Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, X.
Right arrow Articles by Ambudkar, I. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, X.
Right arrow Articles by Ambudkar, I. S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 35, 25121-25129, August 27, 1999


ATP-dependent Activation of KCa and ROMK-type KATP Channels in Human Submandibular Gland Ductal Cells*

Xibao Liu, Brij B. Singh, and Indu S. AmbudkarDagger

From the Secretory Physiology Section, Gene Therapy and Therapeutics Branch, NIDCR, National Institutes of Health, Bethesda, Maryland 20892

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

[Ca2+]i and membrane current were measured in human submandibular gland ductal (HSG) cells to determine the regulation of salivary cell function by ATP. 1-10 µM ATP activated internal Ca2+ release, outward Ca2+-dependent K+ channel (KCa), and inward store-operated Ca2+ current (ISOC). The subsequent addition of 100 µM ATP activated an inwardly rectifying K+ current, without increasing [Ca2+]i. The K+ current was also stimulated by ATP in cells treated with thapsigargin in a Ca2+-free medium and was blocked by glibenclamide and tolbutamide, but not by charybdotoxin. This suggests the involvement of a Ca2+-independent, sulfonylurea-sensitive K+ channel (KATP). UTP mimicked the low [ATP] effects, while benzoyl-ATP activated internal Ca2+ release, a Ca2+ influx pathway, and KCa. Thus, ATP acts via P2U (P2Y2) and P2Z (P2X7) receptors to increase [Ca2+]i and activate KCa, but not KATP. Importantly, (i) ROMK1 and the cystic fibrosis transmembrane regulator protein (but not SUR1, SUR2A, or SUR2B) and (ii) cAMP-stimulated Cl- and K+ currents were detected in HSG cells. These data demonstrate for the first time that a ROMK-type KATP channel is present in salivary gland duct cells that is regulated by extracellular ATP and possibly by the cystic fibrosis transmembrane regulator. This reveals a potentially novel mechanism for K+ secretion in these cells.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Receptors for ATP are widely expressed in mammalian tissues and are reportedly involved in regulating a variety of cellular functions (1). Pharmacological studies with various ATP analogues have demonstrated two major groups of purinergic (P2) receptors: ionotropic receptors (P2X), associated with ligand-gated nonselective cation channel activity, and metabotropic receptors (P2Y), associated with activation of G-proteins (2-5). In nonexcitable cells, extracellular ATP induces an elevation of cytosolic [Ca2+] ([Ca2+]i) by two distinct mechanisms, either by activation of Ca2+ release from intracellular Ca2+ stores or via activation of Ca2+ influx from the external medium (5, 6). The P2Y subtype is coupled via Galpha q/11 to the activation of phosphatidylinositol 4,5-bisphosphate-specific phospholipase C. Thus, activation of these receptors by ATP leads to an increase in [Ca2+]i due to increase in inositol 1,4,5-trisphosphate (IP3)1 and IP3-mediated internal Ca2+ release. Activation of the P2X subtype has been shown to be coupled to the activation of a nonspecific cation channel(s), resulting in increased permeability of the plasma membrane to Na+, K+, and Ca2+.

P2 receptors have been found in many epithelial cells, including those from various salivary glands. Four P2 receptors have been identified in salivary gland cells: P2Y1, P2Y2 (P2U), P2X4, and P2X7 (P2Z) (6). In rat parotid acinar cells, it has been reported that ATP primarily activates a Ca2+ and Na+-permeable cation channel via stimulation of P2Z receptors. While transcripts for P2Y receptors have been detected in rat parotid acinar cells, ATP does not appear to strongly induce IP3 generation or internal Ca2+ release (6-9). However, in rat submandibular ductal cells, evidence for both P2U and P2Z receptors have been presented (6, 10-13). Interestingly, these P2-purinergic receptors have distinct cellular localizations in these cells; P2Z receptors were found in the luminal membrane, while P2U receptors were detected in basolateral membrane (10-13). Presently, the exact mechanisms and ion channels involved in P2 receptor-mediated regulation of salivary gland function are poorly understood (6). The human submandibular ductal cell line (HSG) has been widely used to study the mechanism(s) of Ca2+ signaling in salivary gland cells (6, 14-18). Previous studies with HSG cells have demonstrated that activation of the muscarinic receptor leads to the generation of IP3, which causes intracellular Ca2+ release and activation of store-operated Ca2+ influx (15-18). HSG cells have also been reported to have P2 receptors (6, 14). ATP, via the P2U receptor, was shown to increase [Ca2+]i and Ca2+-activated 86Rb+ efflux (14). It was also reported that in HSG cells ATP-stimulated IP3 formation is coupled to the P2U activation, while ATP-stimulated 45Ca2+ influx is mediated via activation of P2X receptors (19). However, the types of ion channels involved in these ATP-induced ion fluxes have not yet been identified.

This study examines the mechanisms involved in the regulation of salivary gland cell function by ATP, by measuring [Ca2+]i and the membrane conductance of HSG cells. The data show that ATP acts via multiple P2 purinergic receptors, including P2U (P2Y2) and P2Z (P2X7), to activate the Ca2+-activated K+ channel (KCa), the store-operated Ca2+ influx channel, and probably a Ca2+-permeable cation channel. Importantly, we report here that ATP also activates an inwardly rectifying, Ca2+-independent K+ current. The inhibition of this current by sulfonylurea compounds and the presence of ROMK1 and cystic fibrosis transmembrane regulator (CFTR) proteins in HSG cells, suggests for the first time that a ROMK type of epithelial KATP channel is present in salivary gland epithelial cells. As has been suggested for kidney epithelial cells (20, 21), the putative ROMK channel in HSG cells might also be regulated by a CFTR-dependent mechanism. These data reveal a potentially novel mechanism for the regulation of K+ secretion in salivary epithelial cells.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cell Culture-- HSG cells were a kind gift from Dr. Mitsunabo Sato (Tokushima University, Japan). The conditions for cell culture were similar to those described previously (16, 17). Briefly, cells were grown in Eagle's minimum essential medium supplemented with 10% fetal calf serum, 2 mM L-glutamine, 100 units/ml penicillin, and 100 µg/ml streptomycin (all from Biofluids, Rockville, MD) under 5% CO2 at 37 °C. Cells were passaged when confluent by detaching from the tissue culture dish with 0.25% trypsin, 1.0 mM EDTA (Biofluids). A single-cell suspension was reseeded onto coverslips and used after about 24 h.

