|
J Biol Chem, Vol. 274, Issue 37, 26085-26090, September 10, 1999
A 12-Amino Acid Stretch in the Hypervariable Region of the
Spike Protein S1 Subunit Is Critical for Cell Fusion Activity of Mouse
Hepatitis Virus*
Chang-Wu
Tsai §,
Shin C.
Chang¶, and
Ming-Fu
Chang
From the Institutes of Biochemistry and
¶ Microbiology and the § Laboratory Animal Center,
College of Medicine, National Taiwan University,
Taipei 100, Taiwan
 |
ABSTRACT |
The spike (S) glycoprotein of mouse hepatitis
virus (MHV) plays a major role in the viral pathogenesis. It is often
processed into the N-terminal S1 and the C-terminal S2 subunits that
were evidently important for binding to cell receptor and inducing cell-cell fusion, respectively. As a consequence of cell-cell fusion,
most of the naturally occurring infections of MHV are associated with
syncytia formation. So far, only MHV-2 was identified to be
fusion-negative. In this study, the S gene of MHV-2 was molecularly
cloned, and the nucleotide sequence was determined. The MHV-2 S protein
lacks a 12-amino acid stretch in the S1 hypervariable region from amino
acid residue 446 to 457 when compared with the fusion-positive strain
MHV-JHM. In addition, there are three amino acid substitutions in the
S2 subunit, Tyr-1144 to Asp, Glu-1165 to Asp, and Arg-1209 to Lys. The
cloned MHV-2 S protein exhibited the fusion-negative property in DBT
cells as the intrinsic viral protein. Furthermore, similar to the
fusion-positive MHV-JHM strain, proteolytic cleavage activity was
detected both in DBT cells infected with the fusion-negative MHV-2 and
in the transfected cells that expressed the cloned MHV-2 S protein.
Domain swapping experiments demonstrated that the 12-amino acid stretch
missing in the MHV-2 S1 subunit, but not the proteolytic cleavage site,
was critical for the cell-fusion activity of MHV.
 |
INTRODUCTION |
Mouse hepatitis virus
(MHV)1 is a member of the
Coronaviridae family that causes inapparent enteric and
respiratory infection, hepatitis, and acute and chronic demyelinating
diseases of the central nervous system (1). It is an enveloped virus
that contains a positive sense, single-stranded genomic RNA of
approximately 31 kilobases in length (2, 3). The viral particle
contains four major structural proteins: the nucleocapsid (N) protein
that interacts with the viral genomic RNA and membrane (M) protein to
form a spherical core (4, 5) and the spike (S) and small membrane (E)
proteins that together with the M protein constitute the envelope (6,
7). In some strains of MHV, there exists an additional enveloped
protein, the hemagglutinin esterase (8, 9). The E and M proteins were
demonstrated to be required for virion assembly (5, 10). The S protein
of MHV forms large characteristic projections of coronaviruses and
plays a major role in viral pathogenesis.
The S protein is cotranslationally glycosylated in the endoplasmic
reticulum, giving a molecular mass of approximately 180 kDa, and
trimerized (11). Following a transport through the Golgi apparatus, the
high mannose oligosaccharides are trimmed, and the protein is further
acylated (12). After the modifications, the S protein is often cleaved
by a cellular protease into two noncovalently bound 90-kDa subunits, S1
and S2, derived from the N-terminal and C-terminal halves, respectively
(13, 14). S protein that is not assembled into virions is transported
by the secretory system to the cell surface, where it may participate in inducing fusion between adjacent cells (15). In addition to the
induction of pH independent cell-to-cell fusion, the S protein also
mediates the viral attachment to the receptor of susceptible cells and
is involved in the elicitation of neutralizing antibodies, the tissue
tropism, and the variation of viral pathogenicity (7, 16-21).
The process of S protein-mediated membrane fusion has been intensively
studied, but the mechanism is still poorly understood. Proteolytic
cleavage of the S protein precursor into the S1 and S2 subunits was
thought to be a prerequisite for the virus to induce cell fusion (14);
cell fusion activity correlated with the cleavage level of S protein.
The cleavage site was located at the C terminus of the amino acid
sequence RRARR in the middle of the S protein (22). Nevertheless,
mutations at the cleavage site did not completely abolish the cell
fusion activity (23-26). Although the S2 subunit appeared to be
responsible for the cell fusion activity of MHV spike protein (27, 28),
both S1 and S2 subunits were suggested to be correlated with the cell
fusion activity and viral infectivity (29, 30).
There is considerable polymorphism in both the length and nucleotide
sequence of the S1 subunit that possibly resulted from mutation and
recombination (31-33). Several neuroattenuated variants of MHV-JHM
have been isolated. Deletions and mutations in the hypervariable region
of the S1 subunit of the variants were demonstrated to be associated
with altered antigenicity and virulence (18, 33, 34). Studies performed
by infection of cultured cells demonstrated that most of the MHV
strains identified so far are capable of inducing membrane fusion
between infected and uninfected cells, resulting in multinucleated
polykaryons (syncytia) (2, 35). Among the identified naturally
occurring strain of MHV, MHV-2 is the only one that cannot induce
syncytia (36). Although MHV-2 lacks the cell fusion activity, it causes
fulminant hepatitis in mice (37).
To examine the cell fusion activity of MHV in cultured DBT cells, a
recombinant vaccinia virus that encodes the T7 RNA polymerase (38)
and a recombinant plasmid containing the cDNA of MHV S protein
driven by the promoter of T7 RNA polymerase were used in this study. We
found that the 12-amino acid stretch from residue 446 to 457 of the
MHV-JHM was important for the cell fusion activity. In addition, the S
protein of MHV-2 was capable of undergoing proteolytic cleavage, but it
lost the ability to induce cell-cell fusion.
 |
EXPERIMENTAL PROCEDURES |
Cell Line and Viruses
The DBT cell line was derived from a Schmidt-Ruppin Rous Sarcoma
virus-induced murine astrocytoma (39) and was maintained as monolayer
culture in Eagle's minimal essential medium (Life Technologies, Inc.)
supplemented with 10% heat-inactivated fetal bovine serum, 10%
tryptose phosphate broth (Difco), and 0.06 mg/ml kanamycin. MHV-JHM and
MHV-2 were kindly provided by Dr. Fujiwara (University of Tokyo) and
were propagated on DBT cells.
