 |
INTRODUCTION |
The 
2 integrin lymphocyte function-associated
antigen-1 (LFA-1)1
(CD11a/CD18 or 
L2) is a
leukocyte-specific adhesion receptor that coordinates different
adhesive and signaling interactions within the immune system (1-4).
LFA-1 mediates cell-cell adhesion upon binding to its cellular ligand
intercellular adhesion molecule-1 (ICAM-1) (5). At distinct sites in
the body, leukocytes behave as adherent cells, whereas at other sites
they have to circulate as nonadherent cells. This dynamic control of
adhesion is regulated by binding strength, and the kinetics of
interactions between adhesive ligands and 2 integrins.
In addition, events such as lateral diffusion of integrins (6-11) and
interactions with and reorganization of the cytoskeleton enforce
adhesion (12, 13). Integrins are heterodimeric transmembrane molecules
composed of an chain that is noncovalently linked to a chain.
The cytoplasmic tails of LFA-1, as well as other integrins, are
essential for control of adhesion. Mutation or deletion of specific
cytoplasmic sequences causes integrins to become constitutively active
and have also revealed amino acids located in the 2
cytoplasmic tail that interact with the cytoskeleton (14-16). On
resting, lymphocytes LFA-1 is inactive. It is thought that the
attachment of LFA-1 to the actin cytoskeleton keeps the integrin in an
inactive state. Binding to its ligand ICAM-1 is only observed through
intracellular signals (3, 17-19) by TCR/CD3 cross-linking that causes
LFA-1 activation (17, 18). A temporary dislodgment from the actin cytoskeleton may facilitate lateral diffusion of 2
integrins into clusters (9, 10, 20, 21), as can be observed after disruption of the cytoskeleton by cytochalasin D or activation of
calpaises that facilitate adhesion of 2 integrins
(22).
Activation of LFA-1 likely results in a conformational change in the
/ heterodimer, as evidenced by the expression of neo-epitopes or
activation epitopes (L16 and M24) (6, 23). This has led to the
speculation that affinity changes in LFA-1 are associated with
conformational alterations, leading to an enhanced binding to its
ligand ICAM-1 (24). Both affinity (active conformation) and avidity
(clustering) changes have been considered to be important for strong
LFA-1-mediated cell binding (25). These affinity/avidity-induced conformational changes in LFA-1 depend on an intact cytoskeleton, physiological temperature, and on binding of divalent cations, Mg2+ in particular (7, 23, 26, 27). Binding of
Ca2+ to LFA-1 supports clustering (high avidity state) of
LFA-1 on the cell surface resulting in enhanced LFA-1-mediated adhesion (7, 8). Antibodies such as NKI-L16, which recognizes a
Ca2+-dependent epitope on the chain of
LFA-1 have been used to detect clustered LFA-1 on the cell surface,
whereas the antibody M24 recognizes a
Mg2+-dependent epitope on LFA-1 that coincides
the high affinity state of LFA-1 or ligand bound state (23, 28, 29).
Although the cytoplasmic tails of the and chain LFA-1 are
relatively short (58 and 45 amino acids, respectively) and do not
contain any intrinsic kinase activity, the cytoplasmic tails seem to be
involved in affinity or avidity regulation and cytoskeleton
association. It has been demonstrated that the adhesiveness of LFA-1 is
controlled by the cytoplasmic domain of the 2 subunit,
because truncation of the cytoplasmic 2 tail, but not
the L tail, eliminates LFA-1 binding to ICAM-1 (30).
Because deletion of the cytoplasmic domain of the L
subunit does not affect binding to ICAM-1, it is hypothesized that the
cytoplasmic tail of L is predominantly involved in
"post-ligand binding" events by integrins (30).
In this work, we have examined the role of the L and
2 cytoplasmic domains of LFA-1 on their capacity to
regulate ligand binding affinity and avidity, and on the interaction
with the actin cytoskeleton network. We observed that the cytoplasmic
tail of both the 2 chain and the GFFKR sequence in the
L cytoplasmic tail play a pivotal role in regulating
ligand binding through induction of avidity changes rather than by
affinity changes.
| |
EXPERIMENTAL PROCEDURES |
Monoclonal Antibodies--
The monoclonal antibodies (mAbs)
SPV-L7 (IgG1), NKI-L15 (IgG2a), and NKI-L16 (IgG2a) reactive with the
chain of LFA-1 were raised as described previously (31, 32).
NKI-L16 recognizes a Ca2+-dependent epitope on
the chain of LFA-1 (32). The nonblocking mAb TS2/4 (IgG1) reactive
with L (33), M24 (IgG1) that recognizes a
Mg2+-dependent epitope on L
(23), mAb 60.3 (IgG1) directed against 2 (34), and mAb
KIM185 (IgG1) used to activate 2 integrins (35), were
kindly provided by Drs. E. Martz, N. Hogg, J. Harlan, and M. Robinson,
respectively
DNA Constructs--
The chimeric chain constructs
L4 and LX
were generated by PCR using oligonucleotides for the
L containing at the 5' end a StuI site
(GAGATCGAGGCCTCTTCC) and at the 3' end a AatII site
(TTATAGACGTCCAACCTTGTACAGCACTAT). Oligonucleotides for the 4 and x contained at the 5' end
AatII site (ATATTGACGTCTTCTTTAAAAGACAATACAAATC, and
TTATTGACGTCTTCTTCAAGCGTCAGTAC, respectively) and at the 3' end a
EclXI site (ATAAACGGCCGCATGAAGACATAATATGTCAC and
ATATACGGCCGGTGGTGCAGTGGTTCC, respectively). Digestion of the PCR
products with AatII followed by ligation of the two products
was furthermore cloned by StuI and EclXI
digestion in the pBluescript vector containing the L cDNA thereby creating an AatII site in the chimeric
product. The 
KVGFFKR mutant was created by PCR with primers
containing at the 5' end a StuI site and at the 3'end a
AatII site for L (see above) and an
L PCR product using primers containing at the 5' end
RSAI site (ATTTGTACAACCTGAAGGAGAAGATGG) and at the 3' end EclXI (TTATACGGCCGGACTCAGTCCTTGCCAC). These two PCR products
were ligated and digested with RSAI in chain removing only the
KVGFFKR sequence from the L cytoplasmic tail. The
L cytoplasmic deletion mutants 1088L
and 1095L were generated by introduction of a
termination codon into the L cDNA by P-Alter. The
following antisense oligonucleotides were used for mutation and
amplification (1088L, GTGCTGTACTAGGTTGGTTTC; and
1095L, TCTTCAAACGGTAGCTGAAGGAG). All
L cDNA constructs in pBluescript were digested with
HindIII and EclX1 and cloned in the pRc/CMV
vector (containing a neomycin resistance gene; Invitrogen Corp., San
Diego, CA). The 4.2-kilobase chain of LFA-1 was cloned in the
HindIII site of pRc/CMV. The 2 mutant of
LFA-1 was made by truncation of the 2 cytoplasmic tail
from amino acid 724 as described earlier (36) (Fig. 2).
