 |
INTRODUCTION |
Decidualization is a differentiation process of the endometrium in
preparation for blastocyst implantation. In humans this process is
independent of the presence of a blastocyst and is first apparent in
the stromal cells surrounding the spiral arteries in the second half of
the luteal phase. The key stimulus for decidualization in
vivo is progesterone acting on an estrogen-primed uterus, however, in vitro in cultured endometrial stromal cells
(ESC),1 progesterone only
acts as a weak inducer of decidualization (1). Its action is
synergistically enhanced by a number of factors such as prostaglandin
E2, corticotropin releasing factor, and gonadotropin free
-subunit (2-4). In fact, in vitro decidualization of ESC
can be triggered in the absence of progesterone by agents that elevate
intracellular cAMP levels, including gonadotropins, relaxin, or cAMP
analogs (3, 5-9). Induction of prolactin (PRL) gene expression serves
as a decidualization marker in human ESC (8, 10). PRL expressed in the
human endometrium is referred to as decidual PRL (dPRL) to distinguish
it from pituitary-derived PRL. Transcription of the human PRL gene is
driven by two alternative tissue-specific promoters, the dPRL promoter
being located approximately 5.7 kilobases upstream of the pituitary
promoter at an additional non-coding exon 1A (11-13). Utilization of
the dPRL promoter has been detected in decidualized endometrial stroma,
in myometrial smooth muscle cells, and in hematopoietic cells (12-15),
and is specific to humans and primates (16).
Little is known about the molecular mechanisms governing dPRL promoter
control. Cyclic AMP, which is a major decidualization stimulus in
vitro, also controls dPRL gene transcription (12). We have shown
previously that the cAMP response of the transfected dPRL promoter in
ESC occurs in two phases. An early weak induction, mediated by an
imperfect cAMP response element (CRE-L) at position 
12 relative to
the major transcriptional start site, is detectable within 6 h of
treatment with 8-Br-cAMP. This is followed by a delayed strong
induction which sets in after 12-18 h of stimulation and is dependent
on the dPRL promoter region 332/270 (17). Mutation of the CRE-L
abolishes the early, but not the delayed cAMP-mediated induction of
promoter activity (17). Computerized search for transcription factor
binding sequences revealed two consensus sites for members of the
CCAAT/enhancer-binding protein (C/EBP) family in the dPRL-332/-270
promoter fragment.
C/EBP factors belong to the superfamily of basic region/leucine zipper
DNA-binding proteins (18). So far, six members of the C/EBP family have
been described: C/EBP, -
, -
, -
, -
and -
(reviewed in
Ref. 19). C/EBP, -, and - are found in liver, adipose tissue,
intestine, lung, cells of the inflammatory system, and in reproductive
tissues, while C/EBP is restricted to myeloid and lymphoid lineages
(19-27). Specificity of gene control by C/EBPs is ensured through
their ability to homo- and heterodimerize and to interact with other
transcription factors, together with cell-specific and temporal
expression patterns and different transactivation potentials
(28-37).
C/EBP was originally identified as a mediator of interleukin-6 (IL6)
signaling and is therefore also known as NF-IL6 (38, 39). The related
factor C/EBP is occasionally designated NF-IL6 (29). From the
single C/EBP mRNA, protein isoforms with different functions can
be generated by a leaky ribosomal scanning mechanism involving three
methionine residues in the intronless C/EBP gene, Met1,
Met24, and Met199. Proteins initiated at
Met1 or Met24 have a calculated molecular mass
of about 36 and 33.5 kDa and are referred to as LAP (liver-enriched
activator protein) whereas translation initiation at Met199
results in the 16-kDa isoform LIP (liver-enriched inhibitory protein)
which lacks the transactivation domain of the longer forms. LIP readily
heterodimerizes with LAP, counteracting its activation potential in
substoichiometric amounts and therefore acts as a potent repressor
(40).
Several lines of evidence indicate an important role for C/EBPs as
mediators of hormonal signals in reproductive tissues. C/EBP is
regulated by gonadotropins in the ovary and testis (20, 24-26, 41).
Deletion of the C/EBP gene in female mice leads to sterility, caused
by the inability to form corpora lutea (20). C/EBP is also an
essential factor for mammary gland differentiation and proliferation
(21, 22).
In this study we demonstrate for the first time the presence of C/EBP
transcription factors in human endometrial stroma, an interaction
between C/EBP family members and the dPRL promoter, and their
involvement in cAMP-induced dPRL gene expression.
| |
EXPERIMENTAL PROCEDURES |
Cell Culture--
Primary cultures of purified human ESC were
prepared and maintained as described previously (12, 17). Cells of the
first passage were used for transfections and for extraction of nuclear and cytoplasmic protein and RNA. Primary cultures of myometrial smooth
muscle cells were prepared as detailed elsewhere (42) and maintained in
Dulbecco's modified Eagle's medium/Ham's F-12, 10% fetal calf
serum, 100 units/ml penicillin, 100 µg/ml streptomycin, and
10
9 M 17-estradiol. COS-7 cells
were kept in the same medium but without estradiol.
Transient Transfection, Protein Extraction, and RNA
Isolation--
Transient transfections were performed by the calcium
phosphate precipitation method for ESC and myometrial cells and with DOTAP reagent (Roche Molecular Biochemicals) for COS-7 cells overnight as described previously (43) in triplicates using 12-well dishes if not
indicated otherwise, or 24-well dishes. Medium was replaced the next
morning and 0.5 mM 8-Br-cAMP (Biolog, Bremen, Germany) added for stimulation experiments. Cell harvest was performed for ESC
and myometrial cultures 48 h and for COS-7 cells 24 h after
medium replacement. Luciferase activity was measured with the
luciferase reagent kit (Promega) and expressed as relative light units.
Transfections were repeated at least three times, and representative
experiments are shown (mean ± S.D.). Nuclear and cytoplasmic
protein extracts were prepared as described by Schreiber et
al. (43, 44) with minor modifications and protein concentrations
were determined using the DC protein detection kit (Bio-Rad). For RNA
isolation the method developed by Gough (45) was applied, using the
cytosolic lysate generated during protein extraction as the source.
Antibodies--
Rabbit antisera against rat C/EBP (numbers 6 and 247) were kindly provided by Dr. Steve McKnight (University of
Texas Southwestern Medical Center, Dallas, TX) and diluted 1:10 for use
as a working stock solution. Rabbit antibodies raised against rat
C/EBP and human C/EBP (0.1 µg/µl) were purchased from Santa
Cruz Biotechnology.
