|
J Biol Chem, Vol. 274, Issue 35, 24550-24558, August 27, 1999
Agonist-dependent Up-regulation of Human Somatostatin
Receptor Type 1 Requires Molecular Signals in the Cytoplasmic
C-tail*
Nedim
Hukovic ,
Magalie
Rocheville§,
Ujendra
Kumar,
Ramakrishnan
Sasi,
Suvarnalatha
Khare, and
Yogesh C.
Patel¶
From Fraser Laboratories, Departments of Medicine, Neurology and
Neurosurgery, and Pharmacology and Therapeutics, McGill University,
Royal Victoria Hospital and the Montreal Neurological Institute,
Montreal, Quebec H3A 1A1, Canada
 |
ABSTRACT |
We have previously reported that the
human somatostatin receptor type 1 (hSSTR1) stably expressed in Chinese
hamster ovary-K1 cells does not internalize but instead up-regulates at
the membrane during continued agonist treatment (1 µM somatostatin (SST)-14 × 22 h). Here
we have investigated the molecular basis of hSSTR1 up-regulation.
hSSTR1 was up-regulated by SST in a time-, temperature-, and
dose-dependent manner to saturable levels, in intact cells but not in membrane preparations. Although hSSTR1 was acutely desensitized to adenylyl cyclase coupling after 1 h SST-14
treatment, continued agonist exposure (22 h) restored functional
effector coupling. Up-regulation was unaffected by cycloheximide but
blocked by okadaic acid. Confocal fluorescence immunocytochemistry of intact and permeabilized cells showed progressive,
time-dependent increase in surface hSSTR1 labeling,
associated with depletion of intracellular SSTR1 immunofluorescent
vesicles. To investigate the structural domains of hSSTR1 responsible
for up-regulation, we constructed C-tail deletion ( ) mutants and
chimeric hSSTR1-hSSTR5 receptors. Human SSTR5 was chosen because it
internalizes readily, displays potent C-tail internalization signals,
and does not up-regulate. Like wild type hSSTR1, C-tail hSSTR1 did
not internalize and additionally lost the ability to up-regulate.
Swapping the C-tail of hSSTR1 with that of hSSTR5 induced
internalization (27%) but not up-regulation. Substitution of hSSTR5
C-tail with that of hSSTR1 converted the chimeric receptor to one
resembling wild type hSSTR1 (poor internalization, 71% up-regulation).
These results show that ligand-induced up-regulation of hSSTR1 occurs
by a temperature-dependent active process of receptor
recruitment from a pre-existing cytoplasmic pool to the plasma
membrane. It does not require new protein synthesis or signal
transduction, is sensitive to dephosphorylation events, and critically
dependent on molecular signals in the receptor C-tail.
 |
INTRODUCTION |
Somatostatin (SST),1 a
naturally occurring regulatory peptide with two biologically active
forms, SST-14 and SST-28, is produced in neural, endocrine, and immune
cells and exerts potent effects on many different tissue targets
including the brain, pituitary, pancreas, gut, thyroid, adrenals, and
kidneys (1-3). The cellular actions of SST include the inhibition of
hormone and exocrine secretion as well as modulation of
neurotransmission and cell proliferation and are mediated by G
protein-coupled receptors (GPCR) (2, 3). Somatostatin receptors (SSTR)
belong to the family of seven transmembrane domain proteins and
comprise five distinct subtypes that are encoded by separate genes (2,
3). In the case of the human receptors, four of the isoforms
(hSSTR1-4) display weak selectivity for binding to SST-14, whereas
hSSTR5 shows preference for SST-28 binding (2). SSTRs are widely
expressed in many tissues frequently as multiple subtypes that coexist
in the same cell (2-6). The five receptors share common signaling pathways such as the inhibition of adenylyl cyclase, activation of
phosphotyrosine phosphatase, or modulation of mitogen-activated protein
(MAP) kinase through G protein-dependent mechanisms (2, 3,
7). Some of the subtypes are also coupled to K+ and
Ca2+ ion channels, to phospholipase C, and phospholipase
A2 (2). hSSTR1 activates a Na+/H+
exchanger via a non-G protein-linked pathway (8).
A common property of most GPCRs is their ability to regulate their
responsiveness to continued agonist exposure (9). Such agonist-specific
regulation typically involves receptor desensitization due to
uncoupling from G proteins, as well as receptor internalization and
receptor degradation (9). The underlying molecular mechanisms have been
extensively studied in the case of the -adrenergic and several other
GPCRs, and a general model has been proposed that involves
phosphorylation of the C-tail and intracellular loops of the
agonist-occupied receptor by a second messenger activated or G
protein-coupled receptor kinase, resulting in rapid attenuation of
receptor signaling. G protein-coupled receptor kinase phosphorylation promotes the binding of -arrestin, which acts as an adapter molecule linking the receptor to clathrin-mediated endocytosis (9-11). The
endocytosed receptor is either sorted to lysosomes for degradation if
agonist stimulation is prolonged or recycled back to the cell surface
as a result of pH-dependent conformational change and dephosphorylation by a membrane-associated GPCR phosphatase in endosomes (9-11). Another less well known type of agonist-induced receptor regulation is the property of receptor up-regulation that
occurs in response to chronic agonist stimulation of receptors such as
the 3-adrenergic receptor ( 3AR) (12),
5HT2A (13, 14), gonadotropin-releasing hormone (GnRH) (15), angiotensin II (16), dopamine 3 (17), the long form of dopamine 2 (D2LR) (18-21), and endogenous SSTRs (22). Since
continuous exposure of receptors to agonists is unlikely to occur under
normal physiological conditions, this type of response appears to be
pharmacological and is observed during long term drug therapy or in
disease states. Unlike receptor down-regulation, the underlying
molecular mechanisms for up-regulation are poorly understood and
thought to involve ligand-induced transcriptional or
posttranscriptional induction of receptor synthesis and targeting to
the plasma membrane (12-20).
In the case of the SSTR family, we have previously reported that hSSTR5
stably expressed in CHO-K1 cells undergoes rapid
agonist-dependent desensitization and internalization,
whereas hSSTR1 under the same conditions fails to be internalized and
is up-regulated at the plasma membrane following prolonged agonist
exposure (23, 24). To identify the underlying molecular signals, we
have here created C-tail deletion mutants and hSSTR1/hSSTR5 chimeras,
and we have analyzed the ability of these mutant receptors to undergo agonist-dependent internalization or up-regulation as well
as G protein-linked coupling to adenylyl cyclase. We have further investigated membrane and intracellular trafficking of hSSTR1 as well
as the relationship between the internalization and up-regulation pathways. We report that the up-regulated receptor is functionally coupled to G proteins and that up-regulation of hSSTR1 is an intrinsic property of the receptor that occurs in the absence of endocytosis or
new protein synthesis by an active process of receptor recruitment from
the cytoplasm to the cell surface. Furthermore, the receptor C-tail
contains molecular signals that specify up-regulation.
 |
EXPERIMENTAL PROCEDURES |
Materials--
SST-14, SST-28, and Leu8,
D-Trp22, Tyr25 SST-28 (LTT SST-28)
were from Bachem (Marina Del Rey, CA). Cycloheximide, pertussis toxin, okadaic acid, phenylmethylsulfonyl fluoride, and bacitracin were from
Sigma. Carrier-free Na125I was obtained from Amersham
Pharmacia Biotech. Rhodamine-conjugated goat anti-rabbit IgG was from
Jackson Immunoresearch Laboratories (West Grove, PA). Ham's F-12
medium, fetal bovine serum, and G418 were from Life Technologies Inc.