Patch Clamp Measurements-- Patch clamp in a whole cell configuration was performed on single HSG cells attached to coverslips using the standard patch-clamp technique described previously (16, 17). The resistance of the pipette was about 3-6 megaohms. The chamber was connected with an Ag-AgCl pellet through a 150 mM NaCl-containing agar bridge. Membrane currents were measured with an Axopatch 200A amplifier in conjunction with pClamp 6.1 software and a Digidata 1200 A/D converter (Axon Instruments, Foster City, CA). The currents were filtered at 2 kHz (low pass bessel filter) and sampled with an interval of 10 ms. In the step protocol, the cell was held at 0 mV for 312 ms and stepped from -120 to -80 mV in 20-mV steps for 200 ms each step. The leakage subtraction function was used to minimize the leak currents. The currents were digitized and recorded directly onto the hard drive of a Dell Pentium computer. The I-V relationship was calculated using the peak amplitude of the current during the step protocol and exported to Origin 5 (Microcal Software, Inc., Northampton, MA) for further analysis.

A piece of coverslip (0.5 × 0.5 mm) with cells was placed in the perfusion chamber (Warner Instrument Corporation, Hamden, Connecticut). For measuring KCa, the standard extracellular solution contained 145 mM NaCl, 5 mM KCl, 1 mM MgCl2, 1 mM CaCl2, 10 mM glucose, 0.2 mM EGTA, and 10 mM HEPES, pH 7.4. The pipette was filled with 150 mM KCl, 2 mM MgCl2, 1 mM ATP, 10 mM HEPES, pH 7.2. For measuring Isoc, the extracellular solution contained 135 mM sodium glutamate, 1 mM MgCl2, 10 mM CaCl2, 10 mM glucose, and 10 mM HEPES, pH 7.4 (NaOH). The pipette was filled with 135 mM NMDG-glutamate, 10 mM CsCl, 10 mM 1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid, 1 mM MgCl2, 1 mM ATP, 10 mM HEPES, pH 7.2 (CsOH). Any changes in the composition of the pipette and external solutions are given under "Results." ATP, ATP analogs, thapsigargin (Tg), or CCh was included in the perfusion medium.

[Ca2+]i Measurements-- Fluorescence was measured in fura2-loaded single HSG cells at excitation wavelengths of 340 and 380 nm, with emission at 510 nm, using a SLM 8000/DMX 100 spectrofluorimeter attached to an inverted Nikon Diaphot inverted microscope with a Fluor 40× oil immersion objective. Images were acquired using an enhanced CCD camera (CCD-72, MTI) and the Image-1 software (Universal Imaging Corporation, PA). The 340/380-nm ratio of fura2 fluorescence has been used to represent [Ca2+]i. Other details of the experiments are given in the text and figure legends. All experiments were performed at room temperature.

Western Blotting-- Preparation of crude and plasma membrane fractions, SDS-PAGE, and Western blotting were performed as described previously (22). Reactivity of the samples against either a polyclonal anti-human CFTR antibody, 1:150 dilution (a generous gift from Dr. W. Guggino, Johns Hopkins University, Baltimore, MD) or polyclonal anti-ROMK antibody, 1:200 dilution (Alomone Laboratories, Jerusalem, Israel) was determined using a secondary antibody 1:5000 dilution and ECL reagent (Amersham Life Sciences). Plasma membrane fraction from HEK-293 cells overexpressing the CFTR protein was kindly provided by Dr. Nelson Arispe (Department of Cell Biology, Uniformed Services University of Health Sciences, Bethesda, MD). Control ROMK1 protein was supplied by Alomone Laboratories. Amido Black B was used to stain the proteins after transfer to the polyvinylidene difluoride membrane.

RNA Isolation, cDNA Synthesis, and RT-PCR-- mRNA was isolated from HSG cells using TRIzol reagent (Life Technologies, Inc.) and the Oligotex mRNA kit (Qiagen). The RNA was treated with DNase I (amplification grade, Life Technologies, Inc.) at a concentration of 1 unit/µg of RNA. Human pancreatic mRNA was purchased from CLONTECH. First strand cDNA synthesis of ROMK, SUR1, SUR2A, and SUR2B was carried out using 0.5 µg of mRNA using antisense-specific primers as follows: ROMK (5'-GGAGCTTTAGAGACTTTGCTTTAC), SUR1 (5'-CTCAAGGATGGCACCCCGCTTCAGG), SUR2A (5'-CTGAGGGTATTTTAGTGGAGTGTG), and SUR2B (5'- CACACTATTCTGACGGCAGACCTGG). The sense primers used for RT-PCR were as follows: ROMK (5'-CAGGGTGTTGACAGAAAGTATGTTC), SUR1 (5'-GCCCTGGCCGTCATCTCCTATGTC), and SUR2A and -2B (5'-CCAACCTTGGAATCTCTAACTCGC). RT-PCR was performed using SuperScript reverse transcriptase II (Life Technologies, Inc.). The PCR mixture contained 20 mM Tris-HCl (pH 8.5), 50 mM KCl, 1.5 mM MgCl2, a 0.2 mM concentration of each dNTP, 20 pmol of each primer, first strand cDNA, and 2.5 units of Taq DNA polymerase. PCR was performed as follows for 35 cycles: 94 °C denaturation for 30 s, 55 °C annealing for 45 s, and 68 °C extension for 2 min. 10% of the sulfonylurea receptor (SUR) products and 5% of the ROMK product were loaded on a 1% agarose gel.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

ATP-induced Increase in [Ca2+]i and Membrane Conductance in HSG Cells-- ATP, at concentrations ranging from 0.1 to 100 µM, was added sequentially to the cell as shown in Fig. 1. An outward current was detected in 95% (43/48) of the HSG cells tested at a holding potential of 0 mV in a whole cell patch clamp mode. Typically, the cells showed a response, i.e. an increase in the outward current, at 1 µM ATP with a few cells responding at 0.1 or 10 µM. A second response was seen at 100 µM ATP. However, a subsequent addition of 1 mM or higher ATP failed to induce any further increase in the membrane current. The current was blocked by replacing intracellular K+ with Cs+ (data not shown), strongly indicating that it was due to an increase in K+ ion conductance. Further, this pattern of response was similar in the presence or absence of external Ca2+ (Fig. 1, compare A and B). However, in the presence of external Ca2+, the outward current seen at 1 µM ATP was more sustained, presumably due to the involvement of a Ca2+ influx component in this response. Most cells showed a quick run down of the membrane conductance with a duration of about 2-3 min at any given ATP concentration. This is consistent with a previous report showing that ATP induced transient 45Ca2+ influx and IP3 production (19) in HSG cells.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 1.   ATP-stimulated outward current and [Ca2+]i increase in HSG cells. Currents were recorded in HSG cells by using a patch clamp, in a whole cell configuration, at 0 mV holding potential in the presence (A) or absence (B) of external Ca2+. External medium, with increasing [ATP], was perfused into the chamber for the periods indicated by the corresponding bar. The traces shown are representative of data obtained in 14 cells. [Ca2+]i was monitored in single HSG cells maintained Ca2+-free or Ca2+-containing (C) or Mg2+-free (D) medium. Various [ATP] was added to the medium as shown by the corresponding arrows. These traces are the representative results from at least 40 cells in each experiment.

