). Thus, the PQS-rich and PQA domains both appear to be required for
maximal transactivation. The mutant proteins were expressed stably in
rabbit reticulocyte lysate (Fig. 9B, i), bound to
DNA in an EMSA (Fig. 9B, ii) and were imported
into the nuclei when expressed in COS-7 cells (Fig. 9C).
Thus the decreased activity of the mutant proteins does not appear to
be due to protein instability or to failure of the mutant proteins to
localize in the nucleus and to bind to DNA.
|
| |
DISCUSSION |
|---|
|
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
|
|---|
In this study, we have investigated the structure and function of wild type SOX9 and two classes of mutation that occur in patients with campomelic dysplasia. We report the identification of a novel amino acid substitution mutation (H65Y) in the SOX9 HMG domain of a CD patient. The mutation appears to have been inherited from the unaffected father. It is unlikely that the mutation is a rare polymorphism that is unrelated to the CD phenotype, as a screen of the DNA from 62 Pakistanis failed to detect another instance of the mutation. Furthermore, the DNA binding activity of the H65Y mutant protein was barely detectable, suggesting that the patient's CD phenotype results from failure of the mutant SOX9 protein to bind DNA and its consequent failure to activate expression of target genes. The father's normal phenotype might be explained by mosaicism, whereby a certain proportion of his cells (including germ cells) are heterozygous for the mutant SOX9 allele and the remainder have two copies of the wild type allele.
A comparison of the amino acid sequences of the HMG domains that bind DNA with sequence specificity with those that bind without sequence specificity (such as HMG-1 and HMG-D) gives some clues as to which residues are important in DNA binding and sequence specificity (24). His65 of SOX9 is conserved in sequence-specific HMG domain proteins, but is replaced by a Tyr residue in most of the nonspecific HMG domains, suggesting that a His residue at this position is required for sequence-specific DNA binding. The greatly reduced DNA binding activity of the H65Y mutant compared with the wild type HMG domain supports this interpretation. In the model of the wild type HMG domain of SOX9 presented here, His65 lies in a hollow on the DNA binding surface. Replacement of this residue with a larger and more hydrophobic tyrosine residue might interfere with interaction with the DNA by protruding into the DNA binding pocket. An alternative explanation for the lack of DNA binding activity observed in the H65Y mutant is suggested by inspection of the solution structure of SRY. Packing of His65 (homologous to His65 of SOX9) with Pro8, Leu61, and Gln62 helps stabilize the middle of the long arm of the "L" (7). The model of the SOX9 HMG domain presented here suggests that the larger side chain of Tyr65 in the H65Y mutant would cause Pro8 to relocate and modulate an interaction between Arg7 and the DNA.
The present study also investigated the effect of three other point mutations within the HMG domain of SOX9: F12L, A19V, and P70R. Phe12 is conserved in the sequence-specific HMG domains and is conserved or replaced with another aromatic residue (Tyr) in the nonspecific HMG domains and thus is expected to be important for sequence-specific DNA binding. Phe12 of SRY appears to interact with an AT base pair in the minor groove of the DNA and aid the deformation of the DNA that is brought about by intercalation of the adjacent residue, Ile13, between two AT base pairs (25). In our model of the SOX9 HMG domain, Phe12 lies in a similar position on the DNA binding surface and can therefore be expected to function similarly. Thus, the F12L mutation is likely to interfere with a key contact between the SOX9 HMG domain and the DNA. The present study supports this prediction, as the F12L mutant protein shows undetectable binding to the DNA sequences tested. It is also possible that the mutation disrupts the structure of the SOX9 HMG domain, as Phe12 of SRY is one of 12 residues that lie at the junction of the three helices and form a large hydrophobic core, which stabilizes the "L" shape and has an exposed surface that contacts the DNA (7).
The A19V mutant HMG domain bound the DNA probes 3-5-fold less strongly than the wild type HMG domain, but both mutant and wild type HMG domains bent DNA probes bearing S9WT or SOXCON to the same extent. The lack of conservation of Ala19 of SOX9, among other SOX proteins, and the substantial DNA binding activity observed in the A19V mutant, suggest that Ala19 is not critical for sequence-specific DNA binding and that the A19V mutation does not drastically disrupt the structure of the HMG domain. Ala19 in SOX9 corresponds to Gln19 in SRY, which does not contact the DNA directly; instead, it helps to maintain the orientation of the long and short arms of the L-shape of the molecule (7). Thus, the reduced DNA binding activity observed in the A19V mutant HMG domain might be explained if this mutation modulates some of the interactions responsible for maintaining the orientation of the long and short arms of the wild type HMG domain. Inspection of the model of the SOX9 HMG domain suggests that interaction between Val19 in the A19V mutant with Phe12, Tyr15, and Tyr43 is likely to modulate the interaction of Phe12 with the DNA. The CD phenotype that results from the A19V mutation indicates that the residual DNA binding activity observed in this mutant protein is insufficient to allow the protein to bind and activate target genes to levels required for normal development. Alternatively, the A19V mutant may be deficient in some activity not measured here.