Cyclic AMP radioimmunoassay kits were obtained from Diagnostic Products
Corp. (Los Angeles, CA). All other reagents were of analytical grade
and purchased from various suppliers.
Construction of Wild Type, Mutant, and Chimeric
Receptors--
cDNA for wild type hSSTR5 was created as a cassette
construct in PTEJ8. Wild type (wt) hSSTR1 DNA encoding the complete
receptor sequence was generated by PCR amplification using human
genomic DNA as template and subcloned into the pDNA3 expression vector. A series of mutant and chimeric hSSTR1/hSSTR5 receptors were created to
investigate the role of the C-tail in the internalization and up-regulation properties of the receptors (Fig.
1). The cytoplasmic tail (C-tail) of wt
hSSTR1 contains 65 amino acid residues with 3 tyrosine residues and 11 serine or threonine residues that could serve as putative
phosphorylation sites. The wt hSSTR5 C-tail contains 55 amino acid
residues with 7 potential serine/threonine phosphorylation sites.
C-tail deletions were created at position 318 for hSSTR5 ( C-tail
hSSTR5) and at position 331 for hSSTR1 ( C-tail hSSTR1). Chimeric
receptors were constructed by swapping the C-tail of hSSTR5 with the
C-tail of hSSTR1 and of the C-tail of hSSTR1 with the C-tail of hSSTR5.
Mutations were created by the PCR overlap extension technique (25); for
the C-tail-truncated mutants, oligonucleotide primers were used that
contain an appropriately placed stop codon after position 331 (hSSTR1)
and position 318 (hSSTR5). Chimeric receptors were constructed using
oligonucleotide primers designed to allow separate amplification of 5',
3', and internal segments that were subsequently fused by PCR. All
primers were designed so as to avoid any change in the reading frame as follows: primer A,
5'-GATCAAGCTTGCCGCCACCATGTTCCCCAATGGCACCGCC-3' (R1 forward);
primer B, 5'-CAGCCCGGCCGCACACACCACGGAGTAGAT-3' (R1-R5 reverse); primer
C, 5'-TGTGCGGCCGGGCTG-3' (R1-R5 forward); primer D,
5'-GATCGAATTCTTATCAGAGCGTCGTGATCCGG-3' (R5 reverse); primer E, 5'
GACTAAGCTTCTGCCGCCATGGAGCCCCTG -3' (R5 forward); primer F,
5'-GCGCTTGAAGTTGTCCGAGAGGAAGC-3' (R5-R1 reverse); primer G, 5'-CTCGGACAACTTCAAGCGCTC-3' (R5-R1 forward); primer H,
5'-GATCGAATTCTTATCAGAGCGTCGTGATCCGG-3' (R1 reverse).

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 1.
Schematic depiction of the putative membrane
topology of wt hSSTR1 (391 residues) and wt hSSTR5 (363 residues) and
of the C-tail hSSTR1 + C-tail hSSTR5 and C-tail hSSTR5 + C-tail hSSTR1 chimeric
receptors. Residues in the VIIth transmembrane domain and C-tail
of wt hSSTR1 and wt hSSTR5 are marked. Putative phosphorylation sites
on serine and threonine residues are highlighted by the dark
circles. CHO, putative N-linked
glycosylation site, the zig-zag line denotes putative palmitoylation
site. C-tail deletion mutants of hSSTR1 and hSSTR5 were created by
introducing stop codons after position 331 (hSSTR1) and position 318 (hSSTR5).
|
|
To construct the C-tail hSSTR1/C-tail hSSTR5 chimera, primer pairs
A and B were used to synthesize the 5' fragment of SSTR1 using SSTR1
cDNA as template for PCR. Primer pairs C and D were used to
generate the 3' C-terminal fragment using SSTR5 cDNA as template.
PCR was carried out with 50 ng of SSTR cDNA in 100 µl containing
20 mM Tris-HCl, pH 8.5, 50 mM KCl, 200 µM dNTPs, 1.5 mM MgCl2, 7%
Me2SO, and 2.00 units of Pfu polymerase
(Stratagene). The PCR conditions were as follows: denaturation at
94 °C for 1 min, annealing at 58 °C for 50 s, and extension
at 72 °C for 75 s for 25 cycles followed by extension at
72 °C for 10 min. PCR products were separated by agarose gel
electrophoresis; the amplified bands were electroeluted and purified.
Receptor fragments A B and C D were then fused in a third PCR
reaction to generate the full-length chimeric receptor in a ligation
reaction using flanking primer pairs A and D. The C-tail hSSTR5 + C-tail SSTR1 chimera was generated using primer pairs E F and G H to
synthesize the 5' and 3' receptor fragments, respectively. The purified
amplification products were ligated by PCR using primer pairs E and H. All 5'-flanking primers contained HindIII endonuclease
restriction sites, Kozak consensus sequences, and initiation codons.
All 3'-flanking primers comprised a stop codon followed by an
EcoRI restriction site. After PCR ligation, the products
were digested to completion with HindIII and
EcoRI, and purified fragments were subcloned into the
HindIII-EcoRI multiple cloning sites of pTEJ8.
The structure of all mutant and chimeric receptor constructs was
confirmed by sequence analysis (University Core DNA Service, University
of Calgary, Alberta, Canada). CHO-K1 cells were transfected with cDNAs for wild type or mutant and chimeric hSSTR1/hSSTR5 receptors by the Lipofectin method (Life Technology, Inc.), and stable
G418-resistant nonclonally selected cells were propagated for study. wt
hSSTR1 was also stably expressed in HEK-293 cells by the same method.
Binding Assays--
CHO-K1 cells expressing wild type, mutant,
or chimeric receptors were cultured in D75 flasks to ~70% confluency
in Ham's F-12 medium containing 10% fetal calf serum and 700 µg/ml
G418. Cells were harvested, homogenized, and membranes prepared by
centrifugation. Binding studies were carried out for 30 min at 37 °C
with 20-40 µg of membrane protein and 125I-LTT SST-28
radioligand in 50 mM Hepes, pH 7.5, 2 mM
CaCl2, 5 mM McCl2, 0.5% bovine
serum albumin, 0.02% phenylmethylsulfonyl fluoride, and 0.02%
bacitracin (binding buffer) as described previously (23, 24).
Saturation binding experiments were performed with membranes using
increasing concentrations of 125I-LTT SST-28 (2-2000
pM) under equilibrium binding conditions (24). Incubations
were terminated by the addition of 1 ml of ice-cold phosphate-buffered
saline containing 0.2% bovine serum albumin, rapid centrifugation, and
washing. Radioactivity associated with membrane pellets was quantified
in an LKB gamma counter (LKB-Wallach, Turku, Finland). Binding data
were analyzed with INPLOT 4.03 (Graph Pad Software, San Diego, CA).