SDS-Polyacrylamide Gel Electrophoresis, Western Blotting, and
Immunodetection--
A modified method of Rittenhouse and Marcus (46)
was used for protein analysis. Nuclear and cytosolic proteins were
loaded on 12% SDS-polyacrylamide gels and electrophoresed for 1 h
at 150 V. Gels were transferred for 1 h at 1.2 mA/cm2
in a semi-dry chamber with a three buffer system (cathode buffer: 25 mM Tris-HCl, pH 9.4, 40 mM -aminocaproic
acid, 20% methanol; anode buffer I: 30 mM Tris-HCl, pH
10.4, 20% methanol; anode buffer II: 300 mM Tris-HCl, pH
10.4, 20% methanol) onto PVDF Immobilon membrane (Millipore) and
stained with Fount India Ink (Pelikan) to control for even loading and
transfer efficiency. Blots were blocked overnight at 4 °C with
Blotto (5% nonfat dry milk in 15 mM Tris-HCl, pH 7.6, 136 mM NaCl), exposed to primary antibodies for 1 h at
room temperature (dilution 1:1000 in Blotto), and then incubated with
secondary antibody (horseradish peroxidase-conjugated anti-rabbit IgG,
Sigma), diluted 1:1000 in Blotto, for 1 h at room temperature.
Detection was performed with the ECL system (Pierce).
RT-PCR Analysis--
Total RNA was used for oligo(dT)-primed
cDNA synthesis with SuperScript RNase H reverse
transcriptase (Life Technologies Inc.). PCR for dPRL and GAPDH
cDNAs was performed as described previously (42, 43). For
amplification of C/EBP cDNA (38) Taq DNA polymerase
and solution Q (Qiagen) were used. The sense primer
TCTCCGACCTCTTCTCCGACGA spans cDNA positions 353-374 relative to
the first start codon, and the antisense primer CAGCTGCTTGAASAASTKCCG
anneals to the region 982-1002. After transfer of the electrophoresed
PCR products to positively charged nylon membrane (Roche Molecular
Biochemicals), Southern blot hybridization was performed with internal
oligonucleotides labeled with terminal deoxynucleotidyl transferase
(Life Technologies) and digoxigenin-11-dUTP (Roche Molecular
Biochemicals), and detected with the DIG luminescent detection kit
(Roche Molecular Biochemicals). The probe sequences were for GAPDH:
TCGTCATGGGTGTGAACCATG; for hPRL: CAAGGGGGCCACGCTCTGGCA; for C/EBP:
TTGCGCACGGCGATGTTGTTG (antisense to positions 840-860).
Reporter Constructs and Expression Vectors--
All luciferase
gene reporter constructs were generated in the pGL3-Basic plasmid
(Promega). The dPRL promoter/luciferase reporter fusion construct
dPRL-332/luc3 contains the wild type dPRL promoter sequence 332 to
+65 relative to the major transcriptional start site and has been
described previously (12, 17). The minimal promoter construct
dPRL-32/luc3 was generated by PCR using dPRL-332/luc3 as the template.
Primers were: CCTGAAGCttGCCATAAAAGAATCCTCTGACGTTTC (sense),
annealing at positions 39 to 4 of the dPRL promoter and including
two mismatches (lowercase letters) to introduce a HindIII
site (underlined) at position 32, and CTTTATGTTTTTGGCGTCTTCCA (antisense), corresponding to positions 2-23 relative to the ATG start
codon of the luciferase gene in pGL3-Basic. The PCR product was cleaved
with HindIII and ligated into HindIII digested
pGL3-Basic. The fragment dPRL-332/-270 was amplified using primers with
BamHI overhangs (underlined):
AGGATCCATTATGTTCTGAGGGCTG (sense) spanning the dPRL
sequence 332/315 (primer dPRL-332-S), and
AGGATCCGAGCAGAGACCAGACATG (antisense), corresponding to
positions 287/270. The PCR products were digested with
BamHI, concatamerized, and cloned into pLucIAV Link V.4
(kindly provided by Dr. Richard N. Day, University of Virginia,
Charlottesville, VA). Inserts with one or two copies were excised by
digestion at 3' with PstI followed by polishing, and
digestion at 5' with Acc65I, and then ligated into the
Acc65I and SmaI sites of dPRL-32/luc3 5' to the
minimal promoter element. The resultant constructs
1x(dPRL-332/-270)/-32/luc3 and 2x(dPRL-332/-270)/-32/luc3 carry the
dPRL promoter fragment in 5'-3' orientation.
Plasmid dPRL(-332/-191)/-32/luc3 was constructed by PCR with
Pwo polymerase (Peqlab, Erlangen, Germany), using dPRL-332-S (see above) as upstream primer and the downstream primer
GTCAAGATCTCTCCCAGGAGACATTTGG (antisense), corresponding to
positions 208/191 and carrying an overhang with BglII
recognition sequence (underlined). The PCR product was digested with
BglII and inserted into the Ecl136II (AGS,
Heidelberg, Germany) and BglII sites of dPRL-32/luc3.
Plasmid dPRL(-332/-134)/-32/luc3 was generated with the sense primer
ATTATGTTCTGAGGGCTGCTTGTGTTGT (positions 332/302) and the antisense
primer AGGATCCCATCAATCTAAATGAGTG (positions 154/135)
with BamHI overhang (underlined). The PCR product was
digested with BamHI and inserted into Ecl136II
and BglII sites of dPRL-32/luc3.
Plasmid dPRL-270/luc3 was generated by PCR, using dPRL-332/luc3 as
template. The upstream primer AGGATCCACCAGATGCCAGCAGCAC spans positions 270 to 253 of the dPRL promoter and contains a
BamHI overhang (underlined); the antisense primer is
anchored in exon 1A: CAAGAAGAATCGGAtCcTACAGGCTTT, covering
positions +54 to +80 relative to the transcription start site, and
containing two mismatches (lowercase letters) to introduce a
BamHI restriction site (underlined) at position +65. The PCR
product was subjected to incomplete digestion with BamHI to
prevent restriction at the BamHI site close to the 5' end of
the upstream primer. This created a dPRL270/+65 fragment with 5'
blunt and 3' BamHI ends which was ligated into pGL3-Basic
digested with Ecl136II and BglII.
Computerized searches for transcription factor consensus binding sites
were performed with TFSEARCH v1.3 by Yutaka Akiyama using the TRANSFAC
data bases (47). Mutations of consensus sequences were introduced into
the dPRL promoter by site-directed mutagenesis of dPRL-332/luc3 using
the QuikChange system and Pfu polymerase (Stratagene). PCR
products were transformed and plasmid DNA prepared to retrieve the
mutated insert by Acc65I/NcoI digestion and
ligate it into native pGL3-Basic cleaved with the same enzyme
combination. The sense sequences of the complementary oligonucleotides
used for site-directed mutagenesis (D-B-mut, F-mut, G-mut) and the resultant constructs (dPRL-332/D-Bmut/luc3, dPRL-332/F-mut/luc3, dPRL-332/G-mut/luc3) are illustrated in Fig. 6.
As a reporter control for C/EBP expression vectors NFIL6RE/luc3 was
constructed. Complementary oligonucleotides with Acc65I overhangs were annealed and inserted into the Acc65I
site of the dPRL-32/luc3 minimal promoter construct. The resultant
insert sequence
GGTACCCAGATCTGGCAGGATCCAGATTGCGCAATCTGCGGTACC carries a palindromic NF-IL6 response element consensus sequence (bold faced) flanked by Acc65I sites (underlined).
