J Biol Chem, Vol. 274, Issue 35, 24449-24452, August 27, 1999
COMMUNICATION
GRF
, a Novel Regulator of Calcium Signaling, Is Expressed
in Pancreatic Beta Cells and Brain*
Yoav
Arava
,
Rony
Seger§, and
Michael D.
Walker
¶
From the
Department of Biological Chemistry and the
§ Department of Biological Regulation, Weizmann Institute of
Science, Rehovot, Israel 76100
 |
ABSTRACT |
By screening for genes expressed differentially
in pancreatic beta cells, we have isolated a cDNA encoding GRF
,
a novel 178-amino acid protein whose N terminus is identical to that of
GRF1, a calcium-dependent guanine nucleotide exchange
factor, and whose C terminus is unrelated to known proteins. We show
that both GRF1 and GRF
are expressed selectively in beta cell lines,
pancreatic islet cells and brain. Treatment of beta cell lines (
TC1
and HIT) with calcium ionophore led to a significant elevation in activity of the Ras signal transduction pathway, as determined by
phosphorylation of extracellular signal-related kinase (ERK). Transfection of beta cells with a plasmid encoding a dominant negative
variant of GRF1 led to 70% reduction in ERK phosphorylation, consistent with a role for GRF1 in calcium-dependent Ras
signaling in these cells. To examine the possible function of GRF
,
cultured cells were transfected with a GRF
expression vector. This
led to a significant reduction in both GRF1-dependent ERK
phosphorylation and AP1-dependent reporter gene activity.
The results suggest that GRF1 plays a role in mediating
calcium-dependent signal transduction in beta cells and
that GRF
represents a novel dominant negative modulator of Ras signaling.
 |
INTRODUCTION |
Control of carbohydrate homeostasis is achieved largely through
regulated secretion of insulin by pancreatic endocrine beta cells. The
beta cell functions as a glucose sensor through specialized enzymatic
machinery, including a high Km glucose transporter (Glut2) and a high Km glucokinase (reviewed in Refs. 1 and 2). Elevated blood glucose levels lead to increased intracellular
ATP/ADP ratios, causing closure of ATP-dependent potassium
channels, membrane depolarization, and a resultant increase in
intracellular Ca2+ levels. This, in turn, is believed to
cause increased insulin biosynthesis and secretion through mechanisms
that are poorly defined. Elevated glucose concentrations can activate
MAP1 kinase pathways in
cultured beta cells (3-5), accompanied by increased insulin secretion.
However, specific inhibitors of MAP kinase showed little effect on
insulin secretion (4-6). Since exposure of beta cells to glucose leads
to nuclear translocation of ERK (4, 5), it is possible that one of the
major effects of MAPK activation is modulation of transcription factor
activity (7, 8), leading to changes in insulin biosynthetic rate. The
precise actions of Ca2+ and the functional significance of
elevated MAP kinase activity in beta cells remain to be established.
In order to better understand the molecular basis for cell-specific
functions of beta cells, we have used representational difference
analysis (9, 10) to identify genes expressed differentially between
alpha and beta cells; this led to isolation of 26 cDNA clones (11,
12); using one of these, we have now isolated a clone encoding the
novel protein GRF
, which shares an identical region with GRF1, a
calcium-dependent guanine exchange factor originally
identified in brain cells (13, 14). In this report, we document the
sequence of GRF
, and demonstrate that both GRF
and GRF1 are
expressed preferentially in beta cells and brain. In addition we show
that GRF1 plays a role in calcium signaling in beta cells and that
GRF
represents a naturally occurring, dominant negative form of GRF1.
 |
EXPERIMENTAL PROCEDURES |
Library Screening--
A
TC1 cDNA library constructed in
the vector
GT11 (15) was screened using a labeled DNA probe of clone
41 (12) generated by random priming. Inserts of positive clones were
excised and subcloned to the vector pcDNA3. Sequencing was
performed using an automated Applied Biosystems DNA sequencer.
Cell Lines--
HIT T15 (16) (hamster insulinoma), NIH3T3, and
293T cells were grown in Dulbecco's modified Eagle's medium
supplemented with 10% fetal calf serum (FCS).
