|
J Biol Chem, Vol. 274, Issue 35, 25108-25112, August 27, 1999
Kinetic Analysis of the Actinorhodin Aromatic Polyketide
Synthase*
Juerg
Dreier §,
Aseema N.
Shah , and
Chaitan
Khosla §¶
From the Departments of Chemical Engineering,
§ Chemistry, and ¶ Biochemistry, Stanford University,
Stanford, California 94305-5025
 |
ABSTRACT |
Type II polyketide synthases (PKSs) are bacterial
multienzyme systems that catalyze the biosynthesis of a broad range of
natural products. A core set of subunits, consisting of a ketosynthase, a chain length factor, an acyl carrier protein (ACP) and possibly a
malonyl CoA:ACP transacylase (MAT) forms a "minimal" PKS. They generate a poly- -ketone backbone of a specified length from
malonyl-CoA derived building blocks. Here we (a) report on
the kinetic properties of the actinorhodin minimal PKS, and
(b) present further data in support of the requirement of
the MAT. Kinetic analysis showed that the apoACP is a competitive
inhibitor of minimal PKS activity, demonstrating the importance of
protein-protein interactions between the polypeptide moiety of the ACP
and the remainder of the minimal PKS. In further support of the
requirement of MAT for PKS activity, two new findings are presented.
First, we observe hyperbolic dependence of PKS activity on MAT
concentration, saturating at very low amounts (half-maximal rate at
19.7 ± 5.1 nM). Since MAT can support PKS activity at
less than 1/100 the typical concentration of the ACP and
ketosynthase/chain length factor components, it is difficult to rule
out the presence of trace quantities of MAT in a PKS reaction mixture.
Second, an S97A mutant was constructed at the nucleophilic active
site of the MAT. Not only can this mutant protein support PKS activity,
it is also covalently labeled by [14C]malonyl-CoA,
demonstrating that the serine nucleophile (which has been the target of
PMSF inhibition in earlier studies) is dispensible for MAT activity in
a Type II PKS system.
 |
INTRODUCTION |
Polyketides are a large family of structurally diverse natural
products which are synthesized by a variety of organisms. They include
many macrocyclic and aromatic compounds such as tetracyclines and
erythromycin (antibiotics), FK506 (immunosuppressant), doxorubicin (anticancer), and avermectin (antiparasite). The aforementioned are all
from actinomycetes, a bacterial group that synthesizes a large
proportion of such compounds. Gene clusters of several bacterial and
fungal polyketide pathways have been cloned and analyzed. Sequence
analysis has revealed that polyketide synthases (PKSs)1 are multifunctional
enzymes that are structurally and mechanistically related to fatty acid
synthases. Through a catalytic process involving repeated
decarboxylative condensations between coenzyme A-derived acylthioesters, they synthesize a growing carbon chain backbone that is
regio- and stereoselectively modified into the final natural product.
PKSs achieve enormous structural variety by controlling the overall
chain length, choosing primer and extender units (usually acetyl,
propionyl, malonyl, and methylmalonyl) and, especially in the case of
aromatic polyketides, guiding the regiospecific cyclizations of growing
chains (for reviews, see Refs. 1-4).
Type II PKSs are a family of bacterial PKSs related to Type II fatty
acid synthases found in bacteria and plants. They catalyze the
biosynthesis of a broad range of polyfunctional aromatic natural products. These PKSs contain a single set of iteratively used active
sites carried on separate proteins. They consist of a "minimal" PKS
and auxiliary subunits. The minimal PKS is composed of four subunits: a
ketosynthase (KS), a chain length factor (CLF), an acyl carrier protein
(ACP), and possibly a malonyl CoA:ACP transacylase (MAT) (5, 6). To be
active the ACP needs a phosphopantetheine arm where acyl chains are
attached during the course of polyketide synthesis. Since apoACP, which
lacks this prosthetic group, fails to support polyketide synthesis, the
role of the pantetheine arm in catalysis has been well established. In
contrast, the role (if any) of the polypeptide moiety of the ACP is
less clear. Indeed, in certain polyketide synthases and non-ribosomal
peptide synthetases, the requirement of an acyl carrier protein can be
by-passed by presenting the condensing enzyme with appropriate CoA- or
CoA-mimetic substrates (7).
A model has been proposed for the sequence of reactions in aromatic
polyketide biosynthesis by the minimal PKS (Fig.
1). Malonyl units are transferred from
malonyl CoA to the ACP by the MAT. Repeated decarboxylative
condensations occur between the ACP-bound nucleophilic extender units
and the KS-bound electrophilic growing chains, giving rise to a
poly- -ketone backbone of a specified length (5). (The system is
primed by a decarboxylated malonyl unit by a mechanism that remains to
be elucidated, but presumably involves the decarboxylative activity of
the KS (8).) In the case of the actinorhodin (act) minimal
PKS, a 16-carbon backbone is generated, which subsequently undergoes
cyclization to generate two principal products, SEK4 and SEK4b (Fig.