Virus Titration
Virus titers were determined by plaquing on DBT cells using the
following procedures. Viruses were serially diluted and layered over
DBT cells grown on 60-mm Petri dishes to allow adsorption for 90 min at
37 °C. Five milliliters of overlay medium containing Eagle's
minimum essential medium, 5% calf serum, 10% tryptose phosphate
broth, and 1% Bacto-agar were then added, and the cultures were
incubated at 37 °C for 36 h. Following an addition of 3 ml of
staining solution (1% Bacto-agar and 0.4 mg/ml neutral red) and
incubation for 6-8 h, plaques were counted. Virus titer was expressed
in plaque-forming units.
Virus Purification
Virus was propagated on DBT cells and purified as described
previously (40) with modifications. Briefly, cultured DBT cells were
infected with MHV-JHM or MHV-2 at a multiplicity of infection of 25 plaque-forming units/cell and maintained at 37 °C for 16 h.
Virus particles released into the cultured medium were collected, and
cell debris was clarified by centrifugation for 30 min at 8000 rpm in a
JA-14 rotor (Beckman). Viruses in the supernatant were precipitated
with 50% saturated ammonium sulfate at 4 °C for 1.5 h followed
by centrifugation at 8000 rpm for 30 min. The virus pellets were
resuspended in NTE buffer (100 mM NaCl, 10 mM
Tris-HCl, pH 7.2, and 1 mM EDTA), and the suspensions were further centrifuged at 2000 rpm for 10 min in the same rotor. The
supernatants that contain the virus particles were collected and
subjected to two rounds of discontinuous sucrose gradient consisting of
20, 30, 50, and 60% sucrose in NTE buffer at 26,000 rpm for 3.5 h
in an SW28 rotor (Beckman) at 4 °C. Viral particles that formed a
band at the interface of 30 and 50% sucrose layers were harvested and
pelleted by centrifugation at 40,000 rpm for 1.5 h in an SW41
rotor (Beckman). The virus pellets were resuspended in NTE buffer.
Viral RNA Isolation and cDNA Cloning
To obtain double-stranded cDNA of the S gene of MHV-2,
genomic RNA was isolated from sucrose gradient-purified viral particles by the acid guanidinum thiocyanate/phenol/chloroform extraction method
(41). Complementary DNA synthesis was performed with avian
myeloblastosis virus reverse transcriptase and DNA polymerase I as
described by the manufacturer (Roche Molecular Biochemicals). In
addition, the MHV-specific oligonucleotide primer
3732TCTTTCCAGGAGAGGCTGTGATAG 3709
(nucleotides (nt) are numbered as described by Schmidt et
al. (42) but starting from the translational initiation site, and the letters indicate sequences of the complementary strand) was
used in the reverse transcriptase reaction. Following the second-stranded cDNA synthesis, HindIII linkers were
ligated to the ends of the double-stranded cDNAs. The resultant
cDNAs were then treated with HindIII restriction
endonuclease and inserted into a modified pGEM-4Z vector (Promega) that
had been treated with HindIII restriction endonuclease and
calf intestine alkaline phosphatase. These generated a cDNA library
of the MHV-2 S gene.
DNA Sequence Analysis
The complete sequence of the MHV-2 S gene was determined by
analyzing its cDNA clones with Sequenase (U.S. Biochemical Corp.) and primers SP6 (5'-GATTTAGGTGACACTATA-3') and T7
(5'-TAATACGACTCACTATAG-3') following the dideoxy chain termination
method (43). In addition, all of the plasmids described below were
sequenced across the ligating junctions of DNA fragments to confirm the
accuracy of cloning.
Plasmids
Plasmid pCS-dl--
Plasmid pCS-dl contains the full-length
coding region of the JHM-DL S gene inserted into the MscI
site of pCITE-4a(+) vector (Novagen). It was reconstructed from three
overlapping cDNA clones, pTS-n, pTS-m, and pTS-c, generously
provided by Dr. Michael M. C. Lai at the University of Southern California.
Plasmids pCS-j and pGEM-j-(1125-2042)--
For construction of
plasmid pCS-j, which contains the full-length coding region of the
MHV-JHM S gene, plasmid pGEM-j-(1125-2042) was first generated.
Plasmid pGEM-j-(1125-2042) bears the MHV-JHM-specific region of the S
gene from nt 1125 to 2042 inserted into the SmaI site of
pGEM-4Z vector (Promega). The partial cDNA fragment was obtained
from MHV-JHM genomic RNA by reverse transcriptase-polymerase chain
reaction with the primer
2100CTGCTGTCTGCATGCAGC 2083 and the
amplification primer set
1125TGATGCGTCCAAAGTG1140 and
2042TTGGGAGCCCTTATCTG 2026. Plasmid pCS-j
was then generated from plasmid pCS-dl by replacing its 680-base pair
BspEI-ClaI fragment with the cognate cDNA
fragment of pGEM-j-(1125-2042).
Plasmid pCS-m2--
Plasmid pCS-m2 contains the full-length
coding region of the MHV-2 S gene inserted into the MscI
site of pCITE-4a(+) vector. For construction of plasmid pCS-m2, seven
overlapping cDNA clones were selected from the cDNA library of
MHV-2 S gene generated in this study.
Plasmids pCS-j/m2 and pCS-m2/j--
Plasmid PCS-j/m2 was
generated from pCS-j by replacing its 680-base pair
BspEI-ClaI fragment with the cognate fragment of pCS-m2. Plasmid pCS-m2/j was generated from pCS-m2 by replacing its
644-base pair BspEI-ClaI fragment with the
cognate fragment of pCS-j. Both plasmids were constructed for
performing domain swapping experiments.
