|
J Biol Chem, Vol. 274, Issue 37, 26065-26070, September 10, 1999
Energetics and Topology of CzcA, a Cation/Proton Antiporter of
the Resistance-Nodulation-Cell Division Protein Family*
Martina
Goldberg,
Thomas
Pribyl ,
Susanne
Juhnke , and
Dietrich
H.
Nies§
From the Institut für Mikrobiologie, Kurt-Mothes-Str. 3, D-06099 Halle, Germany
 |
ABSTRACT |
The membrane-bound CzcA protein, a member of the
resistance-nodulation-cell division (RND) permease superfamily, is part
of the CzcCB2A complex that mediates heavy metal
resistance in Ralstonia sp. CH34 by an active cation efflux
mechanism driven by cation/proton antiport. CzcA was purified to
homogeneity after expression in Escherichia coli,
reconstituted into proteoliposomes, and the kinetics of heavy metal
transport by CzcA was determined. CzcA is composed of 12 transmembrane
-helices and two large periplasmic domains. Two conserved aspartate
and a glutamate residue in one of these transmembrane spans are
essential for heavy metal resistance and proton/cation antiport but not
for facilitated diffusion of cations. Generalization of the resulting
model for the function of CzcA as a two-channel pump might help to
explain the functions of other RND proteins in bacteria and eukaryotes.
 |
INTRODUCTION |
Multiple drug resistant bacteria poses a threat to man's fight
against infectious diseases. Some multiple drug resistance systems may
detoxify their substrates by transport across the complete cell wall of
Gram-negative bacteria, across cytoplasmic membrane, periplasm, and
outer membrane. These assumed transenvelope transporters are composed
of a pump protein that energizes the transport, in addition to a
membrane fusion and an outer membrane-associated protein (1, 2). The
pump protein may be an ATP-binding cassette transporter (3, 4), a
transporter of the major facilitator superfamily (5), or a
resistance-nodulation-cell division
(RND)1 protein (4, 6, 7). The
archetype of the RND permease superfamily family is CzcA from the
Gram-negative bacterium Ralstonia sp. CH34 (formerly
Alcaligenes eutrophus strain CH34) (8-12).
This bacterium contains at least seven heavy metal resistance
determinants, located either on the bacterial chromosome or on one of
the two indigenous plasmids pMOL28 (163 kilobase pairs) and pMOL30 (238 kb) (8, 13-16). One of them, the czc-determinant of plasmid
pMOL30, mediates inducible resistance to millimolar concentrations of
Co2+, Zn2+, and Cd2+ in strain CH34
(8, 17). The products of the genes czcA, czcB,
and czcC form a membrane-bound protein complex catalyzing an
energy-dependent efflux of these three metal cations (9, 11), probably across the complete envelope. The mechanism of action of
CzcCB2A is that of a proton/cation antiporter, and the Km values of the efflux system for the substrate
heavy metal cations are also in the millimolar range (10).
Although indirect evidence led to the assumption that CzcA is the
central cation/proton antiporter of the CzcCB2A complex (10), this has not been shown directly. This paper demonstrates that
CzcA is a cation/proton antiporter, and develops the model of CzcA as a
two-channel pump based on topology studies and the function of CzcA
mutant proteins. This model sheds some light on other RND proteins
involved in multiple drug resistance of bacteria or with previously
unknown functions in
mammals.2
 |
EXPERIMENTAL PROCEDURES |
Bacterial Strains, Plasmids, and Growth
Conditions--
Ralstonia sp. strain AE104 (14) is a
metal-sensitive, plasmid-free derivative of strain CH34.
Escherichia coli K38(pGP1-2) (19) was used for expression
of czcCBAD derivatives under control of the phage T7
promoter as described (20). Tris-buffered mineral salts medium (14)
containing 2 g/liter sodium gluconate was used for testing metal
resistance and growth of Ralstonia. E. coli was
cultivated in Luria broth (21). Analytical grade salts of
CdCl2·H2O, ZnCl2, and
CoCl2·6 H2O were used to prepare 1 M stock solutions, which were sterilized by filtration.
Solid Tris-buffered medium contained 2 g/liter agar. Minimal inhibitory
concentrations were determined as described (14) using Tris-buffered
mineral salts medium. Protein concentrations were determined using the Bradford method (22), unless otherwise stated.
Genetic Techniques--
Standard molecular genetic techniques
were used (8, 21). Transformation of E. coli strains was
conducted as described previously (8). For expression of
czcCBAD derivatives under control of the lac
promoter in Ralstonia strain AE104, the plasmid pT7-5-derivatives containing the various czc constructs
were cut with EcoRI and XbaI and cloned into the
broad host range plasmid pVDZ'2 (23). The pVDZ'2-derivatives were
transformed into E. coli S17-1 (24) and transferred into
Ralstonia AE104 by conjugation as described (8). For
reporter gene fusions, fusion vector pECD500 (11) and E. coli CC118 were used (25). All fusions were done immediately
downstream of an arginine or lysine residue of CzcA. Activity of
alkaline phosphatase (25) was determined in triplicate as published previously.
Mutations in the czcA gene were constructed using PCR by an
overlap extension method (26) as published previously (11). The 5' part
of the internal 1,034-base pair NheI-MunI
internal fragment of czcA (position 3,489 to 4,523) (9) was
amplified from plasmid pECD110 (9) using a primer corresponding to the sequence at the NheI site (TAGAGGATCCCGAACGGCTAGCGTCGTA,
NheI primer) and a primer corresponding to the mutated
region. These were (mutations underlined)
TCGAAAACAGTGTGAGGCGA for C417S,
TGGCGCGTGCGCAGGAACA for H423R,
AGGAACGCCATGGCCGGC for H427R,
AGGAACACCGTGGCCGGC for H428R,
TCCGAGCGGTTCCGTGAGGT for H439R,
GTGGTGATTGTCGACAACTGTGTG for E415D,
GTGGTGATTGTCCAAAACTGTGTG for E415Q,
GGCGCGCTCAACTTCGGCATC for D402N, and
ATCATCATCAATGGCGCGGTG for D408N. The 3'-part of the 1,034 contained the region from the mutation to the MunI site. These fragments were amplified from pECD110 (9) with primers inverse to
the primers listed above and a MunI region primer
(AAAGGATCCCACGAACAATTGACACC, MunI-primer). After
purification (Wizard PCR preps, Promega, Madison, WI), each pair of PCR
fragments was used as a template in another PCR reaction with the
NheI and MunI primers, which both contained additional BamHI sites at their ends to facilitate cloning.