Cell Culture and Transfection--
Stable LFA-1 expressing K562
transfectants were established by electroporation of 107
cells in 0.8 ml of PBS at 280 V and 960 µF with either the wild-type L (in pRc/CMV) and wild-type 2 subunit
(in pCDM8), or truncated L with 2
wild-type, truncated 2 and wild-type L or
double truncation mutants (36). K562-LFA-1 transfectants were cultured in RPMI 1640 medium (Life Technologies Ltd., Paisley, Scotland), supplemented with 10% fetal calf serum (BioWhittaker, Verviers, Belgium), 1% antibiotics/antimycotics (Life Technologies, Inc.). After
48 h, the neomycin analogue, geneticin (2 mg/ml; Life Technologies Ltd.) was added to the culture medium. The different transfectants were
sorted three or more times to obtain a homogeneous population of cells
expressing high levels of LFA-1. Positive cells were stained with
FITC-conjugated TS2/4 mAb and isolated using a Coulter Epics Elite cell
sorter (Coulter, Hialeah, FL).
Immunofluorescence Analysis--
Expression of LFA-1 on the
transfectants was determined by immunofluorescence. Cells (2 × 105) were incubated (30 min, 4 °C) in PBS containing
0.5% w/v bovine serum albumin (Roche Molecular Biochemicals, Mannheim,
Germany) and 0.01% sodium azide (10 mM; Merck, Hohenbrunn,
Germany), with appropriate dilutions of either an anti-integrin mAb or
an isotype-matched control antibody. For L16 staining, cells were
washed twice with cation-free PBS and staining was performed in the
presence or absence of 1 mM CaCl2. For M24
staining, LFA-1 was activated by 1 mM MnCl2 for
30 min at 37 °C in TSM, cells were washed and followed incubation
with monoclonal antibody M24 for 30 min, 4 °C. Subsequently cells
were incubated with FITC-labeled goat (Fab')2 anti-mouse IgG mAb (Zymed Laboratories, Inc., San Francisco, CA)
for 30 min at 4 °C. The relative fluorescence intensity was measured
by FACScan analysis (Becton Dickinson).
Ligand Coating of Fluorescent
Microspheres--
Carboxylate-modified TransFluorSpheres (488/645 nm,
1.0 µm; Molecular Probes) were coated with adhesion ligands as
follows. Streptavidin was covalently coupled to the TransFluorSpheres
as described by the manufacturer. 20 µl of streptavidin (5 mg/ml in
50 mM MES buffer) was added to 50 µl TransFluorSpheres.
30 µl of 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (1.33 mg/ml) was added and the mixture was incubated at room temperature for 2 h. The reaction was stopped by the addition of glycine to a final
concentration of 100 mM. The streptavidin-coated beads were washed three times with PBS (50 mM phosphate, 0.9% NaCl,
pH 7.4) and resuspended in 150 µl of PBA (PBS, 0.5% bovine serum
albumin (w/v), 0.002 M NaAz). This suspension remained
stable for 2 months if stored at 4 °C. The streptavidin-coated beads
(15 µl) were incubated with biotinylated goat-anti-human anti-Fc
(Fab')2 fragments (6 µg/ml) in 0.5 ml PBA for 2 h at
37 °C. The beads were washed once with PBA and incubated with human
IgG1 Fc-fused ligands (2500 ng/ml) in 0.5 ml overnight at 4 °C. The
IgG1 Fc-fused ligands used in this study were ICAM-1Fc. ICAM-1Fc
consist of the extracellular part of both proteins fused to a human
IgG1 Fc fragment. ICAM-1Fc was produced in Chinese hamster ovary K1
cells cotransfected with the ICAM-1-IgG1Fc (37) and pEE14 vector
similarly as was described for CD4 T lymphocyte glycoprotein (38). The
ICAM-1Fc concentration in the supernatant was determined by an IgG1
enzyme-linked immunosorbent assay, and the supernatant was used without
further purification. The ligand-coated beads were washed with PBA,
resuspended in 100 µl PBA, and stored at 4 °C.
Fluorescent Beads Adhesion Assay--
For cell adhesion to
ICAM-1, cells were resuspended in TSA (TSM (20 mM Tris-HCl,
pH 8.0, 150 mM NaCl, 1 mM CaCl2, 2 mM MgCl2), 0.5% bovine serum albumin (w/v);
5 × 106 cells/ml). 50,000 cells were preincubated
with/without LFA-1-blocking mAb (20 µg/ml) for 10 min at room
temperature in a 96-well V-shaped bottom plate. The ligand-coated
TransFluoSpheres (20 beads/cell) and different integrin stimuli (100 nM PMA (Calbiochem), LFA-1-activating mAbs, KIM185 (10 µg/ml), respectively, were added, and the suspension was incubated
for 30 min at 37 °C. The cells were washed with TSA and incubated
for 10 min at room temperature with FITC-conjugated anti-TS2/4-antibody. The cells were washed with TSA and resuspended in
100 µl TSA. The LFA-1 transfectants that expressed distinct levels of
LFA-1, as determined by staining for TS2/4-FITC, were gated (mean
fluorescence intensity of 40-60), to analyze only those cells that
have similar expression levels. Thus, this assay allows comparison of
different transfectants that express distinct levels of LFA-1.