Coupling to Adenylyl Cyclase--
Receptor coupling to adenylyl
cyclase was tested by incubating cells for 30 min with 1 µM forskolin and 0.5 mM
3-isobutyl-1-methylxanthine with or without SST (10 6 - 10 10 M) at 37 °C as described previously
(24). Cells were then scraped in 0.1 N HCl and assayed for
cAMP by radioimmunoassay.
Internalization Experiments (Acute Agonist Exposure)--
CHO-K1
cells expressing wild type, mutant, and chimeric SSTRs were cultured in
6-well plates and studied at ~90% confluency (1.5 × 106 cells/well). Cells were equilibrated overnight at
4 °C with 125I-LTT SST-28 with or without 100 nM SST-14 (for hSSTR1) or 100 nM SST-28 (for
hSSTR5). After washing, cells were warmed to 37 °C for 15, 30, and
60 min to initiate internalization (23, 24). At the end of each
incubation, surface-bound radioligand was removed by treatment for 10 min at 37 °C with 1 ml of acid wash (Hanks'-buffered saline
acidified to pH 5.0 with 20 mM sodium acetate).
Internalized radioligand was measured as acid-resistant counts in 0.1 N NaOH extracts of acid-washed cells.
Up-regulation Experiments (Chronic Agonist Exposure)--
CHO-K1
cells expressing wild type, mutant, and chimeric receptors were
cultured in 6-well plates in F-12 medium without fetal calf serum with
10 7 M SST-14 or SST-28 for 4, 9, 13, 16, 19, and 22 h at 37 °C. After acid wash to remove surface-bound SST,
whole cell binding assays were performed to determine total and
nonspecific binding (24). Residual surface binding was calculated as
the difference between control and experimental groups. Dose dependence
of up-regulation was studied by incubating cells with
10 11-10 6 M SST-14 for 22 h at 37 °C. The effect of blocking protein synthesis on
up-regulation of hSSTR1 was investigated by applying cycloheximide 10 µg/ml for 30 min to CHO-K1 cells expressing wt hSSTR1 as described previously (22). The effect of pertussis toxin and okadaic acid on
SST-induced hSSTR1 up-regulation was determined by continuous treatment
with pertussis toxin 100 ng/ml or okadaic acid 200 nM followed by whole cell binding analyses. To investigate the fate of the
up-regulated membrane receptor, cells were cultured for 22 h with
10 7 M SST-14 to induce up-regulation. Cells
were then washed gently with 1 ml of 20 mM sodium acetate
pH 5.0 for 2 min to remove surface-bound SST-14 and reincubated in
culture medium without ligand. Residual surface receptors were analyzed
at 12 and 22 h by whole cell binding.
Immunocytochemistry--
To analyze surface and cytoplasmic
pools of receptors, intact or 0.2% Triton X-100-permeabilized CHO-K1
cells expressing wt hSSTR1 or wt hSSTR5 were processed for confocal
fluorescence immunocytochemistry using rabbit polyclonal antipeptide
receptor antibodies (4-6, 24). CHO-K1 cells expressing SSTRs were
cultured to ~70% confluency and treated with SST for different
times. To analyze surface expression of receptors, cells were incubated
in serum-free Ham's F-12 medium supplemented with 1% bovine serum
albumin in the presence of SSTR primary antibodies for 8-12 h at
4 °C. After washing in 50 mM Tris-HCl, 0.9% NaCl (TBS),
pH 7.4, cells were fixed for 30 min at 4 °C in 4% paraformaldehyde.
To label the cytoplasmic pool of receptors, cells were permeabilized
with 0.2% Triton X-100 in TBS for 5 min at room temperature, washed
three times in TBS, and incubated with SSTR primary antibodies for
8-12 h at 4 °C. Antipeptide antibodies directed against the
N-terminal segment of hSSTR1 (49GTLSEGQGS57)
and hSSTR5 (4LF(P/S)(A/L)STPS11) were produced
as described previously and used at a dilution of 1:500 (4). Preimmune
serum and antigen-absorbed antibody were used as controls. Cells were
then rinsed three times in TBS and incubated for 1 h with
rhodamine-conjugated goat anti-rabbit secondary antibody (1:100) at
room temperature. After three additional washes, cells were mounted
with immunofluor and viewed under a Zeiss LSM 410 confocal
microscope. Images were obtained as single optical sections taken
through the middle of cells and averaged over 32 scans/frame. They were
archived on an Iomega Jaz Disc and printed on a Kodak XLS 8300 high
resolution (300 dpi) printer.
 |
RESULTS |
Binding Characteristics of C-tail Deletion and Chimeric
Receptors--
The C-tail deletion and chimeric receptors were
correctly targeted to the plasma membrane as determined by binding
analysis (Table I). Saturation binding
analysis of CHO-K1 cell membranes revealed a comparable level of
expression of wt hSSTR1 and wt hSSTR5 (229 ± 10 and 180 ± 28 fmol/mg protein, respectively). The C-tail hSSTR1 mutant
displayed a small reduction in Bmax (113 ± 14 fmol/mg) and binding affinity (Kd 2.3 nM compared with Kd 0.62 nM
for wt hSSTR1). As previously reported, the C-tail hSSTR5 mutant
displayed high affinity ligand binding (Kd 0.89 nM) which, however, was 3-fold lower than that of the wild
type receptor (21). In contrast, the binding parameters of the C-tail hSSTR5 mutant were comparable to those of the wild type
receptor. Likewise, the Kd and
Bmax of the two chimeric receptors were
comparable to that of wt hSSTR1 and wt hSSTR5.
View this table:
[in this window]
[in a new window]
|
Table I
Comparison of binding, internalization, up-regulation, and adenylyl
cyclase coupling of wild type, mutant, and chimeric receptors
Data shown are the mean ± S.E. of at least three independent
experiments.
|
|
Agonist-induced Regulation of wt hSSTR1 and wt hSSTR5--
As
reported previously, 125I-LTT SST-28 when bound to hSSTR5
was rapidly internalized in a time- and
temperature-dependent manner with 66 ± 7%
internalization after 60 min at 37 °C, whereas hSSTR1 under
comparable incubation conditions showed no internalization (21, 22).
Furthermore, long term exposure to SST-14 or SST-28 (10 7
M) induced time-dependent up-regulation of
hSSTR1 (110 ± 17% increase in surface binding after 22 h at
37 °C) with no effect on hSSTR5 (Fig.
2A). Up-regulation of hSSTR1
was temperature-dependent and was reduced to 44 ± 16% at 20 °C and virtually abolished at 4 °C (Fig.
2A). Up-regulation was also dose-dependent over
the concentration range 10 11-10 6
M SST-14 (Fig. 2C). When cells expressing hSSTR1
were first treated with SST-14 (10 7 M) for
22 h to up-regulate the receptors, and the SST was then removed,
there was a slow loss of surface hSSTR1 expression from 110% at time 0 to 48 ± 9% at 12 h and 8 ± 3% at 22 h (Fig.
