|
J Biol Chem, Vol. 274, Issue 35, 25121-25129, August 27, 1999
ATP-dependent Activation of KCa and
ROMK-type KATP Channels in Human Submandibular Gland
Ductal Cells*
Xibao
Liu,
Brij B.
Singh, and
Indu S.
Ambudkar
From the Secretory Physiology Section, Gene Therapy and
Therapeutics Branch, NIDCR, National Institutes of Health,
Bethesda, Maryland 20892
 |
ABSTRACT |
[Ca2+]i and membrane
current were measured in human submandibular gland ductal (HSG) cells
to determine the regulation of salivary cell function by ATP. 1-10
µM ATP activated internal Ca2+ release,
outward Ca2+-dependent K+ channel
(KCa), and inward store-operated Ca2+ current
(ISOC). The subsequent addition of 100 µM ATP activated an inwardly rectifying K+
current, without increasing [Ca2+]i. The
K+ current was also stimulated by ATP in cells treated with
thapsigargin in a Ca2+-free medium and was blocked by
glibenclamide and tolbutamide, but not by charybdotoxin. This suggests
the involvement of a Ca2+-independent,
sulfonylurea-sensitive K+ channel (KATP). UTP
mimicked the low [ATP] effects, while benzoyl-ATP activated internal
Ca2+ release, a Ca2+ influx pathway, and
KCa. Thus, ATP acts via P2U (P2Y2)
and P2Z (P2X7) receptors to increase
[Ca2+]i and activate KCa, but not
KATP. Importantly, (i) ROMK1 and the cystic fibrosis
transmembrane regulator protein (but not SUR1, SUR2A, or SUR2B) and
(ii) cAMP-stimulated Cl and K+ currents were
detected in HSG cells. These data demonstrate for the first time that a
ROMK-type KATP channel is present in salivary gland duct
cells that is regulated by extracellular ATP and possibly by the cystic
fibrosis transmembrane regulator. This reveals a potentially novel
mechanism for K+ secretion in these cells.
 |
INTRODUCTION |
Receptors for ATP are widely expressed in mammalian tissues and
are reportedly involved in regulating a variety of cellular functions
(1). Pharmacological studies with various ATP analogues have
demonstrated two major groups of purinergic (P2) receptors: ionotropic
receptors (P2X), associated with ligand-gated nonselective cation
channel activity, and metabotropic receptors (P2Y), associated with
activation of G-proteins (2-5). In nonexcitable cells, extracellular ATP induces an elevation of cytosolic [Ca2+]
([Ca2+]i) by two distinct mechanisms, either by
activation of Ca2+ release from intracellular
Ca2+ stores or via activation of Ca2+ influx
from the external medium (5, 6). The P2Y subtype is coupled via
G q/11 to the activation of phosphatidylinositol 4,5-bisphosphate-specific phospholipase C. Thus, activation of these
receptors by ATP leads to an increase in [Ca2+]i
due to increase in inositol 1,4,5-trisphosphate
(IP3)1 and
IP3-mediated internal Ca2+ release. Activation
of the P2X subtype has been shown to be coupled to the activation of a
nonspecific cation channel(s), resulting in increased permeability of
the plasma membrane to Na+, K+, and
Ca2+.
P2 receptors have been found in many epithelial cells, including those
from various salivary glands. Four P2 receptors have been identified in
salivary gland cells: P2Y1, P2Y2
(P2U), P2X4, and P2X7
(P2Z) (6). In rat parotid acinar cells, it has been reported that ATP primarily activates a Ca2+ and
Na+-permeable cation channel via stimulation of
P2Z receptors. While transcripts for P2Y receptors have
been detected in rat parotid acinar cells, ATP does not appear to
strongly induce IP3 generation or internal Ca2+
release (6-9). However, in rat submandibular ductal cells, evidence for both P2U and P2Z receptors have been
presented (6, 10-13). Interestingly, these P2-purinergic receptors
have distinct cellular localizations in these cells; P2Z
receptors were found in the luminal membrane, while P2U
receptors were detected in basolateral membrane (10-13). Presently,
the exact mechanisms and ion channels involved in P2 receptor-mediated
regulation of salivary gland function are poorly understood (6). The
human submandibular ductal cell line (HSG) has been widely used to
study the mechanism(s) of Ca2+ signaling in salivary gland
cells (6, 14-18). Previous studies with HSG cells have demonstrated
that activation of the muscarinic receptor leads to the generation of
IP3, which causes intracellular Ca2+ release
and activation of store-operated Ca2+ influx (15-18). HSG
cells have also been reported to have P2 receptors (6, 14). ATP, via
the P2U receptor, was shown to increase [Ca2+]i and Ca2+-activated
86Rb+ efflux (14). It was also reported that in
HSG cells ATP-stimulated IP3 formation is coupled to the
P2U activation, while ATP-stimulated 45Ca2+ influx is mediated via activation of P2X
receptors (19). However, the types of ion channels involved in these
ATP-induced ion fluxes have not yet been identified.
This study examines the mechanisms involved in the regulation of
salivary gland cell function by ATP, by measuring
[Ca2+]i and the membrane conductance of HSG
cells. The data show that ATP acts via multiple P2
purinergic receptors, including P2U (P2Y2) and
P2Z (P2X7), to activate the
Ca2+-activated K+ channel (KCa),
the store-operated Ca2+ influx channel, and probably a
Ca2+-permeable cation channel. Importantly, we report here
that ATP also activates an inwardly rectifying,
Ca2+-independent K+ current. The inhibition of
this current by sulfonylurea compounds and the presence of ROMK1 and
cystic fibrosis transmembrane regulator (CFTR) proteins in HSG cells,
suggests for the first time that a ROMK type of epithelial
KATP channel is present in salivary gland epithelial cells.
As has been suggested for kidney epithelial cells (20, 21), the
putative ROMK channel in HSG cells might also be regulated by a
CFTR-dependent mechanism. These data reveal a potentially
novel mechanism for the regulation of K+ secretion in
salivary epithelial cells.
 |
EXPERIMENTAL PROCEDURES |
Cell Culture--
HSG cells were a kind gift from Dr. Mitsunabo
Sato (Tokushima University, Japan). The conditions for cell culture
were similar to those described previously (16, 17). Briefly, cells
were grown in Eagle's minimum essential medium supplemented with 10% fetal calf serum, 2 mM L-glutamine, 100 units/ml penicillin, and 100 µg/ml streptomycin (all from Biofluids,
Rockville, MD) under 5% CO2 at 37 °C. Cells were
passaged when confluent by detaching from the tissue culture dish with
0.25% trypsin, 1.0 mM EDTA (Biofluids). A single-cell
suspension was reseeded onto coverslips and used after about 24 h.
Patch Clamp Measurements--
Patch clamp in a whole cell
configuration was performed on single HSG cells attached to coverslips
using the standard patch-clamp technique described previously (16, 17).