TC1 cells (17) (mouse
beta cell line) were grown in Dulbecco's modified Eagle's medium
supplemented with 15% FCS and 2.5% horse serum.
Plasmids and Transfections--
For reporter assay,
chloramphenicol acetyltransferase (CAT) reporter plasmid containing
nine copies of the AP1 binding sequence derived from the SV40 enhancer
(4 µg), GRF
expression vector (5 µg), and RSV-luciferase
internal control plasmid (2 µg) were transfected using the calcium
phosphate procedure (18). Glycerol shock (10%) was performed after
5 h. Cells were harvested 40 h later and extracts prepared
for assay of luciferase (Promega luciferase reagent) and CAT activity.
For phosphorylation analysis, HA-tagged ERK1 expression plasmid (4 µg) was transfected into HIT cells together with 12 µg of GRF1
C,
encoding a dominant negative GRF1, prepared from a GRF1 expression
vector by EcoRI digestion to remove the catalytic domain
(19). Transfections into 293T cells were performed in six-well plates
with 0.25 µg of HA-ERK plasmid, 0.25 µg of GRF1 expression vector,
where indicated, and 3.5 µg of GRF
expression vector or pcDNA3
parental vector alone.
RNA Preparation and RT-PCR Analysis--
RNA was prepared using
the TRI reagent kit (Molecular Research Center, Inc.) followed by DNase
I treatment for 20 min at 37 °C. Mouse islets were prepared by
collagenase digestion followed by Histopaque density gradient
centrifugation (20). Islet RNA was prepared by the guanidinium
thiocyanate procedure (21). RT-PCR was performed using the Access
RT-PCR System (Promega) with 0.5 µg of total RNA.
The primers used to detect GRF
were TCTAGCATCATGCAGAAAGCC
(top strand primer corresponding to nt 130-150 of GRF
) and
GGGAGGAGAACCATAGATGG (bottom strand primer corresponding to nt
680-699). The predicted amplified fragment is 570 bp. The primers used
to detect GRF1 were TCTAGCATCATGCAGAAAGCC (top strand
primer, same as used for GRF
, corresponding to nt 216-236 of mouse
GRF1) and GCGCAGGAAGTTGTTGACAAGG (bottom strand primer corresponding to
nt 1014-1035). The predicted amplified fragment is 820 bp. The
hybridization probe used for GRF
was a restriction fragment
corresponding to the GRF
-specific region (nt 502-599). The
hybridization probe used for GRF1 was a restriction fragment
corresponding to nt 216-478.
One-fifth of the reaction was analyzed by Southern blot as described
previously (12).
RNase Protection Assay--
DNase I-treated RNA samples (20 µg) were mixed with a 32P-labeled antisense probe
produced by in vitro transcription reaction using T3 RNA
polymerase. Samples were processed as described (21) except that RNase
digestion was performed using 6 units of RNase ONE (Promega) in a total
volume of 300 µl.
Immunoblot Analysis--
Cells extracts (21) were resolved on
12% SDS-polyacrylamide gel electrophoresis and subjected to immunoblot
analysis using the following antibodies: rabbit anti-ERK (1:30,000),
mouse antiphosphorylated ERK (1:30,000), and mouse anti-HA epitope
(1:500). Quantitation was performed on autoradiograms in which signals
were within the linear response range using a Bio-Rad model GS-690
densitometer and Multi-Analyst software. Relative ERK phosphorylation
for each sample was determined from the ratio of absorbance using
anti-P ERK to that obtained using anti-HA or anti-ERK. Statistical
significance was evaluated using two-tailed Student's t test.
 |
RESULTS |
Cloning of GRF
--
Using clone 41, one of the products of the
representational difference analysis (12), we screened a
TC1
cDNA library and obtained a 859-bp cDNA with a complete open
reading frame of 178 amino acids (Fig.
1A). A second cDNA clone
isolated in the screen was identical in sequence except that it was
truncated at the 5'-end. Data base comparisons using the 859-bp
cDNA showed that its 5' portion is identical at the DNA level to
the Ras guanine exchange factor, GRF1 (CDC25Mm1) (Fig.