2B). To determine whether receptor up-regulation was a
membrane phenomenon due to aggregation or clustering, membranes rather
than whole cells were pre-exposed to SST-14 for 22 h at 37 °C
in binding buffer with protease inhibitors (Protease Inhibitor Mixture,
1 tablet/50 ml binding buffer, Roche Molecular Biochemicals). Under these conditions, receptor concentration (Bmax)
immediately after the preparation of membranes was 229 ± 10 fmol/mg protein and did not change significantly when incubated in
binding buffer alone for 22 h at 37 °C indicating stability of
the receptor in the membrane preparation. In contrast to whole cells,
however, hSSTR1 in membrane preparations showed no up-regulation during 22 h treatment with 10 7 M SST-14. This
suggests that up-regulation is a temperature-dependent, active process requiring the intact cell. Treatment of hSSTR1 cells
with pertussis toxin reduced up-regulation by 36 ± 8% suggesting that the up-regulation response is only partly mediated by
Gi or Go proteins (Fig.
3). Pretreatment of cells with
cycloheximide (10 µg/µl for 30 min) had no effect on hSSTR1
up-regulation (Fig. 3). Okadaic acid (200 nM) completely
abolished up-regulation. This suggests that up-regulation of hSSTR1
does not require new protein synthesis but is dependent on
dephosphorylation events. To exclude the possibility that up-regulation
is a peculiarity of CHO-K1 cell transfection or the level of receptor
expression, HEK-293 cells transfected with hSSTR1 were analyzed. These
cells expressed 5-fold higher density of hSSTR1
(Bmax 1.2 ± 0.135 pmol/mg protein); like
CHO-K1 cells they failed to internalize 125I-LTT SST-28 and
displayed 97 ± 16% up-regulation of cell surface binding after
continuous treatment with SST-14 (10 7 M) for
22 h at 37 °C.

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 2.
Effect of time, temperature, and agonist
(SST-14) concentration on surface hSSTR1 expression in stable CHO-K1
cells determined by whole cell binding with 125I-LTT-SST-28
ligand. A, 10 7 M SST induces
surface-receptor expression in a time- and
temperature-dependent manner. , 37 °C; , 20 °C;
*, 4 °C. B, removal of SST-14 results in a slow loss of
surface hSSTR1-binding sites over 48 h. C, agonist
dose-response curve of hSSTR1 up-regulation. (Mean ± S.E. of
three independent experiments in triplicate.)
|
|

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 3.
Effect of pertussis toxin
(PTx), cycloheximide, and okadaic acid on hSSTR1
up-regulation by SST-14 (10 7 M) treatment for
22 h. Whole cell binding assays were carried out with
125I-LTT-SST-28. SST increases surface binding by 110%
which is reduced by 36% by pertussis toxin. Cycloheximide has no
effect on hSSTR1 up-regulation, whereas okadaic acid completely
abolishes the up-regulation response. , control binding; ,
SST-14; , SST-14 + test agent shown (mean ± S.E. of three
independent experiments); *, p < 0.05; **,
p < 0.01.
|
|
Confocal Fluorescence Immunocytochemistry of hSSTR1 and
hSSTR5--
In this experiment, we investigated changes in the pattern
of expression of hSSTR1 and hSSTR5 proteins in the plasma membrane and
intracellular compartments by immunofluorescence with antipeptide receptor antibodies in intact and permeabilized CHO-K1 cells stably expressing hSSTR1 and hSSTR5 (Figs. 4 and 5). After treatment with
SST-14 for 0, 1, 16, and 22 h, nonpermeabilized hSSTR1 cells (Fig.
4, A, C,
E, and G) displayed surface labeling that
increased progressively over time with agonist treatment. Permeabilized cells (Fig. 4, B, D, F, and H) revealed labeling
of ill defined small cytoplasmic vesicular structures at 0 and 1 h
which decreased after 16 and 22 h treatment with SST-14. Fig.
5 (A, C, E, and G)
show surface labeling of hSSTR5 in nonpermeabilized cells. In contrast
to hSSTR1, permeabilized hSSTR5 cells (Fig. 5, B, D, F, and
H) showed a well defined population of hSSTR5-positive cytoplasmic vesicles. Morphologically, these vesicles were larger than
the hSSTR1-positive vesicles, and their cytoplasmic density appeared to
be unchanged following agonist stimulation. As expected, surface
labeling of both hSSTR1 and hSSTR5 in Figs. 4 and 5 was virtually
abolished in the permeabilized cells as a result of Triton X-100
treatment. These results suggest that SSTR1 up-regulation is due to
recruitment of receptors from cytoplasmic vesicles to the plasma
membrane.

View larger version (64K):
[in this window]
[in a new window]
|
Fig. 4.
Immunoconfocal optical sections illustrating
fluorescence analysis of hSSTR1 in stably transfected CHO-K1
cells. After treatment with SST-14 for 0, 1, 16, and 22 h,
nonpermeabilized cells (A, C, E, and G) and
Triton X-100-permeabilized cells (B, D, F, and H)
were labeled with rabbit anti-hSSTR1 primary antibody and
rhodamine-conjugated goat anti-rabbit secondary antibody.
Nonpermeabilized hSSTR1 cells display surface labeling which increases
progressively with SST-14 treatment. Permeabilized cells reveal
labeling of ill-defined small cytoplasmic vesicular structures at 0 and
1 h which decrease over time with agonist treatment. Scale
bar, 25 µm.
|
|

View larger version (79K):
[in this window]
[in a new window]
|
Fig. 5.
Immunoconfocal optical sections illustrating
immunofluorescence analysis of hSSTR5 in stably transfected CHO-K1
cells. Cells were treated with SST-14 for 0, 1, 16, and 22 h,
and receptor immunoreactivity was detected in intact (A, C,
E, and G) and permeabilized (B, D, F, and
H) cells by immunofluorescence using rabbit anti-hSSTR5
primary antibody and rhodamine-conjugated goat anti-rabbit secondary
antibody. Permeabilized hSSTR5 cells show a well defined population of
hSSTR5 positive cytoplasmic vesicles which remain the same in density
during continued agonist exposure. Scale bar, 25 µm.
|
|
Time Course of Agonist Pretreatment on hSSTR1 Coupling to Adenylyl
Cyclase--
To determine the effect of continued agonist exposure on
the desensitization response, we investigated coupling of hSSTR1 to
adenylyl cyclase after 0, 1, and 22 h pretreatment with SST-14 (10 7 M). After removal of surface-bound
SST-14 by acid wash, the ability of subsequently added SST-14 to
inhibit forskolin-stimulated cAMP accumulation was determined (Fig.
6). Control cells (time 0) displayed dose-dependent maximum 68 ± 4% inhibition of
forskolin-stimulated cAMP with 10 6 M SST-14.