The resistance of the pipette was about 3-6 megaohms. The chamber was
connected with an Ag-AgCl pellet through a 150 mM
NaCl-containing agar bridge. Membrane currents were measured with an
Axopatch 200A amplifier in conjunction with pClamp 6.1 software and a
Digidata 1200 A/D converter (Axon Instruments, Foster City, CA). The
currents were filtered at 2 kHz (low pass bessel filter) and sampled
with an interval of 10 ms. In the step protocol, the cell was held at 0 mV for 312 ms and stepped from 120 to 80 mV in 20-mV steps for 200 ms each step. The leakage subtraction function was used to minimize the
leak currents. The currents were digitized and recorded directly onto
the hard drive of a Dell Pentium computer. The I-V
relationship was calculated using the peak amplitude of the current
during the step protocol and exported to Origin 5 (Microcal Software,
Inc., Northampton, MA) for further analysis.
A piece of coverslip (0.5 × 0.5 mm) with cells was placed in the
perfusion chamber (Warner Instrument Corporation, Hamden, Connecticut).
For measuring KCa, the standard extracellular solution contained 145 mM NaCl, 5 mM KCl, 1 mM MgCl2, 1 mM CaCl2,
10 mM glucose, 0.2 mM EGTA, and 10 mM HEPES, pH 7.4. The pipette was filled with 150 mM KCl, 2 mM MgCl2, 1 mM ATP, 10 mM HEPES, pH 7.2. For measuring
Isoc, the extracellular solution contained 135 mM sodium glutamate, 1 mM MgCl2, 10 mM CaCl2, 10 mM glucose, and 10 mM HEPES, pH 7.4 (NaOH). The pipette was filled with 135 mM NMDG-glutamate, 10 mM CsCl, 10 mM
1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid, 1 mM MgCl2, 1 mM ATP, 10 mM HEPES, pH 7.2 (CsOH). Any changes in the composition of
the pipette and external solutions are given under "Results." ATP,
ATP analogs, thapsigargin (Tg), or CCh was included in the perfusion medium.
[Ca2+]i Measurements--
Fluorescence was
measured in fura2-loaded single HSG cells at excitation wavelengths of
340 and 380 nm, with emission at 510 nm, using a SLM 8000/DMX 100 spectrofluorimeter attached to an inverted Nikon Diaphot inverted
microscope with a Fluor 40× oil immersion objective. Images were
acquired using an enhanced CCD camera (CCD-72, MTI) and the
Image-1 software (Universal Imaging Corporation, PA). The 340/380-nm
ratio of fura2 fluorescence has been used to represent
[Ca2+]i. Other details of the experiments are
given in the text and figure legends. All experiments were performed at
room temperature.
Western Blotting--
Preparation of crude and plasma membrane
fractions, SDS-PAGE, and Western blotting were performed as described
previously (22). Reactivity of the samples against either a polyclonal anti-human CFTR antibody, 1:150 dilution (a generous gift from Dr. W. Guggino, Johns Hopkins University, Baltimore, MD) or polyclonal anti-ROMK antibody, 1:200 dilution (Alomone Laboratories, Jerusalem, Israel) was determined using a secondary antibody 1:5000 dilution and
ECL reagent (Amersham Life Sciences). Plasma membrane fraction from
HEK-293 cells overexpressing the CFTR protein was kindly provided by
Dr. Nelson Arispe (Department of Cell Biology, Uniformed Services
University of Health Sciences, Bethesda, MD). Control ROMK1 protein was
supplied by Alomone Laboratories. Amido Black B was used to stain the
proteins after transfer to the polyvinylidene difluoride membrane.
RNA Isolation, cDNA Synthesis, and RT-PCR--
mRNA was
isolated from HSG cells using TRIzol reagent (Life Technologies, Inc.)
and the Oligotex mRNA kit (Qiagen). The RNA was treated with DNase
I (amplification grade, Life Technologies, Inc.) at a concentration of
1 unit/µg of RNA. Human pancreatic mRNA was purchased from
CLONTECH. First strand cDNA synthesis of ROMK,
SUR1, SUR2A, and SUR2B was carried out using 0.5 µg of mRNA using
antisense-specific primers as follows: ROMK
(5'-GGAGCTTTAGAGACTTTGCTTTAC), SUR1
(5'-CTCAAGGATGGCACCCCGCTTCAGG), SUR2A
(5'-CTGAGGGTATTTTAGTGGAGTGTG), and SUR2B (5'-
CACACTATTCTGACGGCAGACCTGG). The sense primers used for RT-PCR were as
follows: ROMK (5'-CAGGGTGTTGACAGAAAGTATGTTC), SUR1
(5'-GCCCTGGCCGTCATCTCCTATGTC), and SUR2A and -2B
(5'-CCAACCTTGGAATCTCTAACTCGC). RT-PCR was performed using
SuperScript reverse transcriptase II (Life Technologies, Inc.). The PCR
mixture contained 20 mM Tris-HCl (pH 8.5), 50 mM KCl, 1.5 mM MgCl2, a 0.2 mM concentration of each dNTP, 20 pmol of each primer,
first strand cDNA, and 2.5 units of Taq DNA polymerase.
PCR was performed as follows for 35 cycles: 94 °C denaturation for
30 s, 55 °C annealing for 45 s, and 68 °C extension for
2 min. 10% of the sulfonylurea receptor (SUR) products and 5% of the
ROMK product were loaded on a 1% agarose gel.
 |
RESULTS |
ATP-induced Increase in [Ca2+]i and
Membrane Conductance in HSG Cells--
ATP, at concentrations ranging
from 0.1 to 100 µM, was added sequentially to the cell as
shown in Fig. 1. An outward current was
detected in 95% (43/48) of the HSG cells tested at a holding potential
of 0 mV in a whole cell patch clamp mode. Typically, the cells showed a
response, i.e. an increase in the outward current, at 1 µM ATP with a few cells responding at 0.1 or 10 µM. A second response was seen at 100 µM
ATP. However, a subsequent addition of 1 mM or higher ATP
failed to induce any further increase in the membrane current. The
current was blocked by replacing intracellular K+ with
Cs+ (data not shown), strongly indicating that it was due
to an increase in K+ ion conductance. Further, this pattern
of response was similar in the presence or absence of external
Ca2+ (Fig. 1, compare A and B).
However, in the presence of external Ca2+, the outward
current seen at 1 µM ATP was more sustained, presumably due to the involvement of a Ca2+ influx component in this
response. Most cells showed a quick run down of the membrane
conductance with a duration of about 2-3 min at any given ATP
concentration. This is consistent with a previous report showing that
ATP induced transient 45Ca2+ influx and
IP3 production (19) in HSG cells.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 1.
