|
J Biol Chem, Vol. 274, Issue 38, 27257-27264, September 17, 1999
Inhibition of Fibronectin Matrix Assembly by the Heparin-binding
Domain of Vitronectin*
Denise C.
Hocking ,
Jane
Sottile,
Thomas
Reho,
Reinhard
Fässler§, and
Paula J.
McKeown-Longo¶
From the Cell and Molecular Biology Program and the Department of
Physiology and Cell Biology, Albany Medical College, Albany, New York
12208 and the § Department of Experimental Pathology, Lund
University, 22185 Lund, Sweden
 |
ABSTRACT |
The deposition of fibronectin into the
extracellular matrix is an integrin-dependent, multistep
process that is tightly regulated in order to ensure controlled matrix
deposition. Reduced fibronectin deposition has been associated with
altered embryonic development, tumor cell invasion, and abnormal wound
repair. In one of the initial steps of fibronectin matrix assembly, the
amino-terminal region of fibronectin binds to cell surface receptors,
termed matrix assembly sites. The present study was undertaken to
investigate the role of extracellular signals in the regulation of
fibronectin deposition. Our data indicate that the interaction of cells
with the extracellular glycoprotein, vitronectin, specifically inhibits matrix assembly site expression and fibronectin deposition. The region
of vitronectin responsible for the inhibition of fibronectin deposition
was localized to the heparin-binding domain. Vitronectin's heparin-binding domain inhibited both 1 and
non- 1 integrin-dependent matrix assembly
site expression and could be overcome by treatment of cells with
lysophosphatidic acid, an agent that promotes actin polymerization. The
interaction of cells with the heparin-binding domain of vitronectin
resulted in changes in actin microfilament organization and the
subcellular distribution of the actin-associated proteins -actinin
and talin. These data suggest a mechanism whereby the heparin-binding
domain of vitronectin regulates the deposition of fibronectin into the
extracellular matrix through alterations in the organization of the
actin cytoskeleton.
 |
INTRODUCTION |
The deposition of fibronectin into the extracellular matrix is a
dynamic, multistep process that is normally tightly regulated in order
to ensure controlled matrix deposition. In certain disease states,
including pulmonary fibrosis and atherosclerosis, loss of this
regulation gives rise to either excess or inappropriate fibronectin
deposition (1). In addition, reduced fibronectin deposition has been
associated with altered embryonic development, tumor cell invasion, and
abnormal wound repair (1). The mechanisms that control the rate and
extent of fibronectin deposition are only partially understood.
Adherent cells polymerize an insoluble fibronectin matrix by assembling
cell- or plasma-derived soluble fibronectin into insoluble fibrils (2).
In one of the initial steps of matrix assembly, cell surfaces bind the
amino-terminal region of fibronectin in a reversible and saturable
manner (3, 4). Subsequent homophilic binding interactions are thought
to promote the polymerization of the fibronectin molecule into an
insoluble matrix (5-9) and allow for the regeneration of the cell
surface amino-terminal binding site (2). The binding of the amino
terminus of fibronectin to cell surface receptors, termed matrix
assembly sites (3), is mediated by the first five type I repeats of
fibronectin (4, 10). The molecule(s) that mediates the binding of the
amino terminus of fibronectin to cell surfaces has not been
definitively identified. It has been proposed that the III1
module of fibronectin (8, 11), large molecule mass molecules (12), and
the fibronectin-binding 5 1 integrin
(13-15) interact with the amino terminus of fibronectin on cell surfaces.
Expression of cell surface matrix assembly sites may be rapidly up- and
down-regulated by protein kinase C activation, cyclic AMP levels, and
1-oleoyl lysophosphatidic acid
(LPA)1 treatment (16-18).
Activators of protein kinase C, which effect both stress fiber and
focal contact formation (19), enhance fibronectin matrix assembly (17).
Conversely, increasing intracellular cAMP levels, which disrupt actin
stress fibers and cause cell retraction (20), inhibit matrix assembly
(16). In addition, studies have demonstrated loss of matrix assembly
sites (21) and decreased fibronectin deposition (22) upon disruption of the actin cytoskeleton with cytochalasin D. More recent studies have
defined a role for Rho-mediated contractility in the expression of
matrix assembly sites and fibronectin deposition (18, 23, 24).
Increasing Rho-stimulated contraction through treatment of cells with
either LPA (18, 23) or nocodazole (24) or by microinjection of
recombinant, constitutively active Rho (23) results in an increase in
amino-terminal fibronectin fragment binding and enhanced fibronectin
deposition. Taken together, these observations indicate that matrix
assembly site expression and fibronectin deposition are regulated, in
part, by actin stress fiber formation and the contractile state of the cell.
Although it has been well documented that decreased fibronectin matrix
assembly occurs in most transformed and tumor-derived cell lines,
little is known about the extracellular signals that regulate matrix
assembly activity in normal fibroblasts. Earlier studies have
demonstrated that cells adherent to vitronectin exhibit decreased
levels of cell surface matrix assembly sites compared with
fibronectin-adherent cells (21, 25-27). These data suggest the
possibility that the interaction of cells with vitronectin generates
inhibitory signals that regulate matrix assembly site expression. In
the present study, we demonstrate that the interaction of cells with
vitronectin inhibits matrix assembly site expression and fibronectin
deposition. The region of vitronectin responsible for the inhibition of
fibronectin matrix assembly was localized to the heparin-binding
domain. The inhibitory effect of vitronectin's heparin-binding domain
was independent of the integrin receptor used to assemble the
fibronectin matrix. Vitronectin-mediated inhibition of matrix assembly
site expression could be overcome by treatment of cells with LPA, an
agent that promotes actin polymerization (18, 24). Moreover, the
interaction of fibronectin-adherent cells with the heparin-binding
domain of vitronectin resulted in changes in actin microfilament
organization and the subcellular distribution of the actin-associated
proteins, -actinin, and talin. These data suggest a mechanism
whereby the heparin-binding domain of vitronectin down-regulates
fibronectin matrix assembly through alterations in the organization of
the actin cytoskeleton.
