| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 274, Issue 38, 27219-27224, September 17, 1999
From the Department of Plant Biology, Carnegie Institution of
Washington, Stanford, California 94305
The integration of light-harvesting chlorophyll
proteins (LHCPs) into the thylakoid membrane proceeds in two steps.
First, LHCP interacts with a chloroplast signal recognition particle (cpSRP) to form a soluble targeting intermediate called the transit complex. Second, LHCP integrates into the thylakoid membrane in the
presence of GTP, at least one other soluble factor, and undefined membrane components. We previously determined that cpSRP is composed of
43- and 54-kDa polypeptides. We have examined the subunit stoichiometry of cpSRP and find that it is trimeric and composed of two subunits of
cpSRP43/subunit of cpSRP54. A chloroplast homologue of FtsY, an
Escherichia coli protein that is critical for the function of E. coli SRP, was found largely in the stroma
unassociated with cpSRP. When chloroplast FtsY was combined with cpSRP
and GTP, the three factors promoted efficient LHCP integration into
thylakoid membranes in the absence of stroma, demonstrating that they
are all required for reconstituting the soluble phase of LHCP transport.
SRP1 mediates the
cotranslational targeting of endomembrane and secretory proteins to the
endoplasmic reticulum in eukaryotes and of polytopic membrane proteins
to the cytoplasmic membrane in prokaryotes (1-3). Cytosolic forms of
SRP are ubiquitous in eukaryotic and prokaryotic organisms. All
contain, at a minimum, a 54-kDa GTPase subunit and an RNA (1, 2).
Membrane targeting is facilitated by an interaction between SRP and an
SRP receptor (4-6). In eukaryotes, the receptor consists of two
GTPases, a peripheral protein (the SRP receptor Recently, a specialized SRP was found in the chloroplast (12, 13).
cpSRP contains a homologue of SRP54 (14), but differs from cytoplasmic
forms, as it lacks an RNA, contains a novel 43-kDa subunit, and
interacts with substrates post-translationally (12, 15, 16). Both
genetic and biochemical evidence indicates that the 43-kDa subunit is
essential for this post-translational interaction (12, 15, 17). The
known substrates of cpSRP are the LHCPs, hydrophobic proteins that are
synthesized in the cytoplasm and are post-translationally transported
to the internal membranes of the chloroplast via the soluble phase (18,
19). The solubility of LHCP is maintained in the stroma by its binding
to cpSRP to form the targeting intermediate termed the transit complex
(12, 16, 20).
The transit complex can be reconstituted in vitro from
purified cpSRP and LHCP, suggesting that it is composed of cpSRP54, cpSRP43, and LHCP. However, one unresolved issue is the subunit stoichiometry of cpSRP and the transit complex. The molecular weight
estimate of the transit complex from nondenaturing gel analysis is
120,000 (20), whereas the molecular weight of cpSRP from gel filtration
is 200,000 (12). Also unresolved is the fact that the soluble form of
LHCP is incapable of inserting into the thylakoid membrane unless
additional stroma is added (12, 20). The requirement for additional
stroma has fueled the speculation that two stromal factors are involved
in LHCP integration: one factor, cpSRP, binds LHCP to form the
intermediate, and the second facilitates membrane insertion (12, 20).
This idea is directly supported by the observation that LHCP
integration does not occur when the stroma is immunodepleted of cpSRP,
but does occur when the immunodepleted stroma is supplemented with
cpSRP (12).
Whereas LHCP integration requires GTP hydrolysis (21), the formation of
the transit complex is not GTP-dependent (12, 20).
Therefore, it is likely that the second chloroplast protein participates in the regulation of the GTPase activity of cpSRP54; and
hence, a likely candidate would be a homologue of the SRP receptor. An
essential Escherichia coli protein, FtsY (22), is homologous
to the soluble DNA constructs
GST43 Translation Vector (pSPUTKGSTchaos)--
The chaos
cDNA encoding cpSRP43 was subcloned into the E. coli
expression vector pGTK+ (generously provided by John
Walker) by PCR amplification of the plasmid pBSSK+sschaos
with the primers GGAATTCGCCGCCGTACAAAGAAAC, which introduces an
EcoRI site just 5' to the processing site, and
GTAATACGACTCACTATAGGGC (T7 primer), which results in the introduction
of a 3'-XhoI site from the polylinker. The resulting PCR
product was digested with EcoRI and XhoI and
subcloned into the same sites of pGTK+ to form plasmid
pGTK+chaos. This plasmid encodes a GST43 fusion protein. To
make the translation construct of GST43, the insert from
pGTK+chaos was subcloned in two steps. First,
pGTK+chaos was PCR-amplified with AGTATCCATGGCCCCTATACTAGG,
which introduces an NcoI site at the initiation codon of
GST, and CGGGGTACCTCATTCATTCATTGGTTGTTG, a reverse primer that
hybridizes to the 3'-end of the chaos cDNA. The PCR product was
digested with NcoI and BamHI, and the 670-base pair fragment encoding GST was subcloned into the NcoI and
BamHI sites of pSPUTK to form pTU3. The remaining portion of
the insert from pGTK+chaos was subcloned as a
BamHI-ClaI fragment into similarly digested pTU3
to form pSPUTKGSTchaos.
GST54his Expression Vector (pGTK+54his)--
pNH4
(24) was digested with HindIII and partially digested with
EcoRI. The 1500-base pair fragment was subcloned into the same sites in pGTK+ to form pGTK+54his.