ATP-stimulated outward current and
[Ca2+]i increase in HSG cells. Currents were
recorded in HSG cells by using a patch clamp, in a whole cell
configuration, at 0 mV holding potential in the presence (A)
or absence (B) of external Ca2+. External
medium, with increasing [ATP], was perfused into the chamber for the
periods indicated by the corresponding bar. The
traces shown are representative of data obtained in 14 cells. [Ca2+]i was monitored in single HSG cells
maintained Ca2+-free or Ca2+-containing
(C) or Mg2+-free (D) medium. Various
[ATP] was added to the medium as shown by the corresponding
arrows. These traces are the representative results from at
least 40 cells in each experiment.
|
|
Measurement of [Ca2+]i (expressed as the
340/380-nm fluorescence ratio) demonstrated that an increase in
[Ca2+]i was induced upon the addition of ATP in
94% of HSG cells (254 of 270). Most cells (84%, 212 of 254) showed a
response at 1 µM ATP, with a few cells responding at 0.1 (9%, 24 of 254) or 10 µM ATP (7%, 18 of 254).
Importantly, while a response to lower [ATP] was detected, a higher
[ATP] added subsequently to the same cell failed to evoke a second
response. A typical dose response in the presence or absence of
external Ca2+ is shown in Fig. 1C. In the
absence of external Ca2+, the initial peak increase in
[Ca2+]i was not changed, although the response
was more transient in nature. This suggests that both intracellular
Ca2+ release and Ca2+ influx account for the
ATP-induced increase in [Ca2+]i.
Further, this pattern of [Ca2+]i increase was not
changed when Na+ was removed from the external medium
(n = 35, data not shown). However, when
Mg2+ was removed from the medium as shown in Fig.
1D, a small increase in [Ca2+]i was
induced with 100 µM ATP in a Ca2+-containing
medium. These data suggest that, at 100 µM, ATP induces a
Ca2+ influx component that is inhibited by external
Mg2+. This is also consistent with studies in pancreatic
duct cells (23) and other salivary gland cells (6), showing that
removal of external Mg2+ increased the ATP-induced peak
[Ca2+]i. However, since the K+
current measurements (shown in Fig. 1, A and B)
were made in the presence of external Mg2+, the
K+ current induced at 100 µM ATP is probably
not associated with Ca2+ influx.
UTP, a potent agonist of several P2Y receptors, stimulates
IP3 generation and release of Ca2+ from
intracellular Ca2+ stores (1-4). Unlike with ATP,
sequential additions of increasing [UTP] induced an increase in
[Ca2+]i and outward current only at 1 µM (Fig. 2, A
and B). This pattern was not changed in the absence of
external Mg2+ or with 10 mM external
Mg2+ (n = 43, data not shown). However,
prior stimulation of cells with UTP attenuated the
[Ca2+]i increase induced by a subsequent addition
of ATP to the same cell, and vice versa (see Fig. 2,
C and D). As seen with UTP, only low [2MeS-ATP]
induced a response. However, the response was lower than that induced
by ATP or UTP (data not shown).

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 2.
UTP-induced outward current and
[Ca2+]i increase in HSG cells.
[Ca2+]i (A, C, and
D) and conductance (B) were monitored as
described for Fig. 1. Various concentrations of UTP were added to the
cell medium as shown by arrows (A). External
medium with varying [UTP] was perfused into the chamber for the
periods indicated by the corresponding bars (B).
A and B are representative of results obtained in
50 (A) and 5 (B) cells, respectively.
C, ATP (100 µM), followed by UTP (100 µM), was added to the cell medium as shown by the
corresponding arrows. This trace is representative of data
obtained with 54 cells. D, in another cell, the above order
of addition was reversed. This is a typical response from 47 cells.
|
|
We have recently reported that depletion of intracellular
Ca2+ stores in HSG cells by muscarinic receptor stimulation
with CCh, introduction of IP3 into the cell, or treatment
with the Ca2+ pump inhibitor Tg, activated
ISOC, which was dependent on external [Ca2+] and inhibited by La3+ and
Gd3+ (17). The data in Fig. 3
show that ATP (1 µM) also induced an inward
Ca2+ current in HSG cells. This inward current was
dependent on external [Ca2+] and was eliminated by
changing the external [Ca2+] from 10 to 0 mM
(Fig. 3A). ATP-induced ISOC had a
larger amplitude (25 ± 7 pA), but a shorter duration (3-4 min),
compared with that induced by IP3 or CCh (17) and was
inhibited by La3+ (Fig. 3B). Notably, ATP (1 µM)-induced inward Ca2+ and outward
K+ currents displayed similar characteristics
i.e. dependence on external Ca2+ and inhibition
by La3+ (Fig. 3, compare A and B with
C and D). Further, stimulation of cells with ATP
in a Ca2+-free medium inhibited the response to a
subsequent addition of CCh (data not shown). This is the first report
of ATP-induced Isoc in a salivary cell. Taken
together, these data demonstrate that in HSG cells low [ATP] (<10
µM) stimulates P2U (P2Y2)
receptors to cause the release of Ca2+ from internal
Ca2+ stores, which results in the activation of
KCa and ISOC.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 3.
Inhibition of ATP-activated
ISOC and outward K+ current by
La3+ in HSG cells. Store-operated inward current
(Isoc, A and B) stimulated
by 10 µM ATP (perfused during the entire
experiment) was measured by whole cell configuration at 0 mV holding
potential as described under "Experimental Procedures."
A, [Ca2+] in the external medium was
changed from 10 to 0 mM, shown by the corresponding
bar. B, cells were exposed to external medium
containing 10 mM Ca2+ and 1 mM
La3+, shown by the corresponding bar. These are the
representative traces from five (A) or four (B)
cells, respectively. K+ currents (C and
D) were measured as described for Fig. 1 in the presence of
10 µM ATP in the perfusion medium. C,
[Ca2+] in the perfusion medium was changed to 0 Ca2+ for the period shown by the corresponding
bar; D, 1 mM LaCl3 was
included in the external solution where indicated.
|
|
ATP-induced Ca2+-independent K+
Current--
Fig. 1 shows that high [ATP] activates a K+
current in HSG cells that is not accompanied by any changes
[Ca2+]i. To determine the nature of this
K+ current, we examined the effect of depletion of the
intracellular Ca2+ store with Tg.
[Ca2+]i was monitored in the absence of external
Ca2+, and data are shown in Fig.
4A. Tg induced an increase in
[Ca2+]i due to Ca2+ "leakage"
from the internal stores. The subsequent addition of ATP (10-100
µM) to the cells failed to induce any further increase in
[Ca2+]i (Fig. 4A). This suggests that
the [Ca2+]i increase induced by ATP is due to
Ca2+ release from Tg-sensitive stores. Similarly Tg-induced
increases in [Ca2+]i or the KCa
current were diminished or greatly reduced after the cell was first
exposed to ATP (n = 56 or n = 4 for
[Ca2+]i and the KCa currents,
respectively; data not shown). In contrast to
[Ca2+]i increases shown in Fig. 4A,
100 µM ATP induced an increase in the outward current in
Tg-treated cells (Fig. 4B). When external Ca2+
was reintroduced, a further increase in the outward current was seen,
probably due to the activation of KCa as a result of
Ca2+ entry. These results clearly indicate that two kinds
of outward K+ currents are stimulated by ATP in HSG cells.