1).

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 1.
Synthesis of SEK4 and SEK4b by the
act minimal PKS. A C16 carbon chain
is synthesized from malonyl-CoA derived building blocks, resulting in
the octaketides SEK4 and SEK4b.
|
|
There is some debate about the requirement of the MAT for minimal PKS
activity. Since no MAT or homologous protein is encoded within typical
aromatic PKS gene clusters, it was originally suggested that these
aromatic PKSs utilized the MAT from primary fatty acid metabolism (9,
10). As a direct test of this idea, we attempted to reconstitute the
act minimal PKS from purified components (5). In our
laboratory purified KS-CLF (which co-elute as a tight complex) and ACP
were found to be insufficient for reconstituting PKS activity comparable to that seen in crude cell-free extracts of
Streptomyces coelicolor, which produces actinorhodin.
However, when crude extracts from CH999, an engineered strain of
S. coelicolor that lacks the entire act gene
cluster, were added to purified KS-CLF and ACP, PKS activity was
observed. Based on this assay, we purified a 32-kDa protein from CH999
that was responsible for this activity. N-terminal sequencing revealed
that it was identical to the MAT involved in fatty acid biosynthesis in
S. coelicolor. Based on this and earlier in vivo
results (9, 10), we proposed that the fatty acid MAT is also a
component of the act minimal PKS. A similar conclusion was
also reached by Hutchinson and co-workers (6) who determined that
>90% of the malonyl-CoA incorporated into TCM F2 was derived from a
MAT-catalyzed pathway. However, two recent communications from Simpson
and co-workers (11, 12) have challenged the validity of these results.
Hitchman, et al. (11) showed that: (i) in contrast to the
Escherichia coli ACP (obtained from a commercial source and
purified) wild-type and mutant forms of the act ACP is
capable of transferring malonyl groups from malonyl-CoA in the absence
of MAT; (ii) that this self-malonylation reaction has a
kcat of 0.34 min 1 and a
Km of 219 µM; and (iii) that this
reaction is not inhibited by phenylmethylsulfonyl fluoride, a known
inhibitor of the E. coli MAT. These results led them to
speculate that an MAT is not required for PKS activity, and that the
KS, CLF, and ACP may constitute a truly minimal PKS in vivo.
Subsequently, Matharu et al. (12) presented additional data
in support of this model. They showed that: (i) their ACP and KS/CLF
preparations, which contain low (but non-zero) MAT activity, were
necessary and sufficient for PKS activity, and (ii) the marginal
advantage of the S. coelicolor MAT on the rate of polyketide
synthesis is only detectable up to a concentration of 20 µM ACP. Thus, the exact composition of the minimal PKS
remains unresolved.
This report describes the steady-state kinetic properties of the
act minimal PKS. The dependence of the rate of polyketide synthesis on the concentration of individual protein components is
assessed. Likewise, the ability of the apoACP to inhibit minimal PKS
activity is evaluated. Finally, an S97A mutant of the S. coelicolor MAT, which lacks the nucleophile on which malonyl
groups are believed to be transiently attached, has been constructed
and analyzed. Our results provide direct evidence for interactions
between the polypeptide portion of the ACP and the remainder of the
minimal PKS components. Moreover, they also shed further light on
whether physiologically relevant minimal PKS activity requires the MAT or not.
 |
EXPERIMENTAL PROCEDURES |
Materials--
[14C]Malonyl-coenzyme A (25 µCi/ml, 52 mCi/mmol) was purchased from Movarek Biochemicals. Silica
gel plates Si250F for thin layer chromatography were obtained from
J. T. Baker. All other chemicals were purchased from Sigma and
were of the highest available grade.
Protein Expression and Purification--
Both the act
KS/CLF and the act holoACP were obtained from S. coelicolor CH999/pSEK38 cultures (13). The act KS·CLF
complex was purified as described earlier (5, 8). Although Simpson and
co-workers (12) have reported difficulties in reproducing these
procedures, the published protocols reliably yield KS/CLF preparations
that are devoid of ACP and MAT (as judged by SDS-PAGE as well as the
absolute requirement of both ACP and MAT for minimal PKS activity).