GST54his Translation Vector
(pSPUTK54+his)--
pGTK+54his was digested
with BamHI and HindIII and cloned into the
3.6-kilobase vector fragment from pSPUTKGSTchaos digested with
BamHI and partially digested with HindIII to form
pSPUTK+54his.
ftsY RNA was extracted (RNeasy kit, QIAGEN Inc.) from
Arabidopsis leaf tissue and used to amplify the ftsY
cDNA by reverse transcription-PCR using a kit from Life
Technologies, Inc. To clone the FtsY precursor into a translation
vector, the forward and reverse primers CTCTAGCACAACTGCCATGGCAACTTCT
and GGTTCTAAAGCTTAAGAGAATATAGCATTCAC, respectively, were used to
introduce NcoI and HindIII sites at the
initiation methionine and stop codons of the open reading frame, and
the resulting PCR product was cloned into the same sites of pSS6.5NcoI
(14) to form pTU1. For overexpressing FtsY in E. coli, the
forward primer GGGGATCCGCCGGACCGAGCGGATTCTTC, which introduces a
BamHI site at the predicted processing site, and the above
reverse primer were used to PCR amplify cDNA that was cloned into
the BamHI and HindIII sites of pQE30 to form
pTU2. The GST43 expression vector (pGEX4Tchaos(m)), the cpSRP54
translation vector (pAF1), and the Lhcb1 translation vector (pAB80)
have been previously described (12, 13, 18)
Antibodies and Immunoblot Analysis
Recombinant FtsY was expressed from pTU2 in the E. coli strain XL1-Blue. Cells were grown in LB medium containing 100 µg/ml ampicillin and 25 µg/ml kanamycin to an absorbance of
0.6-1.0, and expression was induced by the addition of 0. 1 mM isopropyl- Cross-linking
20 ng of recombinant cpSRP43 or GST-cpSRP43 were incubated with
1 mM disuccinimidyl tartarate in 20 mM
HEPES-KOH, pH 8.0, and 150 mM NaCl for 2 h on ice in a
final volume of 20 µl. The cross-linking reaction was quenched by the
addition of 1.5 µl of 1 M Tris-HCl, pH 8.0, and
incubation for 15 min at room temperature. Samples were separated on
8% SDS-polyacrylamide gels and detected by immunoblotting as described
(24).
Subunit Stoichiometry
cpSRP was assembled by incubating 3.4 µCi of cpSRP54his and
2.7 µCi of GST43 translation products with incubation buffer (20 mM HEPES-KOH, pH 8.0, 50 mM KOAc, and 10 mM MgCl2) for 15 min at 25 °C. The reaction
was mixed end-over-end with glutathione-Sepharose beads (Amersham
Pharmacia Biotech) for 1 h at 4 °C. The beads were washed three
times with 1.5 ml of washing buffer (20 mM HEPES-KOH, pH
8.0, 0.3 M KCl, 10 mM MgCl2 and 1%
Tween 20). The beads were transferred to Wizard minicolumns (Promega),
and the protein was eluted in 50 µl of 10 mM glutathione
in incubation buffer. The eluted sample was diluted to 120 µl with
incubation buffer and incubated with Ni2+-NTA-agarose beads
for 1 h at 4 °C. The beads were transferred to a second Wizard
column, washed three times with 1.5 ml of washing buffer, and eluted in
45 µl of 200 mM imidazole in 20 mM HEPES-KOH, pH 8.0. The sample was analyzed by SDS-PAGE on 13% acrylamide gels,
and radioactivity was quantitated by radioimaging on a PhosphorImager (Molecular Dynamics, Inc.). Normalized pixel values were calculated by
dividing the total pixels in each band by the number of methionines within the protein, and the ratio of the normalized values was used to
calculate the molar ratio of the two subunits. To investigate cpSRP43-mediated dimerization of cpSRP54, 0.5 µg of GST54 was incubated with 3.4 µCi of cpSRP54his, 0.5 µg of cpSRP43, or both under standard conditions; purified on glutathione-Sepharose; and
analyzed by SDS-PAGE as described above.
Isolation of Stroma, Salt Washing of Thylakoids, and Gel
Filtration
The stroma was collected from chloroplasts lysed in 20 mM HEPES-KOH, pH 8.0, 5 mM MgCl2, 1 mM dithiothreitol, and 1 mM
phenylmethylsulfonyl fluoride (lysis buffer) at 2 mg of chlorophyll/ml
and centrifuged for 10 min in a microcentrifuge. The thylakoid pellet
was resuspended in lysis buffer, centrifuged, and resuspended in lysis
buffer containing the indicated salt solution. Samples were rotated
end-over-end for 10 min at 4 °C and centrifuged, and the pellet was
washed a second time as described before and resuspended in lysis
buffer at a concentration of 0.5 mg of chlorophyll/ml.
Arabidopsis stroma, pea stroma, or purified recombinant
protein was fractionated on a Superose 6HR gel filtration column
(Amersham Pharmacia Biotech) in 20 mM HEPES-KOH, pH 7.0, 5 mM MgCl2, and 180 mM NaCl at 0.5 ml/min and analyzed as described (12).
Reconstitution
Pea thylakoids were washed one time in 20 mM
HEPES-KOH, pH 8.0, and 2 M KOAc and two times in 50 mM HEPES-KOH, pH 8.0, and 330 mM sorbitol.