Measurement of [Ca2+]i (expressed as the 340/380-nm fluorescence ratio) demonstrated that an increase in [Ca2+]i was induced upon the addition of ATP in 94% of HSG cells (254 of 270). Most cells (84%, 212 of 254) showed a response at 1 µM ATP, with a few cells responding at 0.1 (9%, 24 of 254) or 10 µM ATP (7%, 18 of 254). Importantly, while a response to lower [ATP] was detected, a higher [ATP] added subsequently to the same cell failed to evoke a second response. A typical dose response in the presence or absence of external Ca2+ is shown in Fig. 1C. In the absence of external Ca2+, the initial peak increase in [Ca2+]i was not changed, although the response was more transient in nature. This suggests that both intracellular Ca2+ release and Ca2+ influx account for the ATP-induced increase in [Ca2+]i. Further, this pattern of [Ca2+]i increase was not changed when Na+ was removed from the external medium (n = 35, data not shown). However, when Mg2+ was removed from the medium as shown in Fig. 1D, a small increase in [Ca2+]i was induced with 100 µM ATP in a Ca2+-containing medium. These data suggest that, at 100 µM, ATP induces a Ca2+ influx component that is inhibited by external Mg2+. This is also consistent with studies in pancreatic duct cells (23) and other salivary gland cells (6), showing that removal of external Mg2+ increased the ATP-induced peak [Ca2+]i. However, since the K+ current measurements (shown in Fig. 1, A and B) were made in the presence of external Mg2+, the K+ current induced at 100 µM ATP is probably not associated with Ca2+ influx.

UTP, a potent agonist of several P2Y receptors, stimulates IP3 generation and release of Ca2+ from intracellular Ca2+ stores (1-4). Unlike with ATP, sequential additions of increasing [UTP] induced an increase in [Ca2+]i and outward current only at 1 µM (Fig. 2, A and B). This pattern was not changed in the absence of external Mg2+ or with 10 mM external Mg2+ (n = 43, data not shown). However, prior stimulation of cells with UTP attenuated the [Ca2+]i increase induced by a subsequent addition of ATP to the same cell, and vice versa (see Fig. 2, C and D). As seen with UTP, only low [2MeS-ATP] induced a response. However, the response was lower than that induced by ATP or UTP (data not shown).


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 2.   UTP-induced outward current and [Ca2+]i increase in HSG cells. [Ca2+]i (A, C, and D) and conductance (B) were monitored as described for Fig. 1. Various concentrations of UTP were added to the cell medium as shown by arrows (A). External medium with varying [UTP] was perfused into the chamber for the periods indicated by the corresponding bars (B). A and B are representative of results obtained in 50 (A) and 5 (B) cells, respectively. C, ATP (100 µM), followed by UTP (100 µM), was added to the cell medium as shown by the corresponding arrows. This trace is representative of data obtained with 54 cells. D, in another cell, the above order of addition was reversed. This is a typical response from 47 cells.

We have recently reported that depletion of intracellular Ca2+ stores in HSG cells by muscarinic receptor stimulation with CCh, introduction of IP3 into the cell, or treatment with the Ca2+ pump inhibitor Tg, activated ISOC, which was dependent on external [Ca2+] and inhibited by La3+ and Gd3+ (17). The data in Fig. 3 show that ATP (1 µM) also induced an inward Ca2+ current in HSG cells. This inward current was dependent on external [Ca2+] and was eliminated by changing the external [Ca2+] from 10 to 0 mM (Fig. 3A). ATP-induced ISOC had a larger amplitude (25 ± 7 pA), but a shorter duration (3-4 min), compared with that induced by IP3 or CCh (17) and was inhibited by La3+ (Fig. 3B). Notably, ATP (1 µM)-induced inward Ca2+ and outward K+ currents displayed similar characteristics i.e. dependence on external Ca2+ and inhibition by La3+ (Fig. 3, compare A and B with C and D). Further, stimulation of cells with ATP in a Ca2+-free medium inhibited the response to a subsequent addition of CCh (data not shown). This is the first report of ATP-induced Isoc in a salivary cell. Taken together, these data demonstrate that in HSG cells low [ATP] (<10 µM) stimulates P2U (P2Y2) receptors to cause the release of Ca2+ from internal Ca2+ stores, which results in the activation of KCa and ISOC.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 3.   Inhibition of ATP-activated ISOC and outward K+ current by La3+ in HSG cells. Store-operated inward current (Isoc, A and B) stimulated by 10 µM ATP (perfused during the entire experiment) was measured by whole cell configuration at 0 mV holding potential as described under "Experimental Procedures." A, [Ca2+] in the external medium was changed from 10 to 0 mM, shown by the corresponding bar. B, cells were exposed to external medium containing 10 mM Ca2+ and 1 mM La3+, shown by the corresponding bar. These are the representative traces from five (A) or four (B) cells, respectively. K+ currents (C and D) were measured as described for Fig. 1 in the presence of 10 µM ATP in the perfusion medium. C, [Ca2+] in the perfusion medium was changed to 0 Ca2+ for the period shown by the corresponding bar; D, 1 mM LaCl3 was included in the external solution where indicated.

ATP-induced Ca2+-independent K+ Current-- Fig. 1 shows that high [ATP] activates a K+ current in HSG cells that is not accompanied by any changes [Ca2+]i. To determine the nature of this K+ current, we examined the effect of depletion of the intracellular Ca2+ store with Tg. [Ca2+]i was monitored in the absence of external Ca2+, and data are shown in Fig. 4A. Tg induced an increase in [Ca2+]i due to Ca2+ "leakage" from the internal stores. The subsequent addition of ATP (10-100 µM) to the cells failed to induce any further increase in [Ca2+]i (Fig. 4A). This suggests that the [Ca2+]i increase induced by ATP is due to Ca2+ release from Tg-sensitive stores. Similarly Tg-induced increases in [Ca2+]i or the KCa current were diminished or greatly reduced after the cell was first exposed to ATP (n = 56 or n = 4 for [Ca2+]i and the KCa currents, respectively; data not shown). In contrast to [Ca2+]i increases shown in Fig. 4A, 100 µM ATP induced an increase in the outward current in Tg-treated cells (Fig. 4B). When external Ca2+ was reintroduced, a further increase in the outward current was seen, probably due to the activation of KCa as a result of Ca2+ entry. These results clearly indicate that two kinds of outward K+ currents are stimulated by ATP in HSG cells. One is associated with [Ca2+]i increase, and the other appears to be independent of [Ca2+]i increase. Consistent with the [Ca2+]i measurements shown in Fig. 4A, Tg induced a transient activation of the K+ current. In aggregate, the data presented above indicate that in HSG cells ATP (100 µM) activates a K+ current that is not (i) due to activation of KCa or (ii) accompanied by increases in [Ca2+]i.