Fractions containing the act holoACP were collected at the
beginning of the (NH4)2SO4 gradient
from phenyl-Sepharose columns (as described for KS/CLF). Further
purification of the ACP was achieved with a Resource Q (Pharmacia)
column using a gradient from buffer A (20 mM Tris, pH 6, 2 mM EDTA, 2 mM dithiothreitol, 15% glycerol) to
buffer B (A + 1 M NaCl). The ACP eluted between 240 and 300 mM NaCl. Gel filtration on a Superdex-200 column in 100 mM NaHPO4, pH 7.3, 2 mM EDTA, 2 mM dithiothreitol was performed as the final purification
step. Frenolicin (fren) apoACP was purified from an E. coli strain expressing this gene as described earlier (14, 15).
Fren holoACP was obtained by coexpressing fren
ACP and Sfp phosphopantetheinyl transferase (16, 17) in
E. coli. The sequence for the fabD gene of
S. coelicolor A3(2) (9), which encodes the MAT, has been
deposited in the EMBL Data Base under accession number X86475. The
following primers were designed with NdeI and
EcoRI sites at the 5' and 3' termini, respectively: ATATACATATGCTCGTACTCGTCGC and ATCCGAATTCGGCCTGGGTGTGCTCGGC.
The stop codon was deleted. S. coelicolor genomic DNA
was used as a template for polymerase chain reaction. The polymerase
chain reaction fragment was cloned into pET21c vector in the
NdeI-EcoRI restriction sites to result in
pANS512. The expressed protein had a 6xHis tag at the C-terminal end
for simpler purification. E. coli BL21(DE3) cells were
transformed with pANS512, containing the cloned S. coelicolor MAT gene. 1-Liter cultures were induced with 1 mM isopropyl-1-thio- -D-galactopyranoside at
A595 = 0.6-0.8. Cells were harvested 3 h
after induction. The cell pellet was resuspended in 50 mM
Tris, pH 8.4, and lysed by sonication on ice. Cell debris was pelleted
at 11,000 rpm, 4 °C and the supernatant was loaded onto a nickel
NTA-agarose column (Qiagen). MAT elutes at 50 mM imidazole,
pH 8.0. Protein was obtained at yields of ~1 mg/liter and was judged
to be >95% pure by SDS-PAGE. The MAT was concentrated after
purification and buffer was changed to 100 mM
NaHPO4, pH 7.3, 2 mM EDTA, 2 mM
dithiothreitol. All protein concentrations were determined by Lowry
assays (18) using a kit from Sigma diagnostics.
PKS Activity Assays--
Production of SEK4 and SEK4b was
monitored in vitro by an assay based on
14C-labeled malonyl-CoA incorporation. 100-µl reactions
in 100 mM NaHPO4, pH 7.3, 2 mM
EDTA, 2 mM dithiothreitol were started by adding
[14C]malonyl-CoA (23.654 mM, 0.705 mCi/mmol) to a final concentration of 2.4 mM and stopped by
addition of solid NaH2PO4. Reaction products were visualized by thin layer chromatography (TLC) as described in Ref.
5. Products were quantified by counting radioactivity using an
InstantImager 2024 (Packard).
Mutagenesis and Analysis of the MAT--
MAT S97A was
constructed using pANS512 as template for a T7 DNA polymerase-based
double-stranded, site-directed mutagenesis method (Chameleon,
Stratagene). The mutant clone used for enzyme preparation was verified
by DNA sequencing.
21-µl Reaction mixtures of 25 pmol of MAT and 14C-labeled
malonyl-CoA (75 nCi, 52 mCi/mmol) were incubated for 15 min, stopped by
addition of 5 µl of acidic gel loading buffer (0.1% bromphenol blue,
1% SDS, 40% glycerol, 5% trichloroacetic acid), and analyzed by
autoradiography of a 10% SDS-polyacrylamide gel (5).
 |
RESULTS |
Km for Malonyl CoA--
Polyketides produced in
vitro can be radiolabeled using [14C]malonyl-CoA as
substrate. SEK4 and SEK4b, synthesized by the act minimal
PKS, are visualized and quantities determined by TLC autoradiography. Polyketide production in 100-µl reactions containing 20 µM act holoACP, 100 nM MAT,
and 0.8 µM KS/CLF is linear over about 30 min; during
this period the PKS turns over approximately 12 times. We measured SEK4
and SEK4b production within this range to determine initial reaction
velocities for different conditions. In a series of reactions, initial
velocities of SEK4 + SEK4b production were measured as a function of
malonyl-CoA concentration. The apparent Km for
malonyl-CoA was found to be 79.1 ± 8.2 µM (data not
shown). To keep the substrate concentration at saturating levels, all
reactions described below were performed at 2.4 mM malonyl-CoA concentrations.
Titration of KS/CLF--
The core component of the act
minimal PKS is formed by the KS and CLF. These two proteins form a
tight complex. One pair of KS and CLF is expected to contain one active
site for the condensation of acylthioesters. Therefore, concentrations
of KS and CLF were calculated assuming an  type complex
representing 1 catalytic unit even though these two proteins purify as
an 2 2 heterotetramer (5). KS/CLF was
titrated into reaction mixtures containing a fixed act
holoACP concentration of 20 µM and a fixed MAT
concentration of 100 nM. (These concentrations of both MAT
and ACP are sufficient to saturate the system, as described below.)