Expression vectors for transient transfections were created in pSG5
(Stratagene) under the SV40 promoter. The human C/EBP cDNA
insert (48) was excised from hCMV-C/EBP (kindly provided by Dr. G. Darlington, Baylor College of Medicine, Houston, TX) with
BamHI and ligated into BamHI cleaved pSG5 to give
pSG-C/EBP. Expression vectors for human C/EBP and C/EBP
(pCMV/NF-IL6, pCMV/NF-IL6) were a gift from Dr. S. Akira (Hyogo
College of Medicine, Hyogo, Japan) (29, 38). Inserts were excised with
SalI, blunt-ended and cloned into pSG5 which had been
linearized with BamHI and blunt-ended. This yielded
pSG-C/EBP, pSG-C/EBP, and pSG-C/EBPrev, which carries the
C/EBP cDNA in the reverse orientation and was used as a negative control.
To generate pSG/LIP, pSG-C/EBP plasmid was cut with EcoRI
(in the polylinker region of pSG5 upstream of the cDNA insert) and
SacII (in the insert). Released cDNA fragments were
removed and the remaining plasmid polished with mung bean nuclease
(Promega) and recircularized, retaining as the insert the C-terminal
portion of CEBP cDNA extending from the SacII site
49-base pair upstream of the Met199 codon to beyond the
stop codon.
To generate the expression vector pSG/LAP, Met199 was
changed to Leu by PCR-mediated mutagenesis using the following primers: LAP-H-S
(CGCAGGCtTGGCGGCaaGCTTCCCGTAC,
corresponding to positions 588-615 in the human C/EBP cDNA
relative to the first Met codon; lowercase letters represent nucleotide
changes, italicized triplets indicate codon mutations from
Met199 to Leu and Gly202 to Ser, and underlined
is a HindIII site introduced by mutation), LAP-H-AS
(antisense to LAP-H-S), and NFIL6-H (TTGCGCACGGCGATGTTGTTG, antisense
to positions 840-860 of human C/EBP cDNA). Two separate PCR
reactions were performed with Pfu polymerase on template pSG-C/EBP. Primer pairs T7 (anchored in the polylinker of pSG5 5' to the cDNA
insert) and LAP-H-AS, and LAP-H-S and NFIL6-H were used to amplify
overlapping portions of the C/EBP cDNA, introducing the mutations Met199 to Leu, Gly202 to Ser, and a
HindIII site within the overlap. Both PCR products were
digested with HindIII and ligated to one another to span the
entire amplified region from the T7 to the NFIL6-H sequences. The
purified ligation product was cleaved with BsiWI to isolate an internal 495-base pair fragment containing the mutations. This BsiWI fragment was used to replace the wild type
BsiWI fragment in pSG-C/EBP thus yielding pSG/LAP.
The construct pABVP16 was kindly provided by Drs. Sergio Onate and
Sophia Tsai (Baylor College of Medicine, Houston, TX). It contains
coding region for the transactivation domain (AD) of herpes simplex
virus VP16 under control of the Rous sarcoma virus promoter and was
used to generate pVP16/LAP-DBD. The sequence encoding the DNA-binding
domain (DBD) was excised from pSG-C/EBP by digestion with
BsiWI (immediately downstream of the Met199
codon), polishing with mung bean nuclease, and digestion with BglII in the polylinker 3' to the cDNA insert. The
fragment was ligated into pABVP16 which had been prepared as follows:
the plasmid was cut with XhoI in the polylinker 3' to the
VP16 sequence, filled in with the Klenow fragment of DNA polymerase I
and dTTP/dCTP only, polished with mung bean nuclease, and finally
cleaved with BamHI. The ligation resulted in an in-frame
fusion of VP16-AD and LAP-DBD. All mutations and preservation of open
reading frames were verified by sequencing.
Electrophoretic Mobility Shift Assay (EMSA)--
Fragments of
the dPRL promoter used as probes or competitors for EMSA were:
dPRL-332/-270, dPRL-301/-270 (subfragment B), dPRL-311/-291
(subfragment D), dPRL-332/-302 (subfragment A), dPRL-332/-312
(subfragment C), and dPRL-290/-270 (subfragment E). Recombinant
proteins were produced from cDNAs cloned into pSG5, using the TNT
T7 quick coupled transcription/translation system (Promega). Per
binding reaction 5 µg of nuclear protein or 2 µl of
transcription/translation product and 30,000 cpm of end-labeled probe
were used. Final concentrations of components in the binding reaction,
including high salt nuclear extracts, were: 15 mM HEPES,
200 mM NaCl, 5 mM MgCl2, 65 mM KCl, 0.05 mM EDTA, 0.05 mM EGTA,
1 mM dithiothreitol, 1.25 mM spermidine, 3.5% Ficoll, 0.5% Nonidet P-40, and 0.02 units of poly(dI-dC) (Roche Molecular Biochemicals). Preincubation was performed for 15 min at
4 °C with 200-400-fold molar excess of competitor, followed by
addition of probe and incubation at 4 °C for 30 min. For supershift analyses, antibody (1 µl per reaction) was added for an additional 15-min incubation at room temperature. Protein-DNA complexes were resolved on 4% polyacrylamide gels in 0.25 × TBE running buffer (1 × TBE = 0.09 M Tris borate, 2 mM
EDTA) for 1.5-2 h at 200 V. Dried gels were exposed to x-ray film
overnight at 80 °C with intensifying screen.
| |
RESULTS |
Specific Complexes Formed between the dPRL Promoter Fragment
dPRL-332/-270 and Nuclear Proteins from Decidualized ESC Contain
Primarily C/EBP--
The region 332/270 is required for the
delayed cAMP response of the dPRL promoter in ESC. We therefore used
this promoter fragment as a probe in gel shift assays in an attempt to
identify nuclear proteins induced during cAMP-stimulated
decidualization of ESC. Nuclear extracts from untreated,
undifferentiated ESC cultures were compared with those from cultures
which had been treated with 8-Br-cAMP for 6 days to decidualize (Fig.
1). No specific DNA-protein complexes
were obtained with extracts from undifferentiated cells. However, a
number of specific complexes appeared with extracts from decidualized
cells: a faster migrating distinct doublet and a more diffuse range of
bands migrating more slowly (compare lanes 6 and
7). In order to define the binding sequences in
dPRL-332/-270 more closely, we used five subfragments (A-E,
illustrated in Fig. 1) as competitors. Two of these subfragments, B and
D, were able to compete for binding, eliminating all complexes specific
to decidualized cells. Fragment B spans the sequence dPRL-301/-270 and
overlaps with fragment D, which covers dPRL-311/-291. We therefore
concluded that the sequence involved in binding with decidual proteins
must be localized to the overlap. However, a double-stranded
oligonucleotide containing the overlap 301 to 291 was not able to
compete with the full-length probe dPRL-332/-270 for binding of
decidual proteins (data not shown). This led us to postulate that
sequences with functional homology must be present in both
subfragments, not or not entirely contained within the overlap, to
explain their ability to compete for the same proteins. Computerized
search revealed consensus binding sites for members of the C/EBP family
in both subfragments. A binding site for C/EBP is found at
310/297 in fragment D, and for C/EBP and - at 298/285 in
fragment B (Fig. 1; see also Fig. 6B). These clustered sites
with coordinates 310/285 will be referred to as the D-B site.