LFA-1-mediated adhesion was measured by flow cytometry using the
FACScan. Values are depicted as integrin specific adhesion,
i.e. cell adhesion percentage minus cell adhesion percentage in the presence of a LFA-1 blocking mAb (NKI-L15), which was always less than 3%.
Soluble ICAM-1Fc Binding--
Transfectants were resuspended in
TSA (TSM (20 mM Tris-HCl, pH 8.0, 150 mM NaCl,
1 mM CaCl2, 2 mM
MgCl2), 0.5% bovine serum albumin (w/v); 5 × 106 cells/ml). 50,000 cells were preincubated with/without
LFA-1-blocking mAb (20 µg/ml) for 10 min at room temperature in a
96-well V-shaped bottom plate. Different concentrations of purified
soluble ICAM-1Fc was added together with medium or the LFA-1-activating
mAbs, KIM185 (10 µg/ml), and the suspension was incubated for 30 min
at 37 °C. The cells were washed with TSA and incubated for 30 min at room temperature with FITC-conjugated goat-anti-human Fc-specific antibody (Jackson Immunoresearch Labs, West Grove, PA). The cells were
washed with TSA and resuspended in 100 µl TSA. The percentage of
positive cells was measured by flow cytometry using the FACScan. Values
are depicted as percentage of positive cells, i.e. cell adhesion percentage minus cell adhesion percentage in the presence of
an integrin blocking LFA-1 mAb (NKI-L15), which was always less than
2% Alternatively, the concentration of soluble ICAM-1Fc that gives
half-maximal adhesion (ED50) is depicted.
Confocal Microscopy--
Cells were fixed with 0.5%
paraformaldehyde. Fixed cells were stained with TS2/4 mAb (10 µg/ml)
for 30 min at 4 °C, followed by incubation with FITC-labeled goat
(Fab')2 anti-mouse IgG mAb (Zymed Laboratories
Inc.) 30 min at room temperature. Cells were attached to
poly-L-lysine-coated glass slides, after which cell surface
distribution of integrins was determined by confocal laser scanning
microscopy (CLSM) at 488 nm with a krypton/argon laser (Bio-Rad 1000).
The CLSM settings were: lens, 60×; gain, 1300; pinhole, 1.5 µm; and
magnification, 2.0×. The same instrument settings of the CLSM were
used throughout the distinct experiments.
| |
RESULTS |
Active Regulation of LFA-1 Ligand Binding by Disconnecting the
Actin Cytoskeleton Network--
LFA-1 expressed on resting peripheral
blood lymphocytes is inactive and poorly binds ICAM-1, even when the
cells are stimulated by PMA (Fig. 1).
This might enable leukocytes by a mechanism to migrate through the
blood vessel wall in an nonadhesive state. Several findings have
demonstrated that a number of cytoskeletal components ( actinin,
talin) are attached to the cytoplasmic tails of LFA-1. LFA-1 connected
to the cytoskeleton remains inactive whereas temporary dislodgment of
the cytoskeleton by treatment of cells with cytochalasin D, reduces the
cytoskeleton restraints and results in enhanced LFA-1-ICAM-1-mediated
binding (Fig. 1) (10, 22). We have demonstrated that this temporary
dislodgment of the cytoskeleton alters the otherwise homogeneous cell
surface distribution of LFA-1 into the formation of clusters (10). Here we analyzed in detail whether the connection of the cytoskeleton to the
cytoplasmic tails of LFA-1 regulates cell adhesion by altering the cell
surface distribution of LFA-1 (avidity) and/or the affinity for ICAM-1.
We therefore generated different L and 2
cytoplasmic tail deletion mutants and chimeric cytoplasmic mutants that
were analyzed for these conditions (see "Experimental Procedures") (Fig. 2).
View larger version (19K):
[in this window]
[in a new window]
|
Fig. 1.
Disruption of the actin cytoskeleton network
enhances LFA-1-mediated ICAM-1 binding and clustering of LFA-1 on the
cell surface. Resting peripheral blood lymphocytes were treated
with cytochalasin D (5 µg/ml; 30 min at 37 °C) or untreated as a
control, followed by activation with PMA (50 nM). The mean
percentage of LFA-1-specific adhesion of triplicate wells is shown.
Specific adhesion is percentage of cells binding  percentage of
cells binding in the presence of a LFA-1-blocking mAb (NKI-L15). One of
three representative experiments is shown. LFA-1 cell surface
distribution was analyzed by staining cells with the anti-LFA-1 mAb
TS2/4 and FITC-labeled goat (Fab')2 anti-mouse IgG as
earlier described (36).
|
|
View larger version (14K):
[in this window]
[in a new window]
|
Fig. 2.
Schematic diagram of LFA-1
and subunit deletion
mutants. The wild-type and subunits are composed of a
large extracellular part, a transmembrane (black box), and a
cytoplasmic domain (right side). The conserved cytoplasmic
KVGFFKR sequence corresponding to amino acids 1088-1094 is adjacent to
the transmembrane domain. Mutant KVGFFKRL contained
an internal deletion of the KVGFFKR sequence. Mutants
1088L and 1095L were generated by
truncation of the cytoplasmic domain before and after the conserved
KVGFFKR sequence, respectively. The chimeric
XL and 4L
the X and 4 cytoplasmic tails,
respectively, are joined to the L cytoplasmic tail just
after the KVGFFKR sequence of L. The 2
cytoplasmic deletion mutants were created by truncation immediately
after the transmembrane at amino acid position 724 (36).
|
|
Chimeric LFA-1 Molecules and the Actin Cytoskeleton--
To
discriminate between the role of the integrin conserved KVGFFKR
sequence present in the cytoplasmic tail in affinity/avidity regulation and that of other amino acids C-terminal of this sequence, we generated chimeric LFA-1 receptors in which the L
cytoplasmic tail was swapped for that of X or
4. K562 transfectants expressing high levels of
L chimeric LFA-1 receptors (Fig.