Thylakoids containing 25 µg of chlorophyll were resuspended in a
total of 100 µl of the indicated reaction mixture. Each reaction
mixture contained 10 mM MgCl2, 10 mM methionine, 0.15 mM GTP, 82 mM
sorbitol, and 13 mM HEPES-KOH, pH 8.0. cpSRP54, cpFtsY, and
LHCP were translated either in a wheat germ translation extract or a
commercial rabbit reticulocyte lysate. The amounts added for wheat germ
and rabbit reticulocyte lysate translations were as follows: cpSRP54,
20 and 20 µl, respectively; cpFtsY, 40 and 30 µl, respectively; and
LHCP, 5 and 40 µl, respectively. Recombinant cpSRP43 (150 ng), pea
stroma (equivalent to 90 µg of chlorophyll), and apyrase (1 unit)
were added as noted. Reactions were incubated for 30 min at 25 °C,
followed by trypsin treatment and analysis by SDS-PAGE and fluorography.
General
Previously described conditions were used for import of FtsY
into chloroplasts (26), in vitro transcription/translation (26), and expression and purification of GST fusion proteins (12).
Mature cpSRP43 was generated by thrombin cleavage of GST43 using
biotinylated thrombin and purified from GST and thrombin using
streptavidin-agarose (Novagen) as suggested by the manufacturer.
cpSRP43 Is a Dimer--
We previously determined that cpSRP54 is a
monomer based on gel filtration analysis of cpSRP54 translation
products (Fig. 1A) (12). To
determine the oligomeric state of cpSRP43, we examined the gel
filtration characteristics of cpSRP43 from the stroma of
ffc1-2, an Arabidopsis mutant that
lacks cpSRP54 (17). Stromal cpSRP43 eluted as a 70-kDa protein (Fig.
1B), which is identical to the elution profile of purified
recombinant cpSRP43 (data not shown). The same molecular mass estimate
was obtained by nondenaturing gel electrophoresis (data not shown)
(27). Whereas Arabidopsis cpSRP43 migrates as a 42-kDa
polypeptide during SDS-PAGE, its molecular mass predicted from the
cDNA sequence is 35 kDa (15). Hence, the 70-kDa species identified
by gel filtration probably represents a homodimer. This notion is
further supported by cross-linking experiments. Following treatment of
dilute protein solutions with a cross-linking reagent, part of the
Arabidopsis cpSRP43 and cpSRP43 fused to glutathione
S-transferase (GST43, 66 kDa) migrate as a 90- and 126-kDa
species, respectively, on SDS-polyacrylamide gels (Fig. 1B).
Furthermore, based on the cDNA sequences, cpSRP43 has chromodomains
that could mediate dimerization (15).
Stoichiometry of cpSRP--
To determine the subunit stoichiometry
of cpSRP, the complex was assembled in vitro from cpSRP54his
and GST43 translation products. cpSRP was purified by successive passes
of the sample over glutathione-Sepharose and
Ni2+-NTA-agarose, and the final eluate was analyzed by
SDS-PAGE (Fig. 2a). GST43 and
cpSRP54his alone did not bind to Ni2+-NTA-agarose and
glutathione-Sepharose, respectively. However, these proteins did
copurify on the resins after assembly. The eluate from successive
passes of the assembled complex over the two resins was quantitated by
radioimaging, and the GST4354his ratio was determined to be 2:1 in two
independent experiments. This ratio suggested that cpSRP is a trimer
composed of one cpSRP43 dimer and one cpSRP54 monomer. An alternative
possibility inconsistent with the binding data, but more consistent
with the previously determined molecular mass estimation by gel
filtration (200 kDa) (12) is that each cpSRP is a tetramer consisting
of two cpSRP54/cpSRP43 heterodimers. A qualitative test to distinguish
these two possibilities was conducted using GST54 and cpSRP54his, which
are discernible by size and binding affinity for glutathione-Sepharose.
Recombinant GST54 was incubated with the cpSRP54 translation product in
the presence and absence of cpSRP43. If cpSRP43 causes cpSRP54 to dimerize, then radiolabeled cpSRP54his should bind GST54 in the presence of cpSRP43. However, no additional cpSRP54his bound to GST54
in the presence of cpSRP43 (Fig. 2b). Immunoblotting of the
fractions revealed that cpSRP43 bound to GST54, and this interaction was reduced by the presence of cpSRP54his, indicating that both forms
of cpSRP54 bound cpSRP43. That cpSRP54his bound to cpSRP43 is also
evident from the retention of cpSRP54his on glutathione-Sepharose in
the presence of GST43 (Fig. 2b). Together, these data
indicate that cpSRP is a trimer.
Arabidopsis Contains a Chloroplast Homologue of Bacterial
FtsY--
An alignment of the Arabidopsis FtsY homologue
with related sequences is shown in Fig.
3. High similarity among all sequences is
observed in the C terminus containing the GTP-binding and hydrolysis domains. An acidic N terminus present in E. coli and
Synechocystis FtsY is absent in the Arabidopsis
protein. The N terminus of the Arabidopsis protein is
predicted to contain a chloroplast transit peptide cleaved after Arg-40
based on analysis by the ChloroP program (28).
After our study was complete, but prior to the publication of our
results, Kogata et al. (29) reported that the
Arabidopsis FtsY homologue was a chloroplast protein
localized to the thylakoid membrane. We tested whether the putative
ftsY clone encodes a chloroplast protein by incubating the
corresponding translation product with isolated pea chloroplasts as
described (26). The precursor (44 kDa) was processed to a 37-kDa
protease-protected mature form, indicating that the protein was
imported into the chloroplast (Fig.
4A, lanes 1-3).