The resulting DNA fragment was purified, digested with
BamHI, and cloned into pUC19 (27).
All final PCR products were sequenced to verify the exchange and to
check for PCR-mediated unwanted changes. To facilitate the exchange of
the wild type NheI-MunI fragment against the
mutated fragments, the respective fragment from plasmid pECD110 was
first deleted and a kanamycin resistance gene was inserted instead
leading to plasmid pECD451. This was done as published (11). Next, the mutated NheI-MunI fragments were inserted into
pECD451 instead of the kanamycin resistance gene. The resulting
plasmids were verified by restriction endonuclease digestion using
several enzymes, and correct expression of the mutant proteins was
demonstrated by T7 expression (19).
Purification of CzcA--
The czcA gene was
PCR-amplified as an EcoRI-BamHI fragment from
plasmid pECD110 (9) and cloned into the vector pASK3 (Institut für Bioanalytik, Göttingen, Germany) in E. coli
BL21 (Stratagene Europe, Amsterdam, Netherlands). The resulting plasmid
pECD559 was verified by DNA sequencing. For each expression, the
bacterial strain was freshly transformed. E. coli
BL21(pECD559) was cultivated for 16 h at 30 °C and diluted into
1 liter of fresh Luria broth (21). The cultures were cultivated with
shaking at 30 °C until the optical density at 600 nm reached 1.0. CzcA production was induced with 100 µg of anhydrotetracyclin/liter
of medium. The cells were cultivated for an additional 3 h with
shaking at 30 °C and harvested by centrifugation. The pellet was
washed and suspended in 10 ml of buffer W (100 mM Tris-HCl
buffer (pH 8.0), 1 mM EDTA), treated twice with the French
press (SLM Aminco, SOPRA GmbH, Germany; 1,000 psi) in the presence of
protease inhibitor (1 mM phenylmethylsulfonyl fluoride) and
DNase (10 µg/liter), and cell debris was removed by centrifugation
for 15 min at 20,000 × g. The membrane fraction of the
resulting supernatant was harvested by ultracentrifugation (1.5 h,
100,000 × g) and suspended in buffer W at 10 g of
protein/liter (28, 29). CzcA was solubilized from membranes of the
E. coli host using 1 g of
n-dodecyl-maltoside/g of membrane protein and 3.5 g of
L- -phosphatidylcholine, -linoyl- -palmitoyl/liter (stirred for 30 min at 23 °C), and membrane debris was removed (30 min, 100,000 × g). CzcA was purified on a
strep-tactin-Sepharose column (bed volume 1 ml) equilibrated with
buffer W containing 0.1 mM n-dodecyl-maltoside
and 0.2 g of phospholipid/liter. After the column was washed with
12 bed volumes buffer W containing 0.1 mM
n-dodecyl-maltoside and 0.2 g of phospholipid/liter,
CzcA was eluted using buffer W containing 0.1 mM
n-dodecyl-maltoside, 0.2 g of phospholipid/liter, and
2.0 mM desthiobiotin. Aliquots from the different steps of
the purification procedure were loaded on a SDS gel (30).
Reconstitution of CzcA--
Soybean
L- -phosphatidylcholine (type II-S, 17%
phosphatidylcholine) was suspended in Tris buffer (20 mM
Tris-HCl, pH 7.0, 2 mM dithiothreitol,
-D-octylglucoside (15 g/liter)) to yield a lipid
concentration of 10 g/liter. Subsequently,
-D-octylglucoside was removed by dialysis against 20 mM Tris-HCl, pH 7.0, 2 mM dithiothreitol, and
the resulting liposomes were frozen in liquid nitrogen and stored at
80 °C. For reconstitution, the liposomes were thawed and extruded
through a 400-nm filter (31). Triton X-100 (0.45% w/v) was added, and
total solubilization of lipids was determined by measuring changes in
adsorbance at 540 nm (32, 33). Detergent-destabilized liposomes were
mixed with purified CzcA in a 100:1 ratio (w/w) and incubated at room
temperature under gentle agitation for 15 min. Detergent was removed by
adding Bio-Beads SM-2 at a final concentration of 80 mg/ml (34). After
30 min of incubation, Bio-Beads were removed by filtration on glass
silk, and incubation was continued with fresh Bio-Beads for an
additional 30 min at 23 °C, and overnight at 4 °C. The turbid
proteoliposome suspension was dialyzed two times against 20 mM Tris-HCl, pH 7.0, 2 mM dithiothreitol at
4 °C, and concentrated by centrifugation at 300,000 × g for 45 min. For NH4Cl loading, the
proteoliposomes (pellet) were suspended in 4 ml of 20 mM
Tris-HCl buffer, pH 7.0 (containing 0.5 M
NH4Cl) and incubated on ice for 30 min, followed by a
second ultracentrifugation at 300,000 × g for 45 min.
The pellet was suspended in 20 mM Tris-HCl buffer, pH 7.0 (containing 0.5 M NH4Cl). Light scattering
indicated a mean diameter of the resulting proteoliposomes of about 500 nm. This calculates to a liposome volume of 65.4 attoliter, an outer
surface area of 785,000 nm2 and an inner surface area of
736,000 nm2. With a surface area of 0.23 nm2/phospholipid (35), each liposome contained
6.61·106 phospholipids/liposome. With 1 g of CzcA
(116,611 g/mol)/100 g of phospholipids (734 g/mol), about 417 CzcA
proteins should have been present in each proteoliposome. The loaded
proteoliposomes were frozen in liquid nitrogen and stored at
80 °C.