3) were generated as described under
"Experimental Procedures." Analysis of expression levels of the L16
and the M24 epitopes, which have been described to be reporters for
clustered or activated LFA-1, respectively, are expressed on low levels
on both wild-type LFA-1 as on chimeric LFA-1 receptors as compared with
expression of regulatory LFA-1 epitopes (i.e. SPV-L7) (Table
I). As we earlier reported wild-type LFA-1 expressed in K562 cells does not bind ICAM-1 unless activated by
the activating anti-2 mAb (KIM185), whereas PMA is
incapable of activating LFA-1 expressed in these cells (36). Also
disconnection from the actin cytoskeleton network did not alter the
LFA-1-mediated adhesion after treatment with cytochalasin D (Table
II). Confocal laser microscopy studies
revealed that these chimeric cytoplasmic LFA-1 mutants did not show any
altered cell surface distribution of LFA-1 compared with wild-type
LFA-1 (data not shown). From these data we conclude that the C-terminal
part of LFA-1, immediately after the KVGFFKR region, is not involved in
the active connection of LFA-1 to the actin cytoskeleton network,
regulating avidity or affinity changes.
View larger version (16K):
[in this window]
[in a new window]
|
Fig. 3.
Expression of LFA-1 on LFA-1-transfected K562
cells. K562-L2 transfectants were
stained with specific antibodies directed against the subunit
(SPV-L7), the subunit of LFA-1 (60.3), or an isotype-matched
control antibody. One of five experiments is shown.
|
|
View this table:
[in this window]
[in a new window]
|
Table I
Expression of LFA-1 activation epitopes on the and cytoplasmic
deletion mutants
NKI-L16 expression was determined in the absence or presence of 1 mM CaCl2. The mean expression levels (relative
fluorescence intensity) and the ratio (Ca2+:+Ca2+)
are depicted. M24 expression was determined in the absence or presence
of 1 mM MnCl2. The mean expression levels and ratio
Mn2+:+Mn2+) are depicted. Expressions of isotype
match control antibody and LFA-1 staining by an anti-CD11a mAb SPV-L7
are presented as the mean expression levels.
|
|
View this table:
[in this window]
[in a new window]
|
Table II
Effect of cytochalasin D (CD) on the spontaneous ICAM-1 adhesion of
LFA-1 cytoplasmic deletion mutants
Various K-LFA-1 transfectants were pretreated with 10 µg/ml
cytochalasin D or Me2SO as control for 15 min at 37 °C and
subsequently allowed to adhere to ICAM-1Fc-coated fluorescent beads as
described in the Materials and Methods section. Percentage of cells
that spontaneously bind ICAM-1-coated fluorescent beads is depicted in
the presence or absence of cytochalasin D (% adhesion ± CD), and
factor by which adhesion is enhanced (adhesion index) is depicted (% adhesion with CD/% adhesion without CD). Whereas cytochalasin D has no
effect on binding of wild-type LFA-1 to ICAM-1 nor on the spontaneous
binding of the cytoplasmic deletion mutants, it enhances adhesion of
mutant 1095L/2 16-fold.
|
|
Domains in the and Cytoplasmic Tails Important in
Regulating LFA-1 Function--
To analyze in more detail, regions in
the cytoplasmic and tail of LFA-1 that are involved in the
avidity and/or affinity regulation of LFA-1/ICAM-1 binding, different
L and 2 cytoplasmic tail deletion mutants
were generated (Fig. 2). Cytoplasmic deletion mutants of the LFA-1 chain were created by deleting the cytoplasmic tail before the highly
conserved KVGFFKR region (1088 L) and just after the
KVGFFKR region (1095L), or by deleting only the KVGFFKR region (KVGFFKRL). Mutant 2
was generated by truncation of the 2 cytoplasmic tail
from the amino acid 724 tail of 2, deleting the
conserved DLRE motif (36). Thus, we created LFA-1 transfectants that
lack complete or parts of the L or 2
cytoplasmic tail alone or that lack both L and
2 cytoplasmic tails
(1088L/2 and
1095L/2). LFA-1 surface expression
on these K562 transfectants was evaluated by staining for
anti-2 and anti-L antibodies using flow
cytometry (Fig. 3). All mutants expressed similar levels of LFA-1
except those LFA-1 mutants that lack both the L and 2 cytoplasmic tail
(1088L/2 and
1095L/2) or that lacks only the
KVGFFKR region (KVGFFKRL) expressed low amounts of LFA-1. Mutations in the cytoplasmic tail of L or
2 did not affect / association of LFA-1 based on
expression of the MHM23 epitope, which has been reported to detect an
/ association-dependent epitope on LFA-1 (39), and
immunoprecipitation of LFA-1 from all mutants confirmed that mutant
LFA-1 was expressed as / heterodimers (data not shown).
Affinity and Avidity Regulation by the LFA-1 L and
2 Cytoplasmic Tails--
The capacity of the LFA-1 tail
deletion mutants to bind ICAM-1 was determined by the ICAM-1
fluorescent beads adhesion assay we developed (see "Experimental
Procedures"),2 which allows
analysis of only those cells that have similar expression levels of
LFA-1, by staining LFA-1 with the FITC-conjugated nonblocking mAb TS2/4
and are under similar gate settings (fluorescence intensity 40-60).
Thus, this new adhesion assay is suitable to investigate and compare
various cell lines that express distinct levels of adhesion receptors
and excludes variation in adhesion due to variation in expression
levels of LFA-1. In contrast to wild-type LFA-1 and the chimeric LFA-1
transfectants, deletion of the 2 cytoplasmic tail
(2) or L cytoplasmic tail
(1088L) and deletion of only the KVGFFKR region in
the L cytoplasmic tail (KVGFFKRL)
resulted in high spontaneous adhesion that was as high as adhesion
after stimulation with the activating LFA-1 antibody KIM185 (Fig.