Pro70 of SOX9 is conserved among sequence-specific HMG domain proteins but not among the nonspecific HMG domains, suggesting that it is important for sequence-specific DNA binding. Meyer et al. (26) found that the P70R mutant HMG domain showed reduced binding to a DNA probe that includes S9WT. We extend these results to show that the P70R mutant has altered DNA binding specificity. Although the wild type HMG domain binds S9WT with only 8-fold higher affinity than it binds SOXCORE, the P70R mutant showed moderately strong binding to S9WT, but no detectable binding to SOXCORE. These results suggest that the mutant protein lacks some of the contacts that the wild type protein makes with the core SOX consensus site, but retains contacts with the flanking residues in S9WT.
An inspection of the structures of SRY and LEF1 suggests that Pro70 in SOX9 is likely to be important for determining the orientation of the C-terminal tail of the HMG domain (residues 71-84). In these structures, the corresponding proline residues break helix 3 and produce a kink, such that helix 3 is shorter than that found in the HMG-1 and HMG-D domains, which lack DNA sequence specificity. The C-terminal strand then bends back toward the N terminus, forming a small hydrophobic cluster, that brings the N- and C-terminal strands into proximity and is thought to be important for sequence-specific DNA binding (8). Tyr74 of SRY forms part of the hydrophobic core, and its aromatic ring is packed against the bases of A3 and T14 and appears to push the A3 base toward the major groove, thereby disrupting base stacking and base pairing. Thus, Tyr74 appears to be important for sequence-specific DNA binding and bending. Lys73 of SRY appears to form a salt bridge with the phosphate group of C16 (7). Lys73 and Tyr74 are highly conserved in SOX proteins. In our model of the wild type SOX9 HMG domain, Lys73 and Tyr74 also appear to make important contacts with the DNA. We predicted that replacement of Pro70 in the SOX9 HMG domain with Arg would alter the orientations of these residues. Accordingly, the molecular models of the respective HMG domains, presented here, show Lys73 to be on the DNA binding surface of the wild type HMG domain, but not on that of the P70R mutant. Although Tyr74 is located on the DNA binding surface in the P70R mutant, it is not close enough to make contact with the DNA. Thus, we propose that the P70R mutation interferes with the ability of the protein to bind and activate target genes by modulating the interaction of Lys73 and Tyr74 with the DNA.
The NMR structure of SRY suggests that Lys73 and Tyr74 of SRY play an important role in DNA bending (7). As the homologous residues have altered orientations with respect to the DNA binding surface in our model of the P70R mutant of SOX9, we predicted that this mutant would have altered DNA bending properties. Using a circular permutation assay, we estimated the bend angle induced upon binding of the P70R mutant HMG domain to probes bearing S9WT to be close to the angle induced upon binding of the wild type HMG domain. Thus, the P70R mutation does not appear to affect the DNA bending properties of the SOX9 HMG domain. The model of the P70R mutant suggests that a compensating interaction between Arg77 and the extended DNA sequence of S9WT might stabilize DNA binding and bending by the P70R mutant.
Many of the mutations that give rise to CD truncate the C terminus of the protein. We constructed a number of SOX9 deletion mutants, which mimic the truncation and frameshift mutations seen in CD patients, and used these mutants to define the transactivation domain of SOX9. Analysis of the transactivation activity of the deletion mutants shows that progressive truncation of the C terminus of SOX9 results in progressive loss of transactivation activity and therefore demonstrates that most of the transactivation activity is conferred by the PQS-rich domain. However, the PQA domain is also required for maximal transactivation. The present results contrast with those of Sudbeck et al. (9), who also found that the transactivation activity of SOX9 was conferred by the PQS-rich domain, but that the PQA domain was not required for maximal transactivation. The apparent discrepancy between these results and the present results might be explained by the fact that Sudbeck et al. studied the effect of removal of the PQA domain in the context of a fusion protein in which SOX9 (with or without the DNA binding domain) was fused to the Gal4 DNA binding domain. In contrast, the present study examined the effect of deletions, on the transactivation activity of SOX9, in the context of the native protein. The results of the present study are therefore more likely to reflect the activity of the native protein and mutant SOX9 proteins found in patients with CD.