One is associated with [Ca2+]i increase, and the
other appears to be independent of [Ca2+]i
increase. Consistent with the [Ca2+]i
measurements shown in Fig. 4A, Tg induced a transient activation of the K+ current. In aggregate, the data
presented above indicate that in HSG cells ATP (100 µM)
activates a K+ current that is not (i) due to activation of
KCa or (ii) accompanied by increases in
[Ca2+]i.

View larger version (9K):
[in this window]
[in a new window]
|
Fig. 4.
Effects of internal Ca2+ store
depletion on ATP-induced increases in [Ca2+]i
and outward currents in HSG cells. A,
[Ca2+]i was measured during sequential
application of Tg (1 µM) and ATP (10 and 100 µM) as shown by the corresponding arrows.
B, the outward KCa current was monitored during
a similar application of Tg and ATP. The external Ca2+ was
removed and added back to the bath as shown by the corresponding
bars. These are the representative results from 55 (A) or five (B) different cells.
|
|
To further characterize the apparent Ca2+-independent
K+ current, the effect of charybdotoxin (ChTx) was
examined. We reported earlier that ChTx, a large conductance
Ca2+-dependent K+ channel
antagonist, inhibits the carbachol-stimulated KCa current in HSG cells (16). As seen in Fig.
5A, 25 nM ChTx
also effectively blocked the K+ current induced by 1 and 10 µM ATP but not that induced by 100 µM ATP
(Fig. 5A). The I-V curve of the outward current
induced by 100 µM ATP in ChTx-treated cells shows a weak
inward rectification with a reversal potential of 75 mV, which is
close to the K+ reversal potential (Fig. 5B).
Furthermore, replacing intracellular K+ ion with
Cs+ eliminated ATP-induced outward currents at all
concentrations tested (from 1 µM to 1 mM,
n = 5, data not shown). These data suggest that high
[ATP] activates an inwardly rectifying, Ca2+-independent,
K+ current in HSG cells.

View larger version (8K):
[in this window]
[in a new window]
|
Fig. 5.
Effect of charybdotoxin on the ATP-stimulated
Ca2+-independent outward current. A,
25 nM ChTx was introduced to the bath when the cell was
stimulated by ATP (1 µM to 1 mM), as shown by
the corresponding bar. This is representative of results
obtained in five cells. B, I-V curve of the
outward current induced by ATP in the presence of 25 nM
ChTx (n = 5). The current induced by 100 µM ATP was measured by a step protocol in whole cell
configuration. The cell was held at 0 mV, and the membrane potential
was stepped from 140 to 80 mV in 20-mV steps with a duration of 500 ms.
|
|
Bz-ATP-induced Ca2+ Influx and K+
Currents--
In addition to the P2U receptor, a
P2Z subtype of P2 receptor (P2X7)
has also been found in the salivary gland cells (6). To determine
whether the Ca2+-independent ChTx-insensitive
K+ channel was stimulated by the activation of a
P2Z receptor, we examined the effects of Bz-ATP, a potent
agonist of the P2Z receptor, on
[Ca2+]i and whole cell current. The data are
shown in Fig. 6. Fig. 6, A and
B, shows whole cell currents following the sequential additions of 1, 10, 100, and 1000 µM Bz-ATP to HSG cells
in Ca2+-containing and Ca2+-free medium,
respectively. In the presence of external Ca2+ (Fig.
6A), Bz-ATP activated a K+ current at all
concentrations tested, with the largest response, a somewhat sustained
increase, obtained at 100 µM. No significant response was
seen at 1 mM Bz-ATP. When cells were stimulated in the
absence of external Ca2+ (Fig. 6B), the response
at 1 µM Bz-ATP was relatively more transient, while that
at 10 µM was greatly attenuated, and that at 100 µM was barely detectable. Thus, Bz-ATP, at higher
concentrations, appeared to stimulate K+ currents only in
the presence of external Ca2+. Similar effects of Bz-ATP
were seen on [Ca2+]i (Fig. 6, C and
D). P2Z-associated cation channels in salivary
gland cells are reportedly permeable to external Na+ and
inhibited by external Mg2+ (6). However, the Bz-ATP-induced
[Ca2+]i increase did not appear to be affected by
replacing Na+ in the external medium with NMDG (Fig.
7A). Further, as shown in Fig.
7B, external Mg2+ attenuated the
[Ca2+]i increases induced at all concentrations
of Bz-ATP but especially that at 100 µM. In the presence
of 3 mM external [Mg2+], attenuated
[Ca2+]i increases were observed in 35% of cells
tested (23 of 65), while [Ca2+]i increase was not
detected in 65% of the cells. Furthermore, 10 mM
Mg2+ totally eliminated Bz-ATP (1 µM to 1 mM) induced responses (data not shown, n = 35). In aggregate, these data demonstrate the presence of a
P2Z (P2X7) receptor in HSG cells, which can be
activated by Bz-ATP to stimulate Ca2+ influx, via an as yet
unidentified ion channel. Low Bz-ATP also stimulates internal
Ca2+ release, probably via IP3 generation or by
an as yet unidentified mechanism (6, 19). The resulting increase in
[Ca2+]i activates KCa. However, the
data are not consistent with the involvement of the P2Z
receptor in the activation of the ChTx-insensitive,
Ca2+-independent, inwardly rectifying K+
channel by high [ATP].

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 6.
Bz-ATP-stimulated outward current and
[Ca2+]i increase in HSG cells.
KCa current was measured as described for Fig. 1. External
medium with (A) or without (B) Ca2+,
containing various [Bz-ATP] was perfused for the periods indicated by
the bars. The traces shown are representative of
data obtained with six cells. C and D,
[Ca2+]i was monitored as shown in Fig. 1, and
Bz-ATP was added to the cell medium, with (C) or without
Ca2+ (D), as indicated by the corresponding
arrows. These are the representative traces from 52 (C) and 65 (D) cells.
|
|

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 7.
Effect of external Na+ and
Mg2+ on Bz-ATP-induced increases in
[Ca2+]i. [Ca2+]i was
measured in HSG cells as described for Fig. 1, in a
Na+-free medium (A) or in medium containing 3 mM Mg2+ (B). Increasing [Bz-ATP]
were added to the medium as shown by the corresponding
arrows. These are the representative traces from 64 (A) or 52 (B) cells.
|
|
Effects of Sulfonylurea Compounds on the ATP-induced
Ca2+-independent K+ Current--
To further
characterize the ChTx-insensitive K+ current activated by
higher [ATP], we examined the effects of the sulfonylurea compounds,
which have been reported to block a family of inwardly rectifying
K+ channels, Kir (20, 21, 25). Fig.
8 shows that glibenclamide (10 µM) and tolbutamide (1 mM) inhibited the
outward current induced by 100 µM ATP. Importantly, the
K+ current stimulated by 1 µM ATP was not
significantly affected by these compounds. Further, when ATP was
substituted by Bz-ATP, 2MeS-ATP, UTP, or ADP no currents were detected
in charybdotoxin-treated HSG cells (data not shown).

View larger version (8K):
[in this window]
[in a new window]
|
Fig. 8.