4B). Surprisingly, the
L deletion mutant that contained the GFFKR region
(1095L) did not show any spontaneous adhesion and was similar to wild-type LFA-1. The two mutants that contained deletion of
both the L cytoplasmic tail and the 2
cytoplasmic tails (1088L/2 and
1095 L/2) also expressed a
constitutive active receptor that bound to ICAM-1 spontaneously. These
observations are in line with findings of others showing that integrins
exert high spontaneous ligand binding when both cytoplasmic tails are
deleted (14, 16). Furthermore these data demonstrate that the somewhat lower expression levels of LFA-1 on the double cytoplasmic deletion mutants and KVGFFKRL does not affect the adhesive
state of the receptor, because they remain extremely active and bind
extremely well to ICAM-1. We demonstrated previously that an altered
distribution of integrins might affect the avidity state of the
receptors, thus facilitating ligand binding (7-9). We therefore
investigated whether adhesive properties of the or cytoplasmic
tail transfectants correlate with the cell surface distribution of
LFA-1. Analysis by confocal microscopy revealed that the cytoplasmic
deletion mutants that strongly bound to ICAM-1
(KVGFFKRL, 2,
1088L/2, and
1095L/2) all show clusters of LFA-1
on the cell surface. Mutant 1088L LFA-1 contained
tiny clusters, compared with K562 expressing wild-type LFA-1 or
1095L, who both show a homogeneous distribution of
LFA-1 and did not adhere spontaneously to ICAM-1 (Fig.
5). Again the lower expression levels of
LFA-1 present on the cytoplasmic deletion mutants could rule out its
effect on surface distribution.
View larger version (21K):
[in this window]
[in a new window]
|
Fig. 4.
Binding of
K562-L2
transfectants to bind to ICAM-1-coated fluorescent beads measured by
flow cytometry. A, adhesion of cytoplasmic chimeric
LFA-1 mutants; B, adhesion of L deletion
mutants; C, adhesion of 2 deletion mutants.
K562-L2 cells were preincubated in medium
(control,  ), PMA (50 nM,  ), or the activating
anti-2 mAb KIM185 (5 µg/ml,  ), respectively, for 15 min at 37 °C in the absence or presence of the LFA-1 blocking mAb
(NKI-L15). Depicted is the mean percentage of LFA-1-specific adhesion
to ICAM-1 of the gated cells that expressed equal amounts of LFA-1
(mean fluorescent intensity 40-60) as determined by staining with the
FITC-conjugated nonblocking anti-LFA-1 antibody (TS2/4).
Integrin-specific adhesion: percentage of cells binding percentage of cells binding in the presence of an integrin-blocking mAb
(NKI-L15). Data are representative of four experiments.
|
|
View larger version (42K):
[in this window]
[in a new window]
|
Fig. 5.
Surface distribution of LFA-1 as determined
by CLSM. Cells were fixed (0.5% paraformaldehyde) and
subsequently stained with the anti-LFA-1 mAb TS2/4 and goat
anti-mouse-(Fab')2-FITC second antibodies. Wild-type LFA-1
is found homogeneous on the cell surface similar as
1095L2, although it is localized in
little clusters on 1088L2 and large
clusters on KVGFFKRL2,
2, and the double / deletions
(1088L2 and
1095L2. The instrument settings of
the CLSM were the same for the four different panels: lens, 60×; gain,
1300; pinhole, 1.5 µm; and magnification × 2.0. One of three
experiments is shown.
|
|
To investigate whether the affinity of LFA-1 for ICAM-1 is altered upon
deletion or mutation of the cytoplasmic tails also, we determined the
concentration of soluble ligand (ICAM-1Fc) that yielded half-maximal
direct ligand binding activity (ED50) (11, 40). The lower
the concentration of ICAM-1Fc needed to bind to 50% of the positive
cells, the higher the affinity of LFA-1 for ICAM-1. Similar to the
beads adhesion assay, strong binding of sICAM-1 was observed for the
cytoplasmic deletion mutants that spontaneously adhered to
ICAM-1 (KVGFFKRL, 2,
1088L/2 and
1088L) (Fig. 6).
Binding of sICAM-1 was completely LFA-1 dependent, because anti-LFA-1
antibodies completely blocked the binding (data not shown). When we
calculated the concentration of sICAM-1 that yielded half-maximal
binding we observed that sICAM-1 binding to LFA-1 for all the mutants
ranged from ED50 of less than 1 µg/ml ICAM-1Fc
(KVGFFKRL) to an ED50 of 2 µg/ml for
all the other mutants (Table III). These
findings indicate that, although the cytoplasmic tail deletion mutants
KVGFFKRL, 1088L,
2, 1088L/2, and
1095L/2 all show high spontaneous binding to ICAM-1, the affinity of LFA-1 for ICAM-1 on these
transfectants is not higher than that of wild-type LFA-1.
View larger version (19K):
[in this window]
[in a new window]
|
Fig. 6.
Analysis of soluble ICAM-1Fc binding to K562
cytoplasmic deletion mutants by direct ligand binding. Recombinant
ICAM-1Fc fusion protein was incubated for 30 min at 37 °C with the
transfectants in the presence of medium. The concentration of ligand
varied 100-0.1 µg/ml. Binding was detected by staining with
FITC-conjugated goat anti-human Fc, and analyzed on FACScan. The
percentage of positive cells represent the percentage of cells binding
soluble ICAM-1Fc. The specific adhesion could be blocked by blocking
anti-LFA-1 mAbs, and was less than 2% (not shown). Data are
representative of three experiments.
|
|
View this table:
[in this window]
[in a new window]
|
Table III
Cytochalasin D does not enhance soluble ICAM-1Fc binding of
1095L/2
Mutants 1095L/2,
1088L/2,
KVGFFKRL/2,L/2 and
wild-type LFA-1 were preincubated with 10 µg/ml cytochalasin D for 15 min at 37 °C. Recombinant ICAM-1Fc fusion protein was incubated for
30 min at 37 °C with the transfectants in the presence of medium.