Acridine Orange Fluorescence Quenching--
As published (10,
36), 1 µl of proteoliposomes were diluted into 2 ml of buffer C (10 mM Tris-HCl (pH 8.0), 0.5 M choline chloride, 5 mM MgCl2) containing 2 µM
acridine orange (3,6 bis-dimethylaminoacridine). Acridine orange
fluorescence was measured using an excitation wavelength of 490 nm and
an emission wavelength of 530 nm (SFM25 spectrofluorometer, Kontron,
Zürich, Switzerland) in stirred cuvettes at 24 °C.
Uptake Experiments--
Cation uptake experiments using the
filtration method were performed as described (17, 36) with some
modifications. The NH4Cl-containing proteoliposomes were
diluted into Tris-choline buffer (0.5 M choline chloride,
20 mM Tris (pH 9.0)) to a final volume of 30 µl. After 1 min (5 min in inhibitor experiments), cation uptake was started by the
addition of the radioactive cations 65Zn2+,
57Co2+, or 109Cd2+
(Amersham Pharmacia Biotech, Braunschweig, Germany), and the reaction
mixture was incubated at 30 °C. Samples (5 µl) were filtered through membrane filters (pore size 0.45 µm, Schleicher & Schuell) and rinsed with 0.3 ml of Tris-choline buffer containing 10 mM EDTA and 10 mM Mg2+. The
radioactivity that remained on the membrane filter was determined with
a scintillation counter (LS6500, Beckman, München, Germany). Control liposomes without CzcA were prepared using the same amounts of
phospholipids but no CzcA. To calculate a "mol zinc/mol CzcA" value
with these negative controls, the amount of zinc accumulated by control
liposomes was divided by the CzcA content of the CzcA-containing proteoliposomes in the parallel experiment, which was 0.5 µg/sample. With 417 CzcA molecules/proteoliposome and an internal volume of 65.4 attoliter/proteoliposome, 1 Zn2+/CzcA transported into the
proteoliposome corresponds to an internal zinc concentration
(ci) of 10 µM.
 |
RESULTS |
Purification of CzcA and Its Active Reconstitution into
Proteoliposomes--
CzcA was purified to homogeneity (Fig.
1). The first amino acids of CzcA were
determined as MFE as expected from DNA sequence analysis (9). CzcA was
reconstituted into proteoliposomes, which were incubated in 100 mM Tris-HCl, pH 5.0. At 1 mM Zn2+,
CzcA proteoliposomes accumulated about 70 mol of Zn2+/mol
of CzcA (ci = 0.7 mM) more within the
first 15 s than control liposomes (Fig.
2A). In the following 2 min,
another 100 mol of Zn2+/CzcA (final ci = 1.7 mM) were accumulated, whereas binding of zinc by
control liposomes did not increase with time. The rapid transport of
zinc by CzcA proteoliposomes could be inhibited by 100 µM
of the protonophore FCCP (Fig. 2A) or using Tris buffer, pH
5.0, instead of pH 7.0 for dilution (data not shown). Thus, this rapid
transport was probably driven by the zinc concentration gradient across
the proteoliposome membrane. Increased amounts of CzcA proteoliposomes
led to increased metal transport, but increased amounts of control
liposomes did not (Fig. 2B). Thus, CzcA was functional,
catalyzed a proton-independent fast facilitated diffusion of zinc and a
proton-dependent slower transport of zinc into the
proteoliposomes.

View larger version (139K):
[in this window]
[in a new window]
|
Fig. 1.
Purification of the CzcA protein. An SDS
gel (30) is shown with size markers (lane 1, sizes on the
left), 15 µg of solubilized membrane protein (lane 2),
four wash fractions of the strep-tactin-Sepharose column (lanes
3-6), and finally 2 µg of CzcA as eluted from the
column.
|
|

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 2.
Activity of CzcA-containing
proteoliposomes. A volume of 3 µl of proteoliposomes (3 g of
CzcA/liter) in 100 mM Tris-HCl, pH 5.0, was diluted into
100 mM Tris-HCl buffer, pH 7.0 (panels A and
B), or proteoliposomes charged with 0.5 M
NH4Cl were diluted into choline buffer, pH 9.0 (panels C and D). After 1 or 5 min,
65Zn2+ was added. 5-µl samples (containing
0.5 µg of CzcA each) were filtrated, washed, and used to calculate
the mols of zinc transported into the proteoliposomes per mol of CzcA
(molecular mass of CzcA-strep-tag, 116,611 Da). Control liposomes did
not contain CzcA but were prepared in a parallel fashion, contained the
same amount of phospholipids, and were adjusted to a concentration
giving the same acridine orange fluorescence quench level as CzcA
proteoliposomes. To calculate a "mol of zinc/mol of CzcA" value
with these negative controls, the amount of zinc accumulated by control
liposomes was divided by the CzcA content of the CzcA-containing
proteoliposomes in the parallel experiment, which was 0.5 µg/sample.
Panel A, the uptake of CzcA proteoliposomes ( ) in the
Tris system was compared with CzcA-containing proteoliposomes in the
presence of 100 µM FCCP ( ). After 10-fold dilution, 1 mM of zinc was added after 1 min. The control ( ) were
liposomes without CzcA. Panel B, uptake of zinc (1 mM) by CzcA-containing proteoliposomes diluted 10-fold
( ) or 6-fold ( ). Control liposomes were diluted 10- ( ), 6- ( ), or 2.5-fold ( ). Please note that these data are given in
"nmol of zinc/sample" to show the differences between the various
amounts of proteoliposomes and liposomes. Panel C,
CzcA-containing proteoliposomes ( ) and control liposomes in the
ammonium chloride/choline system ( ). Panel D, uptake of 3 ( ), 1 ( ), or 0.5 mM of zinc ( ). The values
obtained for the liposome control were subtracted from the CzcA
proteoliposome values to yield a zero point.