Plasmid pES-e/p--
For construction of plasmid pES-e/p, a
539-base pair EcoRI-PstI fragment was obtained
from pTS-m that contains the middle region of the JHM-DL S gene. The
DNA fragment was blunted with the Klenow fragment of DNA polymerase I
and inserted into a modified pET-15b expression vector (Novagen) that
had been treated with NdeI restriction endonuclease and the
Klenow fragment of DNA polymerase I. Plasmid pES-e/p encodes a
His-tagged MHV S2 subunit from amino acid residue 45 to 223 with a
predicted molecular size of 22 kDa, designated S2-(45-223). The His
tag facilitated purification of the recombinant S2-(45-223) protein
by Ni2+-chelating affinity chromatography (44).
Plasmid pGEM-A59--
Plasmid pGEM-A59 contains the full-length
coding region of the MHV-A59 S gene inserted into the SmaI
site of pGEM-3Z vector and was kindly provided by Dr. Michael M. C. Lai.
Production of His-tagged MHV S Protein and Generation of the
S Protein-specific Antisera
For generation of antisera against MHV S protein, the His-tagged
recombinant S2-(45-223) protein was produced by transforming Escherichia coli BL21(DE3) (45) with plasmid pES-e/p.
Expression and purification of the recombinant protein were performed
essentially according to the procedures described by the manufacturer
(Novagen). The
isopropyl-1-thio- -D-galactopyranoside-induced
recombinant S2-(45-223) protein was found to be present in the
insoluble fraction (data not shown). To obtain the recombinant S
protein, cell pellet was resuspended in a 50 mM sodium
phosphate buffer (pH 8.0) containing 30 mM NaCl and 6 M urea and further purified on
Ni2+-nitrilotriacetic acid resin following the procedures
as described by the manufacturer (Amersham Pharmacia Biotech). The
recombinant S2-(45-223) protein was used as the antigen to generate
rabbit antisera against MHV S protein. Preparation of rabbit polyclonal antisera was carried out as described previously (46). The final bleeding was carried out 1 week after the last immunization, and IgG
fractions of the antisera were purified through immobilized protein G
(Pierce). The specificity of the rabbit antiserum to the S2 subunit was
confirmed by immunoprecipitation of in vitro translated
products of plasmid pGEM-A59 (data not shown). In vitro transcription-translation of the MHV S protein was performed as described previously (46, 47) with T7 RNA polymerase (Promega) and the
mRNA-dependent rabbit reticulocyte lysate system
(Promega), and immunoprecipitation was performed as described
previously (48).
Virus Infection and Transient Transfection
Infection of DBT cells with MHV-JHM or MHV-2 was performed at a
multiplicity of infection of 25 plaque-forming units/cell. For
performing transient transfection with S protein-encoding plasmid, DBT
cells were preinfected with the T7 RNA polymerase-expressing recombinant vaccinia virus vTF7-3 (38) at a multiplicity of infection
of 0.25 plaque-forming units/cell in Opti-MEM 90 min prior to DNA
transfection. After removal of the inoculum, the cells were transfected
with 5 µg of an S protein-encoding plasmid premixed with 10 µg of
Lipofectin, and the incubation was continued for 6 h prior to
medium change as described by the manufacturer (Life Technologies,
Inc.).
Cell Fusion Assay and Indirect Double Immunofluorescence
Staining
For analysis of the cell fusion activity of the S protein of
MHV-JHM, MHV-2, and their hybrids, plasmids pCS-j, pCS-m2, and pCS-j/m2
and pCS-m2/j, respectively, were transfected into the vTF7-3-infected
DBT cells grown on 60-mm Petri dishes or 21 × 20-mm four-chamber
glass slides (Nunc). The cells were monitored at 6-h intervals under
microscope and photographed. Indirect immunofluorescence staining was
performed as described previously (24, 49) with modifications. In
brief, cells cultured on chamber slides were washed with
phosphate-buffered saline at 48 h posttransfection, fixed with
precooled acetone-methanol (1:1) for 5 min at 20 °C, and
air-dried. The fixed cells were blocking at room temperature for 15 min
with 1% bovine serum albumin in phosphate-buffered saline and then
overlaid with a mixture of a rabbit antiserum (1:60 dilution) specific
for MHV S protein and a mouse antiserum (1:120 dilution) specific for
glial fibrillary acidic protein and incubated in a 37 °C moist
chamber for 1 h. The antiserum against glial fibrillary acidic
protein was used as a glial cell-specific cytoplasmic marker (50).
After three rinses in phosphate-buffered saline, fluorescein
isothiocyanate-conjugated goat anti-rabbit IgG (1:200 dilution) and
rhodamine-conjugated goat anti-mouse IgG (1:200 dilution) were added
and incubated for 40 min. The immunostained cells were washed
thoroughly with phosphate-buffered saline and mounted by SlowFade
(Molecular Probes, Inc., Eugene, OR). Photographs were taken under a
fluorescence microscope.
Metabolic Labeling and Immunoprecipitation of MHV S Protein
8-10 h postinfection of MHV-JHM or MHV-2 and 36 h
posttransfection of an S protein-encoding plasmid, DBT cells were
subjected to metabolic labeling followed by immunoprecipitation to
identify expression of MHV S protein. For performing the labeling,
cultured medium was replaced with methionine-free Eagle's minimal
essential medium supplemented with 3% dialyzed fetal bovine serum 30 min prior to the addition of 60 µCi of Redivue
[35S]methionine (Amersham Pharmacia Biotech) per ml of
cultured medium. Following a 1-h metabolic labeling, the monolayer
cells were lysed in a buffer containing 50 mM Tris-HCl (pH
7.5), 100 mM NaCl, 0.1% SDS, 1% Nonidet P-40, 1% sodium
deoxycholate, and 100 µg of phenylmethylsulfonyl fluoride per ml. The
cell lysates were clarified, and supernatants were collected to perform
immunoprecipitation as described previously (48) with rabbit antiserum
against the recombinant MHV S2-(45-223) protein.
 |
RESULTS |
Cloning and Sequencing of MHV-2 S Gene--
To learn the possible
sequence variations of the S gene of MHV that conferred the cell fusion
activity of MHV-JHM in contrast to the fusion-negative strain MHV-2,
cDNA of MHV-2 S gene was cloned from polyadenylated viral genomic
RNA. Partial cDNA clones that were obtained as outlined in Fig.