The concentration of ligand varied 100-0.1 µg/ml. Binding was
detected by staining with FITC-conjugated goat anti-human Fc, and
analyzed on FACScan. The specific adhesion could be blocked by blocking
anti-LFA-1 mAbs (not shown). Depicted is the concentration of sICAM-1Fc
that gives half maximal binding to the LFA-1 transfectants; data are
representative of three experiments.
|
|
Expression of the LFA-1 Activation Epitopes (L16 and M24) on the
LFA-1 Cytoplasmic Deletion Mutants--
Next we studied the expression
of the L16 epitope and the M24 epitope that both have been described as
reporters for clustered or activated forms of LFA-1, respectively.
Although the L16 epitope is a Ca2+-dependent
epitope on the chain of LFA-1 and correlates with the clustering
status of LFA-1 on the cell surface (8, 31), the 24 epitope is a
Mg2+-dependent epitope expressed on the chain of LFA-1 that has been used as an "activation reporter" of
LFA-1, which can be induced by Mn2+ (23, 27). As depicted
in Table I, wild-type LFA-1 transfected in K562 cells express only low
levels of L16 (mean ratio 0.3 compared with expression of a regular
LFA-1 epitope, SPV-L7) in line with previous findings (36). Similarly,
low levels of M24 epitope are expressed on cells expressing wild-type
LFA-1, but M24 can be induced by Mn2+ (mean ratio 0.3). In
contrast, all cytoplasmic tail deletion mutants that express a
constitutive active form of LFA-1 (KVGFFKR L,
2, 1088 L/2 and
1095 L/2), express high levels of the L16 epitope, as well as the M24 epitope, without prior activation with Mn2+ (both mean ratio 0.9-1.0). The only exception is
mutant 1088L, which also spontaneously binds ICAM-1
but does not express high levels of the L16 and M24 epitope and has
little clustered LFA-1. In conclusion these data clearly demonstrate
that when LFA-1 is found in large clusters on the cell surface, L16 and
M24 epitopes are expressed. Furthermore, our findings demonstrate that
clustering of LFA-1 is not associated with an enhanced affinity for
ICAM-1 (Fig. 6).
Disruption of Cytoskeleton Restraints Enhances LFA-1-mediated
Ligand Binding and Is Associated with Avidity but Not Affinity
Alterations--
We studied the role of the actin cytoskeleton by
treating all LFA-1 cytoplasmic tail mutants with cytochalasin D and
subsequently determined binding to ICAM-1-coated beads. As expected,
the high spontaneous binding to ICAM-1 of mutants
1088L and 2 and the double
L2 cytoplasmic deletion mutants
(1088L/2 and
1095L/2) were not affected by
disruption of the actin cytoskeleton network (Table II). Probably
deletion of the cytoplasmic tail of the 2 or
L chain reduces the interaction with the cytoskeleton
causing aggregates of LFA-1 receptors (avidity) that favors ligand
binding. Surprisingly, 1095L, containing the
wild-type 2 cytoplasmic tail together with the
L cytoplasmic tail deleted immediately after the GFFKR
sequence, showed enhanced spontaneous binding to ICAM-1(from 2 to 32%,
Table II) after cytochalasin D treatment, indicating that disruption of
the cytoskeleton restraints, attached to the short cytoplasmic tail of
L, affect the spontaneous activated state of LFA-1.
Titrations of cytochalasin D demonstrate that concentrations ranging
from 0.5-0.1 µg/ml enhanced the spontaneous adhesion of
1095L 16-fold (data not shown).
To analyze whether the enhanced adhesion of 1095L was
due to an altered redistribution of LFA-1 on the cell surface (avidity) or due to an altered affinity of LFA-1 for ICAM-1, both cell surface distribution by confocal laser microscopy as well as the affinity for
ICAM-1 was analyzed with and without cytochalasin D. Fig. 7 and Table III clearly demonstrate that
cytochalasin D alters the cell surface distribution of LFA-1 on
1095L but not the affinity for ICAM-1. The cell
surface distribution of LFA-1 1095L after treatment
with cytochalasin D is similar to the clustered distribution of LFA-1
observed on mutant 1088L, which showed a high
spontaneous adhesion to ICAM-1. In contrast, clustering of LFA-1 on
1095L was less than the huge LFA-1 clusters found on
mutants 2,
1088L/2, and
1095L/2. These results indicate that disrupting LFA-1 from the actin cytoskeleton network enhances the
mobility of the receptors in the cell membrane to form aggregates, thereby enhancing the avidity of LFA-1-ICAM-1 interactions.
View larger version (48K):
[in this window]
[in a new window]
|
Fig. 7.
Disruption of the interaction of LFA-1 with
the actin cytoskeleton network by cytochalasin D induces clustering of
LFA-1 transfectant
1095L/2.
LFA-1 is homogeneously distributed on
1095L/2, whereas distribution shifts
toward a clustered distribution upon cytochalasin D treatment (10 µg/ml). Cells were stained for 30 min with anti-LFA-1 mAb TS2/4 (10 µg/ml) and FITC-labeled goat (Fab')2 anti-mouse IgG.
Fluorescence distribution was determined by confocal laser scanning
microscopy at 488 nm. The same instrument settings of the CLSM were
used throughout the experiment.
|
|
Post-ligand Binding Events Are Regulated by Both the and
2 Cytoplasmic Tail--
We also investigated the
post-adhesion cell spreading on ICAM-1 of the LFA-1 cytoplasmic
deletion mutants (Table IV) to study in
more detail the role of the cytoskeleton in LFA-1-ICAM-1 adhesion. When
activated by KIM185, wild-type LFA-1 transfected in K562 cells binds to
ICAM-1, and cells are able to spread on ICAM-1, because a flattening of
the cell is observed after 60 min of binding. Disruption of the actin
cytoskeleton network after treatment of cells with cytochalasin D
dramatically reduces the spreading, whereas no effect is seen on ICAM-1
binding. (Table II). Also the chimeric LFA-1 molecules
LX and L4
spread on ICAM-1 after KIM185 treatment similar to wild-type. Deletion
of the 2 cytoplasmic tail resulted in high binding to
ICAM-1, however, binding was not accompanied by any spreading of cells
also not after KIM185 activation. Similarly, the double cytoplasmic
tail deletion mutants did not spread on ICAM-1, indicating that
spreading requires connections with the actin cytoskeleton. In
contrast, truncation of the L cytoplasmic tail before
the KVGFFKR or just after this domain, results in strong binding of
ICAM-1 and normal spreading, whereas the mutant in which only the
KVGFFKR domain was deleted binds ICAM-1 very well, but does not spread.