One hour pretreatment with SST-14 markedly reduced the inhibitory
effect of SST-14 on forskolin-stimulated cAMP to a maximum of 29 ± 3.4% suggesting receptor uncoupling. After 22 h pretreatment
with SST-14, absolute cAMP levels increased 2.4-fold. At the same time,
the maximum forskolin-stimulated cAMP inhibition by SST-14 increased to
45 ± 4.1% indicating partial restoration of receptor coupling to
adenylyl cyclase. These results suggest that the up-regulated membrane
receptors are not desensitized but are functionally coupled to G
protein-linked effector pathways.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 6.
Time course of agonist pretreatment on hSSTR1
coupling to adenylyl cyclase. Control cells display
dose-dependent maximum 68% inhibition of
forskolin-stimulated cAMP with 10 6 M SST-14
( ) which is reduced to 29% after 1 h pretreatment with SST-14
(10 7 M) suggesting receptor uncoupling ( ).
After 22 h pretreatment with SST-14, receptor coupling to adenylyl
cyclase is partially restored ( ) suggesting that the up-regulated
membrane receptors are not desensitized but are functionally coupled to
G protein-linked effector pathways (mean ± S.E. of three
independent experiments in triplicate).
|
|
Internalization of Mutant and hSSTR1-hSSTR5 Chimeric
Receptors--
Fig. 7 and Table I depict
the internalization profiles of 125I-LTT SST-28 incubated
over 60 min with CHO-K1 cells expressing C-tail deletion mutants and
hSSTR1-hSSTR5 chimeric receptors. Compared with internalization of wt
hSSTR5 (66 ± 7% at 60 min), truncation of the C-tail reduced
internalization to 44 ± 5%. In the case of hSSTR1, both the wild
type and C-tail deletion mutants displayed a comparable inability to
undergo agonist-promoted endocytosis. Replacement of hSSTR5 C-tail with
the C-tail of hSSTR1 completely abolished internalization of the
chimeric receptor. This suggests the presence of potent negative
internalization signals in the C-tail of hSSTR1 sufficient to block
internalization of hSSTR5. The C-tail signals alone, however, cannot
explain the inability of hSSTR1 to internalize, since deletion of
hSSTR1 C-tail did not induce internalization suggesting the additional
involvement of other intracellular domains. Replacement of the hSSTR1
C-tail with the C-tail of hSSTR5 induced 27 ± 9% internalization
confirming the presence of internalization signals in hSSTR5 C-tail
(24).

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 7.
Time course of internalization of
125I-LTT SST-28 by CHO-K1 cells expressing mutant and
hSSTR1-hSSTR5 chimeric receptors. Compared with internalization of
wt hSSTR5 of 66% at 60 min (F) truncation of the C-tail
reduces internalization to 44% (E). wt hSSTR1 does not
internalize (A), and deletion of its C-tail does not induce
internalization (C) suggesting that the failure of hSSTR1 to
internalize is not due to the presence of negative internalization
signals. Replacement of hSSTR1 C-tail with the C-tail of hSSTR5
(B) induces 27% internalization indicating the presence of
potent internalization signals in the hSSTR5 C-tail (mean ± S.E.
of three complete experiments).
|
|
Up-regulation of Mutant and hSSTR1-hSSTR5 Chimeric
Receptors--
Fig. 8 and Table I
illustrate the results of whole cell binding analysis of mutant and
chimeric receptors treated with SST-14 for 22 h. Like wt hSSTR5,
the C-tail hSSTR5 mutant showed no agonist-dependent
increase in cell surface binding. Deletion of the C-tail of hSSTR1,
however, completely abolished the ability of this receptor to undergo
agonist-dependent up-regulation. The chimeric C-tail
hSSTR1 + C-tail hSSTR5 receptor behaved identically to the C-tail
hSSTR1 receptor in showing a complete absence of up-regulation.
Substitution of hSSTR5 C-tail with that of hSSTR1, however, converted
the chimeric receptor to one resembling wt hSSTR1 with 71 ± 18%
up-regulation at the cell surface. This suggests that up-regulation is
a functional property of hSSTR1 and is dependent on molecular signals
localized in the receptor C-tail.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 8.
Up-regulation of mutant and hSSTR1-hSSTR5
chimeric receptors. Whole cell binding analysis of mutant and
chimeric receptors in stable CHO-K1 cells treated with SST-14
(10 7 M) for 22 h. Up-regulation of
hSSTR1 by chronic agonist treatment (A) is completely
abolished by truncating the receptor C-tail (C). The hSSTR5
C-tail mutant (E) shows no up-regulation. Substitution
of the hSSTR5 C-tail with that of hSSTR1 converts the chimeric receptor
to one resembling wt hSSTR1 with 71% up-regulation of surface binding
(D) (mean ± S.E. of three independent
experiments).
|
|
Coupling of Mutant and Chimeric hSSTR1-hSSTR5 Receptors to Adenylyl
Cyclase--
To determine the influence of receptor signaling
capability, if any, on the up-regulation process, we determined the
ability of mutant and chimeric hSSTR1-hSSTR5 receptors to inhibit
forskolin-stimulated cAMP by SST-14 (Fig.
9 and Table I). Deletion of the hSSTR1
C-tail reduced its ability to inhibit forskolin-stimulated cAMP by 23% (from 68 ± 4 to 46 ± 3%). In contrast, as previously
shown, deletion of the C-tail of hSSTR5 completely abolished the
ability of this receptor to couple to adenylyl cyclase. The two C-tail
chimeric constructs maintained some ability to inhibit
forskolin-stimulated cAMP; the maximum inhibitory response, however,
was reduced to 38 ± 4 and 30 ± 3% for the C-tail
hSSTR1 + C-tail hSSTR5 and C-tail hSSTR5 + C-tail hSSTR1 chimeras,
respectively.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 9.
Coupling of mutant and chimeric hSSTR1-hSSTR5
receptors to adenylyl cyclase. Dose-dependent
inhibition by SST-14 of forskolin-stimulated cAMP in CHO-K1 cells
stably expressing mutant and chimeric hSSTR1-hSSTR5 receptors
(mean ± S.E. of three independent experiments in
triplicate).
|
|
 |
DISCUSSION |
Although negative regulation by agonists has been established as a
fundamental property of most GPCRs (reviewed in Ref. 9), there are only
sporadic reports describing the opposite phenomenon of receptor
up-regulation by agonists (12-23). This is because unlike acute
receptor desensitization, which is clearly a physiological event,
receptor up-regulation is elicited only during prolonged agonist
stimulation and is consequently less well characterized. Agonist-induced up-regulation has been shown not only for GPCRs but
applies to other classes of membrane proteins as well, such as the
nicotinic acetylcholine receptor and may, therefore, be a fundamental
cellular response (26). Up-regulated receptor function may explain drug
tolerance and the ability of receptors such as the D2L
receptor and SSTRs to maintain normal responsiveness during long term
pharmacotherapy (2, 3, 21). Several different mechanisms have been
described. In cultured rat pituitary cells, GnRH up-regulates its
receptor after a delay of 6 h by a process that is dependent on
extracellular Ca2+ and new protein synthesis (15).