1B) (13, 14, 22). We term the encoded 178-amino acid protein
GRF
. Its N-terminal 92 amino acids are identical to the N terminus
of mouse GRF1 (Fig. 1B), whereas the C-terminal 86 amino
acids show no significant resemblance to known proteins. Thus GRF
lacks all the characteristic motifs of GRF1, except for the N-terminal
pleckstrin homology (PH) domain (Fig. 1B), half of which is
identical to the corresponding portion of GRF1 and half of which
derives from the novel C-terminal portion. The complete identity
between 5' regions of GRF
and GRF1 at the DNA level suggests that
these represent alternate splice products of a single gene. Consistent
with this is the fact that both GRF1 and GRF
sequences match
perfectly the sequence of a mouse genomic clone U55232 up to a position
where all three sequences diverge completely (Fig. 1C). The
sequence of the genomic clone at this location matches exactly the
splice donor consensus sequence (23) (Fig. 1C). To
characterize GRF1 and GRF
transcripts, we performed RNase protection
assay, using a 462-nt antisense probe derived from the GRF
DNA
sequence, which contained a 287-nt identity with GRF1 (Fig.
2A). A distinct band,
corresponding in size to the expected 432-nt GRF
protected fragment
was obtained using
TC1 RNA, but not with
TC1 RNA (Fig.
2A). A faster migrating band corresponding to the expected
287-nt GRF1 protected fragment was also obtained with
TC1 but not
with
TC1 RNA (Fig. 2A).

View larger version (39K):
[in this window]
[in a new window]
|
Fig. 1.
A, DNA sequence and deduced amino acid
sequence of GRF (GenBankTM accession number AF169826). The protein
segment identical to mouse GRF1 (CDC25Mm1) is
underlined. An oligo(A) sequence (presumptive 3' terminus)
is shown in bold. A putative PKA site is boxed. *
indicates stop codon. The sequence of GRF has been scanned against
the data base at protein and DNA levels. Significant relatedness was
observed only against GRF1 (GenBankTM accession number
L20899), GRF2 (GenBankTM accession number U67326), and its
species homologs. B, schematic map comparing GRF and
GRF1. The region of identity between GRF1 and GRF is indicated by
vertical bars. PH, pleckstrin homology domain.
PH1 and PH2, pleckstrin homology domains of GRF1.
C, alignment of GRF (nt 301-375), GRF1 (nt 445-519;
GenBankTM accession number L20899), and the genomic clone
corresponding to GRF1/GRF (nt 901-975; GenBankTM
accession number U55232). Also shown is the splice donor consensus
sequence (23). The sequence GT, corresponding to the invariant
nucleotides found at the 5'-end of introns, is shown in bold
letters.
|
|

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 2.
A, RNase protection assay. Antisense
probe was mixed with 20 µg of total RNA from TC1 and TC1.
Following RNase digestion, the products were resolved on sequencing gel
and exposed to x-ray film. The scheme indicates the expected sizes of
the intact antisense probe (462 nt) and the predicted protected bands
corresponding to GRF RNA (432 nt) and GRF1 (287 nt). The
arrows indicate the migration of labeled DNA size markers.
B, RT-PCR analysis of RNA extracted from the following mouse
tissues: brain (B), pancreas (P), lung
(L), testis (T), spleen (S), kidney
(K), liver (Li), heart (H), muscle
(M), TC1 ( ), TC1 ( ), and islets (Is).
0.5 µg total RNA (left panel) or 5 ng (right panel) was
subjected to RT-PCR followed by hybridization with the indicated
probes. The lower panel shows the ethidium bromide staining
of PCR reactions performed with glyceraldehyde-3-phosphate
dehydrogenase (GPD) primers, as a control for the efficiency
of the RT-PCR reaction.
|
|
To study the tissue distribution of GRF
, we performed RT-PCR
analysis with RNA from different tissues using primers specific for
each splice variant (Fig. 2B). Using the GRF
primers two bands were observed. By isolating and sequencing these bands separately we showed that the upper band represents GRF
and the lower band a
truncated version lacking nucleotides 355-507. The highest levels of
GRF
mRNA were seen in
TC1 cells and in the brain, while GRF1 was expressed at highest levels in the brain and to a lesser extent in
TC1 cells. Both transcripts appeared in substantial amounts in mouse
islets, at similar levels as in
TC1. Taken together, the RNase
protection and the RT-PCR analyses indicate relatively high levels of
GRF
and GRF1 in the brain and beta cells. However, while GRF1 was
expressed at higher levels in the brain than in beta cells, GRF
showed the opposite pattern: higher expression in beta cells than in
the brain.