Upon subsequent fractionation, the imported protein was found to
associate with both the thylakoid membrane and the stroma. Antibodies
raised in rabbits and affinity-purified against the recombinant protein
readily detected 5 ng of antigen (Fig. 4A, lane
4). The same antibodies cross-reacted with a single Arabidopsis chloroplast protein that comigrated with the
mature form of the imported protein, whereas the corresponding pea
protein migrated slightly faster on SDS-PAGE (Fig. 4A,
lanes 5 and 6). In contrast to the results
reported by Kogata et al. (29), the majority of the
cross-reacting protein was localized in the stroma, although a
significant fraction was found associated with the thylakoid membrane
(Fig. 4A, lanes 2, 3, 6,
and 7). Putative FtsY was effectively removed from the
thylakoid membrane after two washes in 0.5 M KOAc.
Together, these data indicate that the ftsY clone encodes a
soluble chloroplast protein that has an affinity for the thylakoid
membrane.
cpFtsY Is a Monomer--
To determine if other factors associate
with putative cpFtsY, we fractionated the stroma by fast protein liquid
chromatography and used antibodies to quantitate the protein in the
different fractions. cpFtsY eluted with an estimated molecular mass of
25 kDa (Fig. 4B), implying that the stromal form is a
monomer. The same blot probed with antibodies against cpSRP54 and
cpSRP43 revealed that, in contrast and as previously observed, cpSRP54
and cpSRP43 coeluted in the 200-kDa fraction (12). These data indicate
that soluble cpFtsY does not form a stable complex with cpSRP. As such, it would remain in the stroma after immunodepletion of cpSRP, a
characteristic of the second factor required for LHCP integration.
Reconstitution of the Soluble Phase of LHCP Transport--
To
examine whether putative cpFtsY is required for LHCP biogenesis, we
tested whether cpFtsY, cpSRP, and GTP were sufficient to mediate the
integration of LHCP into thylakoid membranes. To remove any residual
stromal factors, thylakoids were washed with buffer containing 2 M KOAc. As shown in Fig. 5,
LHCP integration occurred when the stroma and GTP were added to
salt-washed thylakoids. If GTP was removed by apyrase addition, no LHCP
was recovered in the thylakoids. No integration occurred with the
individual or pairwise addition of any of the three proteins. However,
when cpSRP43, cpSRP54, and cpFtsY were all added, LHCP was efficiently integrated into the thylakoid membrane. These data establish that the
putative cpFtsY clone is indeed a homologue of FtsY, as it is needed
for the cpSRP-dependent integration of LHCP into thylakoid membranes. Furthermore, they conclusively demonstrate that these three
factors are all required for LHCP biogenesis.
This work establishes four new and important points. First, we
show that cpSRP43 is a dimer. Second, we demonstrate that cpSRP is a
trimer consisting of two cpSRP43 subunits and one cpSRP54 subunit (Fig.
6). Third, we show that cpFtsY is a
soluble chloroplast protein that has a weak affinity for cpSRP. Fourth,
we conclusively demonstrate that cpFtsY is the second soluble factor
that is required to reconstitute the soluble phase of LHCP
transport.
cpSRP is distinctive in its ability to interact with members of the
LHCP protein family post-translationally. It is likely that this
specialized role is mediated directly or indirectly through cpSRP43.
From an analysis of Arabidopsis mutants that lack cpSRP43,
it appears that only members of the LHCP protein family are adversely
affected (15, 17). Thus, it appears that cpSRP43 functions primarily,
if not exclusively, in LHCP biogenesis. Mutant plants lacking cpSRP54
show wider effects; chloroplast encoded proteins whose targeting is
cotranslational are affected in addition to LHCP (17, 24). A
substantial pool of cpSRP54 is dissociated from cpSRP43 and associated
with 70 S ribosomes (14). Furthermore, cpSRP54 has been shown to
directly interact with the nascent chain of a chloroplast protein
synthesized in a chloroplast translation extract (30). Therefore, we
think it likely that cpSRP54 free of cpSRP43 mediates cotranslational targeting, whereas the presence of cpSRP43 enables the
post-translational interaction between cpSRP and LHCP. Cross-linking
data clearly demonstrate that cpSRP54 directly interacts with LHCP
(16). It remains to be shown whether cpSRP43 is also able to interact directly with LHCP or whether it simply modifies the conformation of
cpSRP54 to facilitate the post-translational interaction. Previously, we entertained the possibility that cpSRP43 effectively dimerized cpSRP54 and thereby created a novel interaction between the SRP54 homologue and its substrate (12). The results from the present study
clearly indicate that cpSRP, like cytoplasmic SRP, contains a single
SRP54 subunit that presumably binds a single substrate molecule. Thus,
the predicted molecular mass of cpSRP is 123 kDa. The large deviation
of the mass estimate by gel filtration from the predicted value
suggests that cpSRP is not a globular protein.
Previous work provided strong evidence that LHCP integration required
multiple soluble factors (12, 20), a hypothesis that has now been
validated. The present data also provide strong evidence that cpSRP,
cpFtsY, and GTP are sufficient for reconstituting the soluble phase of
LHCP transport. Purifying an active form of cpSRP54 is an obstacle that
must be overcome to prove this point conclusively. For reconstitution
experiments, recombinant and highly purified cpSRP43 was used, whereas
cpSRP54, cpFtsY, and LHCP were synthesized by translation in either
wheat germ extracts or rabbit reticulocyte lysates (data not shown).
The fact that LHCP integration can be reconstituted using translation products synthesized in rabbit reticulocyte lysates indicates that no
other chloroplast factors are required for the reaction.