View larger version (9K):
[in this window]
[in a new window]
 
Fig. 4.   Effects of internal Ca2+ store depletion on ATP-induced increases in [Ca2+]i and outward currents in HSG cells. A, [Ca2+]i was measured during sequential application of Tg (1 µM) and ATP (10 and 100 µM) as shown by the corresponding arrows. B, the outward KCa current was monitored during a similar application of Tg and ATP. The external Ca2+ was removed and added back to the bath as shown by the corresponding bars. These are the representative results from 55 (A) or five (B) different cells.

To further characterize the apparent Ca2+-independent K+ current, the effect of charybdotoxin (ChTx) was examined. We reported earlier that ChTx, a large conductance Ca2+-dependent K+ channel antagonist, inhibits the carbachol-stimulated KCa current in HSG cells (16). As seen in Fig. 5A, 25 nM ChTx also effectively blocked the K+ current induced by 1 and 10 µM ATP but not that induced by 100 µM ATP (Fig. 5A). The I-V curve of the outward current induced by 100 µM ATP in ChTx-treated cells shows a weak inward rectification with a reversal potential of -75 mV, which is close to the K+ reversal potential (Fig. 5B). Furthermore, replacing intracellular K+ ion with Cs+ eliminated ATP-induced outward currents at all concentrations tested (from 1 µM to 1 mM, n = 5, data not shown). These data suggest that high [ATP] activates an inwardly rectifying, Ca2+-independent, K+ current in HSG cells.


View larger version (8K):
[in this window]
[in a new window]
 
Fig. 5.   Effect of charybdotoxin on the ATP-stimulated Ca2+-independent outward current. A, 25 nM ChTx was introduced to the bath when the cell was stimulated by ATP (1 µM to 1 mM), as shown by the corresponding bar. This is representative of results obtained in five cells. B, I-V curve of the outward current induced by ATP in the presence of 25 nM ChTx (n = 5). The current induced by 100 µM ATP was measured by a step protocol in whole cell configuration. The cell was held at 0 mV, and the membrane potential was stepped from -140 to 80 mV in 20-mV steps with a duration of 500 ms.

Bz-ATP-induced Ca2+ Influx and K+ Currents-- In addition to the P2U receptor, a P2Z subtype of P2 receptor (P2X7) has also been found in the salivary gland cells (6). To determine whether the Ca2+-independent ChTx-insensitive K+ channel was stimulated by the activation of a P2Z receptor, we examined the effects of Bz-ATP, a potent agonist of the P2Z receptor, on [Ca2+]i and whole cell current. The data are shown in Fig. 6. Fig. 6, A and B, shows whole cell currents following the sequential additions of 1, 10, 100, and 1000 µM Bz-ATP to HSG cells in Ca2+-containing and Ca2+-free medium, respectively. In the presence of external Ca2+ (Fig. 6A), Bz-ATP activated a K+ current at all concentrations tested, with the largest response, a somewhat sustained increase, obtained at 100 µM. No significant response was seen at 1 mM Bz-ATP. When cells were stimulated in the absence of external Ca2+ (Fig. 6B), the response at 1 µM Bz-ATP was relatively more transient, while that at 10 µM was greatly attenuated, and that at 100 µM was barely detectable. Thus, Bz-ATP, at higher concentrations, appeared to stimulate K+ currents only in the presence of external Ca2+. Similar effects of Bz-ATP were seen on [Ca2+]i (Fig. 6, C and D). P2Z-associated cation channels in salivary gland cells are reportedly permeable to external Na+ and inhibited by external Mg2+ (6). However, the Bz-ATP-induced [Ca2+]i increase did not appear to be affected by replacing Na+ in the external medium with NMDG (Fig. 7A). Further, as shown in Fig. 7B, external Mg2+ attenuated the [Ca2+]i increases induced at all concentrations of Bz-ATP but especially that at 100 µM. In the presence of 3 mM external [Mg2+], attenuated [Ca2+]i increases were observed in 35% of cells tested (23 of 65), while [Ca2+]i increase was not detected in 65% of the cells. Furthermore, 10 mM Mg2+ totally eliminated Bz-ATP (1 µM to 1 mM) induced responses (data not shown, n = 35). In aggregate, these data demonstrate the presence of a P2Z (P2X7) receptor in HSG cells, which can be activated by Bz-ATP to stimulate Ca2+ influx, via an as yet unidentified ion channel. Low Bz-ATP also stimulates internal Ca2+ release, probably via IP3 generation or by an as yet unidentified mechanism (6, 19). The resulting increase in [Ca2+]i activates KCa. However, the data are not consistent with the involvement of the P2Z receptor in the activation of the ChTx-insensitive, Ca2+-independent, inwardly rectifying K+ channel by high [ATP].


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 6.   Bz-ATP-stimulated outward current and [Ca2+]i increase in HSG cells. KCa current was measured as described for Fig. 1. External medium with (A) or without (B) Ca2+, containing various [Bz-ATP] was perfused for the periods indicated by the bars. The traces shown are representative of data obtained with six cells. C and D, [Ca2+]i was monitored as shown in Fig. 1, and Bz-ATP was added to the cell medium, with (C) or without Ca2+ (D), as indicated by the corresponding arrows. These are the representative traces from 52 (C) and 65 (D) cells.


View larger version (10K):
[in this window]
[in a new window]
 
Fig. 7.   Effect of external Na+ and Mg2+ on Bz-ATP-induced increases in [Ca2+]i. [Ca2+]i was measured in HSG cells as described for Fig. 1, in a Na+-free medium (A) or in medium containing 3 mM Mg2+ (B). Increasing [Bz-ATP] were added to the medium as shown by the corresponding arrows. These are the representative traces from 64 (A) or 52 (B) cells.

Effects of Sulfonylurea Compounds on the ATP-induced Ca2+-independent K+ Current-- To further characterize the ChTx-insensitive K+ current activated by higher [ATP], we examined the effects of the sulfonylurea compounds, which have been reported to block a family of inwardly rectifying K+ channels, Kir (20, 21, 25). Fig. 8 shows that glibenclamide (10 µM) and tolbutamide (1 mM) inhibited the outward current induced by 100 µM ATP. Importantly, the K+ current stimulated by 1 µM ATP was not significantly affected by these compounds. Further, when ATP was substituted by Bz-ATP, 2MeS-ATP, UTP, or ADP no currents were detected in charybdotoxin-treated HSG cells (data not shown).