View larger version (64K):
[in this window]
[in a new window]
|
Fig. 1.
Nuclear proteins from decidualized ESC bind
to dPRL-332/-270. Nuclear proteins from untreated ESC () or ESC
treated for 6 days with 8-Br-cAMP (+) were incubated with labeled
dPRL-332/-270 for EMSA. Migration of free probe is marked by an
asterisk. Competition (comp.) was carried out by
addition of 200-fold molar excess of unlabeled probe (332/270) or
of the subfragments A-E illustrated in the panel below the
autoradiogram. dPRL-332/-270 forms specific complexes with nuclear
proteins from decidualized ESC (indicated by arrows and a
vertical bracket) which are absent from untreated cells
(compare lanes 6 and 7). Binding is competed by
subfragments B and D both of which contain consensus binding sequences
for C/EBPs indicated by horizontal brackets: at positions
310 to 297 for C/EBP, and at 298 to 285 for C/EBP and
-.
|
|
We then determined by supershift analysis if the DNA/protein adducts
formed with extracts from decidualized ESC on dPRL-332/-270 contained
C/EBPs (Fig. 2). Specific complexes were
quantitatively supershifted by antibody to C/EBP; a faint supershift
was obtained with C/EBP antibody while addition of C/EBP
antiserum was without effect (Fig. 2A). This indicates that
the multiple and diffuse complexes all contain C/EBP primarily in
homodimeric form and partially heterodimerized with C/EBP or
potentially other basic region/leucine zipper proteins. In the majority
of endometrial preparations, no C/EBP was detectable by supershift
analysis. However, when we used a particular specimen that contained
C/EBP and employed subfragments B and D as probes, different
affinities for C/EBP isoforms became apparent. While fragment B was
able to bind C/EBP, -, and -, fragment D only interacted with
C/EBP and - (Fig. 2B). The banding pattern was again
diffuse, and binding intensity was increased in decidualized compared
with undifferentiated ESC (compare lanes 1 and
6). It is noteworthy that specific complexes formed on
fragment D were completely supershifted with C/EBP antibody, whereas
fragment B gave rise to a very abundant complex which was specific,
i.e. could be competed with unlabeled probe (lane 2, left panel), but was unaffected by addition of antibodies to
C/EBPs. The nature of this complex is presently unknown.
View larger version (48K):
[in this window]
[in a new window]
|
Fig. 2.
Subfragments B and D of dPRL-332/-270 bind
different subsets of C/EBPs from ESC. A, supershift
experiments were carried out on complexes formed between nuclear
extracts from ESC treated for 6 days with 8-Br-cAMP (+) and labeled
dPRL-332/-270 as probe. Antibodies against C/EBP (antiserum number
6), C/EBP, and C/EBP were added, and supershifted complexes
(SS) obtained in lanes 4 and 5 are
indicated by bold arrows. Specific complexes which can be
competed by 400-fold molar excess of unlabeled probe (lane
2) are indicated by two small arrows and a
bracket. Migration of free probe is marked by an
asterisk. B, supershift experiments were carried out as
above, comparing nuclear extracts from untreated ESC () and ESC
treated for 6 days with 8-Br-cAMP (+). Probes were subfragments B
(dPRL-301/-270) (left panel) and D (dPRL-311/-291)
(right panel) (see also Fig. 1). Antisera numbers 6 and 247 to C/EBP produced identical results; supershifted complexes were
only obtained with probe B (lanes 3 and 8), but
not with probe D. Supershifted complexes are labeled by bold
arrows, free probes are marked by an asterisk, and
brackets indicate specific complexes that can be shifted
with C/EBP antibodies. Another specific complex that is competed with
excess unlabeled probe B (left panel, lanes 1 versus 2) but cannot be supershifted is marked with an
arrowhead.
|
|
C/EBP Isoforms LAP and LIP, but Not C/EBP Proteins Are
Induced by 8-Br-cAMP Treatment in ESC--
The rat C/EBP gene has
been reported to be transcriptionally controlled by the cAMP regulatory
element-binding protein, CREB (49). We therefore investigated whether
cAMP treatment up-regulated C/EBP expression in ESC. Three
individual ESC cultures were prepared and either left untreated or
treated with 8-Br-cAMP for 6 days before harvesting cytoplasmic RNA and
nuclear proteins. RT-PCR analysis showed massive induction of dPRL
mRNA in response to the cAMP analog, confirming at the molecular
level the morphologically apparent decidualization in all three
specimens (Fig. 3A). C/EBP mRNA was detectable both in undifferentiated and in decidualized cells and appeared moderately increased in the latter. We then prepared
Western blots with nuclear proteins from the same individual cultures.
Nuclear extracts from COS-7 cells which had been transfected with
expression vectors for C/EBP and C/EBP were run in parallel. Immunodecoration with C/EBP antibody resulted in the appearance of
multiple bands, three of which are likely due to alternative translation initiation (Fig. 3B). Proteins initiated at
Met1 or Met24 are transcriptional activators,
have a molecular mass of more than 30 kDa, and are designated LAP,
whereas translation initiation at Met199 results in the
small 16-kDa repressor isoform LIP (40). LAP and LIP are present in ESC
and in transfected COS-7 cells. In two of the three individual ESC
preparations, both LAP and LIP were elevated after a 6-day 8-Br-cAMP
treatment; in the third preparation, protein levels were equal in
untreated and treated cells. It is not clear if the intermediate
protein migrating at approximately 30 kDa represents a
post-translationally modified form or a proteolytic cleavage product
(see also Fig. 5A).
View larger version (38K):
[in this window]
[in a new window]
|
Fig. 3.
Expression patterns of dPRL and C/EBP
isoforms in ESC in response to 8-Br-cAMP. A, RT-PCR
analysis of ESC. Three individual ESC cultures were left untreated ()
or incubated with 8-Br-cAMP for 6 days (+), and cDNA was
synthesized from cytoplasmic RNA. PCR was performed for detection of
dPRL, C/EBP, and GAPDH mRNA. PRL cDNA was amplified with
primers anchored in the decidua-specific exon 1A and in exon 5 of the
human PRL gene. GAPDH amplification was performed for standardization.
PCR products were subjected to nonradioactive Southern blot
hybridization. B, Western blot analysis of C/EBP isoforms in
ESC. Nuclear proteins were harvested from the same individual ESC
cultures as in panel A. As positive controls, nuclear
extracts were prepared from COS-7 cells which had been transiently
transfected with pSG-C/EBP or pSG-C/EBP (lanes 7 or
8, respectively). The amounts of proteins loaded were: 10 µg (lanes 1 and 2), 15 µg (lanes 3 and 4), 30 µg (lanes 5 and 6), 1 µg (lane 7), and 2 µg (lane 8).