In E. coli, SRP-dependent proteins are inserted
into the membrane via the Sec translocon (31), which minimally consists of SecA/E/Y (32, 33). Homologues of all three proteins are found in the
chloroplast and are required for the translocation of the luminal
33-kDa oxygen-evolving protein OE33
(34-37). One unresolved question is whether the Sec translocon is
required for LHCP integration. The results presented here are
inconsistent with the involvement of cpSecA in LHCP integration. cpSecA
is a soluble protein that needs to be added as stroma or purified protein to reconstitute efficient translocation of OE33 across the
thylakoid membranes (34, 38, 39). In the present work, efficient
integration of LHCP occurred without specifically adding cpSecA.
Together with the observations that azide (an inhibitor of cpSecA) does
not inhibit LHCP integration (34), that OE33 is not a competitor of
LHCP integration (40), and that maize SecA mutants have normal levels
of LHCP (41), the data imply either that the cpSRP and cpSec pathways
do not converge at the Sec translocon or, alternatively, that cpSecY/E
is active in the absence of cpSecA. Either case represents a
fundamental departure from translocation events in E. coli.
We have now shown that cpFtsY is required for the activity of the
specialized cpSRP. It remains to be determined whether cpFtsY also
functions with cpSRP54 in the biogenesis of chloroplast encoded proteins. In either case, FtsY may regulate the GTPase activity of
cpSRP54 and play a role in piloting SRP-dependent
substrates to the thylakoid membrane. The fact that LHCP transport can
now be reconstituted from defined components will allow detailed
mechanistic studies to be conducted on this pathway.
We thank Arthur Grossman for critical reading
of the manuscript and Pinky Amin for expert technical assistance.
*
This work was supported by grants from the United States
Department of Agriculture (to N. E. H.) and the Deutsche
Forschungsgemeinschaft (to D. S.). This article is Carnegie
Institution of Washington Publication 1418.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The abbreviations used are:
SRP, signal
recognition particle;
cpSRP, chloroplast SRP;
LHCP, light-harvesting
chlorophyll protein;
GST, glutathione S-transferase;
PCR, polymerase chain reaction;
NTA, nitrilotriacetic acid;
PAGE, polyacrylamide gel electrophoresis;
cpFtsY, chloroplast FtsY;
cpSec, chloroplast Sec.
Chloroplast FtsY, Chloroplast Signal Recognition Particle, and
GTP Are Required to Reconstitute the Soluble Phase of Light-harvesting
Chlorophyll Protein Transport into Thylakoid Membranes*
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-subunit), and an
integral membrane polypeptide (the SRP receptor 
-subunit) (7, 8). The localization of the SRP receptor to the membrane may facilitate, but is not essential for, targeting (9). A key feature of the SRP/SRP
receptor interaction is the ability of the SRP receptor -subunit and
SRP54 to reciprocally stimulate their GTP hydrolysis activities upon
mutual binding in the presence of SRP RNA and thereby to regulate the
GTP hydrolysis cycle associated with SRP-dependent protein
targeting (10, 11).
-subunit of the SRP receptor (23). Recently, a
putative ftsY gene was detected on chromosome II of Arabidopsis (Bacterial Artificial Clone number F4I18.25 and
GenBankTM accession number ATAC004665). In the present
work, we demonstrate that the FtsY homologue is a chloroplast protein
and, together with cpSRP and GTP, is required for reconstituting the
soluble phase of LHCP transport. Furthermore, using these functionally active proteins, we have measured the subunit stoichiometry of cpSRP.
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-D-thiogalactopyranoside for
3 h. Cells were harvested and frozen at 
80 °C until use. Overexpressed protein was purified on Ni2+-NTA-agarose
(QIAGEN Inc.) as suggested by the manufacturer. Recombinant protein was
further purified by SDS-PAGE, eluted from gel slices, and injected into
rabbits to raise antibodies (Cocalico Biologicals, Inc., Reamstown,
PA). The IgG fraction was prepared from crude serum and
affinity-purified on antigen cross-linked to Affi-Gel 10 (25).
Immunoblot analysis was done as described (24). Antibodies against LHCP
(12), cpSRP43 (15), and cpSRP54 (17) were previously described.
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
View larger version (33K):
[in a new window]
Fig. 1.
cpSRP43 is a dimer. Wheat germ
translation product of cpSRP54 (54tp) (A) and the
stroma from the Arabidopsis mutant
ffc1-2 (lacking cpSRP54) (B) were
fractionated by gel filtration, and cpSRP54 and cpSRP43 were detected
by immunoblot analyses as described under "Experimental
Procedures." A, cpSRP54 elutes as a monomer with an
estimated molecular mass of 55,000 Da. B, cpSRP43 elutes as
a dimer with an estimated molecular mass of 70,000 Da.
Inset, dimers (**) of cpSRP43 (90,000 Da) and GST43 (126,000 Da) were detected by SDS-PAGE after disuccinimidyl tartarate
cross-linking. The monomeric forms (*) run at 42,000 and 66,000 Da for
cpSRP43 and GST43, respectively.
View larger version (49K):
[in a new window]
Fig. 2.
Subunit stoichiometry of cpSRP. a,
cpSRP stoichiometry. First and second lanes,
cpSRP54his (3.4 µCi) and GST43 (2.7 µCi) translation products were
individually bound and eluted from Ni2+-NTA-agarose
(Ni), respectively. Third and fourth
lanes, the same amounts of cpSRP54his and GST43 were individually
bound and eluted from glutathione-Sepharose (GS),
respectively. Fifth lane, 3.4 µCi of cpSRP54his and 2.7 µCi of GST43 translation products were preincubated and successively
purified over glutathione-Sepharose and Ni2+-NTA-agarose as
described under "Experimental Procedures." Pixel values for each
protein were determined by radioimaging of SDS-polyacrylamide gels; the
values were normalized by dividing by the number of methionines in each
protein; and the ratio of the normalized pixel values was determined.