Effect of sulfonylurea compounds on the
ATP-activated, Ca2+-independent inwardly rectifying
K+ current. Outward currents were measured under the
conditions described for Fig. 1 in cells treated with glibenclamide
(A) or tolbutamide (B), at the indicated
concentrations. External medium with increasing [ATP] was perfused
into the chamber for the periods indicated by the bars.
These are the representative traces from five (A) or six
(B) cells.
|
|
These data suggest that the ATP-activated ChTx-insensitive
K+ current might belong to the KATP family of
Kir channels. However, since the pipette solution in these experiments
contained 1 mM ATP, the KATP channel in HSG
cells appears to have a lower sensitivity for inhibition by
intracellular ATP. Consistent with this, increasing internal [ATP] to
5 or 10 mM (in the presence of 1 mM
Mg2+) significantly reduced the K+ current
(data not shown).
Presence of CFTR and ROMK1 Proteins in HSG Cells--
It has been
suggested that the sulfonylurea sensitivity of KATP
channels might be conferred via interaction with sulfonylurea-binding proteins such as SUR or CFTR protein (20, 21, 25). The association of
the classical KATP channel (Kir 6.2) in pancreatic cells with SUR has been well established. This K+ channel
demonstrates high sensitivity for intracellular ATP and glibenclamide
(25). In contrast, the ROMK family of weakly inwardly rectifying
epithelial K+ channels have been reported to have a lower
sensitivity for inhibition by intracellular ATP. These K+
channels also have a relatively lower sensitivity to glibenclamide (20,
21). The KATP channels in kidney epithelial cells (Kir 1.1a
and 1.1b, ROMK1 and ROMK2, respectively) have been suggested to be
regulated via interaction with the CFTR protein, although presently
there are no data that conclusively demonstrate this molecular
interaction. The presence of the CFTR protein was previously demonstrated, both functionally and by immunofluorescence, in the
luminal membrane of salivary gland ductal cells (26-28). Thus, we
examined the presence of CFTR in HSG cells, a human submandibular gland
ductal cell line, by Western blotting using an anti-human CFTR
antibody. A strong reactivity was detected in the plasma membrane
fraction of HSG cells (Fig.
9A, lane
2) associated with a protein of with an approximate
molecular mass of 180 kDa, which co-migrated with the control CFTR
protein (see lane 1, plasma membrane preparation
of HEK cells infected with an adenovirus encoding the CFTR).
Additionally, consistent with the reported intracellular localization
of the CFTR protein (29, 30), more reactivity was detected in a crude
membrane fraction (lane 3), which probably also
includes intracellular organelles. These data suggest that HSG cells,
similar to rat submandibular gland ductal cells and kidney cells, have
the CFTR protein.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 9.
Presence of CFTR and ROMK proteins in HSG
cells. Fig. 9A shows reactivity of proteins in HSG cell
plasma (lane 2) and crude (lane 3) membrane fractions to a polyclonal anti-human CFTR
antibody. Lane 1 shows reactivity in the plasma
membrane fraction of HEK cells overexpressing the human CFTR protein.
The CFTR protein is detected at approximately 180 kDa in all three
samples. Fig. 9B shows reactivity in HSG cell crude
(lane 1) and plasma (lane 2) membranes to an anti-ROMK antibody. Lane 3 shows the reactivity in a control sample containing the
purified ROMK1 protein (obtained from Alomone Laboratories). Control
ROMK protein can be detected at 42 kDa (lane 4 shows Amido
Black staining of the same region of the blot shown in lane 3). Fig. 9C shows RT-PCR products amplified from
HSG cell mRNA. Primers and RT-PCR conditions are described under
"Experimental Procedures." PCR products were analyzed on 1%
agarose gels as follows. Lane 1, ROMK (HSG cell);
lane 2, SUR1 (HSG cell); lane 3, SUR1 (human pancreas); lane 4,
SUR2A (HSG cell); lane 5, SUR2A (human pancreas);
lane 6, SUR2B (HSG cell); lane 7, SUR2B (human pancreas).
|
|
Further, an antibody against the ROMK protein was used to examine the
presence of this protein in HSG cells. The data are shown in Fig.
9B. Three prominent bands were detected in the plasma membrane fraction of HSG cells with estimated molecular masses of about
49, 47, and 42 kDa. We have not yet identified the higher molecular
weight proteins that react with the antibody, which supposedly
recognizes all isoforms of ROMK. However, the 42-kDa band comigrated
with the control ROMK1 protein (lane 3, ECL
reaction; lane 4, Amido Black staining of the
region of the blot shown in lane 3). Importantly,
this protein was enriched in the plasma membrane fraction
(lane 2) compared with the crude membrane
fraction (lane 1). These data demonstrate for the
first time the presence of the ROMK1 protein in salivary gland cells.
To confirm the presence of ROMK in HSG cells, RT-PCR was performed
using ROMK-specific primers and HSG cell mRNA (Fig. 9C; see "Experimental Procedures" for details). A ~1.2-kilobase
RT-PCR product was strongly detected (lane 1).
Further, when RT-PCR was performed using SUR1-, SUR2A-, or
SUR2B-specific primers, SUR-homologous sequences were not detected in
HSG cell mRNA (lanes 2, 4, and 6). However, as reported earlier (31), SUR1 (lane
3) and SUR2B (lane 7), but not SUR2A
(lane 5), were detected in control human pancreatic mRNA.
One of the suggested criteria for the possible functional association
between the CFTR and ROMK proteins in a cell has been the demonstration
that cAMP can stimulate both Cl and K+
currents in the cells. The data in Fig.
10 show that HSG cells fulfill this
criterion. Inclusion of 10 µM cAMP in the pipette solution stimulated a small inward Cl current (250 ± 34 pA, n = 5, at 60 mV holding potential with 150 mM NMDGCl in the external and internal solutions). The
current developed slowly, remained stable for a short time, and
decreased to a lower level. It was blocked by glibenclamide (data not
shown). These data provide evidence for the presence of a functional
CFTR protein in HSG cells. Fig. 10B shows the activation of
outward K+ current by 10 µM cAMP. The outward
current was of smaller magnitude, and relatively more sustained, than
that seen with ATP. The current also showed a decreased sensitivity
toward glibenclamide (data not shown), as has been previously reported
for the ROMK channels in kidney cells (20).

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 10.
cAMP-stimulated Cl and outward
K+ currents in HSG cells. A,
Cl currents were recorded at a holding potential of 60
mV with 10 µM cAMP in the pipette solution. 145 mM NaCl and 5 mM KCl in the external medium and
150 mM KCl in the pipette solution were replaced with 150 mM NMDGCl. B, K+ currents were
recorded as described for Fig. 1, except that the pipette solution
contained 10 µM cAMP.
|
|
 |
DISCUSSION |
The data presented above demonstrate that ATP activates multiple
P2 receptors to increase [Ca2+]i and activate
distinct cation channels in HSG cells. Importantly, the data provide
evidence that external ATP activates a novel glibenclamide-sensitive,
Ca2+-independent, inwardly rectifying K+
current that is mediated by a KATP channel. Further, we
have shown that a ROMK-like channel and CFTR, but not SUR, are present in HSG cells. Thus, we suggest that this KATP channel
belongs to the ROMK subfamily of KATP channels, which might
be regulated via an interaction with the CFTR. These data reveal a
potentially new mechanism for K+ secretion in salivary
epithelial cells.