Together these data demonstrate that both the L and the
2 cytoplasmic tails contain sequences that contribute to
the reorganization of the cytoskeleton.
View this table:
[in this window]
[in a new window]
|
Table IV
Spreading of the various LFA-1 cytoplasmic tail deletion mutants on
ICAM-1-coated wells
The various LFA-1-K562 transfectants were activated with the activating
anti-LFA-1 mAb KIM185 to adhere to ICAM-1Fc-coated wells (200 µg/ml).
Cells were allowed to adhere for 1 h at 37 °C, after which
spreading was scored (percentage of cells spreading) visually on a
microscope using a 10× objective. Spontaneous adhesion was measured by
incubation of the LFA-1 mutants, without further activation, with the
fluorescent ICAM-1-coated beads as described in Fig. 4.
|
|
| |
DISCUSSION |
From our results we conclude the following. 1) Deletion of the
2 and/or L cytoplasmic tail including the
KVGFFKR sequence leads to strong ICAM-1 binding by reducing
cytoskeleton restraints, enabling the formation of LFA-1 clusters
without the necessity of affinity alterations. 2) Together with earlier
reports, this indicates that attachment of the actin cytoskeleton
network to LFA-1 keeps the integrin in a default-inactive state by
inhibiting the lateral movement of the receptors on the cell membrane.
3) Both the L and 2 cytoplasmic tails are
connected to the actin cytoskeleton network, because (a)
cytochalasin D did not inhibit the spontaneous adhesion of the
L and 2 cytoplasmic deletion mutants, and
(b) spreading of LFA-1 transfectants was impaired when the
2 or the KVGFFKR region in the L tail
were deleted. 3) LFA-1 deletion mutants that are constitutively active
express both the L16 "clustering" epitope and the M24 activation
reporter epitope, demonstrating that all clustered LFA-1 is active and binds ICAM-1. 4) Cytochalasin D enhances adhesion of
1095L to ICAM-1 by disrupting cytoskeleton restraints
that are attached to the short remaining L tail and
enhances the avidity (clustering) but not the affinity of LFA-1.
On normal resting lymphocytes, LFA-1 is in an inactive state that
poorly binds ICAM-1. Several recent publications have demonstrated that
temporary dislodgment of LFA-1 from the cytoskeleton network facilitates ICAM-1 binding, following TCR/CD3 or PMA activation (inside-out activation of LFA-1) by increasing lateral diffusion of
LFA-1 (9, 10, 20-22). This temporary disconnection from the
cytoskeleton restraints by cytochalasin D may facilitate redistribution of LFA-1 receptors on the cell membrane altering LFA-1-ICAM-1 avidity
interaction. In this study, we aimed to investigate the role of the and cytoplasmic tails of LFA-1 in regulating ICAM-1 binding through
avidity changes or affinity changes.
Most integrins contain the conserved DLRE motif in the cytoplasmic
tail. Deletion of this sequence has already been shown to lead to an
active receptor for various integrins, enabling it to bind
spontaneously ligand (14, 16, 41). We confirmed this when the deletion
of the 2 cytoplasmic tail (45 amino acids long)
expressed a constitutively active LFA-1 when transfected in K562 cells.
Comparison of the positions at which the distinct cytoplasmic tail
were truncated, would suggest that deletion of the conserved aspartic
acid residue corresponding to position 731 in the 2 tail
results in a constitutively active molecule, indicating that this
residue is most important in regulating integrin activation. In
contrast, we observed that in deletion mutants in which this conserved
aspartic acid residue is not removed, the integrin activity can still
be regulated. Moreover, amino acid sequences more C-terminal of the cytoplasmic tail are more likely important in ligand binding capacity
rather than in regulation of integrin activation (30, 41-46).
Also the cytoplasmic tails of other integrins contain the highly
conserved GFFKR sequence that when deleted enhances ligand binding,
similar to the DLRE motif (14, 16, 47, 48). This notion is supported by
our observation that only those L truncation mutants,
which did not contain the KVGFFKR region (10888L and KVGFFKRL), are constitutively active. Furthermore, it
has been shown recently for both 2 and 1
integrins that mutation of the K in the GFFKR sequence reduces its
capacity to spontaneous bind ligand (16). Hughes et al. (14)
proposed that a salt-bridge between both the conserved sequences in the
and cytoplasmic tails keep the integrin in its inactive state.
To investigate whether the spontaneous activation of LFA-1, due to
truncation of the cytoplasmic tail, was the result of affinity or
avidity alterations, we determined the minimal concentration of soluble
ICAM-1 to bind the various LFA-1 transfectants (affinity), as well as
the surface distribution of LFA-1 by confocal microscopy (avidity). We
observed that all LFA-1 mutants that spontaneously bound ICAM-1
(1088L, KVGFFKRL,
2 and the double / deletion mutants) showed a
clustered cell surface distribution of LFA-1, correlating well with our
earlier findings in which we addressed the importance of clustering of
LFA-1 to facilitate ICAM-1 binding (7-9). This notion is supported by
the demonstration that expression of the clustering sensitive epitope
on LFA-1 (L16) on all these mutants is increased except
1088L/2, which has less clustered LFA-1 than KVGFFKR, 2 and the double /
deletion mutants.
Because clustering of LFA-1 on these cytoplasmic tail mutants might be
due to a reduced capacity to interact with the cytoskeleton, we
investigated whether disruption of the actin cytoskeleton by cytochalasin D affected adhesion. As expected, no reduction of spontaneous adhesion to ICAM-1 was observed, indicating that the cytoskeleton is not attached to LFA-1 when the or cytoplasmic tails are truncated. Therefore, no post-receptor-binding events that
depend on the attachment of cytoskeleton are observed (cell spreading
on ICAM-1). Probably deletion of the cytoplasmic tail disconnects the
integrin from the cytoskeleton and allows lateral movement of the
integrin at the cell membrane, explaining the clustered distribution of
LFA-1 on all the 2 mutants or the KVGFFKR mutants.