Agonist-mediated up-regulation of 5HT2A receptor in cerebellar granule
neurons requires transcriptional induction of receptor mRNA by
receptor-activated Ca2+ influx and activation of calmodulin
kinase (13, 14). Likewise, the 3AR up-regulates after
chronic agonist exposure through transcriptional induction of multiple
cAMP response elements in the receptor gene secondary to ligand-induced
activation of the cAMP signaling pathway (12). Agonist-induced
up-regulation has been extensively investigated in the case of the
D2LR, either as endogenous receptors in tumor cell lines or
as recombinant receptors in various host cells (18-21). These studies
have revealed a time- and concentration-dependent induction
of surface receptors by 30-300% over 4-20 h by
10 9-10 6 M dopamine in
different cells (17-19). The effect of cycloheximide on up-regulation
of D2LR is controversial, with some (18) but not all
(19-21) studies reporting blockade of up-regulation by the protein
synthesis inhibitor, cycloheximide. The kinetics of hSSTR1
up-regulation that we found were comparable to those of the
D2LR. Thus hSSTR1 was up-regulated in a time-,
temperature-, and dose-dependent manner to saturable
levels. Up-regulation did not occur in membrane preparations, required
the intact cell, and produced functional G protein-coupled surface
receptors. Furthermore, up-regulation was unaffected by cycloheximide
suggesting that it is not due to new receptor synthesis but likely
represents receptors from a pre-existing pool. This is in agreement
with earlier findings that up-regulation of endogenous SSTRs in
GH4C1 cells (which express predominantly the
SSTR1 subtype) are also insensitive to cycloheximide (22). Overall
then, these results suggest that up-regulation of most GPCRs is
dependent on transcriptional and posttranscriptional induction of new
receptor synthesis, the exception being SSTR1 and probably the
D2LR.
Four of the five SSTR isotypes, SSTR2, -3, -4, -5, are readily
internalized by ligand binding (23, 24, 27, 28). Internalization of
SSTR2, -3, -5 has been shown to be dependent on residues in the C-tail
(24, 27, 28), and in the case of hSSTR5 both negative and positive
endocytic signals have been identified (24). Like the other SSTRs, the
C-tail of hSSTR1 is rich in putative serine and threonine
phosphorylation sites, and additionally features three tyrosine
residues that could act as potential endocytic signals (Fig. 1).
Nonetheless, this receptor was incapable of ligand-induced
internalization. We found that the C-tail of hSSTR1 contains negative
internalization signals, since substitution of the C-tail of hSSTR5
with that of hSSTR1 blocked internalization of the chimeric receptor.
The inability of hSSTR1 to internalize, however, cannot be attributed
solely to negative signals in the C-tail since deletion of the C-tail
did not activate internalization suggesting that additional positive
signals in the C-tail or on residues located in other intracellular
domains are required. Our finding that SSTR1 is refractory to
agonist-promoted endocytosis raises the question of whether the
increased surface binding over time is simply a reflection of receptor
aggregates, such as dimers with altered binding, or membrane
accumulation of ligand-stabilized SSTRs that would otherwise have been
degraded. Several other receptors that up-regulate, e.g.
3AR, D2LR are also resistant to
internalization (21, 29-31), whereas others such as the GnRH receptor
(15), 5HT2 receptor (32), and SSTR2 and -4 display both endocytosis and
up-regulation (23, 27) suggesting that lack of internalization is not
an absolute requirement for up-regulation. Likewise, up-regulation is
not an automatic consequence of poor internalization as indicated by
the C-tail hSSTR1 mutant in the present study which displayed neither internalization nor up-regulation. We have recently reported that hSSTR1 and hSSTR5 associate as dimers both as homodimers or
heterodimers and that dimerization alters the functional properties of
the receptor such as ligand binding affinity and agonist regulation (33). Our finding, however, that up-regulation is
temperature-dependent and does not occur when membranes are
incubated directly with agonist rules out surface aggregation and
points toward an active process of receptor recruitment to the plasma
membrane. This was directly demonstrated by confocal fluorescence
immunocytochemistry that showed a progressive
time-dependent increase in surface SSTR labeling associated
with a parallel depletion of intracellular SSTR immunofluorescent
vesicles suggesting translocation from the cytoplasm to the plasma membrane.
Up-regulation of hSSTR1 was not dependent on receptor signaling as
evident from the dissociated effects of the C-tail deletion mutants and
chimeric receptors on up-regulation and coupling to adenylyl cyclase.
For instance, the C-tail hSSTR1 mutant showed complete loss of
up-regulation in the face of only a small decrease in adenylyl cyclase
coupling efficiency. Up-regulation was only partially inhibited by
pertussis toxin implying that coupling to a second messenger system via
pertussis toxin-sensitive G proteins such as Gi or
Go is not required. The involvement of non-G protein-linked pathways such as the Na+/H+ antiporter to which
hSSTR1 is coupled, however, cannot be excluded (8). Dissociation of
up-regulation from signaling has also been noted in the case of the
D2L receptor that has been shown to up-regulate as
efficiently with antagonists as with agonists suggesting that receptor
occupancy irrespective of signaling capability is the critical
determinant (20). This means that as in the case of the internalization
of many GPCRs which can be dissociated from receptor signaling,
up-regulation is an intrinsic property of some receptors such as
hSSTR1, being triggered by a specific ligand-induced conformational
change. The molecular signals that specify hSSTR1 up-regulation are
located in the C-tail since deletion of this segment abrogated the
up-regulation response. Even more compelling evidence that the C-tail
of hSSTR1 harbors up-regulating sequences came from the chimeric
receptor studies in which the C-tail of hSSTR1 conferred the property
of up-regulation to hSSTR5, a receptor that normally displays
agonist-dependent internalization. The nature of the
molecular signals in the C-tail of hSSTR1 that mediate up-regulation
remains to be determined. As in the case of internalization,
phosphorylation of C-tail residues is likely to be important, given our
finding that okadaic acid, an inhibitor of serine, threonine
phosphatase, completely abolished up-regulation, suggesting that
receptor dephosphorylation is a requisite step for up-regulation. But
where is the cytoplasmic receptor pool that interacts with the receptor
C-tail and what are the intervening steps? Since the receptor is not
internalized, it is likely to be in a nonendosomal compartment,
probably in post-Golgi transport vesicles for targeting the receptor to
the plasma membrane. This is consistent with our immunocytochemical
studies that showed that hSSTR1 is distributed in morphologically
distinct cytoplasmic vesicles compared with the endosomal localization
of hSSTR5. Recent work with the -adrenergic receptor has proposed
internalization as an obligatory requirement for activation of the
mitogenic signaling complex (34). This model assigns a pivotal role to
-arrestin that binds to the ligand-activated, phosphorylated
receptor and triggers the assembly of clathrin and the cytoplasmic
tyrosine kinase c-src on -arrestin molecules to initiate
internalization of the receptor complex as a necessary step for
effecting MAP kinase activation. The finding that SSTR1 can activate
MAP kinase (35) without being internalized suggests that there may be
alternative non-arrestin-dependent pathways for coupling
the receptor to the MAP kinase signaling cascade.