|
|
To yield a stronger proton gradient, the proteoliposomes were loaded
with 0.5 M NH4Cl; diffusion of NH3
out of the liposome leaves protons inside and generates a proton
gradient. A stable gradient for at least 20 min was shown with acridine
orange fluorescence quenching experiments (data not shown). Ammonium
chloride-charged CzcA proteoliposomes accumulated Zn2+
rapidly (30-fold, Fig. 2C), whereas control liposomes did
not. CzcA-dependent uptake of zinc into ammonium-charged
proteoliposomes could be partially inhibited with 100 µM
FCCP or 500 µM carbonylcyanide m-chlorophenylhydrazone, but neither with 10 µM FCCP nor 50 µM carbonylcyanide
m-chlorophenylhydrazone (data not shown). The high
concentration of uncoupler needed in these experiments might be the
result of the very high concentration of membranes used in the
experiments (Fig. 2).
Kinetics of Cation Transport by CzcA--
Velocity of zinc uptake
was two-fold higher when 3 mM zinc was used as the
substrate instead of 1 mM, however, nearly no uptake was
measured with 0.5 mM zinc (Fig. 2D). The
velocity of zinc transport by CzcA followed a sigmoidal substrate
saturation curve (Fig. 3A). A
Vmax value of 385 s 1 (Table
I) was calculated from the velocities at
10 and 5 mM zinc, and this velocity was used for a Hill
plot (Fig. 3B) yielding a cooperativity constant
n = 2 and a K50 of 6.6 mM (Table I). Concentration higher than 10 mM
gave no significant uptake, probably due to the toxic effect of zinc on
the integrity of the proteoliposomes (data not shown).

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 3.
Kinetics of cation transport by CzcA.
The initial velocity of zinc ( ), cobalt ( ), or cadmium ( , only
in panel A) uptake into CzcA proteoliposomes was determined
and plotted against the substrate concentrations used (panel
A) or in a Hill plot (panel B).
|
|
View this table:
[in this window]
[in a new window]
|
Table I
Heavy metal cation transport by CzcA
The velocity of metal cation uptake was determined for all three
metals. For zinc and cobalt, the substrate saturation curve was
sigmoidal. For zinc, the Vmax was determined using
the velocities at 5 and 10 mM; for cobalt, it was the
velocity at 50 mM. Higher concentrations of either metal
inactivated the proteoliposomes. With this Vmax
value, a Hill plot using the equation ln(V/Vmax V) = n · ln S n · ln K50 was performed yielding
the resulting values. For cadmium, concentration higher than 5 mM inactivated the proteoliposomes, and no significant
transport could be measured with concentrations lower than 1 mM. Within this range of concentrations, the
Lineweaver-Burk plot was linear and yielded the listed
Km and Vmax values.
|
|
Cobalt transport by CzcA was much slower than zinc transport. To
measure any significant transport, 1.5 µl of proteoliposomes instead
of 0.3 µl had to be used, and the cobalt concentration had to be
raised to 10 mM (Fig.
4A). The substrate saturation of cobalt transport by CzcA was again sigmoidal (Fig. 3A),
and, due to a toxic effect, no uptake was detectable at concentrations higher than 50 mM. Using the velocity measured at 50 mM, a Hill plot was performed (Fig. 3B) yielding
n = 2 and a K50 of 18.5 mM (Table I). Cadmium transport by CzcA was even slower
than cobalt uptake (Fig. 4B). No uptake could be detected at
concentrations lower than 1 mM or higher than 5 mM. In this narrow range of substrate concentration (Fig.
3A), a Lineweaver-Burk plot was linear and yielded a
Vmax of 28 s 1 and a
Km of 7.7 mM (Table I).

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 4.
Transport of cobalt and cadmium by CzcA.
Panel A gives the uptake of 10 mM
57Co2+ into CzcA proteoliposomes (3 µg
CzcA/µl) ( ) and into control liposomes ( ); panel B
gives the uptake of 1 mM
109Cd2+.
|
|
Topology of CzcA and Aminoacyl Residues Essential for Cation/Proton
Antiport--
Computer predictions (data not shown) indicated 12 hydrophobic peaks in the amino acid sequence of CzcA, which might
resemble membrane-spanning -helices (TMHs), and two large
hydrophilic regions between TMH I/II and TMH VII/VIII, respectively.
The specific activities of CzcA::PhoA translational fusions
(Table II) gave evidence for (i) a
cytoplasmic location of both termini of CzcA, (ii) a periplasmic
location of both large hydrophilic domains, (iii) the presence of TMHs
I (between N terminus and large hydrophilic domain 1), II, III, IV,
VII, VIII, IX, XI and XII. No fusion could be isolated between TMHs IX
and X, and the low specific activity of the fusion between TMHs V and
VI (position 475) gave no evidence for a periplasmic location of this
region (Table II).
The highly conserved (Fig. 5) aminoacyl
residues Asp-402, Asp-408, and Glu-415 of CzcA were mutated to D402N,
D408N, E415Q, and E415D. The predicted structure of CzcA leaves as
possible metal-binding residues 3 histidine residues and 1 cysteine
residue between TMH IV/V, these were mutated to C417S, H423R, H427R,
and H439R. None of the mutations in the possible metal binding site yielded any decrease in metal resistance, neither on solid medium (Table III) nor in liquid culture (data
not shown). Thus, the residues Cys-417, His-423, His-427, and His-439
alone are not essential for transport of any of the three CzcA
substrate cations Co2+, Zn2+, or
Cd2+. In contrast, mutation to Asn or Gln of the negatively
charged aminoacyl residues in the middle of the transmembrane -helix IV led to a complete loss of metal resistance to each of the three heavy metals (Table III), and not the slightest residual resistance could be observed in liquid culture (data not shown).

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 5.
Conserved amino acid residues in TMH IV of
the RND proteins. Multiple alignments of all CzcA-related protein
sequences in the current data bases were performed (data not shown).