Immunodetection was carried out with antibodies to C/EBP
(upper panel) and C/EBP (lower panel).
Migration of molecular mass markers is indicated on the left
in kilodaltons. C, time course of C/EBP protein induction
in ESC in response to 8-Br-cAMP. Nine flasks of an ESC preparation were
plated in parallel and left untreated or treated for the indicated time
periods with 8-Br-cAMP before simultaneous harvesting of protein
extracts. Western blot analysis was carried out on nuclear (upper
panel) and cytosolic (lower panel) protein fractions
with C/EBP antibody to study changes in isoform expression and
subcellular distribution. Twenty µg of nuclear protein and 15 µg of
cytosolic protein were loaded per lane.
|
|
C/EBP protein levels, in contrast, varied widely between individual
specimens but were never affected by 8-Br-cAMP treatment (Fig.
3B). Only a single band of 32 kDa apparent molecular mass was detected. C/EBP protein could not be demonstrated in ESC by
Western blot analysis, but a single band was immunodecorated with
C/EBP antibody in control nuclear extracts from COS-7 cells transfected with C/EBP expression vector (not shown).
If C/EBP in ESC was in fact transcriptionally controlled by the PKA
pathway, up-regulation might be rapid and transient, having already
passed after 6 days of stimulation with 8-Br-cAMP. We therefore
performed a kinetic study including earlier time points of 1, 2, 4, 8, and 24 h and 2 and 4 days. We also compared C/EBP levels in the
cytosolic versus the nuclear fraction to detect a potential
cAMP-induced change in subcellular distribution (Fig. 3C).
In nuclear extracts, LAP and LIP were detectable in control cells. An
increase in protein levels for both isoforms, but more distinctly for
LIP, became apparent only between 8 and 24 h of 8-Br-cAMP
treatment, reached a maximum between 2 and 4 days, and declined after 6 days. Parallel kinetics were observed in cytosolic extracts for LAP
levels. However, LIP was not detectable in the cytosolic fraction. As
LAP levels in both subcellular compartments changed in parallel, no
cAMP-induced nuclear translocation appears to take place in ESC.
Fragment dPRL-332/-270 Confers C/EBP Responsiveness to a Minimal
Promoter in Co-transfection Experiments--
Since the dPRL promoter
fragment 332/270 was able to bind C/EBP, -, and - in
vitro, we next inserted this fragment in front of the minimal
homologous promoter element dPRL32/+65 in a luciferase reporter
vector (Fig. 4A). This
construct was then co-transfected with expression vectors for C/EBP,
-, or - to investigate their ability to interact with the dPRL
promoter in vivo. COS-7 cells were chosen as the recipient
cells because they express very low endogenous levels of these
transcription factors as determined by Western blot and EMSA/supershift
analyses (see Figs. 3B and 5A, and data not
shown). The reporter fusion 2x(dPRL-332/-270)/-32/luc3 was strongly
induced by C/EBP and moderately by C/EBP, while C/EBP
displayed only a very small activation potential (Fig. 4B).
Surprisingly, the intact dPRL promoter extending from 332 to +65 in
the reporter construct dPRL-332/luc3 was unresponsive to any of the
C/EBP factors. The results obtained with the isolated fragment
332/270 clearly show that C/EBPs bind to it and can transactivate
in vivo, C/EBP being the most potent factor. The very
minimal transactivating ability of C/EBP can be explained by the
fact that COS-7 cells transfected with the C/EBP cDNA translate
not only LAP but also substantial amounts of LIP from this template
(see Fig. 3B). No explanation for the unresponsiveness of
the wild type promoter construct dPRL-332/luc3 to C/EBP could be
provided at this point.
View larger version (24K):
[in this window]
[in a new window]
|
Fig. 4.
Activation of dPRL promoter constructs by
C/EBP expression vectors in COS-7 cells and by cAMP in ESC.
A, schematic depiction of the minimal dPRL promoter/reporter
gene construct 32/luc3 carrying sequence 32/+65 of the dPRL gene
fused to the luciferase gene (luc), the intact dPRL-332/luc3
promoter construct containing sequence 332/+65, deletion constructs
in which regions 332/270, 191/32, or 134/32 had been
removed, and the fusion constructs 1x (dPRL-332/-270)/-32/luc3 and
2x(dPRL-332/-270)/-32/luc3 containing one or two copies of fragment
dPRL-332/-270 inserted in front of the minimal promoter in 32/luc3.
The C/EBP-binding sites D and B are indicated by ovals, the
proximal CRE-like element (CRE-L) by a hexagon. The
black square symbolizes exon 1A of the human PRL gene, and
the perpendicular arrow the decidua-specific transcriptional
start site. B, COS-7 cells were co-transfected with the
indicated reporter constructs (0.9 µg/well) and with expression
vectors pSG-C/EBPrev (as the negative control) (open
bars), pSG-C/EBP (black bars), pSG-C/EBP
(cross-hatched bars), or pSG-C/EBP (hatched
bars) (0.4 µg/well). C, primary cultures of ESC were
transfected in 24-well plates with the indicated reporter constructs
(0.75 µg/well) and left untreated (open bars) or treated
with 8-Br-cAMP for 48 h (black bars).
|
|
The PKA-mediated activation of the dPRL promoter is cell-specific and
cannot be elicited in COS-7 cells (data not shown). All following
transfection experiments were therefore performed in cell types that
are capable of activating the endogenous dPRL promoter, i.e.
primary cultures of ESC and of human myometrial smooth muscle cells.
The wild type promoter in dPRL-332/luc3 is strongly activated by
8-Br-cAMP in transfected ESC (Fig. 4C). Deletion of the
region 332/270 (construct dPRL-270/luc3) significantly reduced the
cAMP response. However, the isolated fragment 332/270 alone,
inserted in front of the minimal dPRL promoter, was unresponsive to
cAMP. Further deletion analyses revealed that a fusion construct carrying element 332/191 was still unresponsive while a construct containing element 332/134 partially regained cAMP responsiveness. This indicates that neither the proximal CRE-L (see Fig. 4A)
nor region 332/270 alone or in combination are sufficient but that an additional cis-acting element located between 191/134
contributes to full cAMP inducibility of the dPRL promoter.
The cAMP Response of dPRL332/+65 in ESC Is Diminished by Mutation
of the Composite C/EBP-binding Site D-B and Is Abolished by Coexpressed
LIP--
In order to dissect the contributions of alternative
translation products to the overall regulatory capacity of expression vector for C/EBP, we created expression vectors for LIP and LAP. The
latter was generated by mutating the methionine residue
Met199 to a leucine to prevent downstream translation
initiation. To verify correct translation initiation, COS-7 cells were
transfected with these expression vectors, and nuclear extracts
subjected to Western blot analysis using antibody to C/EBP (Fig.