Initial reaction velocities were measured up to 1.6 µM
KS/CLF, an upper limit dictated by the concentrations of the
different protein preparations. When initial reaction velocities were
plotted against KS/CLF concentration, a linear relationship was
observed (Fig. 2). From the slope of this
line, an apparent kcat of 0.31 ± 0.11 min 1 was deduced (average based on three independent
experiments).

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 2.
Influence of KS/CLF concentration on overall
SEK4 and SEK4b production. Initial velocities of polyketide
production were measured at 20 µM act holoACP,
100 nM MAT, and increasing amounts of KS/CLF.
|
|
Titration of MAT--
The MAT was titrated into a reaction mixture
containing 0.8 µM act KS/CLF and 20 µM act holoACP (Fig.
3). Several features should be noted.
First, within the limits of TLC autoradiography based detection, no PKS
activity could be observed in the absence of MAT. Second, MAT is
required in only small amounts to allow maximal activity of the system.
In an effort to quantify the ability of MAT to saturate the system, we
determined the concentration of MAT at which 50% of the maximum
velocity was reached. This concentration is found to be 19.7 ± 5.1 nM (average based on two independent experiments).
Third, fitting a hyperbolic curve to the data shown in Fig. 3 yielded
an apparent Vmax of 33.2 ± 2.1 pmol/min.
Taking KS/CLF as the enzyme in the reaction, an apparent kcat of 0.41 ± 0.03 min 1 is
calculated, which is in good agreement with the apparent
kcat measured in the KS-CLF titrations described
above.

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 3.
Reactions with 0.8 µM KS/CLF, 20 µM act holoACP, and
varying amounts of MAT were done to measure polyketide production.
Initial velocities of SEK4/4b production were plotted against MAT
concentrations. A hyperbolic curve was fitted to the data.
|
|
Titration of the Fren ACP--
Fren holoACP was added
in increasing amounts to reaction mixtures containing 0.8 µM KS/CLF and 100 nM MAT. The rate of SEK4 and SEK4b production depends on fren holoACP concentration
as shown in Fig. 4A. At about
10 µM fren holoACP a maximum velocity is
reached. A hyperbolic curve fitted to the data measured shows a
Vmax of 34.7 ± 1.7 pmol/min. Half-maximal
velocity is reached at 2.1 ± 0.55 µM.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 4.
A, initial velocities of SEK4 and SEK4b
production were measured for 0.8 µM KS/CLF, 100 nM MAT and fren holoACP concentrations from 0 to
35 µM. A hyperbolic curve was fitted to the data
measured. B, apoACP inhibition of fren
holoACP. K50 values are holoACP
concentrations required to reach Vmax/2 in the
presence of different amounts of apoACP. The linear fit was used to
calculate a Ki for competitive inhibition.
|
|
Titration of the Act ACP--
The same experiment as with
fren ACP was performed with wild-type act
holoACP. As shown in Fig. 5, the
dependence of the rate of polyketide synthesis on the concentration of
act holoACP is complex; it peaks at a concentration of 20 µM and drops thereafter. This profile was reproducibly
observed in three separate experiments conducted with independent
protein preparations. The reaction velocity at 20 µM ACP
is 34 pmol/min, corresponding to an apparent kcat of 0.43 min 1, which compares
well with the numbers obtained in MAT and KS/CLF titrations. Not
accounting for the inhibitory effects that are observed beyond 20 µM (see "Discussion"), a half-saturating
concentration for ACP can be estimated to be approximately 5 µM (average based on three independent experiments).

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 5.
Act holoACP titration. Initial
velocities of SEK4 and SEK4b production for 0.8 µM
KS/CLF, 100 nM MAT, and act holoACP
concentrations from 0 to 35 µM were determined
(closed circles). The same experiment was performed in the
presence of 6 µM apoACP (open circles).
|
|
Inhibition of Polyketide Synthesis by ApoACP--
Fren
holoACP titrations were performed as described above (0.8 µM KS/CLF, 100 nM MAT). In these experiments
the fren apoACP was present in the reaction at a fixed
concentration. Interestingly, we observe a clear inhibition of SEK4 and
SEK4b production in the presence of the catalytically inactive apoACP.