In summary, these results show that hSSTR1 can desensitize rapidly in
response to agonist but lacks the ability to be internalized, and thus
displays only part of the acute agonist-dependent
regulatory response. Continued agonist exposure induces a time- and
concentration-dependent up-regulation of functional surface
receptors. Up-regulation occurs by a temperature-dependent
active process of ligand-induced receptor recruitment from a
pre-existing cytoplasmic pool. It does not require new protein
synthesis or signal transduction, is sensitive to dephosphorylation
events, and is critically dependent on molecular signals in the
receptor C-tail. Further studies are required to map the specific
regulatory motifs in the C-tail of hSSTR1 and to identify the mediators
distal to the C-tail which direct receptor trafficking from the
cytoplasm to the plasma membrane.
 |
ACKNOWLEDGEMENT |
We thank Wei-Yi for technical assistance and
M. Correia for secretarial help.
 |
FOOTNOTES |
*
This work was supported in part by the Medical Research
Council of Canada Grant MT-10411, National Institutes of Health Grant RO1 NS32160-04A1, U. S. Department of Defense Grant DAMD17-96-1-6189, and National Cancer Institute of Canada Grant 7140.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Supported by a fellowship from the Fonds de la Recherche en Sante
du Quebec.
§
Recipient of studentship support from the Royal Victoria Hospital
Research Institute and the FRSQ.
¶
Distinguished Scientist of the Canadian Medical Research
Council. To whom correspondence should be addressed: Royal Victoria Hospital, Rm. M3-15, 687 Pine Ave. West, Montreal, Quebec H3A 1A1,
Canada. Tel.: 514-842-1231 (ext. 5042); Fax: 514-849-3681; E-mail:
patel@rvhmed.lan.mcgill.ca.
 |
ABBREVIATIONS |
The abbreviations used are:
SST, somatostatin;
LTT SST-28, Leu8, D-Trp22,
Tyr25 SST-28;
SSTR, somatostatin receptor;
wt hSSTR5, wild
type human somatostatin receptor type 5;
wt hSSTR1, wild type human
somatostatin receptor type 1;
3AR, 3-adrenergic receptor;
D2LR, long form of
dopamine 2 receptor;
GPCR, G protein-coupled receptor;
C-tail, cytoplasmic C-terminal segment;
PCR, polymerase chain reaction;
CHO, Chinese hamster ovary;
MAP, mitogen-activated protein;
GnRH, gonadotropin-releasing hormone.
 |
REFERENCES |
| 1.
|
Reichlin, S.
(1983)
N. Engl. J. Med.
309,
1495-1501[Medline]
[Order article via Infotrieve], 1556-1563
|
| 2.
|
Patel, Y. C.,
and Srikant, C. B.
(1997)
Trends Endocrinol. Metab.
8,
398-405[Medline]
[Order article via Infotrieve]
|
| 3.
|
Lamberts, S. W. J.,
Van Der Lely, A. J.,
and de Herder, W. W.
(1996)
N. Engl. J. Med.
334,
246-254[Free Full Text]
|
| 4.
|
Kumar, U.,
Laird, D.,
Srikant, C. B.,
Escher, E.,
and Patel, Y. C.
(1997)
Endocrinology
138,
4473-4476[Abstract/Free Full Text]
|
| 5.
|
Kumar, U.,
Sasi, R.,
Suresh, S.,
Patel, A.,
Thangaraju, M.,
Metrakos, P.,
Patel, S. C.,
and Patel, Y. C.
(1998)
Diabetes
48,
77-85[Abstract]
|
| 6.
|
Khare, S.,
Kumar, U.,
Sasi, R.,
Puebla, L.,
Calderon, L.,
Lemstrom, K.,
Hayry, P.,
and Patel, Y. C.
(1999)
FASEB J.
13,
387-394[Abstract/Free Full Text]
|
| 7.
|
Sharma, K.,
Patel, Y. C.,
and Srikant, C. B.
(1999)
Mol. Endocrinol.
13,
82-90[Abstract/Free Full Text]
|
| 8.
|
Hou, C.,
Gilbert, R. L.,
and Barber, D. L.
(1994)
J. Biol. Chem.
269,
10357-10362[Abstract/Free Full Text]
|
| 9.
|
Dohlman, H. G.,
Thorner, J.,
Caron, M. G.,
and Lefkowitz, R. J.
(1991)
Annu. Rev. Biochem.
60,
653-658[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Goodman, O. B., Jr.,
Krupnick, J. G.,
Santini, F.,
Gurevich, V. V.,
Penn, R. B.,
Gagnon, A. W.,
Keen, J. H.,
and Benovic, J. L.
(1996)
Nature
383,
447-450[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Zhang, J.,
Barak, L. S.,
Winkler, K. E.,
Caron, M. G.,
and Ferguson, S. S. G.
(1997)
J. Biol. Chem.
272,
27005-27014[Abstract/Free Full Text]
|
| 12.
|
Thomas, R. F.,
Holt, B. D.,
Schwinn, D. A.,
and Liggett, S. B.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
4490-4494[Abstract/Free Full Text]
|
| 13.
|
Akiyoshi, J.,
Hough, C.,
and Chuang, D-M.
(1993)
Mol. Pharmacol.
43,
349-355[Abstract]
|
| 14.
|
Chen, H.,
Li, H.,
and Chuang, D-M.
(1995)
J. Pharmacol. Exp. Ther.
275,
674-680[Abstract/Free Full Text]
|
| 15.
|
Loumaye, E.,
and Catt, K. J.
(1983)
J. Biol. Chem.
258,
12002-12009[Abstract/Free Full Text]
|
| 16.
|
Dudley, D. T.,
and Summerfelt, R. M.
(1993)
Regul. Pept.
44,
199-206[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Cov, B. A.,
Rosser, M. P.,
Kozlowski, M. R.,
Duwe, K. M.,
Neve, R. L.,
and Neve, K. A.
(1995)
Synapse
21,
1-9[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Zhang, L. J.,
Lochowicz, J. E.,
and Sibley, D. R.
(1994)
Mol. Pharmacol.
45,
878-889[Abstract]
|
| 19.
|
Starr, S.,
Kozell, L. B.,
and Neve, K. A.
(1995)
J. Neurochem.
65,
569-577[Medline]
[Order article via Infotrieve]
|
| 20.
|
Filtz, T. M.,
Guan, W.,
Artymyshyn, R. P.,
Pacheco, M.,
Ford, C.,
and Molinoff, P. B.
(1994)
J. Pharmacol. Exp. Ther.
271,
1574-1582[Abstract/Free Full Text]
|
| 21.
|
Ng, G. Y. K.,
Varghese, G.,
Chung, H. T.,
Trogadis, J.,
Seeman, P.,
O'Dowd, B. F.,
and George, S. R.
(1997)
Endocrinology
138,
4199-4206[Abstract/Free Full Text]
|
| 22.
|
Presky, D. H.,
and Schonbrunn, A.
(1988)
J. Biol. Chem.
263,
714-721[Abstract/Free Full Text]
|
| 23.
|
Hukovic, N.,
Panetta, R.,
Kumar, U.,
and Patel, Y. C.