Although the PQA domain of SOX9 varies greatly in length among species, the PQS-rich domain is highly conserved. Analysis of the mutations present in CD patients suggests that CD often arises from truncation of the C terminus of SOX9, and it is likely that in these cases the CD phenotype results from failure of the mutant SOX9 protein to activate target genes to levels sufficient for normal development.
In conclusion, the question of how the PQS and PQA domains
mediate transcriptional activation remains to be answered. It is likely
that they do so via interactions with other transcriptional activators or components of the basal transcription apparatus.
| |
ACKNOWLEDGEMENTS |
|---|
This work was initiated in the Laboratory of Human Molecular Genetics in the Department of Genetics at Cambridge University under the supervision of Professor Peter Goodfellow, to whom we are grateful for guidance and interest in this work. We also thank Alan Schafer for helpful discussion, Steven Matthias for pBEND2SOXCON, Harry Ostrer for the plasmid pS10E1bCAT, and John Todd for microsatellite markers used in parental haplotyping.
| |
FOOTNOTES |
|---|
* This work was supported by National Health and Medical Research Council Grant 983001.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The atomic coordinates (BNL-27758 for model of the wild type SOX9 HMG domain and BNL-27760 for P70R mutant SOX9 HMG domain) are available in the Protein Data Bank, Research Collaboratory for Structural Bioinformatics, Rutgers University, New Brunswick, NJ (http://www.rcsb.org/).
§ To whom correspondence should be addressed. Tel.: 61-3-93447553; Fax: 61-3-93481707; E-mail: smd@hfi.unimelb.edu.au.
| |
ABBREVIATIONS |
|---|
The abbreviations used are:
CD, campomelic
dysplasia;
CAT, chloramphenicol acetyltransferase;
EMSA, electrophoretic mobility shift assay;
HMG, high mobility group;
IPTG, isopropyl-1-thio--D-galactopyranoside;
PAGE, polyacrylamide gel electrophoresis;
PCR, polymerase chain reaction;
SSCP, single strand conformation polymorphism.
| |
REFERENCES |
|---|
|
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
|
|---|
| 1. | Foster, J. W., Dominguez Steglich, M. A., Guioli, S., Kwok, G., Weller, P. A., Stevanovic, M., Weissenbach, J., Mansour, S., Young, I. D., Goodfellow, P. N., Brook, J. D., and Schafer, A. J. (1994) Nature 372, 525-530[CrossRef][Medline] [Order article via Infotrieve] |
| 2. | Ng, L. J., Wheatley, S., Muscat, G. E., Conway Campbell, J., Bowles, J., Wright, E., Bell, D. M., Tam, P. P., Cheah, K. S., and Koopman, P. (1997) Dev. Biol. 183, 108-121[CrossRef][Medline] [Order article via Infotrieve] |
| 3. | Zhao, Q., Eberspaecher, H., Lefebvre, V., and de Crombrugghe, B. (1997) Dev. Dyn. 209, 377-386[CrossRef][Medline] [Order article via Infotrieve] |
| 4. | Bell, D. M., Leung, K. K., Wheatley, S. C., Ng, L. J., Zhou, S., Ling, K. W., Sham, M. H., Koopman, P., Tam, P. P., and Cheah, K. S. (1997) Nat. Genet. 16, 174-178[CrossRef][Medline] [Order article via Infotrieve] |
| 5. |
Zhou, G.,
Lefebvre, V.,
Zhang, Z. P.,
Eberspaecher, H.,
and de Crombrugghe, B.
(1998)
J. Biol. Chem.
273,
14989-14997 |
| 6. |
Bridgewater, L. C.,
Lefebvre, V.,
and de Crombrugghe, B.
(1998)
J. Biol. Chem.
273,
14998-15006 |
| 7. | Werner, M. H., Huth, J. R., Gronenborn, A. M., and Clore, G. M. (1995) Cell 81, 705-714[CrossRef][Medline] [Order article via Infotrieve] |
| 8. | Love, J. J., Li, X., Case, D. A., Giese, K., Grosschedl, R., and Wright, P. E. (1995) Nature 376, 791-795[CrossRef][Medline] [Order article via Infotrieve] |
| 9. | Sudbeck, P., Schmitz, M. L., Baeuerle, P. A., and Scherer, G. (1996) Nat. Genet. 13, 230-232[CrossRef][Medline] [Order article via Infotrieve] |
| 10. | Kwok, C., Weller, P. A., Guioli, S., Foster, J. W., Mansour, S., Zuffardi, O., Punnett, H. H., Dominguez Steglich, M. A., Brook, J. D., and Young, I. D. (1995) Am. J. Hum. Genet. 57, 1028-1036[Medline] [Order article via Infotrieve] |
| 11. | Smith, D. B. (1993) Methods Mol. Cell. Biol. 4, 220-229 |
| 12. |
Mertin, S.,
McDowall, S. G.,
and Harley, V. R.