GRF1 Involvement in ERK Activation by Calcium in Beta
Cells--
To examine the possible role of GRF1 in beta cells, we
treated HIT cells with calcium ionophores. We observed strong
activation of the Ras pathway, as measured by the levels of activated
ERK1/2, almost to the level of the activation obtained by 10% FCS
(Fig. 3A). Activation was also
observed following incubation with ionophore A23187 (Fig.
3B), KCl (50 mM for 10 min), and glucose (15 mM for 10 min) (data not shown). Furthermore, ionomycin led
to activation of ERK also in
TC1 cells (Fig. 3B), but not
in the cell line 293T, which lacks endogenous GRF1 (14) (Fig.
3B).

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 3.
ERK activation in different cell lines.
Protein extracts (10 µg) were subjected to immunoblot using
antibodies recognizing the phosphorylated form of ERK ( Phospho
ERK) and antibodies recognizing both phosphorylated and
nonphosphorylated ERK ( ERK). A, hamster beta
cells (HIT) were incubated overnight in medium containing
0.1% FCS and then incubated with ionomycin (5 µM) or FCS
(10%) for the indicated time (upper panels) or with A23187
for 20 min (+ = 4 µM, ++ = 8 µM)
(lower panels). Numbers shown are the ratios between the
signals obtained with Phospho ERK and ERK as measured by
densitometer. B, 293T cells and TC1 cells were incubated
overnight in medium containing 0.1% FCS and then incubated for 5 min
in the absence or presence of 5 µM ionomycin.
|
|
To determine the role of GRF1 in the calcium-dependent
activation, we constructed a plasmid encoding a truncated GRF1 protein, GRF1
C, lacking its catalytic domain, which is expected to display dominant negative activity (19). When HIT cells were transfected with
GRF1
C, ionomycin-dependent phosphorylation of
co-transfected epitope-tagged HA-ERK was reduced by approximately 70%
(Fig. 4, A and
B).

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 4.
Inhibition of calcium activation by GRF1 C,
the dominant negative form of GRF1. A, HIT cells were
transfected with HA-ERK expression vector, together with 6 µg (+) or
12 µg (++) of expression vector encoding a truncated form of GRF1
lacking the catalytic domain (GRF1 C) or control vector. Cells were
incubated overnight in medium containing 0.1% FCS and for a further 5 min in the presence or absence of 5 µM ionomycin. Cell
extracts were subjected to immunoblot using Phospho ERK and HA
and signals were measured by a densitometer. The histogram shows mean
values for normalized HA-ERK phosphorylation, determined as described
under "Experimental Procedures." *, mean ± S.E.
(n = 5); p < 0.05. B, HIT
cells were transfected with HA-ERK, in the presence of expression
vector encoding GRF1 C or control vector. Cells were incubated
overnight in medium containing 0.1% FCS and for a further 5 min in the
presence of 5 µM ionomycin. Cell extracts (20 µg or 10 µg of protein) were subjected to immunoblot as described for
A.
|
|
GRF
Is an Inhibitor of the Ras Signaling Pathway--
We tested
whether GRF
(which contains the N-terminal 92 amino acids of GRF1)
can affect the Ras/MAPK pathway. In 293T cells co-transfected with GRF1
and GRF
, the extent of ionomycin-dependent ERK
activation was significantly lower than in cells transfected with GRF1
alone (Fig. 5A).
Co-transfection of serum-treated NIH3T3 cells with an AP1 reporter
plasmid and an expression vector encoding the intact GRF
protein
produced a 2-fold lower CAT activity compared with co-transfection with
control vector, almost to the inhibition level obtained with the
dominant negative Ras variant N17 (Fig. 5B) (24). Thus
GRF
behaves as an inhibitor of both GRF1-mediated Ras/ERK signal
transduction and of serum-dependent MAPK signaling pathways
leading to AP1 activation.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 5.