P2Y1, P2Y2 (P2U), P2X4,
and P2X7 (P2Z) receptors are expressed in
salivary glands (6). We have shown here that low [ATP] and [UTP]
are equally potent in activating internal Ca2+ release.
Further, the response to low [ATP] was greater than the response to
low [2MeS-ATP] (data not shown). These data suggest the presence of a
P2U receptor in HSG cells and are consistent with previous
studies showing that in HSG cells the P2U receptor has a
nucleotide selectivity in the order ATP = UTP > ADP (14). Additionally, P2U-stimulated depletion of the internal
Ca2+ store resulted in the activation of the store-operated
Ca2+ influx current (ISOC) that was
inhibited by La3+ and Gd3+, but not by
Zn2+. Thus, ISOC activated by ATP
has similar characteristics as that activated by CCh or Tg (Fig. 3-5;
also see Ref. 17). Low (0.1-10 µM) ATP also activated an
outward K+ current with characteristics similar to those
previously reported for KCa in HSG cells (15,
16): (i) inhibition by charybdotoxin, but not by apamin, and (ii)
dependence on [Ca2+]i. Notably, this is the first
report describing ATP-dependent activation of
KCa and ISOC in human submandibular
gland cells. The present data demonstrate that P2Z
receptors are also present in HSG cells. Bz-ATP, a potent
P2Z receptor agonist, induced responses that were distinct
from that induced by either UTP or ATP. Increasing concentrations of
Bz-ATP produced dose-dependent increases in both
[Ca2+]i and the K+ current. At lower
concentrations, Bz-ATP induced increase in [Ca2+]i and KCa in the absence of
external Ca2+. As has been suggested earlier, this could be
due to (i) release of Ca2+ from intracellular stores by
Na+ that might enter the cells when Ca2+ is
removed from the external medium or (ii) stimulation of IP3 generation (6). However, the effects at higher Bz-ATP were acutely
dependent on the presence of external Ca2+ and were more
sensitive to high external Mg2+. These data suggest that
higher [Bz-ATP] induces a Ca2+ influx component that is
apparently not associated with internal Ca2+ store
depletion (Fig. 5, compare A and B with
C and D). 2MeS-ATP did not induce a similar
Ca2+ influx response, even at higher concentrations, while
100 µM ATP induced a small increase in Ca2+
influx, in the absence of external Mg2+. In aggregate,
these data are consistent with the presence of a P2Z
receptor in HSG cells. However, it is unlikely that ATP induces any
significant effects via this receptor in a normal Mg2+-containing medium.
The important, and novel, finding of this study was that high [ATP]
(>10 µM) induced an outward current that was not
accompanied by an increase in [Ca2+]i. We have
shown that the current was detected in cells previously stimulated with
low [ATP] (Fig. 1), Tg (Fig. 4), or CCh (not shown) and was not
affected by the removal of Ca2+ from the external medium
(Fig. 1) or treatment of cells with charybdotoxin. Furthermore, the
current measured in the presence of high [ATP] and charybdotoxin (i)
displayed a weak inward rectification with a reversal potential of 75
mV, a value close to the K+ equilibrium potential, and (ii)
was blocked by replacing intracellular K+ with
Cs+. Taken together, these data provide strong evidence for
the activation of a Ca2+-independent K+ channel
by high [ATP] in HSG cells. Some previous studies with salivary gland
cells have suggested that ATP induces a Ca2+-independent
component of K+ efflux (24, 32). It was suggested that this
component of K+ release could be due to a direct action of
ATP on nonspecific cation channels on the plasma membrane. We have not
yet determined whether ATP activates the Ca2+-independent
K+ channel directly or via binding to an ATP receptor.
However, our data rule out the possibility that the known P2X or P2Y
receptors are involved in the ATP-dependent activation of
the Ca2+-independent, inwardly rectifying, K+
channel. The charybdotoxin-insensitive K+ current was not
activated by 2MeS-ATP, Bz-ATP, UTP, or low [ATP]. Thus, the
Ca2+-independent K+ current appears to be
selectively activated by high [ATP] via a mechanism that is distinct
from that associated with the P2Z or P2U
receptors. Significantly, the sulfonylurea compounds, glibenclamide and
tolbutamide, inhibited the K+ current induced by high
[ATP] but not that induced by low [ATP], in contrast to
charybdotoxin, which inhibited only the current induced by low [ATP].
These data provide evidence for the presence of at least two
pharmacologically distinct K+ channels in HSG cells: a
Ca2+-dependent maxi-K+ channel that
is sensitive to charybdotoxin and an inwardly rectifying K+
channel that is sensitive to sulfonylurea compounds, probably a
KATP channel (20, 21, 25).
Two classes of KATP channels are modulated by sulfonyl urea
compounds: the ROMK channels and the classical KATP
channels (20, 21, 25). Classical KATP channels (Kir 6.0 subfamily) have been shown to be present in pancreatic cells,
cardiac and skeletal myocytes, vascular smooth muscle, and neurons and
are suggested to regulate the electrical activity of these cells (25).
These KATP channels have been shown to be associated with
the sulfonylurea receptors (SUR1, SUR2A, or SUR2B), which confer the
sensitivity to the sulfonylurea compounds (see Ref. 25 for a review).
The ROMK family of KATP channels (Kir 1.1 family) are
expressed in the nephron, where they have been proposed to regulate
K+ secretion (20, 21, 33, 34). In the case of the ROMK
channels, the sensitivity to sulfonylurea compounds has been suggested
to depend on an interaction with the CFTR protein, although conclusive experimental data for a molecular interaction between these two proteins is yet lacking (20, 21, 35). However, several observations are
consistent with this suggestion. For example both the CFTR and the ROMK
proteins were shown to be localized in the apical membrane of the
nephron (33, 34). Co-expression of the ROMK1 protein and CFTR in
oocytes conferred glibenclamide sensitivity to the K+
current (35). Further, cAMP stimulated both the CFTR-associated Cl current and the inwardly rectifying,
glibenclamide-sensitive, K+ current, and cAMP plus ATP
decreased the sensitivity of the K+ channel for
glibenclamide (20).