The data shown are from one experiment repeated a total of two times
with similar results. b, cpSRP43 does not cause cpSRP54 to
dimerize. 0.5 µg of GST54, 0.5 µg of cpSRP43, or 3.4 µCi of
cpSRP54his (~0.2 µg) were mixed as indicated, purified on
glutathione-Sepharose, subjected to SDS-PAGE, electrophoretically
transferred to nitrocellulose, and analyzed by radioimaging
(lower panel) and immunoblotting (upper panel)
with antibodies against cpSRP54 and cpSRP43 as described under
"Experimental Procedures."
View larger version (73K):
[in a new window]
Fig. 3.
Alignment of Arabidopsis thaliana cpFtsY with related prokaryotic and eukaryotic sequences.
Sequences of FtsY homologues from Synechocystis PCC
6803 (GenBankTM/EBI accession number P73930) and
E. coli (P10121) and the -subunit of the SRP receptor
from Saccharomyces cerevisiae (M77274) and humans (P08240)
were aligned with the A. thaliana cpFtsY sequence using
Clustal W1.7 and shaded using the program Gene.doc. Residues conserved
in all sequences are in black; residues conserved in four
sequences are in dark gray; and residues conserved in three
sequences are in light gray. Conserved residues are based on
the following assignments: D = N, E = Q, S = T, K = R, F = Y = W, L = I = V = M, and G = P. The putative cleavage site for the stromal processing peptidase is
indicated by the arrow.
View larger version (44K):
[in a new window]
Fig. 4.
A, import of the FtsY precursor into pea
chloroplasts and localization of the processed protein. The FtsY
precursor was synthesized in vitro (26), and the
radiolabeled product was incubated with intact pea chloroplasts and
subsequently treated with 0.1 mg/ml thermolysin (42). Chloroplasts were
osmotically lysed by resuspension in 10 mM HEPES-KOH, pH
8.0, and 10 mM EDTA; stromal (Str) and thylakoid
(Tlk) fractions were separated by centrifugation; and the
fractions were analyzed by SDS-PAGE and fluorography. Samples prepared
from intact purified chloroplasts containing the indicated amounts of
chlorophyll (Chl) or 5 ng of FtsY antigen were immunoblotted
against cpFtsY antisera. B, FtsY does not co-chromatograph
with cpSRP. The stroma was prepared from intact pea chloroplasts and
fractionated by fast protein liquid chromatography on a Superose 6HR
column. Each fraction was immunoblotted against cpSRP54, cpSRP43, and
cpFtsY antisera and quantitated as described (12). Arab,
Arabidopsis; pFtsY, precursor FtsY;
mFtsY, mature FtsY; Trans, translation product;
Clps, chloroplast.
View larger version (30K):
[in a new window]
Fig. 5.
Reconstitution of the soluble phase of LHCP
transport requires cpSRP, cpFtsY, and GTP. Integration assays were
performed as described under "Experimental Procedures" using 150 ng
of recombinant cpSRP43, 0.15 mM GTP, and wheat germ
in vitro translation products of precursor LHCP
(pLHCP; 3.6 nCi), cpSRP54 (20 µl), and cpFtsY (40 µl).
Reactions were terminated by treatment with 0.2 mg/ml trypsin for 30 min on ice. After the addition of 3 mM phenylmethylsulfonyl
fluoride, the thylakoids were washed one time in a solution of 0.33 M sorbitol, 10 mM EDTA, and 10 mM
HEPES-KOH, pH 8.0; resuspended in 15 µl of 4× sample buffer; and
analyzed by SDS-PAGE and fluorography. mLHCP, mutant
LHCP.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
View larger version (25K):
[in a new window]
Fig. 6.
Model for LHCP integration into thylakoid
membranes. One cpSRP43 dimer binds one cpSRP54 monomer to form
cpSRP. At steady-state levels, most if not all cpSRP43 is complexed
with cpSRP54. Each cpSRP complex is presumed to interact with a single
molecule of LHCP to form the transit complex. LHCP may actually be
sequestered from the aqueous phase in a cavity within cpSRP. LHCP
integrates into the thylakoid membrane in a reaction that requires
cpFtsY and GTP hydrolysis. The membrane components required for the
integration reaction remain unknown.
ACKNOWLEDGEMENTS
FOOTNOTES
To whom correspondence should be addressed: Paradigm
Genetics, 104 Alexander Dr., Bldg. 2, P. O. Box 14528, Research
Triangle Park, NC 27709. Tel.: 919-544-5578; Fax: 919-544-8094; E-mail: nhoffman@paragen.com.
ABBREVIATIONS
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Rapoport, T. A.,
Jungnickel, B.,
and Kutay, U.
(1996)
Annu. Rev. Biochem.
65,
271-303[CrossRef][Medline]
[Order article via Infotrieve]
2.
Walter, P.,
and Johnson, A. E.
(1994)
Annu. Rev. Cell Biol.
10,
87-119[CrossRef]
3.
Ulbrandt, N. D.,
Newitt, J. A.,
and Bernstein, H. D.
(1997)
Cell
88,
187-196[CrossRef][Medline]
[Order article via Infotrieve]
4.
Gilmore, R.,
Blobel, G.,
and Walter, P.
(1982)
J. Cell Biol.
95,
463-469 5.
Gilmore, R.,
Walter, P.,
and Blobel, G.
(1982)
J. Cell Biol.
95,
470-477 6.
Meyer, D. I.,
and Dobberstein, B.
(1980)
J. Cell Biol.
87,
503-508 7.