Effect of GRF on Ras
signaling. A, 293T cells were transfected with a
plasmid encoding HA-ERK and the indicated expression vector (+) or an
empty vector ( ). Cells were then incubated in the absence or presence
of ionomycin, collected, and subjected to immunoblot with the indicated
antibodies. The same amount of extract from HIT cells, treated with the
same ionomycin concentration, was loaded on the gel as a control. The
histogram shows mean values for normalized HA-ERK phosphorylation,
determined as described under "Experimental Procedures." *,
mean ± S.E. (n = 4); p < 0.05. B, NIH3T3 cells were transfected with a CAT reporter plasmid
containing nine copies of the AP1 binding site together with expression
vectors encoding GRF or Ras (N17), a dominant negative mutated Ras,
and RSV-luciferase as an internal control of transfection efficiency.
Results are normalized CAT activity (mean ± S.E.
(n = 3)) relative to cells transfected with the CAT
reporter alone.
|
|
 |
DISCUSSION |
Proteins of the Ras family play a crucial role in cell
proliferation, differentiation, and tumorigenesis (25). Their activity depends on the presence of guanine exchange factors (GEFs), which are
essential to promote dissociation of GDP-bound Ras to facilitate binding of GTP. The Sos-related GEF proteins are distributed broadly in
many cell types and typically activate Ras following activation of
growth factor receptor and a membrane recruitment mechanism mediated by
the adapter protein Grb2 (26). The GRF-related GEFs, on the other hand,
are less widely distributed; GRF1 is present in neuronal cells (14) and
additional tissues and tumor cells (27); it activates Ras in a
calcium-dependent fashion (14, 28).
Calcium-dependent activation is mediated through calmodulin binding to an N-terminal IQ domain; however the precise mechanism leading to calcium-dependent activation remains to be
determined and involves also pleckstrin and coiled-coil domains of the
protein (28). A number of naturally occurring splice variants have been identified previously (29); these apparently represent N-terminal truncations rather than C-terminal truncations. The physiological significance of these truncations has not been addressed.
In this study, we have demonstrated for the first time that GRF1 is
expressed in pancreatic beta cells. The inhibitory effect of a
truncated dominant negative form of GRF1 suggests that GRF1 is
essential for activation of calcium-dependent MAP kinase
activity in the beta cell. We have further identified GRF
, a novel
178-amino acid protein comprising the N-terminal 92 amino acids of
GRF1, including a portion of the PH1 domain of GRF1 and 86 unrelated amino acids. GRF
RNA was detected in beta cells and brain. We provide evidence that GRF
represents a naturally occurring dominant negative form of GRF1, which may play a role in regulating the normal
function of GRF1. The mechanism whereby GRF
inhibits signaling is
not clear. On the one hand, the N terminus of GRF1 has been shown in
in vitro studies to inhibit the catalytic activity of GRF1
(30), perhaps through intra-molecular rearrangement. On the other hand,
in vivo studies clearly show that deletion of the N-terminal
PH1 domain leads to both intracellular redistribution of the protein
and loss of calcium responsiveness (28). Probably the PH1 domain has
multiple functions, including a role in proper intracellular localization.
The physiological role of GRF1 is not yet established. Mice lacking the
GRF1 gene display impaired memory consolidation and slow growth (31,
32). The presence of GRF1 in beta cells and the ability of a dominant
negative form to inhibit calcium-dependent MAPK activity
suggest a key role for GRF1 in beta cell calcium signaling. GRF
may
function in vivo to modulate GRF1-dependent Ras
activation. It remains to be established how GRF1 and GRF
are
regulated to activate MAPK activity and how MAPK activity influences
beta cell function.
 |
ACKNOWLEDGEMENTS |
We thank C. Ezerzer, V. Ablamunits, and S. Weiss for advice and assistance; Dr. L. Feig for kindly providing the
GRF1 expression plasmid; Dr. S. Michaeli for advice; and Dr. S. Lev for
helpful comments on the manuscript.
 |
FOOTNOTES |
*
This work was supported by a grant (to M. D. W.)