(1996)
Endocrinology
137,
4046-4049[Abstract]
|
| 24.
|
Hukovic, N.,
Panetta, R.,
Kumar, U.,
Rocheville, M.,
and Patel, Y. C.
(1998)
J. Biol. Chem.
273,
21416-21422[Abstract/Free Full Text]
|
| 25.
|
Ho, S. N.,
Hunt, H. D.,
Horton, R. M.,
Pullen, J. K.,
and Pease, L. R.
(1989)
Gene (Amst.)
77,
51-59[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
Whiteaker, P.,
Sharples, C. G. V.,
and Wonnacott, S.
(1998)
Mol. Pharmacol.
53,
950-962[Abstract/Free Full Text]
|
| 27.
|
Hipkin, R. W.,
Friedman, J.,
Clark, R. B.,
Eppler, C. M.,
and Schonbrunn, A.
(1997)
J. Biol. Chem.
272,
13869-13876[Abstract/Free Full Text]
|
| 28.
|
Roth, A.,
Kreienkamp, H.-J.,
Meyerhof, W.,
and Richter, D.
(1997)
J. Biol. Chem.
272,
23769-23774[Abstract/Free Full Text]
|
| 29.
|
Liggett, S. B.,
Freedman, N. J.,
Schwinn, D. A.,
and Lefkowitz, R. J.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
3665-3669[Abstract/Free Full Text]
|
| 30.
|
Nantel, F.,
Bonin, H.,
Emorine, L. J.,
Zilberfarb, V.,
Strosberg, A. D.,
Bouvier, M.,
and Marullo, S.
(1993)
Mol. Pharmacol.
43,
548-555[Abstract]
|
| 31.
|
Barton, A. C.,
Black, L. E.,
and Sibley, D. R.
(1991)
Mol. Pharmacol.
39,
650-658[Abstract]
|
| 32.
|
Perry, R. C.,
Unsworth, C. D.,
and Molinoff, P. B.
(1993)
Mol. Pharmacol.
43,
726-733[Abstract]
|
| 33.
| Rocheville, M., Sasi, R., and Patel, Y. C. (1999) Program of
the 81st Annual Meeting of the Endocrine Society, San Diego, June
12-15, 1999, Abstr. P2-459, Endocrine Society, Bethesda, MD
|
| 34.
|
Luttrell, L. M.,
Ferguson, S. S. G.,
Daaka, Y.,
Miller, W. E.,
Maudsley, S.,
et al..
(1999)
Science
283,
655-660[Abstract/Free Full Text]
|
| 35.
|
Florio, T.,
Yao, H.,
Carey, K. D.,
Dillon, T. J.,
and Stork, P. J. S.
(1999)
Mol. Endocrinol.
13,
24-37[Abstract/Free Full Text]
|
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. Grant, H. Alturaihi, P. Jaquet, B. Collier, and U. Kumar
Cell Growth Inhibition and Functioning of Human Somatostatin Receptor Type 2 Are Modulated by Receptor Heterodimerization
Mol. Endocrinol.,
October 1, 2008;
22(10):
2278 - 2292.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Fusco, G. Gunz, P. Jaquet, H. Dufour, A. L. Germanetti, M. D Culler, A. Barlier, and A. Saveanu
Somatostatinergic ligands in dopamine-sensitive and -resistant prolactinomas
Eur. J. Endocrinol.,
May 1, 2008;
158(5):
595 - 603.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Peverelli, G. Mantovani, D. Calebiro, A. Doni, S. Bondioni, A. Lania, P. Beck-Peccoz, and A. Spada
The Third Intracellular Loop of the Human Somatostatin Receptor 5 Is Crucial for Arrestin Binding and Receptor Internalization after Somatostatin Stimulation
Mol. Endocrinol.,
March 1, 2008;
22(3):
676 - 688.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Tulipano and S. Schulz
Novel insights in somatostatin receptor physiology
Eur. J. Endocrinol.,
April 1, 2007;
156(suppl_1):
S3 - S11.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Roosterman, O. J. Kreuzer, N. Brune, G. S. Cottrell, N. W. Bunnett, W. Meyerhof, and M. Steinhoff
Agonist-Induced Endocytosis of Rat Somatostatin Receptor 1
Endocrinology,
March 1, 2007;
148(3):
1050 - 1058.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Roosterman, T. Goerge, S. W. Schneider, N. W. Bunnett, and M. Steinhoff
Neuronal control of skin function: the skin as a neuroimmunoendocrine organ.
Physiol Rev,
October 1, 2006;
86(4):
1309 - 1379.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Schwarz, D. Renshaw, S. Kapas, and J. P Hinson
Adrenomedullin increases the expression of calcitonin-like receptor and receptor activity modifying protein 2 mRNA in human microvascular endothelial cells.
J. Endocrinol.,
August 1, 2006;
190(2):
505 - 514.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Grant, R. C. Patel, and U. Kumar
The Role of Subtype-specific Ligand Binding and the C-tail Domain in Dimer Formation of Human Somatostatin Receptors
J. Biol. Chem.,
September 10, 2004;
279(37):
38636 - 38643.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Tulipano, R. Stumm, M. Pfeiffer, H.-J. Kreienkamp, V. Hollt, and S. Schulz
Differential {beta}-Arrestin Trafficking and Endosomal Sorting of Somatostatin Receptor Subtypes
J. Biol. Chem.,
May 14, 2004;
279(20):
21374 - 21382.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Niedernberg, S. Tunaru, A. Blaukat, B. Harris, and E. Kostenis
Comparative Analysis of Functional Assays for Characterization of Agonist Ligands at G Protein-Coupled Receptors
J Biomol Screen,
October 1, 2003;
8(5):
500 - 510.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
L. J. Hofland and S. W. J. Lamberts
The Pathophysiological Consequences of Somatostatin Receptor Internalization and Resistance
Endocr. Rev.,
February 1, 2003;
24(1):
28 - 47.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. L. Ramirez, R. Mouchantaf, U. Kumar, V. Otero Corchon, M. Rubinstein, M. J. Low, and Y. C. Patel
Brain Somatostatin Receptors Are Up-Regulated In Somatostatin-Deficient Mice
Mol. Endocrinol.,
August 1, 2002;
16(8):
1951 - 1963.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. C. Patel, U. Kumar, D. C. Lamb, J. S. Eid, M. Rocheville, M. Grant, A. Rani, T. Hazlett, S. C. Patel, E. Gratton, et al.
Ligand binding to somatostatin receptors induces receptor-specific oligomer formation in live cells
PNAS,
March 5, 2002;
99(5):
3294 - 3299.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Rocheville, D. C. Lange, U. Kumar, R. Sasi, R. C. Patel, and Y. C. Patel
Subtypes of the Somatostatin Receptor Assemble as Functional Homo- and Heterodimers
J. Biol. Chem.,
March 10, 2000;
275(11):
7862 - 7869.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Liu and A. Schonbrunn
Agonist-induced Phosphorylation of Somatostatin Receptor Subtype 1 (Sst1). RELATIONSHIP TO DESENSITIZATION AND INTERNALIZATION
J. Biol. Chem.,
January 26, 2001;
276(5):
3709 - 3717.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|