These alignments grouped the RND proteins into a heavy metal subfamily
with a CzcA core and some proteins clustering around the CzcA core, and
into a multiple drug resistance subfamily with an Acr core and some
sequences clustering around this core. The figure gives the conserved
TMH IV of CzcA (Swiss-Prot accession number spP13511), other divalent
heavy metal cation transporters like CnrA and NccA (spP94177, spQ48815,
spQ44586, spP37972), possible monovalent heavy metal cation
transporters like SilA and HelA_ECOLI (gi4155474, gnPIDd1011351,
gi4206630, gi2314494, spP38054), an outgrouping sequence from a
cyanobacterium, SLL0142 (gnPIDd1019295), the Acr outgroup
(gnPIDd1010740, gnPIDd1018802, gi2313726), the Acr core (spP24181,
spP31224, spP37637, spP52002, gi953226, gi1408202, gnPIDe256815,
gi2109271), and another outgrouping sequence from a cyanobacterium,
SLR0454 (gnPIDd1019544). Conserved aspartate and glutamate residues are
shown in bold letters.
|
|
Although the E415Q mutant CzcA protein was not functional, the E415D
protein gave full resistance on solid media (Table III). However, in
liquid culture in the presence of 2.5 mM Co2+,
2.5 mM Zn2+, or 1 mM
Cd2+, an AE104 derivative with the E415D mutation in
czcA grew slower than the respective wild type strain (data
not shown). Thus, the small change in the position of the carboxyl
group of aminoacyl residue 415 of the CzcA protein diminished the
efficiency of heavy metal transport in the respective mutant strain.
CzcA as a Two-channel Pump--
The mutant proteins with defects
in the aspartate residues, CzcA-D402N (pECD557) and CzcA-D408N
(pECD558), were purified like the CzcA wild type protein and
reconstituted into proteoliposomes. When they were compared with the
wild type protein, all three proteins displayed the rapid facilitated
diffusion of zinc (Fig. 6A),
but the mutant proteins were no longer able to catalyze the slower
proton/zinc antiport. To analyze, if the zinc bound in the rapid
reaction was transported into the inside of the proteoliposomes or were
bound at the outside, proteoliposomes with the wild type (data not
shown) and the mutant proteins (Fig. 6B) were incubated for
2 min with 1 mM 65Zn2+, and then an
additional 10 mM of nonradioactive zinc was added. In all
cases, CzcA-containing proteoliposomes accumulated more zinc in this
isotope competition experiment, although the amount of zinc bound by
the control liposomes decreased. Transport of Co2+ and
Cd2+ by wild type and both mutant proteins was not
different (data not shown). Thus, the mutant proteins were still able
to transport metal cations into proteoliposomes but were unable to
catalyze a proton/cation antiport.

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 6.
Zinc transport by CzcA mutant proteins.
Panel A shows the uptake of 1 mM
65Zn into proteoliposomes with CzcA wild type protein ( )
and the D402N ( ) or D408N ( ) mutant proteins. Panel B
shows an isotope competition experiment: proteoliposomes with the
mutant proteins D402N ( ) and D408N ( ) or control liposomes ( )
were incubated with 1 mM 65Zn2+.
After 2 min (arrows), 10 mM of nonradioactive
Zn2+ was added.
|
|
 |
DISCUSSION |
The roughly determined structure of CzcA as N terminus/TMH
I/periplasmic domain 1/TMHs II-VII/periplasmic domain 2/TMHs
VIII-XII/cytoplasmic C terminus fits into the model of a "6+6 spanner
transporter" (37). If two independent channels exist in CzcA, they
may have different functions. The highly conserved "DDE" motif in
one of these channel was essential for CzcA function in vivo
and for proton/cation antiport in vitro but not for
facilitated diffusion of cations. Thus, the DDE channel could form a
charge-relays system (38) with the DDE residues required for proton
transport, whereas the second channel may be a cation channel.
Therefore, the best model to describe the function of CzcA, so far, is
that of a two-channel pump.
In a working model, binding of Zn2+ to a cytoplasmic
metal-binding site of CzcA may trigger proton transport across the
proton channel into the cytoplasm. This could create negative charges in the large periplasmic domains of CzcA. According to calculations using Fick's first law, diffusion of Zn2+ through CzcA
should be far too slow to explain the observed turnover number of CzcA,
thus, these negative charges plus the bound cation could generate an
electrical field that drives the cation through the cation channel to
the periplasm. Finally, the cation should be exchanged for protons from
the periplasm.
Other RND Proteins--
Asp-402 is not conserved (Fig. 5) in the
SilA protein (39) involved in efflux of Ag+, but Asp-408
and Glu-415 are conserved, which may be explained by a
1H+/1Ag+ ratio of transport by this system in
contrast with a ratio of 2 H+/ 1 Zn2+ for CzcA
(10). Therefore, RND proteins with a DE motif like SilA may be involved
in transport of a monovalent cation, and this has been demonstrated for
YbdE from E. coli, which detoxifies Ag+.3
Surprisingly, the Acr-like RND proteins (HAE1 family) (7) contain
another conserved DDE motif in the respective region after TMH IV
(Table II, Fig. 5); however, in contrast to CzcA, Asp-402 is not
conserved, but another Asp at the (CzcA-) position Asp-409.
In Acr proteins, the substrates do not have to carry any charge,
increased hydrophobicity even enhances transport (40). Thus, although
the conserved proton channel suggests that Acr-like RND proteins are
driven by the proton gradient, an electrical field is unlikely to drive
export of substances like toluene, hexadekan, or -lactams with
highly hydrophobic side chains (41-43). In Acr-like proteins,
protonation/deprotonation may switch a periplasmic substrate-binding
site between a hydrophilic and a hydrophobic character. If a
hydrophobic substrate is bound to this site, it may be driven off into
the periplasm when the site becomes hydrophilic as a consequence of protonation.