5A). LIP expression vector
yielded a single band of 16 kDa (lane 3) comigrating with
the smallest product generated by C/EBP expression vector (lane 1). LAP expression vector (lane 2) yielded
a doublet of bands around 40 kDa comigrating with the major products
generated by the C/EBP expression vector (lane 1). Both
expression vectors for C/EBP and LAP yielded an additional minor
product of about 30 kDa which is also visible in nuclear extracts from
cAMP-stimulated ESC cultures (see Fig. 3C) and may represent
a cleavage product.
View larger version (24K):
[in this window]
[in a new window]
|
Fig. 5.
Effect of LAP and LIP on dPRL promoter
activity in ESC and myometrial smooth muscle cells. A,
Western blot analysis of nuclear extracts from COS-7 cells transfected
with expression vectors pSG-C/EBP (lane 1), pSG/LAP
(lane 2), and pSG/LIP (lane 3). Immunoblotting
with antiserum to C/EBP visualized bands around 40 kDa designated
LAP and an intermediate band marked by an
arrowhead in lanes 1 and 2, and a low
molecular weight product designated LIP in lanes
1 and 3. B, ESC were co-transfected in
24-well plates with 2x (dPRL-332/-270)/-32/luc3 (left panel;
gray bars) or dPRL-332/luc3 (right panel) as the
reporter plasmid (0.75 µg/well) and the expression vectors
pSG-C/EBPrev as control, pSG-C/EBP, pSG-C/EBP, pSG/LIP, or
pSG/LAP (0.1 µg/well). Cells were left unstimulated (open
and gray bars) or stimulated with 8-Br-cAMP for 48 h
(black bars). C, primary cultures of myometrial
smooth muscle cells were transfected as described above for ESC in
B, right panel.
|
|
At first, the newly created expression vectors were tested in
co-transfection experiments in ESC using the fusion construct 2x(dPRL-332/-270)/-32/luc3 as the reporter (Fig. 5B, left
panel). The transactivation potential of LAP was very pronounced
and comparable to that of C/EBP. In contrast, LIP did not activate
the reporter construct. C/EBP displayed an intermediate effect, most
likely reflecting the co-translation of LAP and LIP in ESC as shown
before in COS-7 cells.
We then investigated the effect of these expression vectors on the wild
type dPRL promoter in ESC, alone or in combination with 8-Br-cAMP
treatment (Fig. 5B, right panel). Basal activity of
dPRL-332/luc3 was increased approximately 3-fold by 8-Br-cAMP treatment. C/EBP, C/EBP, and LAP all elicited a significant induction of dPRL promoter activity which was further enhanced by the
addition of 8-Br-cAMP. The strongest activation (13-fold) was obtained
by a combination of LAP and 8-Br-cAMP. In contrast, coexpression of LIP
abrogated the cAMP-mediated induction of the dPRL promoter. Even more
pronounced effects of C/EBPs were obtained in myometrial smooth muscle
cells which display a very low basal activity of the dPRL promoter
(Fig. 5C). C/EBP caused a significant 23-fold induction
which was further enhanced by 8-Br-cAMP. Introduction of C/EBP only
resulted in a minimal activation, still allowing enhancement by
8-Br-cAMP, whereas expression of LIP completely abrogated cAMP
induction. Most interestingly, LAP expression vector was as potent as
C/EBP in transcriptional activation, effecting an 87-fold induction
when combined with 8-Br-cAMP.
In order to investigate whether the C/EBP consensus binding sequences
were instrumental in transducing the cAMP signal to the dPRL promoter,
we mutated these sites in the context of the cAMP-responsive promoter
construct dPRL-332/luc3. In addition to the composite D-B site
(coordinates 310/285) we also mutated a downstream C/EBP consensus
site (site F, coordinates 214/201) and a consensus sequence for
binding of Ets factors (site G, coordinates 248/239) (Fig.
6). The latter two sequences overlap with
regions that have recently been described as decidual-specific
footprints formed with extracts from ESC decidualized by progesterone
treatment (209/201 and 257/244) (50). In co-transfection
experiments in ESC, the cAMP responsiveness of promoter constructs was
tested by a 48-h incubation with 8-Br-cAMP. In addition, we
co-transfected the expression vector for the repressor isoform LIP
(Fig. 7A). The intact promoter
in dPRL-332/luc3 displayed the highest basal activity and was induced
4.1-fold by 8-Br-cAMP. Deletion of the major cAMP-responsive region
-332/-270 in dPRL-270/luc3 had the same effect as mutation of the D-B
sites in dPRL-332/D-Bmut/luc3; basal activity was reduced to about
30%, and cAMP inducibility was reduced to about 50% of that seen with
dPRL-332/luc3. The other two promoter mutations dPRL-332/F-mut/luc3 and
dPRL-332/G-mut/luc3 also displayed lowered basal activities but, in
contrast to dPRL-332/D-Bmut/luc3, their cAMP inducibility was not
impaired (4.5- and 4.7-fold, respectively). This indicates that the D-B
sites are essential for cAMP responsiveness of the dPRL promoter,
whereas the F and G sites are dispensable for the cAMP response but
contribute to basal promoter activity. Co-transfection of LIP
completely abolished cAMP induction of all reporter constructs. It is
noteworthy that LIP also reduced basal activity of dPRL-332/luc3,
indicating that the elevated basal transcription from dPRL-332/luc3, as
compared with dPRL-270/luc3, is dependent on endogenous activating
C/EBP isoforms.
View larger version (26K):
[in this window]
[in a new window]
|
Fig. 6.
Map of dPRL promoter constructs and mutations
of C/EBP and Ets factor-binding sites. A, consensus
binding sequences for transcription factors of the C/EBP (B,
D, and F) (ovals) and Ets family
(G) (rhombus), and the CRE-like element (CRE-L)
(hexagon) are depicted in the minimal dPRL promoter
construct 32/luc3, the 5' deletion construct dPRL-270/luc3, and the
intact construct dPRL-332/luc3. Mutated consensus sequences in the
context of dPRL-332/luc3 are crossed-out. Sites G and F are
labeled with question marks because their functionality
could not be confirmed in the course of this study. B,
sequence of the dPRL promoter region from 332 to 187 with the
consensus binding sequences for C/EBP (D, B, and
F) and Ets factors (G) highlighted by
boxes. The oligonucleotides used for site-directed
mutagenesis (D-B-mut, G-mut, and F-mut) are shown below the
sequence. Lowercase letters indicate mutations; new
restrictions sites, integrated for diagnostic purposes, are
underlined.
|
|
View larger version (16K):
[in this window]
[in a new window]
|
Fig. 7.
Site D-B is required for the cAMP response
and for binding of C/EBP to the dPRL promoter
in ESC. A, ESC were co-transfected with the dPRL
promoter constructs (1.5 µg/well) carrying mutations or deletions as
illustrated in Fig. 6, and expression vector pSG/LIP (0.1 µg/well).