Tajima, S.,
Lauffer, L.,
Rath, V.,
and Walter, P.
(1986)
J. Cell Biol.
103,
1167-1178 8.
Miller, J. D.,
Tajima, S.,
Lauffer, L.,
and Walter, P.
(1995)
J. Cell Biol.
128,
273-282 9.
Ogg, S. C.,
Barz, W. P.,
and Walter, P.
(1998)
J. Cell Biol.
142,
341-354 10.
Miller, J. D.,
Bernstein, H. D.,
and Walter, P.
(1994)
Nature
367,
657-659[CrossRef][Medline]
[Order article via Infotrieve]
11.
Powers, T.,
and Walter, P.
(1995)
Science
269,
1422-1424 12.
Schuenemann, D.,
Gupta, S.,
Persello-Cartieaux, F.,
Klimyuk, V. I.,
Jones, J. D. G.,
Nussaume, L.,
and Hoffman, N. E.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
10312-10316 13.
Schuenemann, D.,
Amin, P.,
and Hoffman, N. E.
(1999)
Biochem. Biophys. Res. Commun.
254,
253-258[CrossRef][Medline]
[Order article via Infotrieve]
14.
Franklin, A. E.,
and Hoffman, N. E.
(1993)
J. Biol. Chem.
268,
22175-22180 15.
Klimyuk, V. I.,
Persello-Cartieaux, F.,
Havaux, M.,
Contard, P.,
Schuenemann, D.,
Meiherhoff, K.,
Gouet, P.,
Jones, J. D. G.,
Hoffman, N. E.,
and Nussaume, L.
(1999)
Plant Cell
11,
87-99 16.
Li, X. X.,
Henry, R.,
Yuan, J. G.,
Cline, K.,
and Hoffman, N. E.
(1995)
Proc. Natl. Acad. Sci. U. S .A.
92,
3789-3793 17.
Amin, P., Sy, D., Pilgrim, M., Parry, D., Nussaume, L., and Hoffman,
N. E. (1999) Plant Physiol. (Bethesda), in
press
18.
Cline, K.,
Fulsom, D. R.,
and Viitanen, P. V.
(1989)
J. Biol. Chem.
264,
14225-14232 19.
Reed, J. E.,
Cline, K.,
Stephens, L. C.,
Bacot, K. O.,
and Viitanen, P. V.
(1990)
Eur. J. Biochem.
194,
33-42[Medline]
[Order article via Infotrieve]
20.
Payan, L. A.,
and Cline, K.
(1991)
J. Cell Biol.
112,
603-613 21.
Hoffman, N. E.,
and Franklin, A. E.
(1994)
Plant Physiol. (Bethesda)
105,
295-304[Abstract]
22.
Gill, D. R.,
and Salmond, G. P. C.
(1987)
Mol. Gen. Genet.
210,
504-508[CrossRef][Medline]
[Order article via Infotrieve]
23.
Bernstein, H.,
Poritz, M. A.,
Strub, K.,
Hoben, P.,
Brenner, S.,
and Walter, P.
(1989)
Nature
340,
482-486[CrossRef][Medline]
[Order article via Infotrieve]
24.
Pilgrim, M. L.,
van Wijk, K.-J.,
Parry, D. H.,
Sy, D. A. C.,
and Hoffman, N. E.
(1998)
Plant J.
13,
177-186[CrossRef][Medline]
[Order article via Infotrieve]
25.
Harlow, E.,
and Lane, D.
(1988)
Antibodies: A Laboratory Manual
, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
26.
Adam, Z.,
and Hoffman, N. E.
(1993)
Plant Physiol. (Bethesda)
102,
35-43[Abstract]
27.
Hedrick, J. L.,
and Smith, A. J.
(1968)
Arch. Biochem. Biophys.
126,
155-164[CrossRef][Medline]
[Order article via Infotrieve]
28.
Emanuelsson, O.,
Nielsen, H.,
and von Heijne, G.
(1999)
Protein Sci
8,
978-984[Abstract]
29.
Kogata, N.,
Nishio, K.,
Hirohashi, T.,
Kikuchi, S.,
and Nakai, M.
(1999)
FEBS Lett.
329,
329-333[CrossRef]
30.
Nilsson, R.,
Brunner, J.,
Hoffman, N. E.,
and van Wijk, K.-J.
(1999)
EMBO J.
18,
733-742[CrossRef][Medline]
[Order article via Infotrieve]
31.
Valent, Q. A.,
Scotti, P. A.,
High, S.,
deGier, J. W. L.,
von Heijne, G.,
Lentzen, G.,
Wintermeyer, W.,
Oudega, B.,
and Luirink, J.
(1998)
EMBO J.
17,
2504-2512[CrossRef][Medline]
[Order article via Infotrieve]
32.
Schatz, P. J.,
and Beckwith, J.
(1990)
Annu. Rev. Genet.
24,
215-248[CrossRef][Medline]
[Order article via Infotrieve]
33.
Akimaru, J.,
Matsuyama, S. I.,
Tokuda, H.,
and Mizushima, S.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
6545-6549 34.
Yuan, J. G.,
Henry, R.,
Mccaffery, M.,
and Cline, K.
(1994)
Science
266,
796-798 35.
Nakai, M.,
Goto, A.,
Nohara, T.,
Sugita, D.,
and Endo, T.
(1994)
J. Biol. Chem.
269,
31338-31341 36.
Laidler, V.,
Chaddock, A. M.,
Knott, T. G.,
Walker, D.,
and Robinson, C.
(1995)
J. Biol. Chem.
270,
17664-17667 37.
Schuenemann, D.,
Amin, P.,
Hartmann, E.,
and Hoffman, N. E.