Some other bacterial proteins are related to RND proteins or even
members of this family.2 SecD is involved in protein export
and seems to catalyze the release of the transported preprotein portion
from the Sec pore. This reaction is also proton-dependent
(44, 45). Because SecD is related to the proposed proton channel of RND
proteins (7), the SecD result supports the reaction mechanism proposed
above. Moreover, some proteins in eukaryotes may also be RND
members,2 therefore, they may catalyze comparable
reactions. The Niemann-Pick disease C1-protein NPC1_MAN seems to be
a lysosomal cholesterol transporter (46-48), and should be
proton-driven. Members of the patched gene regulator family are
involved in a signal transduction chain of the hedgehog developmental
signal (18, 49-51); these proteins should be proton-driven
transporters too. The homology to NPC1_MAN suggests a function as a
cholesterol transporter. Because covalently bound cholesterol is
essential for the activity of the hedgehog protein, release and uptake
of the hedgehog-bound cholesterol might be required to set back the
hedgehog signal.
Thus, the data obtained with the purified and reconstituted CzcA
protein might be of help to understand the function of other RND-related proteins involved in multiple drug resistance and protein
export in bacteria, and of proteins involved in cholesterol metabolism,
development and cancer generation in mammals.
 |
ACKNOWLEDGEMENTS |
We thank Peter Rücknagel for the
N-terminal sequence of CzcA, Sabine Meyenburg and Rainer Rudolph for
doing the light scattering.
 |
FOOTNOTES |
*
This work was supported by the Fonds der Chemischen
Industrie, by Forschungsmittel des Landes Sachsen-Anhalt
(Transportverbund) and by Grants Ni-262/2, Ni-262/3-1 and
Graduiertenkolleg "Transport" of the Deutsche
Forschungsgemeinschaft.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
These authors contributed equally to this study.
§
To whom correspondence should be addressed: Tel.:
49-345-5526352; Fax: 49-345-5527010; E-mail:
d.nies@mikrobiologie.uni-halle.de.
2
T.-T. Tseng, K. S. Gratwick, D. H. Nies, A. Goffeau, and M. H. J. Saier, submitted for publication.
3
S. Franke, G. Grass, and D. H. Nies,
unpublished observations.
 |
ABBREVIATIONS |
The abbreviations used are:
RND, resistance-nodulation-cell division;
PCR, polymerase chain reaction;
TMH, transmembrane helix;
FCCP, carbonyl cyanide
p-trifluoromethoxyphenyl hydrozone.
 |
REFERENCES |
| 1.
|
Nikaido, H.
(1996)
J. Bacteriol.
178,
5853-5859[Free Full Text]
|
| 2.
|
Paulsen, I. T.,
Brown, M. H.,
and Skurray, R. D.
(1996)
Microbiol. Rev.
60,
575-608[Abstract/Free Full Text]
|
| 3.
|
Fath, M. J.,
and Kolter, R.
(1993)
Microbiol. Rev.
57,
995-1017[Abstract/Free Full Text]
|
| 4.
|
Saier, M. H. J.
(1994)
Microbiol. Rev.
58,
71-93[Abstract/Free Full Text]
|
| 5.
|
Paulsen, I. T.,
Park, J. H.,
Choi, P. S.,
and Saier, M. H. J.
(1997)
FEMS Microbiol. Lett.
156,
1-8[Medline]
[Order article via Infotrieve]
|
| 6.
|
Saier, M. H.,
Tam, R.,
Reizer, A.,
and Reizer, J.
(1994)
Mol. Microbiol.
11,
841-847[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Tseng, T.-T.,
Gratwick, K. S.,
Kollman, J.,
Park, D.,
Nies, D. H.,
Goffeau, A.,
and Saier, M. H. J.
(1999)
J. Mol. Microbiol. Biotechnol.
1,
22, 258-268
|
| 8.
|
Nies, D.,
Mergeay, M.,
Friedrich, B.,
and Schlegel, H. G.
(1987)
J. Bacteriol.
169,
4865-4868[Abstract/Free Full Text]
|
| 9.
|
Nies, D. H.,
Nies, A.,
Chu, L.,
and Silver, S.
(1989)
Proc. Natl. Acad. Sci. U. S. A.
86,
7351-7355[Abstract/Free Full Text]
|
| 10.
|
Nies, D. H.
(1995)
J. Bacteriol.
177,
2707-2712[Abstract/Free Full Text]
|
| 11.
|
Rensing, C.,
Pribyl, T.,
and Nies, D. H.
(1997)
J. Bacteriol.
179,
6871-6879[Abstract/Free Full Text]
|
| 12.
|
Brim, H.,
Heyndrickx, M.,
De Vos, P.,
Wilmotte, A.,
Springael, D.,
Schlegel, H. G.,
and Mergeay, M.
(1999)
Syst. Appl. Microbiol.
22,
258-268[Medline]
[Order article via Infotrieve]
|
| 13.
|
Taghavi, S.,
Mergeay, M.,
and Van der Lelie, D.
(1997)
Plasmid
37,
22-34[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Mergeay, M.,
Nies, D.,
Schlegel, H. G.,
Gerits, J.,
Charles, P.,
and van Gijsegem, F.
(1985)
J. Bacteriol.
162,
328-334[Abstract/Free Full Text]
|
| 15.
|
Dressler, C.,
Kües, U.,
Nies, D. H.,
and Friedrich, B.
(1991)
Appl. Environ. Microbiol.
57,
3079-3085[Abstract/Free Full Text]
|
| 16.
|
Nies, A.,
Nies, D. H.,
and Silver, S.
(1990)
J. Biol. Chem.
265,
5648-5653[Abstract/Free Full Text]
|
| 17.
|
Nies, D. H.,
and Silver, S.
(1989)
J. Bacteriol.
171,
896-900[Abstract/Free Full Text]
|
| 18.
|
Alcedo, J.,
and Noll, M.
(1997)
Biol. Chem.
378,
583-590[Medline]
[Order article via Infotrieve]
|
| 19.
|
Tabor, S.,
and Richardson, C. C.
(1985)
Proc. Natl. Acad. Sci. U. S. A.