The present data demonstrate that HSG cells have (i) a
Ca2+-independent, sulfonylurea-sensitive, inwardly
rectifying K+ channel (KATP) activity, (ii) the
ROMK channel and CFTR, and (iii) cAMP-stimulated Cl and
K+ currents. Thus, the KATP activity detected
in HSG cells fulfills the criteria associated with the ROMK family of
KATP channels. Based on measurements of electrolytes in
saliva and 86Rb+ flux studies, it has been
suggested that salivary gland ducts mediate K+ secretion
into the lumen (36). Thus, the currently accepted model for ion fluxes
in the salivary gland ductal cell depicts a pathway for K+
efflux via the apical membrane. However, presently there are no data to
demonstrate the identity or function of this K+
conductance. Based on the data discussed above, we suggest that the
ROMK-type KATP channel detected in HSG cells might be a
likely candidate for this K+ secretory function. Further,
as has been proposed for the regulation of the ROMK channels in kidney
cells, the present data suggest that the ROMK channel in HSG cells
might also be regulated via interaction(s) with the CFTR protein.
Importantly, we have clearly demonstrated that CFTR, but not SUR, is
present in HSG cells. Thus, HSG cells provide an excellent experimental
system for further studies to examine the putative mechanism by which
CFTR regulates the ROMK channel. Notably, the CFTR protein has also
been shown to be present in the luminal membrane of rat submandibular
gland ductal cells (27, 28), and studies reported by Muallem and co-workers have demonstrated cAMP-dependent activation of
CFTR-associated Cl current (i.e.
Ca2+-independent, glibenclamide-sensitive) in rat
submandibular gland ductal cells (7). However, the exact physiological
role of CFTR in the ductal luminal membrane of salivary epithelial
cells is still unclear.
In summary, ATP triggers two distinct Ca2+ signaling
pathways in HSG cells through the P2U and P2Z
receptors, respectively. The Ca2+ signaling pathway linked
to the P2U receptor, is independent of external
Na+ and Mg2+ and is associated with activation
of KCa and SOC. In contrast, the Ca2+ signaling
pathway via the P2z receptor does not appear to be activated by ATP under normal conditions (i.e. with 1 mM external Mg2+). However, it is associated
with Ca2+ influx, probably via an as yet unidentified
Ca2+-permeable cation channel, and activation of
KCa when cells are exposed either to an agonist stronger
than ATP or to ATP in low external [Mg2+]. Importantly,
we have shown here that ATP also activates a novel, Ca2+-independent, weakly inwardly rectifying K+
channel in HSG cells, which is blocked by sulfonylurea compounds but
not by charybdotoxin. Together with our demonstration of the presence
of CFTR, a ROMK channel, and the activation of both Cl
and K+ currents in HSG cells by cAMP, the present data
strongly suggest that this K+ channel belongs to the ROMK
family of KATP channels. This putative salivary ROMK
channel provides a potentially novel mechanism for the regulation of
K+ secretion in salivary epithelial cells.
 |
ACKNOWLEDGEMENTS |
We are grateful to Dr. William Guggino for
providing the CFTR antibody and to Dr. Nelson Arispe for the control
sample of CFTR protein. We thank Dr. J. T. Turner and co-authors
for providing the preprint of a review article (6). We especially thank
Julie Jadlowiec and Dr. Timothy Lockwich for the assistance with the Western blots and acknowledge Dr. Bruce Baum and all of our colleagues for support.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom all correspondence should be addressed: Bldg. 10, Rm.
1N-113, National Institutes of Health, Bethesda, MD 20892. Tel.: 301-496-1478; Fax: 301-402-1228; E-mail:
ambudkar@yoda.nidcr.nih.gov.
 |
ABBREVIATIONS |
The abbreviations used are:
IP3,
inositol 1,4,5-trisphosphate, CCh, carbachol;
CFTR, cystic fibrosis
transmembrane regulator;
HSG, human submandibular gland;
ISOC, store-operated Ca2+ current;
KATP, ATP-sensitive K+ channel;
KCa, Ca2+-activated K+ channel;
Kir, inward rectifier K+ current;
SUR, sulfonylurea
receptor;
Tg, thapsigargin;
PCR, polymerase chain reaction;
RT-PCR, reverse transcriptase-PCR;
Bz-, benzoyl-;
ChTx, charybdotoxin.
 |
REFERENCES |
| 1.
|
Burnstock, G.
(1997)
Neuropharmacology
36,
1127-1139[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Burnstock, G.,
and King, B. F.
(1996)
Drug Dev. Res.
38,
67-71
|
| 3.
|
Dubyak, G. R.,
and El-Moatassim, C.
(1993)
Am. J. Physiol.
265,
C577-C606[Abstract/Free Full Text]
|
| 4.
|
Motte, S.,
Communi, D.,
Pirotton, S.,
and Boeynaems, J-M.
(1995)
Int. J. Biochem. Cell Biol.
27,
1-7[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Chan, C. M.,
Unwin, R. J.,
and Burnstock, G.
(1998)
Exp. Nephrol.
6,
200-207[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
| Turner, J. T., Landon, L. A., Gibbons, S. J., and
Talamo, B. R. (1999) Crit Rev. Oral Biol. Med., in
press
|
| 7.
|
Soltoff, S. P.,
McMillian, M. K.,
and Talamo, B. R.
(1992)
Am. J. Physiol.
262,
C934-C940[Abstract/Free Full Text]
|
| 8.
|
McMillian, M. K.,
Soltoff, S. P.,
Cantley, L. C.,
Rudel, R.,
and Talamo, B. R.
(1993)
Br. J. Pharmacol.
108,
453-461[Medline]
[Order article via Infotrieve]
|
| 9.
|
Fukushi, Y.,
Ozawa, T.,
Kanno, T.,
and Wakui, M.
(1997)
Eur. J. Pharmacol.
336,
89-97[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Zeng, W.,
Lee, M. G.,
and Muallem, S.
(1997)
J. Biol. Chem.
272,
32956-32965[Abstract/Free Full Text]
|
| 11.
|
Lee, M. G.,
Zeng, W.,
and Muallem, S.
(1997)
J. Biol. Chem.
272,
32951-32955[Abstract/Free Full Text]
|
| 12.
|
Xu, X.,
Diaz, J.,
Zhao, H.,
and Muallem, S.
(1996)
J. Physiol. (Lond.)
491,
620-624
|
| 13.
|
Amsallem, H.,
Metioui, M.,
VandenAbeele, A.,
Elyamani, A.,
Moran, A.,
and Dehaye, J. P.
(1996)
Am. J. Physiol.
271,
C1546-C1555[Abstract/Free Full Text]
|
| 14.
|
Yu, H.,
and Turner, J. T.
(1991)
J. Pharmacol. Exper. Ther.
259,
1344-1350[Abstract/Free Full Text]
|
| 15.
|
Izutsu, K. T.,
Fatherazi, S.,
and Wellner, R. B.
(1994)
Am. J. Physiol.
266,
C58-C66[Abstract/Free Full Text]
|
| 16.
|
Liu, X.,
Rojas, S. E.,
and Ambudkar, I. S.
(1998)
Am. J. Physiol.
275,
C571-C580[Abstract/Free Full Text]
|
| 17.
|
Liu, X.,
O'Connell, A.,
and Ambudkar, I. S.
(1998)
J. Biol. Chem.
273,
33295-33304[Abstract/Free Full Text]
|
| 18.
|
He, X.,
Wu, X.,
Turner, R. J.,
and Baum, B. J.