1A were used to generate the
full-length cDNA. The complete nucleotide sequence of the MHV-2 S
gene was determined, and an open reading frame was identified that
consists of 3669 nucleotides encoding an S protein of 1223 amino acid
residues. Deduced amino acid sequences indicated that the S protein
contains a signal peptide at the amino terminus, a transmembrane domain
at the carboxyl terminus, and a putative proteolytic cleavage sequence
RRARR in the middle portion. Sequence alignment to the MHV-JHM strain
(42) indicated that there is a 36-nt deletion in the MHV-2 S gene from
nt 1336 to 1371 (Fig. 1B) and 25-nt substitutions scattered
but mainly in the carboxyl-terminal half. The nucleotide substitutions
resulted in three amino acid changes in the coding region as shown in
Fig. 1B and demonstrated approximately 99.3 and 99.8%,
respectively, of the overall nucleotide and amino acid sequence
conservation excluding the deleted region.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 1.
Genetic map of the MHV-2 S gene and its
comparison with MHV-JHM. A, cloning strategy of the
MHV-2 S gene. The coding region of the MHV-2 S gene is represented by a
bar with diagonal lines. Unique
restriction enzyme sites are indicated. Open bars
locate the cDNA fragments derived from MHV-2 RNA by reverse
transcriptase reaction. Closed bars marked
P190/502 and P403/1308 represent cDNA
fragments that were obtained by reverse transcriptase polymerase chain
reaction. B, comparison between the S gene of MHV-JHM and
MHV-2. The nucleotide and deduced amino acid sequences of MHV-2 S gene
were compared with those of MHV-JHM (42). A deletion from nt 1336 to
1371 and three amino acid substitutions in MHV-2 are indicated. Both
MHV-JHM and MHV-2 possess the signal peptide, proteolytic cleavage site
(RRARR) and transmembrane domain.
|
|
Functional Analysis of the Cloned MHV S Protein--
Previous
studies have demonstrated that the MHV-JHM S glycoprotein expressed by
a recombinant vaccinia virus is capable of causing cell-cell fusion
(51). To examine whether the cloned MHV-2 S gene obtained in this study
exhibits a cell fusion property similar to the intrinsic S protein of
MHV-2, a recombinant vaccinia virus system that constitutively
expressed bacteriophage T7 RNA polymerase was applied. Plasmids
pCS-j and pCS-m2 that contain the S-encoding sequence of MHV-JHM and
MHV-2, respectively, under the control of the T7 promoter were
transiently transfected into DBT cells following infection of the
recombinant vaccinia virus. Functional analysis of the S protein was
determined by examining syncytium formation. In pCS-j-transfected DBT
cells, the expression of MHV-JHM S protein was detected at 20 h
posttransfection when polykaryons were also observed, and syncytia were
detected by 48 h (Fig. 2,
A and B). The syncytia induced by transfection of the S-encoding plasmid were morphologically indistinguishable from
those induced by the infection of MHV-JHM (data not shown). In
addition, the size of polykaryons continued to increase until the cells
detaching from the culture dishes that occurred 72 h postinfection
of MHV-JHM (data not shown). Although the expression of MHV-2 S protein
was obvious in cells transfected with pCS-m2, no syncytium formation
but only rounding up of the cells was observed (Fig. 2, C
and D). Syncytium formation was not observed in DBT cells
transfected with vector alone either (Fig. 2, E and
F).

View larger version (142K):
[in this window]
[in a new window]
|
Fig. 2.
Fusion activity of the cloned MHV S
protein. DBT cells were infected with recombinant vaccinia virus
vTF7-3 prior to transfection with plasmid pCS-j (A and
B), pCS-m2 (C and D), and control
plasmid pCITE-4a (E and F). At 48 h
posttransfection, cells were fixed, and indirect double
immunofluorescence staining was carried out with mouse antiserum
against the glial cell-specific cytoplasmic glial fibrillary acidic
protein (A, C, and E) and rabbit
antiserum specific for MHV S protein (B, D, and
F) followed by rhodamine-conjugated goat anti-mouse IgG and
fluorescein isothiocyanate-conjugated goat anti-rabbit IgG. The
microscopic fields are shown in rhodamine (A, C,
and E) and fluorescence (B, D, and
F). Each bar represents 50 µm.
|
|
Cell Fusion Activity Could Be Rescued by Replacing the Deletion
Domain of MHV-2 with MHV-JHM S Protein--
S protein of MHV acts as a
key factor to induce cell fusion in cultured cells. To explore the
possible involvement of the 12-amino acid deletion and 3-amino acid
substitutions of the MHV-2 S protein in its fusion-negative property,
domain swapping experiments were employed between the S genes of
MHV-JHM and MHV-2. By replacing the BspEI-ClaI
fragment of the MHV-2 S gene that lacks the 12-amino acid stretch with
the cognate fragment of MHV-JHM, the hybrid S-m2/j protein was found to
cause syncytia of cultured DBT cells 48 h posttransfection (Fig.
3, C and D),
whereas by replacing the BspEI-ClaI fragment of
MHV-JHM S gene with the cognate fragment of MHV-2, no polykaryon
formation was evident, although the hybrid S-j/m2 protein was expressed
equally well to the S-m2/j in the transfected cells (Fig. 3,
A and B). These results indicated that the 12 amino acid residues in the hypervariable region of the S1 subunit
between 446 and 457 are important, but the three variable amino acid
residues in the C-terminal domain may have little contribution for the
cell fusion activity of MHV S protein.

View larger version (138K):
[in this window]
[in a new window]
|
Fig. 3.