82,
1074-1078[Abstract/Free Full Text]
|
| 20.
|
Nies, A.,
Nies, D. H.,
and Silver, S.
(1989)
J. Bacteriol.
171,
5065-5070[Abstract/Free Full Text]
|
| 21.
|
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual
, 2nd. Ed.
, Cold Spring Harbor Laboratory., Cold Spring Harbor, NY
|
| 22.
|
Bradford, M. M.
(1976)
Anal. Biochem.
72,
248-254[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Deretic, V.,
Chandrasekharappa, S.,
Gill, J. F.,
Chatterjee, D. K.,
and Chakrabarty, A.
(1987)
Gene
57,
61-72[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Simon, R.,
Priefer, U.,
and Pühler, A.
(1983)
Bio/Technology
1,
784-791[CrossRef]
|
| 25.
|
Manoil, C.
(1990)
J. Bacteriol.
172,
1035-1042[Abstract/Free Full Text]
|
| 26.
|
Mikaelian, I.,
and Sergeant, A.
(1992)
Nucleic Acids Res.
20,
376[Free Full Text]
|
| 27.
|
Yanisch-Perron, C.,
Vieira, J.,
and Messing, J.
(1985)
Gene
33,
103-119[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Lowry, O. H.,
Rosebrough, N. J.,
Farr, A. L.,
and Randall, R. J.
(1951)
J. Biol. Chem.
193,
265-275[Free Full Text]
|
| 29.
|
Bensadown, A.,
and Weinstein, D.
(1976)
Anal. Biochem.
70,
241-250[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Laemmli, U. K.
(1970)
Nature
227,
680-685[CrossRef][Medline]
[Order article via Infotrieve]
|
| 31.
|
Mayer, L. D.,
Hope, M. J.,
and Cullis, P. R.
(1986)
Biochim. Biophys. Acta
858,
161-168[Medline]
[Order article via Infotrieve]
|
| 32.
|
Rigaud, J.-L.,
and Pitard, B.
(1995)
in
Liposomes as Tools in Basic Research and Industy
(Philippot, J. R.
, and Schuber, F., eds)
, pp. 71-88, CRC Press, Inc., Boca Raton, FL
|
| 33.
|
Jung, H.,
Tebbe, S.,
Schmid, R.,
and Junk, K.
(1998)
Biochemistry
37,
11083-11088[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Holloway, P. W.
(1973)
Anal. Biochem.
53,
304-308[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Small, D.,
and Zoeller, R. A.
(1996)
in
Encyclopedia of Molecular Biology and Molecular Medicine
(Meyer, R. A., ed), Vol. 3
, pp. 442-462, VCH Verlagsgesellschaft mbH, Weinheim, Germany
|
| 36.
|
Rosen, B. P.
(1986)
Methods Enzymol.
125,
328-336[Medline]
[Order article via Infotrieve]
|
| 37.
|
Nikaido, H.,
and Saier, M. H., Jr.
(1992)
Science
258,
936-942[Abstract/Free Full Text]
|
| 38.
|
Kaback, H. R.,
Voss, J.,
and Wu, J.
(1997)
Curr. Opin. Struct. Biol.
7,
537-542[CrossRef][Medline]
[Order article via Infotrieve]
|
| 39.
|
Gupta, A.,
Matsui, K.,
Lo, J. F.,
and Silver, S.
(1999)
Nat. Med.
5,
183-188[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Nikaido, H.,
Basina, M.,
Nguyen, V.,
and Rosenberg, E. Y.
(1998)
J. Bacteriol.
180,
4686-4692[Abstract/Free Full Text]
|
| 41.
|
Li, X. Z.,
Zhang, L.,
and Poole, K.
(1998)
J. Bacteriol.
180,
2987-2991[Abstract/Free Full Text]
|
| 42.
|
Ramos, J. L.,
Duque, E.,
Godoy, P.,
and Segura, A.
(1998)
J. Bacteriol.
180,
3323-3329[Abstract/Free Full Text]
|
| 43.
|
Kieboom, J.,
Dennis, J. J.,
Zylstra, G. J.,
and de Bont, J. A. M.
(1998)
J. Bacteriol.
180,
6769-6772[Abstract/Free Full Text]
|
| 44.
|
Duong, F.,
and Wickner, W.
(1997)
EMBO J.
16,
4871-4879[CrossRef][Medline]
[Order article via Infotrieve]
|
| 45.
|
Duong, F.,
and Wickner, W.
(1997)
EMBO J.
16,
2756-2768[CrossRef][Medline]
[Order article via Infotrieve]
|
| 46.
|
Lange, Y.,
Ye, J.,
and Steck, T. L.
(1998)
J. Biol. Chem.
273,
18915-18922[Abstract/Free Full Text]
|
| 47.
|
Lange, Y.,
and Steck, T. L.
(1998)
Curr. Opin. Struct. Biol.
8,
435-439[CrossRef][Medline]
[Order article via Infotrieve]
|
| 48.
|
Carstea, E. D.,
Morris, J. A.,
Coleman, K. G.,
Loftus, S. K.,
Zhang, D.,
Cummings, C.,
Gu, J.,
Rosenfeld, M. A.,
Pavan, W. J.,
Krizman, D. B.,
Nagle, J.,
Polymeropoulos, M. H.,
Sturley, S. L.,
Ioannou, Y. A.,
Higgins, M. E.,
Comly, M.,
Cooney, A.,
Brown, A.,
Kaneski, C. R.,
Blanchette Mackie, E. J.,
Dwyer, N. K.,
Neufeld, E. B.,
Chang, T. Y.,
Liscum, L.,
Tagle, D. A.,
et al..
(1997)
Science
277,
228-231[Abstract/Free Full Text]
|
| 49.
|
Cooper, M. K.,
Porter, J. A.,
Young, K. E.,
and Beachy, P. A.
(1998)
Science
280,
1603-1607[Abstract/Free Full Text]
|
| 50.
|
Pennisi, E.