The extent of inhibition depends on apoACP concentration. Thus, we
determined the effect of apoACP by calculation of Ki
values for competitive and noncompetitive inhibition. For the
competitive component a Ki of 12.3 µM
is deduced (Fig. 4B). As the noncompetitive part leads to a
very high Ki (> 300 µM), no
significant noncompetitive competition is measured. To confirm that
fren apoACP also inhibits activity of the PKS in the
presence of the act holoACP, the experiment was repeated by
varying the concentration of the act holoACP in the presence
of 6 µM fren apoACP. Again, significant
inhibition by apoACP was observed in this case (Fig. 5); however, given
the unusual features of the titration curve for the act
holoACP in the absence of apoACP, quantitative measurements of
inhibitory constants were not made.
Construction and Analysis of the S97A Mutant of the
MAT--
Extensive analysis of acyltransferases from various fatty
acid or polyketide synthases has shown that a serine residue
corresponding to Ser-97 of the S. coelicolor MAT is the
active site nucleophile of this enzyme. Malonyl groups are transiently
attached to this residue during their transfer from malonyl-CoA to the
ACP via a ping-pong kinetic scheme (19). More recently, the x-ray
crystal structure of the E. coli MAT (40% identical to the
S. coelicolor MAT at the amino acid level) has confirmed
assignment of Ser-97 as the active site of this family of enzymes. We
sought to construct and analyze a mutant MAT in which this nucleophile
is eliminated. The mutant protein was generated as described under
"Experimental Procedures." Unexpectedly, it was found to be both
necessary and sufficient for polyketide biosynthesis (Fig.
6A). Moreover, consistent with
the expectation that the MAT must function via a ping-pong mechanism,
incubation of the protein with [14C]malonyl-CoA and
analysis by SDS-PAGE-autoradiography showed that malonyl groups could
be covalently attached to the protein (Fig. 6B). These
results suggest that the MAT from S. coelicolor possesses an
alternative nucleophilic group that is capable of substituting for the
active site serine in the S97A mutant.

View larger version (61K):
[in this window]
[in a new window]
|
Fig. 6.
Analysis of MAT S97A. Panel A
shows the results of SDS-PAGE autoradiography in the presence of
[14C]malonyl-CoA, as described under "Experimental
Procedures." Lane 1, wild-type MAT; lane 2, MAT
S97A. Panel B shows an autoradiograph of a TLC plate used to
develop extracts from in vitro PKS assay mixtures. All lanes
show products from 100-µl assays run for 2 h. All samples shown
contain 0.8 µM act KS/CLF, 20 µM
fren holoACP, and the following additions of MAT: lane
1, wild-type MAT; lane 2, 1 µM MAT S97A;
lane 3, no MAT. In lane 3 one observes trace
quantities of polyketide production; however, the kinetics of this
MAT-independent process are difficult to accurately measure, and are
estimated to be less than 5% of the MAT-dependent process
(see text).
|
|
 |
DISCUSSION |
Since the genetic characterization of bacterial aromatic
polyketide synthases (13, 20-27), their mechanisms and relationships with Type II fatty acid synthases have been of considerable interest. Initial efforts toward these goals relied on metabolic characterization of genetically manipulated PKSs. More recently, cell-free systems have
been developed to study polyketide synthesis in vitro (5, 6,
8). The actinorhodin (act) PKS from S. coelicolor
has been an excellent model system for both in vivo and
in vitro studies.
Here we have quantified the steady-state kinetic properties of this
minimal PKS. In particular, titrations of the individual components of
the minimal PKS have yielded interesting insights into the properties
of Type II PKSs. At saturating concentrations of ACP and MAT, the
dependence of initial reaction velocity on KS/CLF concentration is
apparently linear up to a KS/CLF concentration of 1.6 µM
(Fig. 2). The reaction rate could be expected to saturate at higher
KS/CLF concentrations; however, practical limitations prevented the
direct observation of this saturation. An apparent kcat of
0.31 min 1 was derived from these measurements, which is
in good agreement with an apparent kcat of 0.41 min 1, derived from MAT titrations (Fig. 3), as well as
with recently reported measurements in the range of 1 min 1 (12).
Similar titration analysis was also performed for the act
ACP (Fig. 5). At 100 nM MAT and 0.8 µM
KS/CLF, the reaction rate increased with increasing amounts of ACP up
to a concentration of 20 µM, and decreased thereafter.
The reason for this inhibition is unclear, and may perhaps reflect the
ability of the wild-type act ACP to dimerize at high
concentrations (12). However, because of the inhibition observed at
high ACP concentrations, all other measurements in this study involving
the act holoACP were made at a holoACP concentration of 20 µM. The fren ACP saturates the multicomponent
system at slightly lower concentrations than act ACP (Fig.
4). Inhibition is not observed at higher fren ACP concentrations.
The observation that ACP is needed in substantially more than
stoichiometric amounts compared with the KS/CLF for maximal activity is
consistent with earlier genetic studies where alterations in expression
levels of the ACP gene resulted in significant differences in
polyketide production in vivo (28). It suggests that the ACP
interacts only loosely with the PKS core comprised of the KS and CLF.