View larger version (8K):
[in this window]
[in a new window]
 
Fig. 8.   Effect of sulfonylurea compounds on the ATP-activated, Ca2+-independent inwardly rectifying K+ current. Outward currents were measured under the conditions described for Fig. 1 in cells treated with glibenclamide (A) or tolbutamide (B), at the indicated concentrations. External medium with increasing [ATP] was perfused into the chamber for the periods indicated by the bars. These are the representative traces from five (A) or six (B) cells.

These data suggest that the ATP-activated ChTx-insensitive K+ current might belong to the KATP family of Kir channels. However, since the pipette solution in these experiments contained 1 mM ATP, the KATP channel in HSG cells appears to have a lower sensitivity for inhibition by intracellular ATP. Consistent with this, increasing internal [ATP] to 5 or 10 mM (in the presence of 1 mM Mg2+) significantly reduced the K+ current (data not shown).

Presence of CFTR and ROMK1 Proteins in HSG Cells-- It has been suggested that the sulfonylurea sensitivity of KATP channels might be conferred via interaction with sulfonylurea-binding proteins such as SUR or CFTR protein (20, 21, 25). The association of the classical KATP channel (Kir 6.2) in pancreatic beta  cells with SUR has been well established. This K+ channel demonstrates high sensitivity for intracellular ATP and glibenclamide (25). In contrast, the ROMK family of weakly inwardly rectifying epithelial K+ channels have been reported to have a lower sensitivity for inhibition by intracellular ATP. These K+ channels also have a relatively lower sensitivity to glibenclamide (20, 21). The KATP channels in kidney epithelial cells (Kir 1.1a and 1.1b, ROMK1 and ROMK2, respectively) have been suggested to be regulated via interaction with the CFTR protein, although presently there are no data that conclusively demonstrate this molecular interaction. The presence of the CFTR protein was previously demonstrated, both functionally and by immunofluorescence, in the luminal membrane of salivary gland ductal cells (26-28). Thus, we examined the presence of CFTR in HSG cells, a human submandibular gland ductal cell line, by Western blotting using an anti-human CFTR antibody. A strong reactivity was detected in the plasma membrane fraction of HSG cells (Fig. 9A, lane 2) associated with a protein of with an approximate molecular mass of 180 kDa, which co-migrated with the control CFTR protein (see lane 1, plasma membrane preparation of HEK cells infected with an adenovirus encoding the CFTR). Additionally, consistent with the reported intracellular localization of the CFTR protein (29, 30), more reactivity was detected in a crude membrane fraction (lane 3), which probably also includes intracellular organelles. These data suggest that HSG cells, similar to rat submandibular gland ductal cells and kidney cells, have the CFTR protein.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 9.   Presence of CFTR and ROMK proteins in HSG cells. Fig. 9A shows reactivity of proteins in HSG cell plasma (lane 2) and crude (lane 3) membrane fractions to a polyclonal anti-human CFTR antibody. Lane 1 shows reactivity in the plasma membrane fraction of HEK cells overexpressing the human CFTR protein. The CFTR protein is detected at approximately 180 kDa in all three samples. Fig. 9B shows reactivity in HSG cell crude (lane 1) and plasma (lane 2) membranes to an anti-ROMK antibody. Lane 3 shows the reactivity in a control sample containing the purified ROMK1 protein (obtained from Alomone Laboratories). Control ROMK protein can be detected at 42 kDa (lane 4 shows Amido Black staining of the same region of the blot shown in lane 3). Fig. 9C shows RT-PCR products amplified from HSG cell mRNA. Primers and RT-PCR conditions are described under "Experimental Procedures." PCR products were analyzed on 1% agarose gels as follows. Lane 1, ROMK (HSG cell); lane 2, SUR1 (HSG cell); lane 3, SUR1 (human pancreas); lane 4, SUR2A (HSG cell); lane 5, SUR2A (human pancreas); lane 6, SUR2B (HSG cell); lane 7, SUR2B (human pancreas).

Further, an antibody against the ROMK protein was used to examine the presence of this protein in HSG cells. The data are shown in Fig. 9B. Three prominent bands were detected in the plasma membrane fraction of HSG cells with estimated molecular masses of about 49, 47, and 42 kDa. We have not yet identified the higher molecular weight proteins that react with the antibody, which supposedly recognizes all isoforms of ROMK. However, the 42-kDa band comigrated with the control ROMK1 protein (lane 3, ECL reaction; lane 4, Amido Black staining of the region of the blot shown in lane 3). Importantly, this protein was enriched in the plasma membrane fraction (lane 2) compared with the crude membrane fraction (lane 1). These data demonstrate for the first time the presence of the ROMK1 protein in salivary gland cells.

To confirm the presence of ROMK in HSG cells, RT-PCR was performed using ROMK-specific primers and HSG cell mRNA (Fig. 9C; see "Experimental Procedures" for details). A ~1.2-kilobase RT-PCR product was strongly detected (lane 1). Further, when RT-PCR was performed using SUR1-, SUR2A-, or SUR2B-specific primers, SUR-homologous sequences were not detected in HSG cell mRNA (lanes 2, 4, and 6). However, as reported earlier (31), SUR1 (lane 3) and SUR2B (lane 7), but not SUR2A (lane 5), were detected in control human pancreatic mRNA.

One of the suggested criteria for the possible functional association between the CFTR and ROMK proteins in a cell has been the demonstration that cAMP can stimulate both Cl- and K+ currents in the cells. The data in Fig. 10 show that HSG cells fulfill this criterion. Inclusion of 10 µM cAMP in the pipette solution stimulated a small inward Cl- current (250 ± 34 pA, n = 5, at -60 mV holding potential with 150 mM NMDGCl in the external and internal solutions). The current developed slowly, remained stable for a short time, and decreased to a lower level. It was blocked by glibenclamide (data not shown). These data provide evidence for the presence of a functional CFTR protein in HSG cells. Fig. 10B shows the activation of outward K+ current by 10 µM cAMP. The outward current was of smaller magnitude, and relatively more sustained, than that seen with ATP. The current also showed a decreased sensitivity toward glibenclamide (data not shown), as has been previously reported for the ROMK channels in kidney cells (20).


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 10.   cAMP-stimulated Cl- and outward K+ currents in HSG cells. A, Cl- currents were recorded at a holding potential of -60 mV with 10 µM cAMP in the pipette solution. 145 mM NaCl and 5 mM KCl in the external medium and 150 mM KCl in the pipette solution were replaced with 150 mM NMDGCl. B, K+ currents were recorded as described for Fig. 1, except that the pipette solution contained 10 µM cAMP.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The data presented above demonstrate that ATP activates multiple P2 receptors to increase [Ca2+]i and activate distinct cation channels in HSG cells. Importantly, the data provide evidence that external ATP activates a novel glibenclamide-sensitive, Ca2+-independent, inwardly rectifying K+ current that is mediated by a KATP channel. Further, we have shown that a ROMK-like channel and CFTR, but not SUR, are present in HSG cells. Thus, we suggest that this KATP channel belongs to the ROMK subfamily of KATP channels, which might be regulated via an interaction with the CFTR. These data reveal a potentially new mechanism for K+ secretion in salivary epithelial cells.