Fusion activity of the hybrid S proteins of
MHV-JHM and MHV-2. DBT cells were infected with recombinant
vaccinia virus vTF7-3 prior to transfection with hybrid plasmids
pCS-j/m2 (A and B), pCS-m2/j (C and
D), and control plasmid pCITE-4a (E and
F). At 48 h posttransfection, cells were fixed and
proceeded to indirect double immunofluorescence staining with antisera
against glial fibrillary acidic protein (A, C,
and E) and MHV S protein (B, D, and
F).
|
|
Both Fusion-positive MHV-JHM and Fusion-negative MHV-2 S Proteins
Are Capable of Undergoing Proteolytic Cleavage in Infected and
Transfected Cells--
Previous studies have demonstrated that in
MHV-infected cells, the primary 150-kDa S gene product (p150) was
glycosylated to form gp180, which was then proteolytically cleaved into
two 90-kDa subunits (gp90) (14). To examine whether there is a
correlation between proteolytic cleavage and fusion property of the MHV
S protein, the cleavability of MHV S protein was analyzed. DBT cells that were infected with MHV-JHM or MHV-2 or transfected with an S
protein-encoding plasmid were metabolically labeled with
[35S]methionine. Cell lysates were precipitated with the
antiserum against MHV S protein and resolved by SDS-polyacrylamide gel
electrophoresis. Both gp180 and gp90 were detected in DBT cells that
were either infected with MHV-JHM or MHV-2 or transiently transfected
with the plasmid encoding the S protein of MHV-JHM or MHV-2 (Fig.
4). The indistinguishable cleavabilities
of the MHV-JHM and MHV-2 S proteins indicate that the fusion-negative
property of MHV-2 is not due to the loss of proteolytic cleavage
activity of the S protein.

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 4.
Cleavage activity of MHV-2 S protein
expressed in DBT cells. DBT cells were mock-infected
(lane 1); infected with MHV-JHM (lane 2) or MHV-2 (lane 3); or transiently
transfected with plasmid pCITE-4a (lane 4), pCS-j
(lane 5), or pCS-m2 (lane 6) and in vivo labeled with
[35S]methionine as described under "Experimental
Procedures." Cell lysates were precipitated with the rabbit antiserum
against the MHV S2-(45-223) protein and analyzed by SDS-polyacrylamide
gel electrophoresis. Bands corresponding to the uncleaved S precursor
(gp180) and the proteolytically cleaved S2 subunit (gp90) are indicated
with arrowheads on the right. Molecular weight
markers are given on the left.
|
|
 |
DISCUSSION |
In this study, we have cloned and sequenced the S gene of the
fusion-negative MHV-2. The MHV-2 S protein possesses the predicted proteolytic cleavage sequence RRARR and was capable of undergoing cleavage both in MHV-2-infected cells and cells transfected with the
S-encoding plasmid. The MHV-2 S1 subunit lacks a 12-amino acid stretch
that resulted in its fusion-negative characteristics.
Previous studies have identified amino acid substitutions in a
predicted heptad repeat region of S2 subunit that abolished the neutral
pH-dependent cell fusion activity of MHV-4 (52). Bos
et al. (26) postulated that mutations in the conserved
cysteines of the hydrophobic stretch of S2 transmembrane region altered the cell fusion activity of MHV-A59. However, none of the amino acid
mutations was found in the fusion-negative MHV-2 strain used in this
study. In addition to the 12-amino acid deletion in the S1 subunit of
the MHV-2, only three amino acid substitutions in the S2 subunit were
identified when compared with the fusion-positive MHV-JHM. Domain
swapping experiments indicated that the three amino acid substitutions
had little effect on the cell fusion activity; DBT cells transfected
with plasmid pCS-m2/j that encodes an MHV S protein with the three
point mutations possessed cell fusion activity (Fig. 3). By analyzing a
fusion-positive variant of MHV-2, MHV-2f, Yamada et al. (53)
concluded that MHV-2 does not possess cell fusion activity due to the
lack of the cleavage sequence in the S protein. Nevertheless, the
possible effect of a mutation in the signal peptide cannot be ruled
out. In addition, although both MHV-2 are nonfusogenic, our MHV-2
strain is different from that of Yamada (53) in that no mutation was
found in the signal peptide and proteolytic cleavage sequence. The
genetic variation suggested that the fusion-negative MHV-2 strain has evolved variants.
Proteolytic activation of cell fusion has been observed for the
negative-stranded orthomyxovirus and paramyxovirus (54, 55). In these
cases, the newly generated amino terminus after cleavage seems to be
critical for cell fusion; synthetic oligopeptides of the amino-terminal
sequence inhibited the biological activity of the naturally occurring
cleavage products (56). Although cell fusion has been observed with
uncleavable S protein of MHV-JHM variants (23-26), previous studies
also demonstrated that proteolytic cleavage of S glycoprotein into S1
and S2 subunits was required to promote cell fusion in some MHV
strains (14). In addition, the S2 subunit of MHV appeared to play an
important role in the cell fusion activity (19, 26-28, 52, 57).
Nevertheless, the amino terminus of MHV S2 subunit does not have the
hydrophobic characteristics of those adjoining the cleavage sites of
the orthomyxovirus HA and paramyxovirus F glycoprotein (22, 58, 59). A
putative fusogenic peptide (PEP1) in the longer heptad repeat of the S2 subunit of MHV-A59 was recently identified that possibly functions as
an internal fusion peptide (60). The fusion peptide is a relatively
hydrophobic alanine/glycine-rich stretch of 19 amino acids. However,
MHV-2 S protein was unable to induce fusion in cultured DBT cells,
although it retained the proteolytic cleavage activity and the putative
fusogenic peptide of MHV-A59. Taken together, both the proteolytic
cleavage sequence and the conserved S2 fusogenic peptide may be
involved, but may not be sufficient to determine the cell fusion
activity of MHV. Additional factors are likely to be required.
Sequence analysis of the S1 subunit of our MHV-2 did not find any amino
acid stretch that resembles the putative fusogenic peptides of
influenza virus hemagglutinin HA2, Newcastle disease virus glycoprotein
F1, human immunodeficiency virus env glycoprotein gp41,
semliki forest virus spike protein E1, and vesicular stomatitis virus
glycoprotein G (59, 61). In addition, the S1 subunit is relatively
variable among MHV; deletions and mutations often occur in the
hypervariable region (22, 31, 62). When compared with the S protein of
MHV-4, there are three deletions of one, three, and eight amino acid
residues in Yamada's MHV-2 strain (31, 42, 53) and a large deletion of
141 and 153 amino acid residues in the fusion-positive MHV-JHM strain
and our fusion-negative MHV-2 strain, respectively, in the
hypervariable region of the S1 subunit. Domain swapping experiments
indicated that the 12-amino acid stretch,
446WNRRYGFKVNDR457, missing in the S1 subunit
of our fusion-negative MHV-2 is critical for the cell fusion activity
of MHV-JHM (Fig. 3). Earlier studies have demonstrated that the S1
subunit was involved in binding to cell surface receptor (63) and that
the S2 subunit was responsible for cell-cell fusion (19, 27, 28). Based
on our results, the S1 subunit also contributed to the cell fusion
activity of MHV.
Conformational change of fusogenic proteins is a current model for the
mechanism of protein-mediated membrane fusion (10, 64). Deletions and
mutations that caused conformational changes of putative fusogenic
peptides significantly affected the cell fusion activity of MHV-4,
MHV-A59, Newcastle disease virus, human cytomegalovirus, and human
immunodeficiency virus (52, 60, 65-67). In these cases, amino acid
modification often occurred in the hydrophobic regions of the viral
fusogenic proteins. Fusion peptides are often rich in alanine and
glycine and have hydrophobicity values ranging from 0.5 to 0.8 (59).
Therefore, the 12-amino acid stretch
446WNRRYGFKVNDR457 that is lacking in the S1
subunit of MHV-2 does not seem by itself to be a good candidate of
fusion domain. Nevertheless, domain swapping experiments did
demonstrate a role of the 12-amino acid critical for cell-cell fusion.
We thus proposed that the 12-amino acid stretch may not function as a
fusion peptide but is involved in maintaining a correct folding of the
S protein that would allow the exposure of internal fusion peptides
and, in turn, facilitate the cell fusion process upon viral infection.
In the fusion-negative MHV-2, although the S protein is capable of
undergoing cleavage into S1 and S2 subunits, deletion of the 12-amino
acid stretch in the S1 subunit may result in a conformation to which
the putative fusion peptides are embedded. Further structural analysis
of the S protein of naturally occurring MHV-2 would shed light on the mechanisms of its fusion-negative property.
 |
ACKNOWLEDGEMENTS |
We thank Y.-C. Hsia, S.-W. Hee, B.-T. Juang,
Y.-H. Chen, Y.-T. Peng, and M.-D. Lin for technical assistance. We are
grateful to C.-L. Liao for providing recombinant vaccinia virus; to K. Fujiwara for providing MHV-JHM, MHV-2, and DBT cells; and to M. M. C. Lai for providing plasmids pTS-n, pTS-m, pTS-c, and
pGEM-A59.
 |
FOOTNOTES |
*
This work was supported by National Science Council of the
Republic of China Grants NSC82-0412-B-002-257 and NSC86-2314-B-002-139.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF107212.
To whom correspondence should be addressed: Inst. of
Biochemistry, National Taiwan University, College of Medicine, 1 Jen-Ai Rd., First Section, Taipei, 100 Taiwan. Tel.: 2-2397-0800 (ext. 8217);
Fax: 2-2391-5295; E-mail: mfchang@ha.mc.ntu.edu.tw.
 |
ABBREVIATIONS |
The abbreviations used are:
MHV, mouse hepatitis
virus;
nt, nucleotide(s).
 |
REFERENCES |
| 1.
|
Wege, H.,
Siddell, S.,
and Ter Meulen, V.
(1982)
Curr. Top. Microbiol. Immunol.
99,
165-200[Medline]
[Order article via Infotrieve]
|
| 2.
|
Siddell, S.,
Wege, H.,
and Ter Meulen, V.
(1983)
J. Gen. Virol.
64,
761-776[Abstract/Free Full Text]
|
| 3.
|
Lai, M. M. C.
(1990)
Annu. Rev. Microbiol.
44,
303-333[Medline]
[Order article via Infotrieve]
|
| 4.
|
Stohlman, S. A.,
Baric, R. S.,
Nelson, G. N.,
Soe, L.-H.,
Welter, L. M.,
and Deans, R. J.
(1988)
J. Virol.
62,
4288-4295[Abstract/Free Full Text]
|
| 5.
|
Risco, C.,
Anton, I. M.,
Enjuanes, L.,
and Carrascosa, J. L.
(1996)
J. Virol.
70,
4773-4777[Abstract]
|
| 6.
|
Sturman, L. S.,
Holmes, K. V.,
and Behnke, J.
(1980)
J. Virol.
33,
449-462[Abstract/Free Full Text]
|
| 7.
|
Sturman, L. S.,
and Holmes, K. V.
(1985)
Trends Biochem. Sci.
10,
17-20
|
| 8.
|
Shieh, C.-K.,
Lee, H.-J.,
Yokomori, K.,
La Monica, N.,
Makino, S.,
and Lai, M. M. C.
(1989)
J. Virol.
63,
3729-3736[Abstract/Free Full Text]
|
| 9.
|
Yokomori, K.,
Banner, L. R.,
and Lai, M. M. C.
(1991)
Virology
183,
647-657[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Lai, M. M. C.,
and Cavanagh, D.
(1997)
Adv. Virus Res.
48,
1-99
|
| 11.
|
Delmas, B.,
and Laude, H.
(1990)
J. Virol.
64,
5367-5375[Abstract/Free Full Text]
|
| 12.
|
Schmidt, M. F. G.
(1982)
Virology
116,
327-338[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Frana, M. F.,
Behnke, J. N.,
Sturman, L. S.,
and Holmes, K. V.
(1985)
J. Virol.
56,
912-920[Abstract/Free Full Text]
|
| 14.
|
Sturman, L. S.,
Ricard, C. S.,
and Holmes, K. V.
(1985)
J. Virol.
56,
904-911[Abstract/Free Full Text]
|
| 15.
|
Vennema, H.,
Heijnen, L.,
Zijderveld, A.,
Horzinek, M. C.,
and Spaan, W. J. M.
(1990)
J. Virol.
64,
339-346[Abstract/Free Full Text]
|
| 16.
|
Collins, A. R.,
Knobler, R. L.,
Powell, H.,
and Buchmeier, M. J.
(1982)
Virology
119,
358-371[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Sturman, L. S.,
and Holmes, K. V.
(1983)
Adv. Virus Res.
28,
35-112[Medline]
[Order article via Infotrieve]
|
| 18.
|
Wang, F.-I.,
Fleming, J. O.,
and Lai, M. M. C.
(1992)
Virology
186,
742-749[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Daniel, C.,
Anderson, R.,
Buchmeier, M. J.,
Fleming, J. O.,
Spaan, W. J. M.,
Wege, H.,
and Talbot, P. J.
(1993)
J. Virol.
67,
1185-1194[Abstract/Free Full Text]
|
| 20.
|
Kubo, H.,
Yamada, Y. K.,
and Taguchi, F.
(1994)
J. Virol.
68,
5403-5410[Abstract/Free Full Text]
|
| 21.
|
Suzuki, H.,
and Taguchi, F.
(1996)
J. Virol.
70,
2632-2636[Abstract]
|
| 22.
|
Luytjes, W.,
Sturman, L. S.,
Bredenbeek, P. J.,
Charite, J.,
van der Zeijst, B. A. M.,
Horzinek, M. C.,
and Spaan, W. J. M.
(1987)
Virology
161,
479-487[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Gombold, J. L.,
Hingley, S. T.,
and Weiss, S. R.
(1993)
J. Virol.
67,
4504-4512[Abstract/Free Full Text]
|
| 24.
|
Stauber, R.,
Pfleiderera, M.,
and Siddell, S.
(1993)
J. Gen. Virol.
74,
183-191[Abstract/Free Full Text]
|
| 25.
|
Taguchi, F.
(1993)
J. Virol.
67,
1195-1202[Abstract/Free Full Text]
|
| 26.
|
Bos, E. C. W.,
Heunen, L.,
Luytjes, W.,
and Spaan, W. J. M.
(1995)
Virology
214,
453-463[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Luytjes, W.,
Geerts, D.,
Posthumus, W.,
Meloen, R.,
and Spaan, W.
(1989)
J. Virol.
63,
1408-1412[Abstract/Free Full Text]
|
| 28.
|
Gallagher, T. M.
(1996)
J. Virol.
70,
4683-4690[Abstract]
|
| 29.
|
Sturman, L. S.,
Ricard, C. S.,
and Holmes, K. V.
(1990)
J. Virol.
64,
3042-3050[Abstract/Free Full Text]
|
| 30.
|
Weismiller, D. G.,
Sturman, L. S.,
Buchmeier, M. J.,
Fleming, J. O.,
and Holmes, K. V.
(1990)
J. Virol.
64,
3051-3055[Abstract/Free Full Text]
|
| 31.
|
Parker, S. E.,
Gallagher, T. M.,
and Buchmeier, M. J.
(1989)
Virology
173,
664-673[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Banner, L. R.,
Keck, J. G.,
and Lai, M. M. C.
(1990)
Virology
175,
548-555[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Gallagher, T. M.,
Parker, S. E.,
and Buchmeier, M. J.
(1990)
J. Virol.
64,
731-741[Abstract/Free Full Text]
|
| 34.
|
Fazakerley, J. K.,
Parker, S. E.,
Bloom, F.,
and Buchmeier, M. J.
(1992)
Virology
187,
178-188[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Spaan, W.,
Cavanagh, D.,
and Horzinek, M. C.
(1988)
J. Gen. Virol.
69,
2939-2952[Abstract/Free Full Text]
|
| 36.
|
Keck, J. G.,
Soe, L.-H.,
Makino, S.,
Stohlman, S. A.,
and Lai, M. M. C.
(1988)
J. Virol.
62,
1989-1998[Abstract/Free Full Text]
|
| 37.
|
Hirano, N.,
Tamura, T.,
Taguchi, F.,
Ueda, K.,
and Fujiwara, K.
(1981)
Arch. Virol.
70,
69-73[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Fuerst, T. R.,
Niles, E. G.,
Studier, F. W.,
and Moss, B.
(1986)
Proc. Natl. Acad. Sci. U. S. A.
84,
8122-8126
|
| 39.
|
Hirano, N.,
Fujiwara, K.,
Hino, S.,
and Matumoto, M.
(1974)
Arch. Gesamte Virusforsch.
44,
298-302[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Makino, S.,
Taguchi, F.,
Hayami, M.,
and Fujiwara, K.
(1983)
Microbiol. Immunol.
27,
445-454[Medline]
[Order article via Infotrieve]
|
| 41.
|
Chomczynski, P.,
and Sacchi, N.
(1987)
Anal. Biochem.
162,
156-159[Medline]
[Order article via Infotrieve]
|
| 42.
|
Schmidt, I.,
Skinner, M.,
and Siddell, S.
(1987)
J. Gen. Virol.
68,
47-56[Abstract/Free Full Text]
|
| 43.
|
Sanger, F.,
Nicklen, S.,
and Coulson, A. R.
(1977)
Proc. Natl. Acad. Sci. U. S. A.
74,
5463-5467[Abstract/Free Full Text]
|
| 44.
|
Van Dyke, M. W.,
Sirito, M.,
and Sawadogo, M.
(1992)
Gene (Amst.)
111,
99-104[CrossRef][Medline]
[Order article via Infotrieve]
|
| 45.
|
Studier, F. W.,
and Moffatt, B. A.
(1986)
J. Mol. Biol.
189,
113-130[CrossRef][Medline]
[Order article via Infotrieve]
|
| 46.
|
Chang, M.-F.,
Sun, C.-Y.,
Chen, C.-J.,
and Chang, S. C.
(1993)
J. Virol.
67,
2529-2536[Abstract/Free Full Text]
|
| 47.
|
Chang, M.-F.,
Baker, S. C.,
Soe, L.-H.,
Kamahora, T.,
Keck, J. G.,
Makino, S.,
Govindarajan, S.,
and Lai, M. M. C.
(1988)
J. Virol.
62,
2403-2410[Abstract/Free Full Text]
|
| 48.
|
Lee, C.-H.,
Chang, S. C.,
Chen, C.-J.,
and Chang, M.-F.
(1998)
J. Biol. Chem.
273,
7650-7656[Abstract/Free Full Text]
|
| 49.
|
Chang, M.-F.,
Chen, C.-J.,
and Chang, S. C.
(1994)
J. Virol.
68,
646-653[Abstract/Free Full Text]
|
| 50.
|
Bignami, A.,
Eng, L. F.,
Dahl, D.,
and Uyeda, C. T.
(1972)
Brain Res.
43,
429-435[CrossRef][Medline]
[Order article via Infotrieve]
|
| 51.
|
Pfleiderer, M.,
Routledge, E.,
and Siddell, S. G.
(1990)
Adv. Exp. Med. Biol.
276,
21-31[Medline]
[Order article via Infotrieve]
|
| 52.
|
Gallagher, T. M.,
Escarmis, C.,
and Buchmeier, M. J.
(1991)
J. Virol.
65,
1916-1928[Abstract/Free Full Text]
|
| 53.
|
Yamada, Y. K.,
Takimoto, K.,
Yabe, M.,
and Taguchi, F.
(1997)
Virology
227,
215-219[CrossRef][Medline]
[Order article via Infotrieve]
|
| 54.
|
Scheid, A.,
and Choppin, P. W.
(1974)
Virology
57,
475-490[CrossRef][Medline]
[Order article via Infotrieve]
|
| 55.
|
White, J.,
Matlin, K.,
and Helenius, A.
(1981)
J. Cell Biol.
89,
674-679[Abstract/Free Full Text]
|
| 56.
|
Richardson, C. D.,
and Choppin, P. W.
(1983)
Virology
131,
518-532[CrossRef][Medline]
[Order article via Infotrieve]
|
| 57.
|
Routledge, E.,
Stauber, R.,
Pfleiderer, M.,
and Siddell, S. G.
(1991)
J. Virol.
65,
254-262[Abstract/Free Full Text]
|
| 58.
|
Morrison, T. G.
(1988)
Virus Res.
10,
113-136[CrossRef][Medline]
[Order article via Infotrieve]
|
| 59.
|
White, J. M.
(1990)
Annu. Rev. Physiol.
52,
675-697[CrossRef][Medline]
[Order article via Infotrieve]
|
| 60.
|
Luo, L.,
and Weiss, S. R.
(1998)
Virology
244,
483-494[CrossRef][Medline]
[Order article via Infotrieve]
|
| 61.
|
Zhang, L.,
and Ghosh, H. P.
(1994)
J. Virol.
68,
2186-2193[Abstract/Free Full Text]
|
| 62.
|
Taguchi, F.,
Ikeda, T.,
and Shida, H.
(1992)
J. Gen. Virol.
73,
1066-1072
|
| 63.
|
Cavanagh, D.,
Davis, P. J.,
Darbyshire, J. H.,
and Peters, R. W.
(1986)
J. Gen. Virol.
67,
1435-1442[Abstract/Free Full Text]
|
| 64.
|
Hernandez, L. D.,
Hoffman, L. R.,
Wolfsberg, T. G.,
and White, J. M.
(1996)
Annu. Rev. Cell Dev. Biol.
12,
627-661[CrossRef][Medline]
[Order article via Infotrieve]
|
| 65.
|
Bold, S.,
Ohlin, M.,
Garten, W.,
and Radsak, K.
(1996)
J. Gen. Virol.
77,
2297-2302[Abstract/Free Full Text]
|
| 66.
|
Perrin, C.,
Fenouillet, E.,
and Jones, I. M.
(1998)
Virology
242,
338-345[CrossRef][Medline]
[Order article via Infotrieve]
|
| 67.
|
Young, J. K.,
Hicks, R. P.,
Wright, G. E.,
and Morrison, T. G.
(1998)
Virology
243,
21-31[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
P.-K. Hsieh, S. C. Chang, C.-C. Huang, T.-T. Lee, C.-W. Hsiao, Y.-H. Kou, I-Y. Chen, C.-K. Chang, T.-H. Huang, and M.-F. Chang
Assembly of Severe Acute Respiratory Syndrome Coronavirus RNA Packaging Signal into Virus-Like Particles Is Nucleocapsid Dependent
J. Virol.,
November 15, 2005;
79(22):
13848 - 13855.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-H. Wang, S. C. Chang, C. Huang, Y.-P. Li, C.-H. Lee, and M.-F. Chang
Novel Nuclear Export Signal-Interacting Protein, NESI, Critical for the Assembly of Hepatitis Delta Virus
J. Virol.,
July 1, 2005;
79(13):
8113 - 8120.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. A. M. de Haan, K. Stadler, G.-J. Godeke, B. J. Bosch, and P. J. M. Rottier
Cleavage Inhibition of the Murine Coronavirus Spike Protein by a Furin-Like Enzyme Affects Cell-Cell but Not Virus-Cell Fusion
J. Virol.,
June 1, 2004;
78(11):
6048 - 6054.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Yoo, Y. Pei, N. Christie, and M. Cooper
Primary Structure of the Sialodacryoadenitis Virus Genome: Sequence of the Structural-Protein Region and Its Application for Differential Diagnosis
Clin. Vaccine Immunol.,
July 1, 2000;
7(4):
568 - 573.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|