However, ACP titrations alone do not allow discrimination between two
alternative models for Type II PKS activity, a "static" model in
which one ACP molecule interacts with a given KS/CLF pair to chaperone
the synthesis of a complete octaketide chain, versus a
"dynamic" model in which KS/CLF and ACP proteins can interchange
during the overall catalytic cycle. More detailed kinetic studies
should be illuminating in this regard.
Three results described here shed new light on the debate over whether
the MAT is required for minimal PKS activity or not. First, although
the kcat reported here for the (MAT-containing) act PKS is similar to the kcat
measured for the self-malonation reaction of the act ACP
(0.34 min 1) (11), the Km values for
malonyl-CoA in the two reactions are different. Whereas the overall
Km for the (MAT-containing) act PKS is 79 µM, the Km for the self-malonation
reaction is 216 µM. Since intracellular malonyl-CoA
concentrations are relatively low, this difference supports the notion
that the MAT-dependent pathway dominates over the
MAT-independent one in vivo. Second, a crucial titration
reported here is that of the MAT component into the PKS reaction
mixture (Fig. 3). In this context it is important to note that we do
not detect any PKS activity in the absence of the MAT at a KS/CLF
concentration of 0.8 µM and an act or
fren holoACP concentration of 20 µM (Fig. 3).
(Under these conditions, our assays can reliably detect PKS activity
that is as little as about 5% of the maximum reaction velocity.) This is consistent with our earlier observations (5), as well as those of
Hutchinson and co-workers (6) made with the tetracenomycin PKS, but
contradicts the observations of Simpson and co-workers (12). More
importantly, unlike KS/CLF and ACP, MAT is required in very small
amounts for maximal PKS activity. Vmax/2 is
reached at a MAT concentration of 19.7 nM and suggests a
very fast or tight interaction with the other PKS components. The role
of the MAT is to acylate the ACP with malonyl units derived from
malonyl-CoA. Low MAT concentrations required to saturate the minimal
PKS most probably result from highly efficient acylation of the ACP by the MAT, followed by a slower condensation reaction between the KS- and
ACP-bound substrates. Work on fatty acid synthesis where turnover rates
as high as 1.6 × 103 s 1, were measured
for the MAT, support this view (19). Finally, our studies on the S97A
mutant of the S. coelicolor MAT demonstrate that, even when
the catalytic potency of the MAT is drastically attenuated by removal
of the active site nucleophile, MAT can support PKS activity, perhaps
through the recruitment of an alternative covalent attachment site for
malonyl extender units. Based on these results, we propose that MAT is
an important component of the minimal PKS in vivo. A
definitive test of this matter would involve the construction and
analysis of a knock-out of the MAT gene in S. coelicolor;
however, since MAT is also required for fatty acid biosynthesis in the
cell, this is a challenging task.
Perhaps most interestingly, titration of holoACP in the presence of an
apoACP revealed that apoACP has a substantial inhibitory effect on SEK4
and SEK4b production (Figs. 4 and 5). In vivo studies in
E. coli have recently shown that overexpression of apoACP
inhibits growth, although no direct molecular explanation can be
derived from these studies (29). Moreover, it is known that E. coli maintains its apoACP concentration at a very low level,
perhaps because of its inhibitory effect (30). Since apoACP lacks a pantetheine arm and is catalytically inactive, our results provide direct evidence for functionally relevant interactions between the
peptidic portion of a Type II ACP and the remainder of the PKS. A
mainly competitive type of inhibition was deduced because apoACP
clearly affects saturation and Vmax only to a
lesser extent. Importantly, inhibition is observed with both
act and fren holoACP, ruling out a
fren-specific phenomenon. It is unclear whether this inhibition reflects interactions between the apoACP protein and MAT or
KS/CLF or both. Since the solution structures of several Type II ACPs
have been solved (31-38), further studies into the structural basis
for these molecular recognition properties could provide fundamentally
new insights into the importance of protein-protein interactions in
regulating Type II PKS function and specificity.
 |
FOOTNOTES |
*
This work was supported by National Institutes of Health
Grant CA-77248 (to C. K.), a National Science Foundation Young
Investigator Award (to C. K.), a David and Lucile Packard
Fellowship for Science and Engineering (to C. K.), a postdoctoral
fellowship from the Swiss National Science Foundation (to J. D.),
a grant from the Ciba-Geigy-Jubiläums-Stiftung (to J. D.),
and a Roche Research Foundation fellowship for biomedical research (to
J. D.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of Chemical
Engineering MC5025, Stanford University, Stanford, CA 94305-5025. Tel./Fax: 650-723-6538; E-mail: ck@chemeng.stanford.edu.
 |
ABBREVIATIONS |
The abbreviations used are:
PKS, polyketide
synthase;
CoA, coenzyme A;
KS, ketosynthase;
CLF, chain length factor;
ACP, acyl carrier protein;
MAT, malonyl CoA:ACP transacylase;
act, actinorhodin;
fren, frenolicin;
Vi, initial velocity;
PAGE, polyacrylamide gel
electrophoresis.
 |
REFERENCES |
| 1.
|
Carreras, C. W.,
Pieper, R.,
and Khosla, C.