P2Y1, P2Y2 (P2U), P2X4, and P2X7 (P2Z) receptors are expressed in salivary glands (6). We have shown here that low [ATP] and [UTP] are equally potent in activating internal Ca2+ release. Further, the response to low [ATP] was greater than the response to low [2MeS-ATP] (data not shown). These data suggest the presence of a P2U receptor in HSG cells and are consistent with previous studies showing that in HSG cells the P2U receptor has a nucleotide selectivity in the order ATP = UTP > ADP (14). Additionally, P2U-stimulated depletion of the internal Ca2+ store resulted in the activation of the store-operated Ca2+ influx current (ISOC) that was inhibited by La3+ and Gd3+, but not by Zn2+. Thus, ISOC activated by ATP has similar characteristics as that activated by CCh or Tg (Fig. 3-5; also see Ref. 17). Low (0.1-10 µM) ATP also activated an outward K+ current with characteristics similar to those previously reported for KCa in HSG cells (15, 16): (i) inhibition by charybdotoxin, but not by apamin, and (ii) dependence on [Ca2+]i. Notably, this is the first report describing ATP-dependent activation of KCa and ISOC in human submandibular gland cells. The present data demonstrate that P2Z receptors are also present in HSG cells. Bz-ATP, a potent P2Z receptor agonist, induced responses that were distinct from that induced by either UTP or ATP. Increasing concentrations of Bz-ATP produced dose-dependent increases in both [Ca2+]i and the K+ current. At lower concentrations, Bz-ATP induced increase in [Ca2+]i and KCa in the absence of external Ca2+. As has been suggested earlier, this could be due to (i) release of Ca2+ from intracellular stores by Na+ that might enter the cells when Ca2+ is removed from the external medium or (ii) stimulation of IP3 generation (6). However, the effects at higher Bz-ATP were acutely dependent on the presence of external Ca2+ and were more sensitive to high external Mg2+. These data suggest that higher [Bz-ATP] induces a Ca2+ influx component that is apparently not associated with internal Ca2+ store depletion (Fig. 5, compare A and B with C and D). 2MeS-ATP did not induce a similar Ca2+ influx response, even at higher concentrations, while 100 µM ATP induced a small increase in Ca2+ influx, in the absence of external Mg2+. In aggregate, these data are consistent with the presence of a P2Z receptor in HSG cells. However, it is unlikely that ATP induces any significant effects via this receptor in a normal Mg2+-containing medium.

The important, and novel, finding of this study was that high [ATP] (>10 µM) induced an outward current that was not accompanied by an increase in [Ca2+]i. We have shown that the current was detected in cells previously stimulated with low [ATP] (Fig. 1), Tg (Fig. 4), or CCh (not shown) and was not affected by the removal of Ca2+ from the external medium (Fig. 1) or treatment of cells with charybdotoxin. Furthermore, the current measured in the presence of high [ATP] and charybdotoxin (i) displayed a weak inward rectification with a reversal potential of -75 mV, a value close to the K+ equilibrium potential, and (ii) was blocked by replacing intracellular K+ with Cs+. Taken together, these data provide strong evidence for the activation of a Ca2+-independent K+ channel by high [ATP] in HSG cells. Some previous studies with salivary gland cells have suggested that ATP induces a Ca2+-independent component of K+ efflux (24, 32). It was suggested that this component of K+ release could be due to a direct action of ATP on nonspecific cation channels on the plasma membrane. We have not yet determined whether ATP activates the Ca2+-independent K+ channel directly or via binding to an ATP receptor. However, our data rule out the possibility that the known P2X or P2Y receptors are involved in the ATP-dependent activation of the Ca2+-independent, inwardly rectifying, K+ channel. The charybdotoxin-insensitive K+ current was not activated by 2MeS-ATP, Bz-ATP, UTP, or low [ATP]. Thus, the Ca2+-independent K+ current appears to be selectively activated by high [ATP] via a mechanism that is distinct from that associated with the P2Z or P2U receptors. Significantly, the sulfonylurea compounds, glibenclamide and tolbutamide, inhibited the K+ current induced by high [ATP] but not that induced by low [ATP], in contrast to charybdotoxin, which inhibited only the current induced by low [ATP]. These data provide evidence for the presence of at least two pharmacologically distinct K+ channels in HSG cells: a Ca2+-dependent maxi-K+ channel that is sensitive to charybdotoxin and an inwardly rectifying K+ channel that is sensitive to sulfonylurea compounds, probably a KATP channel (20, 21, 25).

Two classes of KATP channels are modulated by sulfonyl urea compounds: the ROMK channels and the classical KATP channels (20, 21, 25). Classical KATP channels (Kir 6.0 subfamily) have been shown to be present in pancreatic beta  cells, cardiac and skeletal myocytes, vascular smooth muscle, and neurons and are suggested to regulate the electrical activity of these cells (25). These KATP channels have been shown to be associated with the sulfonylurea receptors (SUR1, SUR2A, or SUR2B), which confer the sensitivity to the sulfonylurea compounds (see Ref. 25 for a review). The ROMK family of KATP channels (Kir 1.1 family) are expressed in the nephron, where they have been proposed to regulate K+ secretion (20, 21, 33, 34). In the case of the ROMK channels, the sensitivity to sulfonylurea compounds has been suggested to depend on an interaction with the CFTR protein, although conclusive experimental data for a molecular interaction between these two proteins is yet lacking (20, 21, 35). However, several observations are consistent with this suggestion. For example both the CFTR and the ROMK proteins were shown to be localized in the apical membrane of the nephron (33, 34). Co-expression of the ROMK1 protein and CFTR in oocytes conferred glibenclamide sensitivity to the K+ current (35). Further, cAMP stimulated both the CFTR-associated Cl- current and the inwardly rectifying, glibenclamide-sensitive, K+ current, and cAMP plus ATP decreased the sensitivity of the K+ channel for glibenclamide (20).