from the Juvenile Diabetes Foundation International.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
Holds the Marvin Meyer and Jenny Cyker Chair of Diabetes
Research. To whom correspondence should be addressed. Tel.:
972-8-934-3597; Fax: 972-8-934-4118; E-mail:
bcwalker@wiccmail.weizmann.ac.il.
 |
ABBREVIATIONS |
The abbreviations used are:
MAP, mitogen-activated protein;
MAPK, mitogen-activated protein kinase;
FCS, fetal calf serum;
CAT, chloramphenicol acetyltransferase;
HA, hemagglutinin;
ERK, extracellular signal-related kinase;
RT-PCR, reverse transcriptase-polymerase chain reaction;
nt, nucleotide(s);
bp, base pair(s);
PIPES, 1,4-piperazinediethanesulfonic acid;
PH, pleckstrin homology;
GEF, guanine nucleotide exchange factor.
 |
REFERENCES |
| 1.
|
Matschinsky, F. M.,
Glaser, B.,
and Magnuson, M. A.
(1998)
Diabetes
47,
307-315[Abstract]
|
| 2.
|
Efrat, S.,
Tal, M.,
and Lodish, H. F.
(1994)
Trends Biochem Sci.
19,
535-538[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Frodin, M.,
Sekine, N.,
Roche, E.,
Filloux, C.,
Prentki, M.,
Wollheim, C. B.,
and Van Obberghen, E.
(1995)
J. Biol. Chem.
270,
7882-7889[Abstract/Free Full Text]
|
| 4.
|
Khoo, S.,
and Cobb, M. H.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
5599-5604[Abstract/Free Full Text]
|
| 5.
|
Benes, C.,
Roisin, M. P.,
Van, T. H.,
Creuzet, C.,
Miyazaki, J.,
and Fagard, R.
(1998)
J. Biol. Chem.
273,
15507-15513[Abstract/Free Full Text]
|
| 6.
|
Burns, C. J.,
Howell, S. L.,
Jones, P. M.,
and Persaud, S. J.
(1999)
Mol. Cell. Endocrinol.
148,
29-35[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Macfarlane, W. M.,
Smith, S. B.,
James, R. F.,
Clifton, A. D.,
Doza, Y. N.,
Cohen, P.,
and Docherty, K.
(1997)
J. Biol. Chem.
272,
20936-20944[Abstract/Free Full Text]
|
| 8.
|
Macfarlane, W. M.,
McKinnon, C. M.,
Felton-Edkins, Z. A.,
Cragg, H.,
James, R. F.,
and Docherty, K.
(1999)
J. Biol. Chem.
274,
1011-1016[Abstract/Free Full Text]
|
| 9.
|
Lisitsyn, N.,
Lisitsyn, N.,
and Wigler, M.
(1993)
Science
259,
946-951[Abstract]
|
| 10.
|
Hubank, M.,
and Schatz, D. G.
(1994)
Nucleic Acids Res.
22,
5640-5648[Abstract/Free Full Text]
|
| 11.
|
Arava, Y.,
Adamsky, K.,
Belleli, A.,
Shaltiel, S.,
and Walker, M. D.
(1998)
FEBS Lett.
425,
24-28[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Arava, Y.,
Adamsky, K.,
Ezerzer, C.,
Ablamunits, V.,
and Walker, M. D.
(1999)
Diabetes
48,
552-556[Abstract]
|
| 13.
|
Shou, C.,
Farnsworth, C. L.,
Neel, B. G.,
and Feig, L. A.
(1992)
Nature
358,
351-354[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Farnsworth, C. L.,
Freshney, N. W.,
Rosen, L. B.,
Ghosh, A.,
Greenberg, M. E.,
and Feig, L. A.
(1995)
Nature
376,
524-527[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Walker, M. D.,
Park, C. W.,
Rosen, A.,
and Aronheim, A.
(1990)
Nucleic Acids Res.
18,
1159-1166[Abstract/Free Full Text]
|
| 16.
|
Santerre, R. F.,
Cook, R. A.,
Crisel, R. M. D.,
Sharp, J. D.,
Schmidt, R. J.,
Williams, D. C.,
and Wilson, C. P.
(1981)
Proc. Natl. Acad. Sci. U. S. A.