(1990)
J. Membr. Biol.
115,
159-166[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Kurihara, K.,
Nakanishi, N.,
and Ueha, T.
(1997)
Arch. Oral Biol.
42,
547-557[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Ho, K.
(1998)
Curr. Opin. Nephrol. Hypertens.
7,
49-58[Medline]
[Order article via Infotrieve]
|
| 21.
|
Schwiebert, E. M.,
Benos, D. J.,
Egan, M. E.,
Stutts, M. J.,
and Guggino, W. B.
(1999)
Physiol. Rev.
79 (suppl.),
145-161[Abstract/Free Full Text]
|
| 22.
|
Wang, W.,
O'Connell, B.,
Dykeman, R.,
Sakai, T.,
Delporte, C.,
Swaim, W.,
Zhu, X.,
Birnbaumer, L.,
and Ambudkar, I. S.
(1999)
Am. J. Physiol.
276,
C969-C979
|
| 23.
|
Christoffersen, B. C.,
Hug, M. J.,
and Novak, I.
(1998)
Pflugers Arch.
426,
33-39
|
| 24.
|
Tojyo, T.,
Tanimura, A.,
Matsui, S.,
and Matsumoto, Y.
(1997)
Arch. Oral Biol.
42,
393-399[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Quayle, J. M.,
Nelson, M. T.,
and Standen, N. B.
(1997)
Physiol. Rev.
77,
1165-1232[Abstract/Free Full Text]
|
| 26.
|
Trezise, A. E.,
and Buchwald, M.
(1991)
Nature
353,
434-437[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Zeng, W.,
Lee, M. G.,
Yan, M.,
Diaz, J.,
Benjamin, I.,
Marino, C. R.,
Kopito, R.,
Freedman, S.,
Cotton, C.,
and Muallem, S.
(1997)
Am. J. Physiol.
273,
C442-C455[Abstract/Free Full Text]
|
| 28.
|
He, X.,
Tse, C. M.,
Donowitz, M.,
Alper, S. L.,
Gabriel, S. E.,
and Baum, B. J.
(1997)
Pflugers Arch.
433,
260-268[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Sheppard, D. N.,
and Welsh, M. J.
(1999)
Physiol. Rev.
79,
S23-S45
|
| 30.
|
Bradbury, N. A.
(1999)
Physiol. Rev.
79 (suppl.),
175-191[Abstract/Free Full Text]
|
| 31.
|
Isomoto, S.,
Kondo, C.,
Yamada, M.,
Matsumoto, S.,
Higashiguchi, O.,
Horio, Y.,
Matsuzawa, Y.,
and Kurachi, Y.
(1996)
J. Biol. Chem.
271,
24321-24324[Abstract/Free Full Text]
|
| 32.
|
Soltoff, S. P.,
McMillian, M. K.,
Cragoe, E. J., Jr.,
Cantley, L. C.,
and Talamo, B. R.
(1990)
J. Gen. Physiol.
95,
319-346[Abstract/Free Full Text]
|
| 33.
|
Xu, J. Z.,
Hall, A. E.,
Peterson, L. N.,
Bienkowski, J.,
Eessalu, T. E.,
and Hebert, S. C.
(1997)
Am. J. Physiol.
273,
F739-F748
|
| 34.
|
Kohda, Y.,
Ding, W.,
Phan, E.,
Housini, I.,
Wang, J.,
Star, R. A.,
and Huang, C-L.
(1998)
Kidney Int.
54,
1214-1223[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Ruknudin, A.,
Schulze, D. H.,
Sullivan, S. K.,
Lederer, W. J.,
and Welling, P. A.
(1998)
J. Biol. Chem.
273,
14165-14171[Abstract/Free Full Text]
|
| 36.
|
Cook, D. I.,
Dinudom, A.,
Komwatana, P.,
and Young, J. A.
(1998)
Eur. J. Morphol.
36,
67-73
|
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
D. Heitzmann and R. Warth
Physiology and Pathophysiology of Potassium Channels in Gastrointestinal Epithelia
Physiol Rev,
July 1, 2008;
88(3):
1119 - 1182.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Nakamoto, V. G. Romanenko, A. Takahashi, T. Begenisich, and J. E. Melvin
Apical maxi-K (KCa1.1) channels mediate K+ secretion by the mouse submandibular exocrine gland
Am J Physiol Cell Physiol,
March 1, 2008;
294(3):
C810 - C819.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. O. Hernandez-Gonzalez, C. L. Trevino, L. E. Castellano, J. L. de la Vega-Beltran, A. Y. Ocampo, E. Wertheimer, P. E. Visconti, and A. Darszon
Involvement of Cystic Fibrosis Transmembrane Conductance Regulator in Mouse Sperm Capacitation
J. Biol. Chem.,
August 17, 2007;
282(33):
24397 - 24406.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. L. Ong, X. Liu, K. Tsaneva-Atanasova, B. B. Singh, B. C. Bandyopadhyay, W. D. Swaim, J. T. Russell, R. S. Hegde, A. Sherman, and I. S. Ambudkar
Relocalization of STIM1 for Activation of Store-operated Ca2+ Entry Is Determined by the Depletion of Subplasma Membrane Endoplasmic Reticulum Ca2+ Store
J. Biol. Chem.,
April 20, 2007;
282(16):
12176 - 12185.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. E. Krouse, J. F. Talbott, M. M. Lee, N. S. Joo, and J. J. Wine
Acid and base secretion in the Calu-3 model of human serous cells
Am J Physiol Lung Cell Mol Physiol,
December 1, 2004;
287(6):
L1274 - L1283.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Gonzalez-Guerrico, E. G. Cafferata, M. Radrizzani, F. Marcucci, D. Gruenert, O. H. Pivetta, R. R. Favaloro, R. Laguens, S. V. Perrone, G. C. Gallo, et al.
Tyrosine Kinase c-Src Constitutes a Bridge between Cystic Fibrosis Transmembrane Regulator Channel Failure and MUC1 Overexpression in Cystic Fibrosis
J. Biol. Chem.,
May 3, 2002;
277(19):
17239 - 17247.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Choi, L. W. Hammer, and R. L. Hester
Calcium-Dependent Synthesis of Prostacyclin in ATP-Stimulated Venous Endothelial Cells
Hypertension,
February 1, 2002;
39(2):
581 - 585.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Bringmann, T. Pannicke, V. Moll, I. Milenkovic, F. Faude, V. Enzmann, S. Wolf, and A. Reichenbach
Upregulation of P2X7 Receptor Currents in Muller Glial Cells during Proliferative Vitreoretinopathy
Invest. Ophthalmol. Vis. Sci.,
March 1, 2001;
42(3):
860 - 867.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
T. P. Lockwich, X. Liu, B. B. Singh, J. Jadlowiec, S. Weiland, and I. S. Ambudkar
Assembly of Trp1 in a Signaling Complex Associated with Caveolin-Scaffolding Lipid Raft Domains
J. Biol. Chem.,
April 14, 2000;
275(16):
11934 - 11942.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|