The present data demonstrate that HSG cells have (i) a Ca2+-independent, sulfonylurea-sensitive, inwardly rectifying K+ channel (KATP) activity, (ii) the ROMK channel and CFTR, and (iii) cAMP-stimulated Cl- and K+ currents. Thus, the KATP activity detected in HSG cells fulfills the criteria associated with the ROMK family of KATP channels. Based on measurements of electrolytes in saliva and 86Rb+ flux studies, it has been suggested that salivary gland ducts mediate K+ secretion into the lumen (36). Thus, the currently accepted model for ion fluxes in the salivary gland ductal cell depicts a pathway for K+ efflux via the apical membrane. However, presently there are no data to demonstrate the identity or function of this K+ conductance. Based on the data discussed above, we suggest that the ROMK-type KATP channel detected in HSG cells might be a likely candidate for this K+ secretory function. Further, as has been proposed for the regulation of the ROMK channels in kidney cells, the present data suggest that the ROMK channel in HSG cells might also be regulated via interaction(s) with the CFTR protein. Importantly, we have clearly demonstrated that CFTR, but not SUR, is present in HSG cells. Thus, HSG cells provide an excellent experimental system for further studies to examine the putative mechanism by which CFTR regulates the ROMK channel. Notably, the CFTR protein has also been shown to be present in the luminal membrane of rat submandibular gland ductal cells (27, 28), and studies reported by Muallem and co-workers have demonstrated cAMP-dependent activation of CFTR-associated Cl- current (i.e. Ca2+-independent, glibenclamide-sensitive) in rat submandibular gland ductal cells (7). However, the exact physiological role of CFTR in the ductal luminal membrane of salivary epithelial cells is still unclear.

In summary, ATP triggers two distinct Ca2+ signaling pathways in HSG cells through the P2U and P2Z receptors, respectively. The Ca2+ signaling pathway linked to the P2U receptor, is independent of external Na+ and Mg2+ and is associated with activation of KCa and SOC. In contrast, the Ca2+ signaling pathway via the P2z receptor does not appear to be activated by ATP under normal conditions (i.e. with 1 mM external Mg2+). However, it is associated with Ca2+ influx, probably via an as yet unidentified Ca2+-permeable cation channel, and activation of KCa when cells are exposed either to an agonist stronger than ATP or to ATP in low external [Mg2+]. Importantly, we have shown here that ATP also activates a novel, Ca2+-independent, weakly inwardly rectifying K+ channel in HSG cells, which is blocked by sulfonylurea compounds but not by charybdotoxin. Together with our demonstration of the presence of CFTR, a ROMK channel, and the activation of both Cl- and K+ currents in HSG cells by cAMP, the present data strongly suggest that this K+ channel belongs to the ROMK family of KATP channels. This putative salivary ROMK channel provides a potentially novel mechanism for the regulation of K+ secretion in salivary epithelial cells.

    ACKNOWLEDGEMENTS

We are grateful to Dr. William Guggino for providing the CFTR antibody and to Dr. Nelson Arispe for the control sample of CFTR protein. We thank Dr. J. T. Turner and co-authors for providing the preprint of a review article (6). We especially thank Julie Jadlowiec and Dr. Timothy Lockwich for the assistance with the Western blots and acknowledge Dr. Bruce Baum and all of our colleagues for support.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom all correspondence should be addressed: Bldg. 10, Rm. 1N-113, National Institutes of Health, Bethesda, MD 20892. Tel.: 301-496-1478; Fax: 301-402-1228; E-mail: ambudkar@yoda.nidcr.nih.gov.

    ABBREVIATIONS

The abbreviations used are: IP3, inositol 1,4,5-trisphosphate, CCh, carbachol; CFTR, cystic fibrosis transmembrane regulator; HSG, human submandibular gland; ISOC, store-operated Ca2+ current; KATP, ATP-sensitive K+ channel; KCa, Ca2+-activated K+ channel; Kir, inward rectifier K+ current; SUR, sulfonylurea receptor; Tg, thapsigargin; PCR, polymerase chain reaction; RT-PCR, reverse transcriptase-PCR; Bz-, benzoyl-; ChTx, charybdotoxin.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Burnstock, G. (1997) Neuropharmacology 36, 1127-1139[CrossRef][Medline] [Order article via Infotrieve]
2. Burnstock, G., and King, B. F. (1996) Drug Dev. Res. 38, 67-71
3. Dubyak, G. R., and El-Moatassim, C. (1993) Am. J. Physiol. 265, C577-C606[Abstract/Free Full Text]
4. Motte, S., Communi, D., Pirotton, S., and Boeynaems, J-M. (1995) Int. J. Biochem. Cell Biol. 27, 1-7[CrossRef][Medline] [Order article via Infotrieve]
5. Chan, C. M., Unwin, R. J., and Burnstock, G. (1998) Exp. Nephrol. 6, 200-207[CrossRef][Medline] [Order article via Infotrieve]
6. Turner, J. T., Landon, L. A., Gibbons, S. J., and Talamo, B. R. (1999) Crit Rev. Oral Biol. Med., in press
7. Soltoff, S. P., McMillian, M. K., and Talamo, B. R. (1992) Am. J. Physiol. 262, C934-C940[Abstract/Free Full Text]
8. McMillian, M. K., Soltoff, S. P., Cantley, L. C., Rudel, R., and Talamo, B. R. (1993) Br. J. Pharmacol. 108, 453-461[Medline] [Order article via Infotrieve]
9. Fukushi, Y., Ozawa, T., Kanno, T., and Wakui, M. (1997) Eur. J. Pharmacol. 336, 89-97[CrossRef][Medline] [Order article via Infotrieve]
10. Zeng, W., Lee, M. G., and Muallem, S. (1997) J. Biol. Chem. 272, 32956-32965[Abstract/Free Full Text]
11. Lee, M. G., Zeng, W., and Muallem, S. (1997) J. Biol. Chem. 272, 32951-32955[Abstract/Free Full Text]
12. Xu, X., Diaz, J., Zhao, H., and Muallem, S. (1996) J. Physiol. (Lond.) 491, 620-624
13. Amsallem, H., Metioui, M., VandenAbeele, A., Elyamani, A., Moran, A., and Dehaye, J. P. (1996) Am. J. Physiol. 271, C1546-C1555[Abstract/Free Full Text]
14. Yu, H., and Turner, J. T. (1991) J. Pharmacol. Exper. Ther. 259, 1344-1350[Abstract/Free Full Text]
15. Izutsu, K. T., Fatherazi, S., and Wellner, R. B. (1994) Am. J. Physiol. 266, C58-C66[Abstract/Free Full Text]
16. Liu, X., Rojas, S. E., and Ambudkar, I. S. (1998) Am. J. Physiol. 275, C571-C580[Abstract/Free Full Text]
17. Liu, X., O'Connell, A., and Ambudkar, I. S. (1998) J. Biol. Chem. 273, 33295-33304[Abstract/Free Full Text]
18. He, X., Wu, X., Turner, R. J., and Baum, B. J. (1990) J. Membr. Biol. 115, 159-166[CrossRef][Medline] [Order article via Infotrieve]
19. Kurihara, K., Nakanishi, N., and Ueha, T. (1997) Arch. Oral Biol. 42, 547-557[CrossRef][Medline] [Order article via Infotrieve]
20. Ho, K. (1998) Curr. Opin. Nephrol. Hypertens. 7, 49-58[Medline] [Order article via Infotrieve]
21. Schwiebert, E. M., Benos, D. J., Egan, M. E., Stutts, M. J., and Guggino, W. B. (1999) Physiol. Rev. 79 (suppl.), 145-161[Abstract/Free Full Text]
22. Wang, W., O'Connell, B., Dykeman, R., Sakai, T., Delporte, C., Swaim, W., Zhu, X., Birnbaumer, L., and Ambudkar, I. S. (1999) Am. J. Physiol. 276, C969-C979
23. Christoffersen, B. C., Hug, M. J., and Novak, I. (1998) Pflugers Arch. 426, 33-39
24. Tojyo, T., Tanimura, A., Matsui, S., and Matsumoto, Y. (1997) Arch. Oral Biol. 42, 393-399[CrossRef][Medline] [Order article via Infotrieve]
25. Quayle, J. M., Nelson, M. T., and Standen, N. B. (1997) Physiol. Rev. 77, 1165-1232[Abstract/Free Full Text]
26. Trezise, A. E., and Buchwald, M. (1991) Nature 353, 434-437[CrossRef][Medline] [Order article via Infotrieve]
27. Zeng, W., Lee, M. G., Yan, M., Diaz, J., Benjamin, I., Marino, C. R., Kopito, R., Freedman, S., Cotton, C., and Muallem, S. (1997) Am. J. Physiol. 273, C442-C455[Abstract/Free Full Text]
28. He, X., Tse, C. M., Donowitz, M., Alper, S. L., Gabriel, S. E., and Baum, B. J. (1997) Pflugers Arch. 433, 260-268[CrossRef][Medline] [Order article via Infotrieve]
29. Sheppard, D. N., and Welsh, M. J. (1999) Physiol. Rev. 79, S23-S45
30. Bradbury, N. A. (1999) Physiol. Rev. 79 (suppl.), 175-191[Abstract/Free Full Text]
31. Isomoto, S., Kondo, C., Yamada, M., Matsumoto, S., Higashiguchi, O., Horio, Y., Matsuzawa, Y., and Kurachi, Y. (1996) J. Biol. Chem. 271, 24321-24324[Abstract/Free Full Text]
32. Soltoff, S. P., McMillian, M. K., Cragoe, E. J., Jr., Cantley, L. C., and Talamo, B. R. (1990) J. Gen. Physiol. 95, 319-346[Abstract/Free Full Text]
33. Xu, J. Z., Hall, A. E., Peterson, L. N., Bienkowski, J., Eessalu, T. E., and Hebert, S. C. (1997) Am. J. Physiol. 273, F739-F748
34. Kohda, Y., Ding, W., Phan, E., Housini, I., Wang, J., Star, R. A., and Huang, C-L. (1998) Kidney Int. 54, 1214-1223[CrossRef][Medline] [Order article via Infotrieve]
35. Ruknudin, A., Schulze, D. H., Sullivan, S. K., Lederer, W. J., and Welling, P. A. (1998) J. Biol. Chem. 273, 14165-14171[Abstract/Free Full Text]
36. Cook, D. I., Dinudom, A., Komwatana, P., and Young, J. A. (1998) Eur. J. Morphol. 36, 67-73