Transfected cells were either left unstimulated (open bars)
or stimulated for 48 h with 8-Br-cAMP (filled bars).
B, ESC were transfected with the wild type promoter
construct dPRL-332/luc3, the mutated construct dPRL-332/D-Bmut/luc3, or
the positive control vector NFIL6RE/-32/luc3 which carries a C/EBP
consensus binding element. Co-transfected were the expression vector
pVP16/LAP-DBD containing a fusion of the VP16-AD and the LAP-DBD
(filled bars), or the parent vector pABVP16 carrying the
VP16-AD only (open bars). 1.5 µg of reporter construct and
0.1 µg of expression vector were used per well.
|
|
To further support the notion that the loss of cAMP inducibility in
dPRL-332/D-Bmut/luc3 was a consequence of the inability of C/EBP DBD to
bind to the mutated sequence, we created a fusion of the DBD of
C/EBP with the strong transactivation domain of VP16. The resultant
expression vector pVP16/LAP-DBD was used in a co-transfection
experiment in ESC (Fig. 7B). The fusion protein VP16/LAP-DBD
activated the reporter construct 2x(dPRL-332/-270)/-32/luc3 more than
100-fold (not shown), strongly activated a positive control construct
carrying a palindromic C/EBP response element linked to a minimal
promoter (NFIL6RE/-32/luc3) and was also able to transactivate the wild
type dPRL promoter in dPRL-332/luc3. Mutation of the D-B sites in
dPRL-332/D-Bmut/luc3 resulted in a complete loss of inducibility. Three
conclusions can be drawn from this experiment. The DBD of C/EBP
binds to the wild type dPRL promoter in vivo; the mutations
introduced by us disable the D-B sites; and lastly, no other sequence
in the dPRL promoter, including site F, binds the C/EBP DBD.
| |
DISCUSSION |
The observation that prolonged treatment with cAMP analogs causes
decidualization and induction of dPRL expression in isolated ESC
in vitro prompted us to search for cAMP-inducible factors that interact with the dPRL promoter. We focussed our interest on the
region 332/270 because it is essential for the pronounced but
delayed transcriptional activation of the dPRL promoter in response to
elevated cAMP (17). Gel shift analyses revealed that dPRL-332/-270
formed specific complexes with nuclear proteins from ESC, and that the
intensity of complex formation was increased in decidualized cells
which had been exposed to 8-Br-cAMP for 6 days. The pattern of complex
formation on probe dPRL332/270 was always diffuse in the upper
range and included two distinct sharper bands in the lower range of the
gel. In spite of this multiplicity of DNA/protein adducts, they were
quantitatively supershifted by antibody to C/EBP. This indicates the
engagement of C/EBP in virtually all protein complexes binding to
dPRL-332/-270.
We have shown by Western blot analysis that ESC express both LAP and
LIP, and that protein levels increase in response to cAMP treatment. It
is therefore conceivable that the distinct high mobility complexes seen
in EMSA, which are specific to extracts from decidualized cells and
supershifted by C/EBP antibody, contain LIP homodimers or
heterodimers with another small molecule. Low mobility complexes may,
at least in part, result from heterodimerization of various C/EBP
isoforms. Even when using in vitro transcription/translation mixture primed with pSG-C/EBP only, we observed a broad range of
bands in EMSA on probe dPRL-332/-270 (not shown). In addition, low
mobility complexes may contain heterodimers with C/EBP because we
could demonstrate both by EMSA/supershift and by Western blotting that
this isoform is present in ESC, albeit at much lower levels than
C/EBP. Whether other nuclear proteins from ESC interact with
C/EBP on dPRL-332/-270 remains to be determined.
In addition to elevation of C/EBP protein levels, stimulation of the
PKA pathway may contribute to the enhanced formation of complexes
between the dPRL promoter and C/EBP in other ways. (i) The level or
binding affinity of another unknown nuclear factor, engaged in complex
formation with C/EBP, may increase and serve to recruit C/EBP to
the dPRL promoter. (ii) The binding affinity of C/EBP may be
enhanced as a consequence of post-translational modification. Several
serine residues in C/EBP have been described as targets for PKA
phosphorylation, however, the role of phosphorylation for
transactivating function of the protein has not fully been determined.
While in vitro binding studies seem to indicate that phosphorylation at Ser240 in the DBD of rat C/EBP
reduces DNA binding affinity and at Ser105 in the
transactivation domain is without effect (51), phosphorylation in
vivo at Ser288 in the human C/EBP appears essential
for nuclear translocation (52, 53). This serine residue and its
contiguous sequence are highly conserved in the rat and human proteins,
human Ser288 corresponding to rat Ser240 (38,
54). Our data do not support the notion that PKA-mediated phosphorylation triggers nuclear translocation of C/EBP in ESC. In a
kinetic study including short term stimulations with 8-Br-cAMP we could
not detect a change in subcellular distribution of C/EBP in response
to the stimulus.
A random site selection approach to determine DNA binding specificity
of the C/EBP family had revealed similar, but not identical sequence
preferences (55). We also observed differences in binding of C/EBP,
C/EBP, and C/EBP to two sites in the dPRL-332/-270 promoter
fragment. Whereas the C/EBP site in subfragment B was able to bind all
three C/EBPs, C/EBP failed to bind to the C/EBP site in subfragment
D. This is in agreement with the binding specificities of sites B and D
predicted by the TFSEARCH program.
We performed a series of transfection experiments to determine the role
of C/EBPs in the transcriptional control of the dPRL promoter. C/EBP
and C/EBP were clearly able to bind to the region dPRL-332/-270 and
to transactivate the promoter fusion construct 2x(dPRL-332/-270)/-32/luc3, C/EBP being less potent than C/EBP. This may be due to the presence of only one binding site for C/EBP in the region dPRL-332/-270 as compared with two sites for C/EBP binding, or it may reflect different properties of the transactivation domains and different requirements for interacting partners of these
two proteins. Although there is a certain extent of redundancy in that
C/EBP, -, and - can compensate for one another in some systems
(56), the pronounced phenotypes observed in mice lacking one of the
three genes argue for specific physiological roles of each factor
(20-22, 57, 58; reviewed in Ref. 19). In addition to slightly
different DNA sequence preferences, distinctive functions are likely to
reside in different protein-protein interaction interfaces. For
example, C/EBP but not C/EBP is able to synergize with Sp1 by
physical interaction (33). Surprisingly, in numerous transfection
studies in COS-7 cells, none of the C/EBP expression vectors was
capable of transactivating the wild type intact dPRL promoter in
dPRL-332/luc3. This may in part be explained by different spacing
between the cognate DNA sequence and the transcriptional start site in
the wild type promoter compared with the fusion construct
2x(dPRL-332/-270)/-32/luc3. When the C/EBP-binding sites are located in
close proximity to the start site, as is the case in
2x(dPRL-332/-270)/-32/luc3, the transactivation domains of C/EBPs may
be capable of directly interacting with the basal transcription machinery. In the context of the wild type promoter, additional cofactors may be required to establish contact between the C/EBP transactivation domains and the basal transcription machinery. Such
endogenous factors are possibly present in limiting amounts when C/EBPs
are overexpressed by transfection, or they are cell-specific and
lacking in COS-7 cells which are not capable of activating the
endogenous dPRL promoter.