By contrast, when the entire L cytoplasmic tail was
deleted (1088L), LFA-1 was less clustered and was
still able to spread on ICAM-1 similar to wild-type LFA-1.
It has been demonstrated that integrins can associate with cytoskeletal
components (-actinin, talin), particularly through the chain and
thereby may regulate the cell surface distribution of the integrin (49,
50). In particular, mutations of a triplet of threonines (position
758-760) and the phenylalanine residue at position 766 in the
2 cytoplasmic tail profoundly reduced the adhesiveness
of LFA-1 (13, 41). It has been suggested that the altered adhesiveness
due to mutation of the threonine triplet is caused by an altered
cytoskeletal association/organization and not to an affinity change in
LFA-1 (13).
Clustering of integrins on the cell surface can also co-localize
important kinases essential for proper signal transduction (51). Not
only the intracellular conformation or association with regulatory
proteins is affected by clustering of integrins on the cell surface,
but the extracellular conformation is altered also, as evidenced by
enhanced L16 and M24 epitope expression when the 2 or
L cytoplasmic domain was deleted (KVGFFKR). This may
be attributed to distinct interactions with cytoplasmic proteins affecting the extracellular conformations of the integrin molecule.
Because K562-LFA-1 transfectants express ICAM-1, we investigated
whether initial cell contact with ligand during culture may result in
the dynamic clustering of integrins thereby augmenting the avidity for
ligand. To rule out that the clustering of LFA-1 was induced by ligand
binding, we cultured the transfectants that showed high spontaneous
strong adhesion to ICAM-1 (1088L/2, KVGFFKR, 2 and the double / deletion
mutants) for several days in the presence of anti-ICAM-1 antibodies to
reduce any ligand binding. Indeed cell aggregation of K562
transfectants was dramatically reduced, however no altered LFA-1
clustering or affinity or expression of L16 or M24 epitopes was
observed (data not shown). This indicates that the clustering status of
LFA-1 on the surface of the cytoplasmic deletion mutants is a direct
consequence of reduced cytoskeleton restraints and is not affected by
enhanced binding to ICAM-1. Thus, it might be that it is an intrinsic
property of LFA-1 to form liquid crystals.
We have shown that Ca2+ indirectly enhances LFA-1-mediated
adhesion by reorganizing LFA-1 into clusters on the cell surface, and
thus increases the avidity of LFA-1-ligand interactions by expression
of the Ca2+-dependent L16 epitope (8, 9, 52).
We have observed that the L16 epitope is only expressed when LFA-1 is
dimerized.3 The importance of
clustering or dimerization of LFA-1 receptors is further substantiated
by the observation that dimers of ICAM-1 have been shown to bind LFA-1
with much greater affinity than monomer ICAM-1
(53).4 This is in accordance
with the finding that ICAM-1 is mostly expressed as dimer on the cell
surface (54, 55). The recent crystal structure of a dimeric form of
ICAM-1 containing only the outer two Ig-like domains, provides
additional evidence that dimerization of ICAM-1, and consequently
LFA-1, plays an important role in receptor-ligand interactions and
downstream signaling (56).
Cytochalasin D treatment enhanced spontaneous LFA-1-mediated adhesion
of the LFA-1 mutant 1095L, truncated immediate after the KVGFFKR. Enhanced adhesion after cytochalasin D treatment of
1095L was associated with clustering of LFA-1 but did
not affect the ICAM-1 binding affinity. These findings correlate well with similar results that have been shown for 4 tail
deletions (11). The cytoplasmic domain of the chain may cover a
negative site in the tail, the unshielded and unregulated
interactions of tails with cytoskeletal proteins may lead to
increased constitutive cytoskeletal anchoring, and thus diminished
diffusion and clustering at adhesive sites.
Although previous reports for various integrins (1 and
3) suggest that affinity alterations play an important
role in regulating integrin-mediated adhesion (57, 58), we were not
able to measure any affinity alterations for the 2
integrin LFA-1. It remains largely unknown whether affinity changes are
involved in the regulation of cell adhesion. Thus far, LFA-1 affinity
studies, by competition between sICAM-1 and function blocking antibody
for binding to LFA-1 on T cells, have determined only low affinity of
LFA-1 on resting T cells (100 µM), whereas activation of
T cells increases the affinity up to 400 nM (24). Studies
on the affinity of purified LFA-1, which is constitutively active, for
binding sICAM-1 was calculated somewhat higher (130 nM)
(53, 59). Other evidence for possible affinity changes of LFA-1, comes
from the finding that activation of LFA-1 by EGTA and Mg2+
leads to enhanced expression of the
Mg2+-dependent 24 epitope on CD11a, implying
that Mg2+ binding involves induction of conformational
changes in LFA-1 that coincides with ICAM-1 binding (28, 29, 40).
We observed that the cytoplasmic deletion mutants expressed a
constitutively active LFA-1 receptor, all exhibited LFA-1 in large
clusters on the cell surface, and expressed high levels of L16 and M24
epitopes. Both mutant 1088L/2, as well
as 1095L/2 after cytochalasin D
treatment, were spontaneously active, but did not express the L16 and
M24 epitope, which correlated with less clustered LFA-1 distribution on
these mutants than the double deletion mutants. From this study we may
conclude that the small changes in LFA-1 clustering, as detected by
confocal microscopy, can have huge consequences on the adhesion
capacity, which cannot be detected by L16 and M24 expression.
All LFA-1 cytoplasmic tail deletion mutants that showed enhanced M24
expression were also L16 positive and showed large clusters of LFA-1 on
the cell surface. This did not coincide with an enhanced affinity of
LFA-1 fo
,
TOP
ABSTRACT
INTRODUCTION