(1999)
J. Biol. Chem.
274,
12177-12182 38.
Hulford, A.,
Hazell, L.,
Mould, R. M.,
and Robinson, C.
(1994)
J. Biol. Chem.
269,
3251-3256 39.
Yuan, J. G.,
and Cline, K.
(1994)
J. Biol. Chem.
269,
18463-18467 40.
Cline, K.,
Henry, R.,
Li, C. J.,
and Yuang, J. G.
(1993)
EMBO J.
12,
4105-4114[Medline]
[Order article via Infotrieve]
41.
Voelker, R.,
and Barkan, A.
(1995)
EMBO J.
14,
3905-3914[Medline]
[Order article via Infotrieve]
42.
Cline, K.
(1986)
J. Biol. Chem.
261,
14804-14810
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  P. Jaru-Ampornpan, S. Chandrasekar, and S.-o. Shan Efficient Interaction between Two GTPases Allows the Chloroplast SRP Pathway to Bypass the Requirement for an SRP RNA Mol. Biol. Cell, July 1, 2007; 18(7): 2636 - 2645. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Tzvetkova-Chevolleau, C. Hutin, L. D. Noel, R. Goforth, J.-P. Carde, S. Caffarri, I. Sinning, M. Groves, J.-M. Teulon, N. E. Hoffman, et al. Canonical Signal Recognition Particle Components Can Be Bypassed for Posttranslational Protein Targeting in Chloroplasts PLANT CELL, May 1, 2007; 19(5): 1635 - 1648. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Gerdes, T. Bals, E. Klostermann, M. Karl, K. Philippar, M. Hunken, J. Soll, and D. Schunemann A Second Thylakoid Membrane-localized Alb3/OxaI/YidC Homologue Is Involved in Proper Chloroplast Biogenesis in Arabidopsis thaliana J. Biol. Chem., June 16, 2006; 281(24): 16632 - 16642. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Huang, J. P. Taylor, J.-G. Chen, J. F. Uhrig, D. J. Schnell, T. Nakagawa, K. L. Korth, and A. M. Jones The Plastid Protein THYLAKOID FORMATION1 and the Plasma Membrane G-Protein GPA1 Interact in a Novel Sugar-Signaling Mechanism in Arabidopsis PLANT CELL, May 1, 2006; 18(5): 1226 - 1238. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Funke, T. Knechten, J. Ollesch, and D. Schunemann A Unique Sequence Motif in the 54-kDa Subunit of the Chloroplast Signal Recognition Particle Mediates Binding to the 43-kDa Subunit J. Biol. Chem., March 11, 2005; 280(10): 8912 - 8917. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Spence, S. Bailey, A. Nenninger, S. G. Moller, and C. Robinson A Homolog of Albino3/OxaI Is Essential for Thylakoid Biogenesis in the Cyanobacterium Synechocystis sp. PCC6803 J. Biol. Chem., December 31, 2004; 279(53): 55792 - 55800. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. L. Goforth, E. C. Peterson, J. Yuan, M. J. Moore, A. D. Kight, M. B. Lohse, J. Sakon, and R. L. Henry Regulation of the GTPase Cycle in Post-translational Signal Recognition Particle-based Protein Targeting Involves cpSRP43 J. Biol. Chem., October 8, 2004; 279(41): 43077 - 43084. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Ossenbuhl, V. Gohre, J. Meurer, A. Krieger-Liszkay, J.-D. Rochaix, and L. A. Eichacker Efficient Assembly of Photosystem II in Chlamydomonas reinhardtii Requires Alb3.1p, a Homolog of Arabidopsis ALBINO3 PLANT CELL, July 1, 2004; 16(7): 1790 - 1800. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Asakura, T. Hirohashi, S. Kikuchi, S. Belcher, E. Osborne, S. Yano, I. Terashima, A. Barkan, and M. Nakai Maize Mutants Lacking Chloroplast FtsY Exhibit Pleiotropic Defects in the Biogenesis of Thylakoid Membranes PLANT CELL, January 1, 2004; 16(1): 201 - 214. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. M. Gomez, K. Y. Bil', R. Aguilera, J. N. Nishio, K. F. Faull, and J. P. Whitelegge Transit Peptide Cleavage Sites of Integral Thylakoid Membrane Proteins Mol. Cell. Proteomics, October 1, 2003; 2(10): 1068 - 1085. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Moore, R. L. Goforth, H. Mori, and R. Henry Functional interaction of chloroplast SRP/FtsY with the ALB3 translocase in thylakoids: substrate not required J. Cell Biol., September 29, 2003; 162(7): 1245 - 1254. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Bellafiore, P. Ferris, H. Naver, V. Gohre, and J.-D. Rochaix Loss of Albino3 Leads to the Specific Depletion of the Light-Harvesting System PLANT CELL, September 1, 2002; 14(9): 2303 - 2314. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Yuan, A. Kight, R. L. Goforth, M. Moore, E. C. Peterson, J. Sakon, and R. Henry ATP Stimulates Signal Recognition Particle (SRP)/FtsY-supported Protein Integration in Chloroplasts J. Biol. Chem., August 23, 2002; 277(35): 32400 - 32404. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Motohashi, N. Nagata, T. Ito, S. Takahashi, T. Hobo, S. Yoshida, and K. Shinozaki An essential role of a TatC homologue of a Delta pH- dependent protein transporter in thylakoid membrane formation during chloroplast development in Arabidopsis thaliana PNAS, August 28, 2001; 98(18): 10499 - 10504. [Abstract] [Full Text] [PDF]
|
|