In contrast, in cell types capable of activating the endogenous dPRL
promoter, we observed substantial activation of dPRL-332/luc3 by
C/EBP and LAP. This was the case in ESC and, more dramatically, in
myometrial smooth muscle cells which display a very low basal activity
of the dPRL promoter. These cells therefore show very clearly that by
supplying C/EBP or LAP in combination with an activated PKA pathway,
highly efficient transcription of the dPRL promoter can be elicited.
Introduction of LIP resulted in a complete abrogation of cAMP
induction, both in myometrial and endometrial stromal cells. These
observations strongly argue for the importance of endogenous C/EBPs as
mediators of the cAMP signaling pathway to the dPRL promoter in
PRL-expressing cells and for the requirement of cell-specific cofactors
integrating C/EBP- and cAMP-mediated signals, such factors lacking in
COS-7 cells.
A physiological role for C/EBP in mediating hormonally induced PKA
signaling is supported by a number of reports. In rat granulosa cells,
treated with an ovulatory dose of hCG, an increase in LAP and LIP
isoforms is observed after 2 h (25). Luteinizing hormone induces
C/EBP protein in preovulatory ovaries maintained in an ex
vivo perfusion system; when C/EBP levels are reduced by
application of antisense oligonucleotides, ovulation is inhibited (24).
C/EBP-deficient female mice fail to down-regulate COX-2 and
P450arom in response to luteinizing hormone and do not
develop corpora lutea (20). In cultured rat Leydig cells, C/EBP
expression is elevated both at the mRNA and at the protein level
within 4 h of hCG stimulation, returning to control levels
thereafter (41). Treatment with follicle stimulating hormone rapidly
and transiently increases C/EBP expression in cultured rat Sertoli
cells as well as in whole testes of hypophysectomized animals (26). The
molecular basis, at least in the rat, for gonadotropin- or
cAMP-mediated up-regulation of C/EBP expression is the presence of
two CREs in the C/EBP promoter. PKA stimulates C/EBP
transcription both from the transfected and the endogenous promoter in
rat hepatocytes (49). In addition, autoregulation has been demonstrated
for the mouse C/EBP promoter (59). Such a mechanism may come into play as a secondary event to the cAMP-mediated up-regulation to further
enhance signaling. In contrast to all above reports, we observed a
complete absence of a rapid and transient up-regulation of C/EBP
protein in cAMP-stimulated ESC. An increase in LAP and LIP protein only
became apparent between 8 and 24 h of stimulation, and protein
levels remained elevated between 2 and 6 days of treatment. These
kinetics are congruent with the delayed cAMP-stimulated induction of
the dPRL promoter in ESC which occurs after 18 h and then persists
(17).
Our results provide evidence that the composite C/EBP consensus binding
sites D-B located at 310/285 are required for the cAMP response of
the dPRL promoter. Mutation of five bases in this region in reporter
construct dPRL-332/D-Bmut/luc3 drastically reduced cAMP inducibility
compared with wild type dPRL-332/luc3. Involvement of C/EBPs is
supported by the finding that the same mutation completely abolished
transactivation by VP16/LAP-DBD. The latter observation also indicates
that the downstream C/EBP consensus binding sequence designated site F
in this report does not interact with LAP-DBD.
Decidualization of ESC is a process that requires tight control
in vivo to establish a delicate balance between
proliferation and differentiation. We believe that at the molecular
level this is achieved by a complex orchestration of both
transcriptional activators and repressors. Our understanding of the
mechanisms controlling decidualization is still limited, but we know
that a sustained elevation of intracellular cAMP, a down-regulation of
the regulatory subunit RI of PKA, and a subsequent elevation of
catalytic subunit activity are part of the pathway (17). One of the
transcriptional repressors induced in the course of decidualization is
the inducible cAMP early repressor ICER, a product of the CREM gene
(43). In this report we show that members of the C/EBP family are also
expressed in ESC, and that positive and negative regulators of
transcription (LAP and LIP) are induced by a decidualization stimulus
while the activating form C/EBP is present at a constant level.
Changing the ratio between C/EBP and C/EBP would be predicted to
exert profound effects on dPRL promoter activation via a complex
control mechanism at the level of varying patterns of homo- and
heterodimerization between LAP, LIP, and C/EBP. A regulatory role
for shifting isoform ratios has been elucidated in the rat mammary
gland: while in pregnancy the LAP/LIP ratio is low, during lactation a
more than 100-fold increase in the LAP/LIP ratio is observed. This
hormonally regulated balance of C/EBP isoforms controls milk protein
gene expression (23).
Induction of the dPRL gene in response to cAMP occurs in a delayed
fashion, indicative of the necessity of intermediate steps for
transcriptional activation. We speculate that the C/EBP gene may
be one of the intermediate targets of the PKA pathway. We were
intrigued by the finding that the C/EBP gene itself, in contrast to
numerous reports in the literature (26, 41, 49, 60, 61), is a slow
responder to cAMP in ESC. We do not know at present if this is a
feature characteristic of the promoter of the human C/EBP gene, most
other data having been raised in rodent systems. We rather tend to
believe that the slow response is characteristic of this particular
tissue, the endometrial stroma. Under the assumption that first the
human C/EBP promoter, as reported for the mouse promoter (59),
underlies autoregulation, it would be subject to the same restrictions
as outlined above for the dPRL promoter: a certain balance between LAP
and LIP, and possibly other family members, may have to be established before positive autoregulation can set in. Provided secondly that the
human C/EBP promoter contains functional CREs, as reported for the
rat promoter (49), it would not only receive a positive signal from
activating CREB and CREM isoforms that are phosphorylated by PKA
catalytic subunit, it would also receive an opposing signal from the
repressor ICER which is up-regulated by sustained PKA activity in ESC
(43). Again, a certain balance between these conflicting inputs would
have to be established to allow for transcriptional activation of the
C/EBP gene.
Taken together, our study establishes the role of C/EBPs (particularly
LAP and C/EBP) as important transducers of the cAMP signal to a
delayed-response gene. The binding of activator C/EBPs to a composite
C/EBP response element at 310/285 in the proximal dPRL promoter
region is instrumental for cAMP responsiveness of the promoter.
Mutation of the response element reduces, and expression of the
dominant-negative C/EBP isoform LIP abrogates cAMP inducibility. Further studies will be needed to identify potential cofactors required
for the tight control of differentiation-specific dPRL gene expression
to achieve a deeper knowledge of the process of human endometrial
decidualization in particular and of specific physiological functions
of individual members of the C/EBP family of transcription factors in general.
TOP
ABSTRACT
INTRODUCTION
To whom correspondence should be addressed: IHF Institute for
Hormone and Fertility Research, University of Hamburg, Grandweg 64, 22529 H