(1997)
Top. Curr. Chem.
188,
85-126[CrossRef]
|
| 2.
|
Hutchinson, R. C.,
and Fuji, I.
(1995)
Annu. Rev. Microbiol.
49,
201-238[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Katz, L.,
and Donadio, S.
(1993)
Annu. Rev. Microbiol.
47,
875-912[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Khosla, C.,
and Zawada, R. J. X.
(1996)
Trends Biotechnol.
14,
335-340[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Carreras, C. W.,
and Khosla, C.
(1998)
Biochemistry
37,
2084-2088[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
|
Bao, W.,
Wendt-Pienkowski, E.,
and Hutchinson, C. R.
(1998)
Biochemistry
37,
8132-8138[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Jacobsen, J. R.,
Hutchinson, C. R.,
Cane, D. E.,
and Khosla, C.
(1997)
Science
277,
367-369[Abstract/Free Full Text]
|
| 8.
|
Carreras, C. W.,
Pieper, R.,
and Khosla, C.
(1996)
J. Am. Chem. Soc.
118,
5158-5159[CrossRef]
|
| 9.
|
Revill, P. R.,
Bibb, M. J.,
and Hopwood, D. A.
(1995)
J. Bacteriol.
177,
3946-3952[Abstract/Free Full Text]
|
| 10.
|
Summers, R. G.,
Ali, A.,
Shen, B.,
Wessel, W. A.,
and Hutchinson, C. R.
(1995)
Biochemistry
34,
9389-9404[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Hitchman, T. S.,
Crosby, J.,
Byrom, K. J.,
Cox, R. J.,
and Simpson, T. J.
(1998)
Chem. Biol.
5,
35-47
[CrossRef][Medline]
[Order article via Infotrieve] |
| 12.
|
Matharu, A.-L.,
Cox, R.,
Crosby, J.,
Byrom, K. J.,
and Simpson, T. J.
(1998)
Chem. Biol. (Lond.)
5,
699-711
[CrossRef][Medline]
[Order article via Infotrieve] |
| 13.
|
McDaniel, R.,
Ebert-Khosla, S.,
Hopwood, D. A.,
and Khosla, C.
(1993)
Science
262,
1546-1550[Abstract/Free Full Text]
|
| 14.
|
Carreras, C. W.,
Gehring, A. M.,
Walsh, C. T.,
and Khosla, C.
(1997)
Biochemistry
36,
11757-11761[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Gehring, A. M.,
Lambalot, R. H.,
Vogel, K. W.,
Drueckhammer, D. G.,
and Walsh, C. T.
(1996)
Chem. Biol. (Lond.)
4,
17-24
[CrossRef][Medline]
[Order article via Infotrieve] |
| 16.
|
Nakano, M. M.,
Corbell, N.,
Besson, J.,
and Zuber, P.
(1992)
Mol. Gen. Genet.
232,
313-321[Medline]
[Order article via Infotrieve]
|
| 17.
|
Lambalot, R. H.,
Gehring, A. M.,
Flugel, R. S.,
Zuber, P.,
LaCelle, M.,
Mahariel, M. A.,
Reid, R.,
Khosla, C.,
and Walsh, C. T.
(1996)
Chem. Biol. (Lond.)
3,
923-936
[CrossRef][Medline]
[Order article via Infotrieve] |
| 18.
|
Lowry, O. H.,
Rosebrough, N. J.,
Farr, A. L.,
and Randall, R. J.
(1951)
J. Biol. Chem.
193,
265-275[Free Full Text]
|
| 19.
|
Joshi, V. C.,
and Wakil, S. J.
(1971)
Arch. Biochem. Biophys.
143,
493-505[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Fernandez-Moreno, M. A.,
Martinez, E.,
Boto, L.,
Hopwood, D. A.,
and Malpartida, F.
(1992)
J. Biol. Chem.
267,
19278-19290[Abstract/Free Full Text]
|
| 21.
|
Gramajo, H. C.,
White, J.,
Hutchinson, C. R.,
and Bibb, M. J.
(1991)
J. Bacteriol.
173,
6475-6483[Abstract/Free Full Text]
|
| 22.
|
Sherman, D. H.,
Malpartida, F.,
Bibb, M. J.,
Kieser, H. M.,
Bibb, M. J.,
and Hopwood, D. A.