(1996)
Science
272,
1583-1584[Medline]
[Order article via Infotrieve]
|
| 51.
|
Marigo, V.,
Johnson, R. L.,
Vortkamp, A.,
and Tabin, C. J.
(1996)
Dev. Biol.
180,
273-283[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
K. Nagano and H. Nikaido
Kinetic behavior of the major multidrug efflux pump AcrB of Escherichia coli
PNAS,
April 7, 2009;
106(14):
5854 - 5858.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A.-C. M. Toes, M. H. Daleke, J. G. Kuenen, and G. Muyzer
Expression of copA and cusA in Shewanella during copper stress
Microbiology,
September 1, 2008;
154(9):
2709 - 2718.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Thilakaraj, K. Raghunathan, S. Anishetty, and G. Pennathur
In silico identification of putative metal binding motifs
Bioinformatics,
February 1, 2007;
23(3):
267 - 271.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. M. Teitzel, A. Geddie, S. K. De Long, M. J. Kirisits, M. Whiteley, and M. R. Parsek
Survival and Growth in the Presence of Elevated Copper: Transcriptional Profiling of Copper-Stressed Pseudomonas aeruginosa.
J. Bacteriol.,
October 1, 2006;
188(20):
7242 - 7256.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Takatsuka and H. Nikaido
Threonine-978 in the Transmembrane Segment of the Multidrug Efflux Pump AcrB of Escherichia coli Is Crucial for Drug Transport as a Probable Component of the Proton Relay Network.
J. Bacteriol.,
October 1, 2006;
188(20):
7284 - 7289.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Domenech, M. B. Reed, and C. E. Barry III
Contribution of the Mycobacterium tuberculosis MmpL Protein Family to Virulence and Drug Resistance
Infect. Immun.,
June 1, 2005;
73(6):
3492 - 3501.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. A. Methe, J. Webster, K. Nevin, J. Butler, and D. R. Lovley
DNA Microarray Analysis of Nitrogen Fixation and Fe(III) Reduction in Geobacter sulfurreducens
Appl. Envir. Microbiol.,
May 1, 2005;
71(5):
2530 - 2538.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Lomovskaya and M. Totrov
Vacuuming the Periplasm
J. Bacteriol.,
March 15, 2005;
187(6):
1879 - 1883.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. R. Aires and H. Nikaido
Aminoglycosides Are Captured from both Periplasm and Cytoplasm by the AcrD Multidrug Efflux Transporter of Escherichia coli
J. Bacteriol.,
March 15, 2005;
187(6):
1923 - 1929.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Munkelt, G. Grass, and D. H. Nies
The Chromosomally Encoded Cation Diffusion Facilitator Proteins DmeF and FieF from Wautersia metallidurans CH34 Are Transporters of Broad Metal Specificity
J. Bacteriol.,
December 1, 2004;
186(23):
8036 - 8043.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Anton, A. Weltrowski, C. J. Haney, S. Franke, G. Grass, C. Rensing, and D. H. Nies
Characteristics of Zinc Transport by Two Bacterial Cation Diffusion Facilitators from Ralstonia metallidurans CH34 and Escherichia coli
J. Bacteriol.,
November 15, 2004;
186(22):
7499 - 7507.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Legatzki, G. Grass, A. Anton, C. Rensing, and D. H. Nies
Interplay of the Czc System and Two P-Type ATPases in Conferring Metal Resistance to Ralstonia metallidurans
J. Bacteriol.,
August 1, 2003;
185(15):
4354 - 4361.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Franke, G. Grass, C. Rensing, and D. H. Nies
Molecular Analysis of the Copper-Transporting Efflux System CusCFBA of Escherichia coli
J. Bacteriol.,
July 1, 2003;
185(13):
3804 - 3812.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Shigaki, J. K. Pittman, and K. D. Hirschi
Manganese Specificity Determinants in the Arabidopsis Metal/H+ Antiporter CAX2
J. Biol. Chem.,
February 14, 2003;
278(8):
6610 - 6617.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. R. Aires, J.-C. Pechere, C. Van Delden, and T. Kohler
Amino Acid Residues Essential for Function of the MexF Efflux Pump Protein of Pseudomonas aeruginosa
Antimicrob. Agents Chemother.,
July 1, 2002;
46(7):
2169 - 2173.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Nishino and A. Yamaguchi
Analysis of a Complete Library of Putative Drug Transporter Genes in Escherichia coli
J. Bacteriol.,
October 15, 2001;
183(20):
5803 - 5812.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Grass, B. Fan, B. P. Rosen, K. Lemke, H.-G. Schlegel, and C. Rensing
NreB from Achromobacter xylosoxidans 31A Is a Nickel-Induced Transporter Conferring Nickel Resistance
J. Bacteriol.,
May 1, 2001;
183(9):
2803 - 2807.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
S. Franke, G. Grass, and D. H. Nies
The product of the ybdE gene of the Escherichia coli chromosome is involved in detoxification of silver ions
Microbiology,
April 1, 2001;
147(4):
965 - 972.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
G. Grass and C. Rensing
Genes Involved in Copper Homeostasis in Escherichia coli
J. Bacteriol.,
March 15, 2001;
183(6):
2145 - 2147.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
L. Guan and T. Nakae
Identification of Essential Charged Residues in Transmembrane Segments of the Multidrug Transporter MexB of Pseudomonas aeruginosa
J. Bacteriol.,
March 1, 2001;
183(5):
1734 - 1739.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
G. P. Munson, D. L. Lam, F. W. Outten, and T. V. O'Halloran
Identification of a Copper-Responsive Two-Component System on the Chromosome of Escherichia coli K-12
J. Bacteriol.,
October 15, 2000;
182(20):
5864 - 5871.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
G. Grass, C. Große, and D. H. Nies
Regulation of the cnr Cobalt and Nickel Resistance Determinant from Ralstonia sp. Strain CH34
J. Bacteriol.,
March 1, 2000;
182(5):
1390 - 1398.
[Abstract]
[Full Text]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|