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Physiol. Rev.Home page
D. Heitzmann and R. Warth
Physiology and Pathophysiology of Potassium Channels in Gastrointestinal Epithelia
Physiol Rev, July 1, 2008; 88(3): 1119 - 1182.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
T. Nakamoto, V. G. Romanenko, A. Takahashi, T. Begenisich, and J. E. Melvin
Apical maxi-K (KCa1.1) channels mediate K+ secretion by the mouse submandibular exocrine gland
Am J Physiol Cell Physiol, March 1, 2008; 294(3): C810 - C819.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. O. Hernandez-Gonzalez, C. L. Trevino, L. E. Castellano, J. L. de la Vega-Beltran, A. Y. Ocampo, E. Wertheimer, P. E. Visconti, and A. Darszon
Involvement of Cystic Fibrosis Transmembrane Conductance Regulator in Mouse Sperm Capacitation
J. Biol. Chem., August 17, 2007; 282(33): 24397 - 24406.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. L. Ong, X. Liu, K. Tsaneva-Atanasova, B. B. Singh, B. C. Bandyopadhyay, W. D. Swaim, J. T. Russell, R. S. Hegde, A. Sherman, and I. S. Ambudkar
Relocalization of STIM1 for Activation of Store-operated Ca2+ Entry Is Determined by the Depletion of Subplasma Membrane Endoplasmic Reticulum Ca2+ Store
J. Biol. Chem., April 20, 2007; 282(16): 12176 - 12185.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. E. Krouse, J. F. Talbott, M. M. Lee, N. S. Joo, and J. J. Wine
Acid and base secretion in the Calu-3 model of human serous cells
Am J Physiol Lung Cell Mol Physiol, December 1, 2004; 287(6): L1274 - L1283.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. M. Gonzalez-Guerrico, E. G. Cafferata, M. Radrizzani, F. Marcucci, D. Gruenert, O. H. Pivetta, R. R. Favaloro, R. Laguens, S. V. Perrone, G. C. Gallo, et al.
Tyrosine Kinase c-Src Constitutes a Bridge between Cystic Fibrosis Transmembrane Regulator Channel Failure and MUC1 Overexpression in Cystic Fibrosis
J. Biol. Chem., May 3, 2002; 277(19): 17239 - 17247.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
J. Choi, L. W. Hammer, and R. L. Hester
Calcium-Dependent Synthesis of Prostacyclin in ATP-Stimulated Venous Endothelial Cells
Hypertension, February 1, 2002; 39(2): 581 - 585.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
A. Bringmann, T. Pannicke, V. Moll, I. Milenkovic, F. Faude, V. Enzmann, S. Wolf, and A. Reichenbach
Upregulation of P2X7 Receptor Currents in Muller Glial Cells during Proliferative Vitreoretinopathy
Invest. Ophthalmol. Vis. Sci., March 1, 2001; 42(3): 860 - 867.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
T. P. Lockwich, X. Liu, B. B. Singh, J. Jadlowiec, S. Weiland, and I. S. Ambudkar
Assembly of Trp1 in a Signaling Complex Associated with Caveolin-Scaffolding Lipid Raft Domains
J. Biol. Chem., April 14, 2000; 275(16): 11934 - 11942.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, X.
Right arrow Articles by Ambudkar, I. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, X.
Right arrow Articles by Ambudkar, I. S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement