J Biol Chem, Vol. 274, Issue 37, 26287-26295, September 10, 1999
Transmembrane Tumor Necrosis Factor (TNF)-
Inhibits Adipocyte
Differentiation by Selectively Activating TNF Receptor 1*
Haiyan
Xu,
Jaswinder K.
Sethi
, and
Gökhan S.
Hotamisligil§
From the Harvard School of Public Health, Division of Biological
Sciences and Department of Nutrition, Boston, Massachusetts 02115
 |
ABSTRACT |
Tumor necrosis factor 
(TNF) is a potent
cytokine with multiple biological activities and exists in two forms as
follows: a 17-kDa soluble form that is a cleaved product of the 26-kDa transmembrane form (mTNF). It has been suggested that the
transmembrane form of TNF is mainly responsible for localized
responses via cell-cell contact. Here, we have examined the activities
of transmembrane TNF in cultured adipocytes. A non-cleavable
transmembrane form of TNF (mTNF
1-9K11E) was expressed in several
preadipocyte cell lines using retroviral gene transfer. In wild type
preadipocytes carrying both TNF receptors, expression of
mTNF1-9K11E resulted in inhibition of the differentiation program.
The extent of this varied depending on the nature and strength of the
adipogenic stimuli. The TNF receptor responsible for this function was
determined by expressing mTNF1-9K11E in preadipocyte cell lines
lacking either TNF receptor 1 (TNFR1), 2 (TNFR2), or both. In order to confirm the results in the same cellular background, TNF receptors were
also reconstituted in the cell lines lacking corresponding receptors.
These experiments demonstrated that TNFR1 was necessary and sufficient
for mediating mTNF1-9K11E-induced inhibition of adipogenesis and
that this action was similar to that of soluble TNF. In conclusion,
our results indicate that mTNF1-9K11E is biologically active in
cultured adipocytes and can alter the adipogenic program of these cells
by selectively activating TNFR1. This may have physiological
implications where local TNF actions are thought to be generated at
sites such as adipose tissue.
| |
INTRODUCTION |
Originally identified as a mediator of necrosis of certain tumor
cells, tumor necrosis factor (TNF)1 has now been shown
to have a wide array of biological activities (1, 2). It is also
implicated in the pathogenesis of several diseases such as septic
shock, rheumatoid arthritis, autoimmune disorders, and insulin
resistance (1, 3).
TNF is primarily produced by activated macrophages and lymphocytes
but is also expressed in endothelial cells and other cell types
including adipocytes (1, 2, 4). It exists in two forms as follows: a
17-kDa soluble form (sTNF) that is cleaved from the 26-kDa
transmembrane protein (mTNF) at the cell surface by
TNF-converting enzyme (5, 6). Although the majority of
TNF-induced responses has been attributed to sTNF, a few studies
have shown that mTNF is also biologically active and capable of
mediating similar responses including apoptosis, proliferation, B cell
activation, and some inflammatory responses (7, 8). Furthermore,
mTNF has been implicated in some disease states such as experimental
hepatitis where serum sTNF levels were found to be within the normal
range (9), indicating the relevance of localized TNF responses. The
existence of two different forms of TNF makes its physiology more
complicated. Furthermore, the fact that mTNF relies on cell
contact-dependent signaling may render the actions of
mTNF cell type-specific in vivo. In support of this,
mTNF has been reported to trigger inflammatory responses in
astrocytes but not in neurons, whereas sTNF can induce similar effects in both cell types (10).
The biological functions of both mTNF and sTNF can be signaled by
two distinct TNF receptors: TNFR1 (55 kDa) and TNFR2 (75 kDa). The lack
of homology in intracellular domains of two TNF receptors indicates
that they can mediate distinct biological activities. Indeed, whereas a
broad array of cellular responses has been attributed to TNFR1, many
other effects are mediated by TNFR2 (11, 12). These two receptors can
also act in concert under many circumstances (9, 13). The role of TNFR1
and TNFR2 in mediating the actions of sTNF and the downstream
signaling mechanisms has been studied extensively. In contrast, little
information is available regarding the pathways and mechanisms utilized
by mTNF. Some early studies have demonstrated that transmembrane TNF is superior to sTNF in activating TNFR2 (7, 12). However, subsequent reports have indicated that transmembrane TNF can signal
through both receptors depending on the cellular context (8). Other
studies have used TNFR-deficient mice to demonstrate that both
receptors were required as in the case of experimental hepatitis (9)
and arthritis (14), whereas TNFR2 alone is sufficient to mediate the
effects of transmembrane TNF in experimental cerebral malaria (15).
Soluble TNF plays an important role in regulation of energy
metabolism. It has profound effects on adipocytes, including mobilization of triglycerides and inhibition of insulin action (2, 3).
In adipocytes, it can regulate the expression of several genes (4) and
modulate the secretion of free fatty acids and leptin which play active
roles in systemic energy balance (16, 17). Recent studies demonstrated
that TNF is a candidate mediator of insulin resistance in obesity.
The expression level of TNF in adipose tissue is elevated in a
variety of rodent obesity models (4) and also in obese humans (18, 19).
Soluble TNF has been shown to inhibit insulin action in cultured
adipocytes (20) and other cell types (21, 22) as well as in whole
animals (23-25). Several studies on various models of rodent obesity
demonstrated increased insulin sensitivity upon genetic loss of TNF
function (26-28), although one recent report could not demonstrate
this in TNFR
/R2/ mice with
dietary obesity (29). Similar to genetic studies, pharmacological
blocking of TNF activity also results in significant reversal of
insulin resistance in obesity (4, 30).
Despite strong evidence of a role for TNF in obesity-related insulin
resistance, circulating levels of sTNF appear to be very low or
undetectable (3). It is therefore possible that obesity might be one
example where TNF action is localized to the site(s) of production,
such as adipose tissue. Thus, mTNF may be a potential candidate
mediator of such local events. However, the effects of mTNF on
adipocyte biology and energy metabolism remain unknown.
In this study, we have examined the effects of transmembrane TNF on
cultured 3T3-F442A adipocytes and determined the TNF receptor
responsible for its functions by using
TNFR1/, TNFR2/,
and TNFR1/R2/ preadipocyte
cell lines developed in our
laboratory.2 These studies
demonstrate that transmembrane TNF is indeed biologically active in
cultured adipocytes and that it alters the differentiation program of
adipocytes by selectively activating TNFR1.
| |
EXPERIMENTAL PROCEDURES |
Cells and Reagents--
TNFR1/,
TNFR2/, and
TNFR1/R2/ fibroblast cell
lines were established from day 16-17 mouse embryos with targeted
mutations in the corresponding TNFR(s) using the classic 3T3 protocol.
Multiple fibroblast cell lines were established for each genotype and
tested for their capacity to differentiate into adipocytes. For each genotype, one cell line with the highest rate of differentiation was
selected and used for the experiments. 3T3-F442A,
TNFR1/, TNFR2/,
and TNFR1/R2/ preadipocytes
were grown in Dulbecco's modified Eagle's medium (DMEM, Life
Technologies, Inc.) supplemented with 10% bovine calf serum (HyClone).
Infected cells were maintained in the same medium in the presence of
appropriate selection drugs. For differentiation, cells were seeded at
1.5 × 105 per well on 6-well plates in DMEM
supplemented with 10% cosmic calf serum (HyClone). Cells were grown to
confluency and exposed to adipogenic reagents for 3 to 4 days, followed
by culturing for 4 more days in medium containing insulin only.
Recombinant murine soluble TNF (Genzyme, MA) treatments were started
at confluency and continued throughout the experiments with a new dose
applied every 2 days at the indicated concentrations. Cells were then either stained with oil red O for microscopy or processed for RNA
collection. Unless otherwise indicated, insulin was used at a
concentration of 5 µg/ml, dexamethasone at 1 µM,
isobutylmethylxanthine at 0.5 mM, and BRL49653 at 1 µM. The polyclonal rabbit anti-murine TNF antibody was
purchased from Genzyme (Cambridge, MA). The fluorescein-conjugated anti-rabbit IgG was purchased from Jackson ImmunoResearch (West Grove,
PA). The polyclonal rabbit anti-human aP2 antibody was provided by Dr.
Rex Parker (Bristol-Myers Squibb Co.). The polyclonal rabbit anti-rat
Na,K-ATPase antibody was provided by Dr. Lorraine Santy (Harvard
University). The polyclonal rabbit anti-murine ACRP30 antibody was
provided by Dr. Philip Scherer (Albert Einstein College of Medicine,
New York).
Cell Fractionation and Immunoblot Analysis--
Fully
differentiated adipocytes (1 × 107) were collected
from 10-cm dishes in the presence of breaking buffer (500 mM KCl, 250 mM sucrose, 25 mM
Tris·HCl, pH 8.0, 2 mM EGTA, 5 mM EDTA, 2 µg/ml aprotinin, 0.5 µg/ml leupeptin, 2 µM pepstatin,
and 200 µg/ml Pefabloc). After homogenization for 1 min at the speed
of 25,000 rpm per min with a Polytron (model PT3000, Brinkmann), cell
lysates were centrifuged at 4,700 × g (Megafuge 3.0R,
Heraeus Instruments) for 100 min, and the pellet containing plasma
membranes was collected. The supernatant was further centrifuged at
450,000 × g (L8-M ultracentrifuge, Beckman) for 2 h to precipitate the remaining subcellular membranes and harvest
cytosolic material. The pellets were extracted in lysis buffer (1%
Triton X-100, 50 mM Hepes, 100 mM sodium
pyrophosphate, 100 mM sodium fluoride, 10 mM
EDTA, 2 µg/ml aprotinin, 0.5 µg/ml leupeptin, 2 µM
pepstatin, and 200 µg/ml Pefabloc) and centrifuged at 14,000 rpm in a
microcentrifuge. The supernatants, which contain solubilized membrane
proteins, were collected, and equal amounts of protein from each
fraction were used for immunoblot analysis. To analyze secretion of
sTNF, 48-h conditioned medium (10 ml) was collected from each cell
line and concentrated to a final volume of 1 ml. The polyclonal rabbit anti-murine TNF antibody was used for immunoprecipitation, as described
previously (26). Immunoblots were performed using polyclonal rabbit
antibodies against human insulin receptor and aP2, mouse ACRP30, and
rat Na,K-ATPase, respectively.
Quantitation of Differentiation--
Cells were stained with oil
red O (Sigma) for visualizing the lipid droplets and hematoxylin
(Sigma) for nuclei according to conventional methods. The percentage of
differentiation was calculated as number of cells containing visible
lipid droplets divided by the total number of nuclei per microscopic
field, under 400-fold magnification. Three representative fields were
counted for each sample, and the mean ± S.D. was used for comparisons.
Vector Construction--
The cDNA of the noncleavable murine
membrane TNF (mTNF1-9K11E) was provided by Dr. Els Decoster and
Dr. Walter Fiers (Gent University, K. L. Ledeganckstraat, Belgium) in
vector pSV235 (7). The coding region was amplified by polymerase chain
reaction (5' primer, CTAGATCTCCCTCCAGAAAAGACA, and 3' primer,
GGATCCAGAGTAAAGGGTCAGAGTG) and cloned into the PCRII vector
(Invitrogen). The integrity of the PCR product was confirmed by
sequencing. The coding region was then excised with
XbaI/BamHI digestion followed by Klenow fill-in.
The 0.76-kilobase pair mTNF1-9K11E cDNA fragment was cloned in
sense orientation into the SnaBI site of the retroviral vector, pBabe-hygro, which contains the hygromycin B resistance gene
(32). The cDNA of TNFR1 was obtained by performing reverse transcription-PCR (5' primer, TGCGAGGTCCTGGAGGACC, and 3' primer, AAGGTTGTGGGTGTGGCTTTAT) using mouse spleen cDNA (strain C57BL/6). The final 1.37-kilobase pair PCR product was cloned into PCRII vector.
One point mutation was detected by sequencing and corrected by
site-directed mutagenesis based on the published sequence (33). The
coding region of TNFR1 was excised with
NaeI/EcoRI digestion and cloned into the
SnaBI/EcoRI site of the retroviral vector, pBabe-puro, which contains the puromycin resistance gene (32). The
cDNA of murine TNFR2 was obtained from Immunex (34). The coding
sequence was excised with BamHI (followed by Klenow
fill-in)/EcoRI digestion and cloned into the SalI
(followed by Klenow fill-in)/EcoRI site of the retroviral
vector, pBabe-bleo, which contains the bleomycin resistance gene (32).
All the expression constructs were sequenced to confirm the integrity
and correct orientation of the cloned cDNAs.
Transfection and Infection--
Packaging of the viral particles
was achieved by transfecting the expression plasmids into Bosc 23 cells, a human kidney cell line (35), with the Cell Phect calcium
phosphate coprecipitation kit (Amersham Pharmacia Biotech). Forty-eight
hours post-transfection, supernatant from packaging cells was collected
and filtered through sterile 0.45-µm syringe filters. Twenty-four
hours before infection, recipient cells were seeded at a density of
2 × 105 per 75 cm2. For infection,
recipient cells were incubated with viral supernatant plus fresh DMEM
(3:1) containing a final concentration of 4 µg/ml Polybrene (Sigma).
After a 24-h incubation, cells were fed with fresh DMEM and allowed to
grow to 80% confluency in 2-3 days. Cells were re-seeded at a density
of 6 × 105 per 75 cm2 for selection, and
corresponding antibiotics were added the following day. Puromycin
(Sigma) selection was completed in 3-4 days, while hygromycin B
(Sigma) and zeocin (a derivative of bleomycin, Invitrogen) lasted 1 week and 1 month, respectively. Unless otherwise indicated, cells were
maintained in appropriate antibiotics throughout experiments to
maintain stable expression levels of mTNF1-9K11E, TNFR1, and TNFR2.
Total RNA Preparation and Northern Blotting--
RNA samples
were extracted according to the guanidinium thiocyanate method (4).
Following denaturation, RNAs were loaded on a 1% agarose gel
containing 3% formaldehyde (4). After electrophoresis, RNAs were
transferred to a biotran membrane (ICN), UV cross-linked, and baked at
80 °C for 1 h. Hybridization with [-32P]dCTP
(NEN Life Science Products)-labeled cDNA probes and subsequent washings were done as described previously (4). Northern blots were
quantitated by using NIH image program, and 18 S rRNA was used for
loading adjustment.
Immunofluorescence--
Cells were grown on coverslips in 6-well
plates. After being rinsed 5 times with modified phosphate-buffered
saline (PBS containing 1 mM MgCl2 and 0.1 mM CaCl2), cells were fixed in 3%
paraformaldehyde. Following 5 min incubation in PBS containing 50 mM NH4Cl, cells were rinsed 3 times with PBS
and 2 times with PBS containing 0.5% bovine serum albumin. This was
followed by a 45-min incubation at room temperature in PBS containing
0.5% bovine serum albumin and 1:500 dilution of a rabbit anti-murine
TNF antibody (Genzyme, MA). Cells were then washed 5 times with PBS and
2 times with PBS containing 0.5% bovine serum albumin. After a 30-min
incubation with fluorescein-conjugated anti-rabbit IgG (Jackson
ImmunoResearch), cells were washed 8 times with PBS, once with water
and mounted with fluoromount-G (Southern Biotechnology Associates,
Inc.). Photographs were taken under fluorescence microscope as
described previously (36).
NF-
B Activation--
The mTNF1-9K11E expression construct
or control vector was cotransfected with a NF-B promoter-driven
luciferase reporter gene (provided by Dr. Christopher K. Glass,
University of California, San Diego) using LipofectAMINE-plus kit (Life
Technologies, Inc.) The luciferase activity was determined by a
luminometer and corrected for transfection efficiency as assessed by
-galactosidase assays.
| |
RESULTS |
Expression of a Non-cleavable Transmembrane Form of TNF in
Preadipocyte Cell Lines--
To study the potential effects of
transmembrane TNF in cultured adipocytes, we have ectopically
expressed a non-cleavable transmembrane form of murine TNF in
several preadipocyte cell lines. These include the 3T3-F442A cells and
the newly developed preadipocyte cell lines deficient in TNFR1, TNFR2,
or both.2 The non-cleavable form of TNF
(mTNF1-9K11E) has been generated by deleting amino acids 1-9 and
mutating residue 11 from Lys to Glu in the N-terminal part of mature
TNF and previously characterized in L929, CT6, PC60-R55/R75, and
U937 cells (8). In this study, we chose a retroviral expression system
to express constitutively the non-cleavable mutant (Fig.
1A) because of its high
integration efficiency. This system also allowed expression in a large
number of cells and prevented the common problem of clonal variability. The exogenous TNF message was readily identified in infected cells
since it is larger than the endogenous one produced by LPS-stimulated Raw264.7 macrophages (Fig. 1B). Comparable levels of
mTNF1-9K11E expression were demonstrated by Northern blot analysis
in all stably infected preadipocyte cell lines (Fig. 1B).
Messenger RNA levels of both TNF receptors were also determined in all
cell types to demonstrate the presence and potential regulation of the
relevant TNF receptors. The TNFR2 mRNA level in 3T3-F442A cells
expressing mTNF1-9K11E was substantially higher than those expressing vector alone (Fig. 1B, lanes 3 and
4). Expression of mTNF1-9K11E in
TNFR1/ cells did not affect TNFR2 mRNA
level (Fig. 1B, lanes 5 and 6). This indicates
that either the regulation of TNFR2 mRNA expression by
mTNF1-9K11E requires the presence of TNFR1, or base-line TNFR2 expression in these cells is already at maximum levels. Endogenous TNFR1 mRNA levels were unaffected by the presence of
mTNF1-9K11E.
View larger version (32K):
[in this window]
[in a new window]
|
Fig. 1.
Expression of a non-cleavable murine
TNF1-9K11E in preadipocyte cell lines.
A, map of the mTNF1-9K11E retroviral expression vector.
LTR, long terminal repeat. B, expression of
endogenous TNF message in LPS-induced macrophages (Raw 264.7) and
mTNF1-9K11E in 3T3-F442A, TNFR1/,
TNFR2/, and
TNFR1/R2/ proliferating
preadipocyte cell lines. V, vector-infected; T,
mTNF1-9K11E-infected. Lanes 1 and 2,
endogenous TNF message of Raw264.7 macrophages before and after
treatment with 100 ng/ml lipopolysaccharide (LPS) for 3 h. C, expression of mTNF1-9K11E on the cell surface.
Left, mTNF1-9K11E-expressing
TNFR1/R2/ cells stained with
a polyclonal rabbit anti-murine TNF antibody followed by staining of
a fluorescein-conjugated anti-rabbit IgG. Right,
vector-infected cells with the same treatment. D, ectopic
TNF expression in subcellular fractions of adipocytes.
M , macrophages (Raw264.7). Top panel shows a
TNF immunoblot of membrane and cytosolic fractions (100 µg of
protein each lane) from differentiated vector, mTNF1-9K11E and wild
type (wt)TNF-expressing
TNFR1/R2/ cells. Fraction 1 (Frac 1, low speed spin fraction) contains plasma membrane;
fraction 2 (Frac 2, high speed spin fraction) contains intracellular membranes; soluble
(Sol) fraction contains cytosolic materials. Lanes 1, 4, and 7, vector-infected cells. Lanes 2, 5 and 8, mTNF1-9K11E-expressing cells. Lanes 3, 6, and 9, wtTNF-expressing cells. Lane
10, 500 pg of recombinant soluble murine TNF. Lanes
11 and 12, 20 µg of protein from plasma
membrane-containing fraction of control and lipopolysaccharide
(LPS)-stimulated macrophages, respectively.
Middle and bottom panels, same samples were used
for blotting with a polyclonal rabbit anti-rat Na,K-ATPase antibody
(1:5000 dilution) and a polyclonal rabbit anti-murine aP2 antibody
(1:1000 dilution) as controls for membrane and cytosolic fractions,
respectively. E, immunoreactive TNF in conditioned media
from vector, mTNF1-9K11E, and wtTNF-expressing
TNFR1/R2/ cells. Lanes
1 and 2, conditioned media from control and
LPS-stimulated macrophages. Lanes 3-5, conditioned media
from differentiated vector, mTNF1-9K11E, and wtTNF-expressing
TNFR1/R2/ cells. Upper
panel, immunoprecipitates were immunoblotted with an anti-TNF
antibody. Bottom panel, direct immunoblot analysis of the
same samples with an anti-ACRP30 antibody (1:500 dilution) as a control
for proper protein secretion.
|
|
Proper expression and localization of mTNF1-9K11E as a membrane
protein was determined by both indirect immunofluorescence in intact
cells and immunoblot analysis of cellular fractions. As shown in Fig.
1C, expression of mTNF1-9K11E protein on
TNFR1/R2/ cells could be
visualized by the use of a polyclonal rabbit anti-murine TNF
antibody (left panel) followed by a fluorescein-conjugated anti-rabbit IgG. The peripheral distribution of fluorescence is consistent with plasma membrane-associated localization. To confirm this further, we performed immunoblot analysis of cellular fractions of
adipocytes (Fig. 1D, top panel) which showed that
mTNF1-9K11E was predominantly detected in a high density
membrane-containing fraction. This fraction is enriched with plasma
membranes as confirmed by the detection of Na,K-ATPase (Fig. 1D,
middle panel) which is a commonly used plasma membrane marker
(37). Insulin receptor was also detected in this fraction (data not
shown). The mTNF1-9K11E protein was expressed as a 25-kDa protein
compared with the wild type 26-kDa mTNF. In both mTNF1-9K11E and
wtTNF-expressing cells, two additional smaller molecular weight
bands have been consistently detected in the membrane fractions. These
are likely to be products of alternative initiation sites as previously
reported (38). Transmembrane TNF1-9K11E protein level in total cell extracts from different cell lines was also similar as determined by
immunoblotting (data not shown). The protein expression level of the
non-cleavable mutant in our system is estimated to be 5% of the
endogenous counterpart produced by LPS-stimulated macrophages quantitated by densitometry scanning of immunoblots. No mTNF1-9K11E protein was detected in cytosol. This fraction is indeed enriched with
cytosolic proteins as confirmed by immunoblotting for cytosolic adipocyte fatty acid-binding protein, aP2 (Fig. 1D, bottom
panel). Finally, we also examined whether in our experimental
system, the mTNF1-9K11E could be aberrantly cleaved at other sites
to yield sTNF products. Immunoblot analysis of concentrated
conditioned media did not reveal any detectable TNF immunoreactivity
from vector and mTNF1-9K11E-expressing cells but did show the
presence of sTNF from wtTNF-expressing cells (Fig. 1E, top
panel). ACRP30/AdipoQ (adipocyte complement-related protein of 30 kDa) (39, 41), a secreted protein exclusively made in adipocytes, was
used as a control for proper protein secretion to the conditioned media from these cells (Fig. 1E, right panel). These data
demonstrated that mTNF1-9K11E was expressed on the cell surface and
did not produce detectable sTNF. These results are essentially
identical to those observed in lymphocytes using the same construct
(8).
Effects of mTNF1-9K11E on the Differentiation of
Adipocytes--
The 3T3-F442A preadipocyte cell line is commonly used
as an experimental model for adipocyte differentiation in
vitro (40, 42). These cells express both TNF receptors but do not
produce detectable levels of endogenous TNF (Fig. 1B). In
these cells, we first examined whether ectopic expression of
mTNF1-9K11E could lead to alterations in the differentiation
process. Four different permissive conditions for adipocyte
differentiation were used to compare control 3T3-F442A cells to those
expressing mTNF1-9K11E. The induction conditions used were as
follows: (a) insulin alone (5 µg/ml); (b)
insulin, dexamethasone (1 µM), and isobutylmethylxanthine (0.5 mM); (c) insulin and BRL49653 (1 µM), an activator for the adipogenic transcription factor
peroxisome proliferator-activated receptor 
(PPAR); and
(d) a mixture containing all four of the above reagents.
After the induction of differentiation with these reagents for 3 days,
cells were maintained in 5 µg/ml insulin for 4 more days. Experiments
were then stopped for morphological and molecular comparison of
vector-infected control cells with those expressing mTNF1-9K11E. In
the absence of any adipogenic stimuli, 6 ± 0.6% of control
3T3-F442A cells spontaneously differentiated into adipocytes, whereas
no morphological sign of differentiation was detectable in
mTNF1-9K11E-expressing cells (Fig.
2A). The use of insulin as the
only inducer resulted in the differentiation of 37 ± 2.9%
control cells, but this effect was completely blocked by the presence
of mTNF1-9K11E (Fig. 2A). When a mixture of insulin, dexamethasone, and isobutylmethylxanthine was used, all control F442A
cells differentiated. However, only 36 ± 2.1% of
mTNF1-9K11E-expressing cells differentiated into fat cells under
this condition. The addition of BRL49653, a thiazolidinedione compound
which acts as a high affinity ligand for PPAR, significantly reduced
the effect of mTNF1-9K11E on adipocyte differentiation. The effect of BRL49653 was incomplete (18 ± 3.7% differentiation) when used with insulin alone but complete when used in combination with insulin,
dexamethasone, and isobutylmethylxanthine.
View larger version (92K):
[in this window]
[in a new window]
|
Fig. 2.
Effects of
mTNF1-9K11E on differentiation of 3T3-F442A
cells. A, effects of mTNF1-9K11E on the morphology
of 3T3-F442A cells during differentiation. Upper panel shows
vector-infected 3T3-F442A cells treated with (from left to
right) medium (control), insulin
(Ins), insulin + BRL49653 (Ins+BRL), insulin + dexamethasone + isobutylmethylxanthine (Mix), and all four
reagents (Mix+BRL); lower panel shows
mTNF1-9K11E-infected cells with the same treatments. Cells were
fixed with glutaraldehyde and stained with oil red O. B,
effects of mTNF1-9K11E on gene expression in 3T3-F442A cells during
differentiation. U, uninfected; V,
vector-infected; T, mTNF1-9K11E-infected. For the first
group of controls (lanes 1-3), RNA was collected at
confluency. For the second group of controls (lanes 4-6),
cells were maintained at confluency, and RNA was collected
simultaneously with the samples from induced cells. In lanes
7-9, cells were induced by 5 µg/ml insulin; lanes
10-12, induced by insulin + 1 µM BRL49653
(lanes 10-12). C, gene expression in vector
(V) or mTNF1-9K11E-infected (T) 3T3-F442A
cells induced by Mix+BRL in the presence (+) or absence ( )
of hygromycin B (HygB). Results showed here are
representative of three independent experiments.
|
|
To compare these effects of mTNF1-9K11E to sTNF, 3T3-F442A cells
were also treated with recombinant murine soluble TNF. At a
concentration of 1 ng/ml, sTNF generated inhibitory effects similar
to those observed with the mTNF1-9K11E. The percentages of
differentiated cells under the four different induction conditions were
0% (insulin), 26 ± 5.7% (insulin and BRL49653), 41 ± 6.3% (insulin, dexamethasone, and isobutylmethylxanthine), and 99 ± 3.5% (combination of all reagents). At a concentration of 10 ng/ml, sTNF completely blocked differentiation under all conditions (data
not shown). During differentiation, experiments with both mTNF1-9K11E and soluble TNF, cells were closely monitored every day under microscope, and no obvious cytotoxic effect was observed. At
the end of differentiation, trypan blue uptake was performed to examine
cell viability, and no difference was observed between vector- and
mTNF1-9K11E-infected cells.
The morphological changes that occur during adipocyte differentiation
are accompanied by changes in expression patterns of fat-specific
genes, most of which are involved in creating and maintaining the
adipocyte phenotype (42). Therefore, expression of a panel of
adipose-specific genes can be used to serve as molecular indicators of
the state of differentiation. In order to evaluate the effects of
mTNF1-9K11E on adipocyte differentiation at the molecular level, we
next examined the mRNA levels of four genes that are expressed in a
differentiation-dependent manner in adipocytes. These were
the adipogenic transcription factor PPAR, the adipocyte fatty
acid-binding protein aP2, the serine protease adipsin, and the
insulin-dependent glucose transporter 4 (Glut4). Northern blot analyses were consistent with the morphological changes described above. The expression levels of all of these genes were also
significantly decreased in mTNF1-9K11E-expressing cells compared
with the controls. Fig. 2B (left panel) shows the
comparison of the expression levels of PPAR, Glut4, adipsin, and aP2
in uninfected, vector-infected, and mTNF1-9K11E-expressing cells.
The presence of mTNF1-9K11E completely inhibited expression of
these genes in cells induced to differentiate with insulin alone
(lanes 7-9), whereas no obvious difference was observed
between uninfected and vector-infected F442A cells. Addition of
BRL49653 or dexamethasone and isobutylmethylxanthine dramatically
increased the expression of all of these fat-specific genes in
uninfected and vector-infected cells. This also partially antagonized
the effect of mTNF1-9K11E on adipocyte differentiation (Fig.
2B, lanes 10-14). The combination of all adipogenic
reagents completely prevented the effect of mTNF1-9K11E, and no
difference in gene expression could be detected between vector-infected
and mTNF1-9K11E-expressing cells under this condition (Fig.
2B, lanes 15 and 16). However, when
cells were induced to differentiate in the presence of continuous
selection pressure, the inhibitory effect of mTNF1-9K11E could
still be observed even when the strongest induction mixture was applied
(Fig. 2C). This was consistent with a higher expression
level of mTNF1-9K11E in the presence of continuous selection (Fig.
2C, bottom panel). For these reasons, continuous antibiotic
selection was used throughout the remaining experiments described below.
TNFR1 Is Required for Mediating the Anti-adipogenic Effect of
mTNF1-9K11E--
The TNF receptor responsible for mediating the
inhibitory action of mTNF1-9K11E on adipocyte differentiation was
determined by expressing this molecule in
TNFR1/, TNFR2/,
and TNFR1/R2/ preadipocyte
cell lines. In TNFR1/R2/
preadipocytes, which lack both TNF receptors, the expression of
mTNF1-9K11E had no effect on differentiation as judged by both
morphology and adipocyte-specific gene expression (Fig.
3A, top panel; B, lanes
15 and 16). Identical results were obtained in
TNFR1/ preadipocytes which only express wild
type TNFR2 but do not carry a functional TNFR1 gene. No
obvious difference was observed between vector-infected and
mTNF1-9K11E-expressing TNFR1/ cells
based on morphology of the cells or fat-specific gene expression (Fig.
3A, middle panel; B, lanes 7 and
8). This demonstrates that TNFR2 alone cannot mediate this
action. In TNFR2/ preadipocytes carrying wild type
TNFR1 but no functional TNFR2, the expression of mTNF1-9K11E
resulted in inhibition of differentiation (Fig. 3A, bottom
panel; B, lanes 11 and 12). Only 18.2 ± 3.3% of mTNF1-9K11E-expressing TNFR2/ cells
differentiated under this condition. Further quantitation of
fat-specific genes indicated that the expression levels of PPAR,
Glut4, aP2, and adipsin were 31 ± 8, 18 ± 12, 40 ± 5, and 9 ± 12%, respectively, of those detected in vector-infected
control cells. These results demonstrate that the presence of TNFR1
alone is sufficient for signaling the inhibitory effect of
mTNF1-9K11E on adipocyte differentiation. To rule out the
possibility that TNFR2 function might be generally deficient in
TNFR1/ cells, mTNF1-9K11E-stimulated
NF-B activation was determined in these cells. As shown in Fig.
3C, mTNF1-9K11E could effectively activate NF-B in
both TNFR1/ and
TNFR2/ cells but not in
TNFR1/R2/ preadipocytes,
confirming that the signaling capacity of TNFR2 was intact in
TNFR1/ cells. These results demonstrate that
TNFR1 is necessary for the inhibition of differentiation induced by
mTNF1-9K11E.
View larger version (50K):
[in this window]
[in a new window]
|
Fig. 3.
TNFR1 is required for mediating the
anti-adipogenic effect of mTNF1-9K11E.
A, morphological analysis of vector and
mTNF1-9K11E-infected TNFR1/,
TNFR2/, and
TNFR1/R2/ cells stained with
oil red O. The views of both whole plates (left panel) and
microscopies (right panels) are shown. Upper
panels, vector and mTNF1-9K11E-infected
TNFR1/R2/ cells induced by
Mix + BRL49653 in the presence of 200 µg/ml hygromycin B. Middle and lower panels,
TNFR1/ and TNFR2/
cells with the same treatment. B, fat-specific gene
expression in vector and mTNF1-9K11E-infected 3T3-F442A,
TNFR1/, TNFR2/, and
TNFR1/R2/ cells. Lanes
1-4, vector (V) and mTNF1-9K11E-infected
(T) 3T3-F442A cells without induction () or induced (+) by
Mix+BRL in the presence of 200 µg/ml hygromycin B. Lanes 5-8, 9-12, and 13-16 are vector and
mTNF1-9K11E-infected TNFR1/,
TNFR2/, and
TNFR1/R2/ cells,
respectively, with the same treatments. C, NF-B
activation in TNFR1/,
TNFR2/, and
TNFR1/R2/ cells transfected
with vector or mTNF1-9K11E. Results are expressed as fold of
activation over control in each cell type. Results shown here are
representative of at least two independent experiments.
|
|
We also examined the effect of soluble TNF on adipocyte
differentiation in these cellular systems. Recombinant murine TNF was applied every 2 days at two doses of 1 and 10 ng/ml, respectively. Treatment of TNFR1/R2/ or
TNFR1/ cells with sTNF did not affect
differentiation at both concentrations used in experiments (data not
shown). In contrast, in the presence of 1 ng/ml sTNF,
differentiation was evident in only 53.3 ± 6.4% of the
TNFR2/ cells. At the concentration of 10 ng/ml, sTNF almost completely inhibited adipocyte differentiation
(<1% differentiation). These data indicate that both sTNF and
mTNF can inhibit adipocyte differentiation through TNFR1, and the
extent of inhibition is dose- or expression
level-dependent, respectively.
mTNF1-9K11E Inhibits Adipocyte Differentiation through TNFR1
Alone--
To confirm the role of TNFR1 in mediating the
anti-adipogenic effect of mTNF1-9K11E within the same cellular
background, we next introduced intact TNFR1 back into the
TNFR1/ preadipocytes expressing
mTNF1-9K11E. Since these cells are already resistant to neomycin
and hygromycin B, the retroviral vector containing puromycin resistance
gene was used for exogenous TNFR1 expression. Four stably-infected
TNFR1/ cell lines were established,
expressing 1) vectors with hygromycin B and puromycin resistance genes,
2) vector with hygromycin B resistance gene and TNFR1, 3)
mTNF1-9K11E and vector with puromycin resistance gene, and 4)
mTNF1-9K11E and TNFR1. In cells expressing both mTNF1-9K11E and
TNFR1, exogenous TNFR1 expression levels were significantly lower than
those expressing only TNFR1 (Fig. 4).
Since direct regulation of the exogenous gene is not expected, it is
likely that overexpression of high levels of both mTNF1-9K11E and
TNFR1 simultaneously is cytotoxic, so only cells with low TNFR1
expression levels survived the selection protocol. After the initial
selection period, no cytotoxicity was observed when cells were kept
growing in appropriate antibiotics. All cell lines were also tested for
differentiation. As shown in Fig. 4, mTNF1-9K11E-induced inhibition
of adipogenesis was only observed when both mTNF1-9K11E and TNFR1
were expressed simultaneously in TNFR1/
cells.
View larger version (60K):
[in this window]
[in a new window]
|
Fig. 4.
Effects of reconstituted TNFR1 expression on
mTNF1-9K11E-expressing
TNFR1/ preadipocytes. The expression
levels of PPAR, Glut4, aP2, and adipsin mRNAs were compared in
TNFR1/ adipocytes expressing mTNF1-9K11E
with or without exogenous TNFR1. Lanes 1, 5, and
9, TNFR1/ cells expressing
hygromycin B (V)- and puromycin-resistant vectors (used to
express TNFR1); lanes 2, 6, and 10, TNFR1/ cells expressing mTNF1-9K11E
(T) and puromycin-resistant vector; lanes 3, 7, and 11, TNFR1/ cells expressing
hygromycin B-resistant vector (V); and TNFR1, and
lanes 4, 8, and 12, TNFR1/ essing both mTNF1-9K11E
(T) and TNFR1. Lanes 1-4, control; lanes
5-8, induced by Mix in the presence of 200 µg/ml hygromycin B;
lanes 9-12, induced by Mix+BRL in the presence
of 200 µg/ml hygromycin B. Results shown are representative of at
least two independent experiments.
|
|
To determine whether TNFR2 cooperates with TNFR1 in inhibiting
adipocyte differentiation, TNFR2 expression was also reconstituted in
TNFR2/ preadipocytes expressing
mTNF1-9K11E. The retroviral vector containing bleomycin resistance
gene was used to express TNFR2. The stably infected
(TNFR2/) cell lines were established
expressing the following: 1) vectors with hygromycin B and bleomycin
resistance genes, 2) vector with hygromycin B resistance gene and
TNFR2, 3) mTNF1-9K11E and vector with bleomycin resistance gene,
and 4) mTNF1-9K11E and TNFR2. Exogenous TNFR2 expression levels
were significantly higher in (TNFR2/) cells
expressing both mTNF1-9K11E and TNFR2 than in cells expressing only
TNFR2. The ability of mTNF1-9K11E to inhibit adipocyte
differentiation was not enhanced in (TNFR2/)
preadipocytes overexpressing TNFR2 when compared with the parental (TNFR2/) cells (Fig.
5). Hence, TNFR2 did not potentiate the
inhibitory functions of mTNF1-9K11E on adipocyte differentiation
mediated by TNFR1. These results demonstrate that the transmembrane
TNF inhibits adipocyte differentiation by engaging TNFR1 alone.
View larger version (56K):
[in this window]
[in a new window]
|
Fig. 5.
Effects of reconstituted TNFR2 expression on
mTNF1-9K11E-expressing
(TNFR2/) preadipocytes. The expression
levels of PPAR, Glut4, aP2, and adipsin mRNAs were compared in
TNFR2/ cells expressing mTNF1-9K11E with or without
exogenous TNFR2. Lanes 1 and 5, (TNFR2/) cells expressing hygromycin B
(V)- and bleomycin-resistant (used to express TNFR2)
vectors; lanes 2 and 6,
(TNFR2/) cells expressing mTNF1-9K11E
(T) and bleomycin-resistant vector; lanes 3 and
7, (TNFR2/) cells expressing
hygromycin B-resistant vector (V) and TNFR2; and lanes
4 and 8, (TNFR2/) cells
expressing both mTNF1-9K11E (T) and TNFR2. Lanes
1-4, control; lanes 5-8, induced by
Mix+BRL in the presence of 200 µg/ml hygromycin B. Results
shown are representative of at least two independent experiments.
|
|
| |
DISCUSSION |
The wide array of biological actions of TNF is regulated at
many levels. The presence of both transmembrane and secreted forms of
functional TNF ligands adds a spatial mode of control to TNF
actions. As the local actions of this molecule are recognized in both
physiological and pathological states, understanding the biology of its
cell surface-associated form becomes more critical. However, in
contrast to the well characterized function and signaling of sTNF,
information regarding mTNF is still limited.
The actions of sTNF on adipocytes have also been extensively
investigated. Numerous reports have shown that sTNF has strong negative effects on adipocyte differentiation (43-46). Furthermore, the use of human TNF in cultured murine adipocytes has indicated that TNFR1 can mediate this effect (43, 44). On the other hand, the
biological activities and signaling mechanisms of mTNF have
not yet been determined in this respect. In this study, we have
generated several preadipocyte cell lines stably expressing a
non-cleavable form of TNF (mTNF1-9K11E) to examine its actions in adipocytes. These studies demonstrate that mTNF1-9K11E is biologically active in several independent preadipocyte cell lines and
can induce marked alterations in the adipocyte differentiation program.
In wild type cells carrying both functional TNF receptors, expression
of mTNF1-9K11E led to significant inhibition of terminal differentiation into adipocytes. The biological activities generated by
mTNF1-9K11E in our experimental system are unlikely to be supra-physiological since the protein expression level of the noncleavable mutant is about 5% of the endogenous counterpart produced
by LPS-stimulated macrophages.
Our parallel experiments with sTNF generated results consistent with
previous reports and demonstrated that adipocyte differentiation can be
altered similarly by both mTNF1-9K11E and sTNF under the
experimental conditions used in this study. In addition, the observation that the use of BRL49653 can reverse the anti-adipogenic effects of mTNF1-9K11E is also consistent with previous reports, which demonstrated that similar compounds could block the inhibitory effects of sTNF on adipocyte differentiation (47, 48). The extent of
inhibition of differentiation by both mTNF1-9K11E and sTNF was
dependent on the amount of ligand and on the strength of the induction
conditions. Under the experimental conditions where mTNF1-9K11E
expression is stable, it is possible that stronger induction conditions
could deliver stronger or multiple adipogenic signals, which cannot be
completely blocked by a constant level of mTNF1-9K11E. Consistent
with this, we observed that high levels of both sTNF (10 ng/ml) and
mTNF1-9K11E (obtained by continuous selection, Fig. 2C)
can still block adipocyte differentiation even under the most
permissive condition. Therefore, it is reasonable to assume that there
is a balancing point between adipogenic and anti-adipogenic signals,
the outcome of differentiation will be determined by the relative
strength of signals from either side.
In this study, we have also determined the TNF receptor responsible for
mediating this action of mTNF1-9K11E by utilizing newly developed
preadipocyte cell lines deficient in TNFR1, TNFR2, or both receptors.
These cells can differentiate into adipocytes with high efficiency and
thus provided a valuable experimental system to study signaling through
each TNF receptor. Expression of mTNF1-9K11E in
TNFR1/, TNFR2/,
and TNFR1/R2/ preadipocyte
cell lines demonstrated that TNFR1 is necessary for the inhibitory
action of mTNF1-9K11E on adipocyte differentiation. By introducing
TNFR1 or TNFR2 back into the TNFR1/ or
TNFR2/ cell lines, respectively, we have
further demonstrated that mTNF1-9K11E selectively acts through
TNFR1 and signaling through this receptor is necessary and sufficient
for its effects. This latter experiment also allowed us to use the
identical cellular background to examine the possibility of cooperative
signaling between TNFR1 and TNFR2. Reconstitution of TNFR1 in
TNFR1/ preadipocytes restored the inhibitory
effect of mTNF1-9K11E on differentiation. In contrast,
overexpression of TNFR2 in TNFR2/ preadipocytes did not
enhance this inhibitory action of mTNF1-9K11E mediated by TNFR1.
Therefore, we conclude that mTNF1-9K11E inhibits adipocyte
differentiation by selectively activating TNFR1.
The fact that mTNF1-9K11E does not utilize TNFR2 to inhibit
adipocyte differentiation is somewhat unexpected since other studies
have shown that it engages TNFR2 (15) or both TNFR1 and TNFR2 (9, 14).
TNFR2 is expressed in both preadipocytes and adipocytes and is elevated
in obesity (4, 49). In human adipocytes, it plays a complementary role
in sTNF-mediated inhibition of insulin receptor signaling through
TNFR1 (50). However, it is not involved in inhibition of adipogenesis
by either transmembrane or soluble TNF. Taken together, these
observations suggest that mTNF can engage both TNFR1 and TNFR2, but
receptor selectivity or biological outcome may be dependent upon the
cell type or the underlying pathophysiology or possibly the expression
level of the transmembrane ligand.
Finally, earlier studies have shown that TNFR1 can mediate other
sTNF functions in adipocytes, in addition to signaling the anti-adipogenic activity. These include modulation of leptin production (51, 52) and inhibition of insulin signaling in murine adipocytes (31).
Further studies will be necessary to elucidate whether mTNF exerts
similar actions, and selective usage of TNFR1 is a general mechanism in adipocytes.
The fact that TNF is biologically active in adipocytes when retained
on the cell surface makes it a candidate mediator of other local
TNF-induced responses. It is tempting to speculate that this might
potentially be relevant in disease states involving adipose mass and/or
altered local levels of tissue TNF, such as obesity, or
lipodystrophies. It is also possible that mTNF produced in the
stroma-vascular component of adipose tissue, from either preadipocytes
or macrophages, could also affect adipocytes through cell-cell contact.
Thus, if mTNF is active in mediating other effects that influence
the metabolism and/or number of adipocytes, it might also have a strong
impact on systemic energy metabolism. However, the limitations of the
applicability of the studies in cultured cells to whole animals are
obvious. Further in vivo studies, including gain of function
transgenic mice, are needed to address the role of this form of TNF
in regulating adipocyte biology locally under physiological or
pathological conditions.
| |
ACKNOWLEDGEMENTS |
We thank K. Teoman Uysal, Sarah M. Wiesbrock,
and Ludger Scheja for their contributions in establishing TNF
receptor-deficient cell lines. We are grateful to Drs. Els Decoster and
Walter Fiers (Gent University, K. L. Ledeganckstraat, Belgium) for
providing the cDNA of the non-cleavable murine TNF1-9K11E.
| |
FOOTNOTES |
*
This work was supported by an American Diabetes Association
Career Development award and in part by National Institutes of Health
Grant DK52539 (to G. S. H.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Wellcome Trust research fellow.
§
To whom correspondence should be addressed: Harvard School of
Public Health, Division of Biological Sciences and Dept. of Nutrition,
665 Huntington Ave., Boston, MA 02115. Tel.: 617-432-1950; Fax:
617-432-1941; E-mail: ghotamis@hsph.harvard.edu.
2
J. K. Sethi, H. Xu, K. T. Uysal,
S. M. Wiesbrock, L. Scheja, and G. Hotamisligil, submitted for publication.
| |
ABBREVIATIONS |
The abbreviations used are:
TNF, tumor
necrosis factor ;
sTNF, secreted tumor necrosis factor ;
mTNF, wild type transmembrane tumor necrosis factor ;
TNFR, TNF
receptor;
PPAR, peroxisome proliferator-activated receptor ;
mTNF1-9K11E, a non-cleavable murine TNF mutant;
DMEM, Dulbecco's modified Eagle's medium;
PBS, phosphate-buffered saline;
LPS, lipopolysaccharide;
wt, wild type.
| |
REFERENCES |
| 1.
|
Beutler, B.,
and Cerami, A.
(1989)
Annu. Rev. Immunol.
7,
625-655[Medline]
[Order article via Infotrieve]
|
| 2.
|
Grunfeld, C.,
and Feingold, K. R.
(1991)
Biotherapy
3,
143-158[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Hotamisligil, G. S.,
and Spiegelman, B. M.
(1994)
Diabetes
43,
1271-1278[Abstract]
|
| 4.
|
Hotamisligil, G. S.,
Shargill, N. S.,
and Spiegelman, B. M.
(1993)
Science
259,
87-91[Abstract/Free Full Text]
|
|
TOP
ABSTRACT
INTRODUCTION