(1999)
Nucleic Acids Res.
27,
1359-1364 |
| 13. | van de Wetering, M., Oosterwegel, M., Dooijes, D., and Clevers, H. (1991) EMBO J. 10, 123-132[Medline] [Order article via Infotrieve] |
| 14. | Kim, J., Zwieb, C., Wu, C., and Adhya, S. (1989) Gene (Amst.) 85, 15-23[CrossRef][Medline] [Order article via Infotrieve] |
| 15. |
Thompson, J. F.,
and Landy, A.
(1988)
Nucleic Acids Res.
16,
9687-9705 |
| 16. | Sali, A., and Blundell, T. L. (1993) J. Mol. Biol. 234, 779-815[CrossRef][Medline] [Order article via Infotrieve] |
| 17. | Laskowski, R. A., McArthur, M. W., Moss, D. S., and Thornton, J. M. (1993) J. Appl. Crystallogr. 26, 283-291 [CrossRef] |
| 18. | Nicholls, A., and Honig, B. J. (1991) J. Comput. Chem. 12, 434-445 |
| 19. |
Gauss, G. H.,
and Lieber, M. R.
(1992)
Nucleic Acids Res.
20,
6739-6740 |
| 20. |
Harley, V. R.,
Lovell Badge, R.,
and Goodfellow, P. N.
(1994)
Nucleic Acids Res.
22,
1500-1501 |
| 21. |
Kanai, Y.,
Kanai Azuma, M.,
Noce, T.,
Saido, T. C.,
Shiroishi, T.,
Hayashi, Y.,
and Yazaki, K.
(1996)
J. Cell Biol.
133,
667-681 |
| 22. | Denny, P., Swift, S., Connor, F., and Ashworth, A. (1992) EMBO J. 11, 3705-3712[Medline] [Order article via Infotrieve] |
| 23. | Pontiggia, A., Rimini, R., Harley, V. R., Goodfellow, P. N., Lovell Badge, R., and Bianchi, M. E. (1994) EMBO J. 13, 6115-6124[Medline] [Order article via Infotrieve] |
| 24. | Grosschedl, R., Giese, K., and Pagel, J. (1994) Trends Genet. 10, 94-100[CrossRef][Medline] [Order article via Infotrieve] |
| 25. | Tang, Y., and Nilsson, L. (1998) Proteins 31, 417-433[CrossRef][Medline] [Order article via Infotrieve] |
| 26. |
Meyer, J.,
Sudbeck, P.,
Held, M.,
Wagner, T.,
Schmitz, M. L.,
Bricarelli, F. D.,
Eggermont, E.,
Friedrich, U.,
Haas, O. A.,
Kobelt, A.,
Leroy, J. G.,
Van Maldergem, L.,
Michel, E.,
Mitulla, B.,
Pfeiffer, R. A.,
Schinzel, A.,
Schmidt, H.,
and Scherer, G.
(1997)
Hum. Mol. Genet.
6,
91-98 |
| 27. | Sinclair, A. H., Berta, P., Palmer, M. S., Hawkins, J. R., Griffiths, B. L., Smith, M. J., Foster, J. W., Frischauf, A. M., Lovell Badge, R., and Goodfellow, P. N. (1990) Nature 346, 240-244[CrossRef][Medline] [Order article via Infotrieve] |
| 28. |
Travis, A.,
Amsterdam, A.,
Belanger, C.,
and Grosschedl, R.
(1991)
Genes Dev.
5,
880-894 |
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  D. Wilhelm, R. Hiramatsu, H. Mizusaki, L. Widjaja, A. N. Combes, Y. Kanai, and P. Koopman SOX9 Regulates Prostaglandin D Synthase Gene Transcription in Vivo to Ensure Testis Development J. Biol. Chem., April 6, 2007; 282(14): 10553 - 10560. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Saint-Germain, Y.-H. Lee, Y. Zhang, T. D. Sargent, and J.-P. Saint-Jeannet Specification of the otic placode depends on Sox9 function in Xenopus Development, April 15, 2004; 131(8): 1755 - 1763. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Argentaro, H. Sim, S. Kelly, S. Preiss, A. Clayton, D. A. Jans, and V. R. Harley A SOX9 Defect of Calmodulin-dependent Nuclear Import in Campomelic Dysplasia/Autosomal Sex Reversal J. Biol. Chem., September 5, 2003; 278(36): 33839 - 33847. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. R. Harley, M. J. Clarkson, and A. Argentaro The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9] Endocr. Rev., August 1, 2003; 24(4): 466 - 487. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Schepers, M. Wilson, D. Wilhelm, and P. Koopma |
) is equivalent to relative binding <0.01.