78,
4339-4343[Abstract/Free Full Text]
|
| 17.
|
Efrat, S.,
Linde, S.,
Kofod, H.,
Spector, D.,
Delannoy, M.,
Grant, S.,
Hanahan, D.,
and Baekkeskov, S.
(1988)
Proc. Natl. Acad. Sci U. S. A.
85,
9037-9041[Abstract/Free Full Text]
|
| 18.
|
Wigler, M.,
Pellicer, A.,
Silverstein, S.,
Axel, R.,
Urlaub, G.,
and Chasin, L.
(1979)
Proc. Natl. Acad. Sci. U. S. A.
76,
1373-1376[Abstract/Free Full Text]
|
| 19.
|
Zippel, R.,
Orecchia, S.,
Sturani, E.,
and Martegani, E.
(1996)
Oncogene
12,
2697-2703[Medline]
[Order article via Infotrieve]
|
| 20.
|
Gotoh, M.,
Maki, T.,
Kiyoizumi, T.,
Satomi, S.,
and Monaco, A. P.
(1985)
Transplantation
40,
437-438[Medline]
[Order article via Infotrieve]
|
| 21.
|
Ausubel, F. M.,
Brent, R.,
Kingston, R. E.,
Moore, D. D.,
Seidman, J. G.,
Smith, J. A.,
and Struhl, K.
(1988)
Current Protocols in Molecular Biology
, Greene/Wiley-Interscience, New York
|
| 22.
|
Cen, H.,
Papageorge, A. G.,
Zippel, R.,
Lowy, D. R.,
and Zhang, K.
(1992)
EMBO J.
11,
4007-4015[Medline]
[Order article via Infotrieve]
|
| 23.
|
Mount, S. M.
(1982)
Nucleic Acids Res.
10,
459-472[Abstract/Free Full Text]
|
| 24.
|
Quilliam, L. A.,
Kato, K.,
Rabun, K. M.,
Hisaka, M. M.,
Huff, S. Y.,
Campbell-Burk, S.,
and Der, C. J.
(1994)
Mol. Cell. Biol.
14,
1113-1121[Abstract/Free Full Text]
|
| 25.
|
Lowy, D. R.,
and Willumsen, B. M.
(1993)
Annu. Rev. Biochem.
62,
851-891[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
Qian, X.,
Vass, W. C.,
Papageorge, A. G.,
Anborgh, P. H.,
and Lowy, D. R.
(1998)
Mol. Cell. Biol.
18,
771-778[Abstract/Free Full Text]
|
| 27.
|
Guerrero, C.,
Rojas, J. M.,
Chedid, M.,
Esteban, L. M.,
Zimonjic, D. B.,
Popescu, N. C.,
Font de Mora, J.,
and Santos, E.
(1996)
Oncogene
12,
1097-1107[Medline]
[Order article via Infotrieve]
|
| 28.
|
Buchsbaum, R.,
Telliez, J. B.,
Goonesekera, S.,
and Feig, L. A.
(1996)
Mol. Cell. Biol.
16,
4888-4896[Abstract]
|
| 29.
|
Cen, H.,
Papageorge, A. G.,
Vass, W. C.,
Zhang, K. E.,
and Lowy, D. R.
(1993)
Mol. Cell. Biol.
13,
7718-7724[Abstract/Free Full Text]
|
| 30.
|
Baouz, S.,
Jacquet, E.,
Bernardi, A.,
and Parmeggiani, A.
(1997)
J. Biol. Chem.
272,
6671-6676[Abstract/Free Full Text]
|
| 31.
|
Brambilla, R.,
Gnesutta, N.,
Minichiello, L.,
White, G.,
Roylance, A. J.,
Herron, C. E.,
Ramsey, M.,
Wolfer, D. P.,
Cestari, V.,
Rossi, A. C.,
Grant, S. G.,
Chapman, P. F.,
Lipp, H. P.,
Sturani, E.,
and Klein, R.
(1997)
Nature
390,
281-286[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Itier, J. M.,
Tremp, G. L.,
Leonard, J. F.,
Multon, M. C.,
Ret, G.,
Schweighoffer, F.,
Tocque, B.,
Bluet, P. M.,
Cormier, V.,
and Dautry, F.
(1998)
Nature
393,
125-126[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.