(1989)
EMBO J.
8,
2717-2725[Medline]
[Order article via Infotrieve]
|
| 23.
|
Bibb, M. J.,
Sherman, D. H.,
Satoshi, O.,
and Hopwood, D. A.
(1994)
Gene (Amst.)
142,
31-39[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Malpartida, F.,
and Hopwood, D. A.
(1986)
Mol. Gen. Genet.
205,
66-73[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Hopwood, D. A.,
Malpartida, F.,
Kieser, H. M.,
Ikeda, H.,
Duncan, J.,
Fuji, I.,
Rudd, B. A.,
Floss, H. G.,
and Omura, S.
(1985)
Nature
314,
642-644[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
McDaniel, R.,
Ebert-Khosla, S.,
Fu, H.,
Hopwood, D. A.,
and Khosla, C.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
11542-11546[Abstract/Free Full Text]
|
| 27.
|
McDaniel, R.,
Ebert-Khosla, S.,
Hopwood, D. A.,
and Khosla, C.
(1995)
Nature
375,
549-554[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Khosla, C.,
McDaniel, R.,
Ebert-Khosla, S.,
Torres, R.,
Sherman, D. H.,
Bibb, M. J.,
and Hopwood, D. A.
(1993)
J. Bacteriol.
175,
2197-2204[Abstract/Free Full Text]
|
| 29.
|
Keating, D. H.,
Zhang, Y.,
and Cronan, J. E., Jr.
(1996)
J. Bacteriol.
178,
2662-2667[Abstract/Free Full Text]
|
| 30.
|
Jackowski, S.,
and Rock, C. O.
(1983)
J. Biol. Chem.
258,
15186-15191[Abstract/Free Full Text]
|
| 31.
|
Holak, T. A.,
Kearsley, S. K.,
Kim, Y.,
and Prestegard, J. H.
(1988)
Biochemistry
27,
6135-6142[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Holak, T. A.,
Nilges, M.,
Gronenborn, A. M.,
Clore, G. M.,
and Prestegard, J. H.
(1988)
Eur. J. Biochem.
175,
9-15[Medline]
[Order article via Infotrieve]
|
| 33.
|
Ghose, R.,
Geiger, O.,
and Prestegard, J. H.
(1996)
FEBS Lett.
388,
66-72[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Kim, Y.,
and Prestegard, J. H.
(1990)
Proteins
8,
377-385[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Crump, M. P.,
Crosby, J.,
Dempsey, C. E.,
Murray, M.,
Hopwood, D. A.,
and Simpson, T. J.
(1996)
FEBS Lett.
391,
302-306[CrossRef][Medline]
[Order article via Infotrieve]
|
| 36.
|
Crump, M. P.,
Crosby, J.,
Dempsey, C. E.,
Parkinson, J. A.,
Murray, M.,
Hopwood, D. A.,
and Simpson, T. J.
(1997)
Biochemistry
36,
6000-6008[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Andrec, M.,
Hill, R. B.,
and Prestegard, J. H.
(1995)
Protein Sci.
4,
983-993[Medline]
[Order article via Infotrieve]
|
| 38.
|
Oswood, M. C.,
Kim, Y.,
Ohlrogge, J. B.,
and Prestegard, J. H.
(1997)
Proteins
27,
131-143[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
G. Schmoock, F. Pfennig, J. Jewiarz, W. Schlumbohm, W. Laubinger, F. Schauwecker, and U. Keller
Functional Cross-talk between Fatty Acid Synthesis and Nonribosomal Peptide Synthesis in Quinoxaline Antibiotic-producing Streptomycetes
J. Biol. Chem.,
February 11, 2005;
280(6):
4339 - 4349.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Marti, Z. Hu, N. L. Pohl, A. N. Shah, and C. Khosla
Cloning, Nucleotide Sequence, and Heterologous Expression of the Biosynthetic Gene Cluster for R1128, a Non-steroidal Estrogen Receptor Antagonist. INSIGHTS INTO AN UNUSUAL PRIMING MECHANISM
J. Biol. Chem.,
October 20, 2000;
275(43):
33443 - 33448.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Kremer, K. M. Nampoothiri, S. Lesjean, L. G. Dover, S. Graham, J. Betts, P. J. Brennan, D. E. Minnikin, C. Locht, and G. S. Besra
Biochemical Characterization of Acyl Carrier Protein (AcpM) and Malonyl-CoA:AcpM Transacylase (mtFabD), Two Major Components of Mycobacterium tuberculosis Fatty Acid Synthase II
J. Biol. Chem.,
July 20, 2001;
276(30):
27967 - 27974.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|