 |
EXPERIMENTAL PROCEDURES |
Reagents and Antibodies--
Gel electrophoresis supplies were
from Bio-Rad. Unless other indicated, chemicals were obtained from
Sigma. The polyclonal anti-fibronectin antibody was prepared by as
described previously (28). The following monoclonal antibodies were
purchased: anti-integrin v 3 (LM609),
integrin subunit 5 (P1F6), -actinin, and talin from
Chemicon International (Temecula, CA); anti-vinculin antibody from Sigma.
Cell Culture--
Human foreskin fibroblasts, A1-Fs, were a gift
from Dr. Lynn Allen-Hoffmann (University of Wisconsin, Madison, WI).
A1-Fs were cultured in Dulbecco's modified eagle's medium (DMEM; Life Technologies, Inc.) supplemented with 10% fetal bovine serum (Sterile Systems, Logan, UT). GD25 and GD25 1 cells were cultured
as described previously (29).
Purification of Plasma Proteins and Fragments--
Human
plasma fibronectin was purified from a fibronectin- and fibrinogen-rich
by-product of Factor VIII production by ion exchange chromatography on
DEAE-cellulose (Amersham Pharmacia Biotech) as described previously
(30). The 70-kDa amino-terminal fragment of fibronectin was generated
by limited digestion of intact fibronectin with cathepsin D, followed
by gelatin affinity chromatography as described previously (30).
Vitronectin was purified from fibronectin- and fibrinogen-depleted
human plasma by heparin-Sepharose (Amersham Pharmacia Biotech) affinity
chromatography according to the method of Yatohgo et al.
(31). The 40-kDa cell-binding fragment of vitronectin was generated by
acid cleavage of intact vitronectin (32). Purified vitronectin was
dissolved in 70% formic acid and incubated at 37 °C for 46 h.
The digested vitronectin was diluted 1:10 with water, lyophilized, and
reconstituted in 50 mM Tris, pH 7.6. The 40-kDa
cell-binding fragment of vitronectin was separated from heparin-binding
fragments by exclusion on a heparin-Sepharose affinity column.
Vitronectin fragments that bound to the heparin-Sepharose were eluted
with 0.5 M NaCl in 25 mM phosphate buffer, pH
7.4. Both the cell-binding and heparin-binding fragments were dialyzed extensively against PBS prior to use. Purity of protein preparations was assessed by SDS-polyacrylamide gel electrophoresis, and proteins were frozen at 80 °C until use.
Rat tail collagen type I was purchased from Beckton Dickinson. Laminin
(purified from EHS tumors) was purchased from Upstate Biotechnology,
Inc. (Lake Placid, NY). Thrombospondin was purified from platelet
releasate as described previously (72) and was a gift from Dr. Deane
Mosher (University of Wisconsin, Madison, WI). Fibrinogen was purified
from human plasma (33) and was a gift of Dr. John Kaplan (Albany
Medical College).
Purification of Recombinant Proteins--
Recombinant human
fibronectin III9,10 (FnIII9,10) was expressed
in BL21 (DE3) bacteria as a fusion protein with glutathione S-transferase (GST) as described previously (9).
FnIII9,10 was separated from GST by digestion with trypsin
followed by chromatography over glutathione-agarose (9).
Polymerase chain reaction (PCR) was used to amplify human fibronectin
cDNA encoding the 12th and 13th type III modules of fibronectin
(FnIII12,13) (bases 5081-5623). This DNA encodes amino acids Ala-1689 through Thr-1869, which represents the major
heparin-binding region of fibronectin (34). Bases are numbered from the
A in the codon for the first amino acid of the mature protein (EMBL accession number X02761), and amino acids are numbered from the
amino-terminal pyroglutamic acid (35). PCR was also used to amplify
human vitronectin cDNA) encoding the heparin-binding domain of
vitronectin (VnHBD) (bases 1138-1258) (36, 37). This DNA
encodes amino acids from Ala-341 through Ala-380 (38, 39). The sense
primers for the FnIII12,13 construct
(5'-CCGGATCCGCTATTCCTGCACCAACTGAC) and the VnHBD
construct (5'-CCCGGATCCGCACCCCGCCCCTCCTTG) were
synthesized with a BamHI site (shown in boldface type) at the 5'-end. The antisense primers for the FnIII12,13
construct (5'-CCCGAATTCCTATAGTGGAGGC
GTCGATGACCA) and the VnHBD construct (5'-CCCGAATTCCTAGGCGCGGGATGGCCGGCG) were
synthesized with an EcoRi site (shown in boldface type) at
the 5'-end. Underlined bases introduce a stop codon after the last base
in the sequence to be amplified. PCR was performed according to
established procedures (40), using human full-length fibronectin
cDNA, pFH100 (a gift from Dr. Jean Thiery, Paris, France) or
vitronectin cDNA (a gift from Dr. Erkki Ruoslahti, Burnham
Institute, La Jolla, CA) as a template. Following restriction enzyme
digestion, the PCR-amplified DNA was cloned into the bacterial
expression vector pGEX-2T (Amersham Pharmacia Biotech) and transfected
into BL21 (DE3) bacteria using standard procedures (40). PCR-amplified
DNA was sequenced to confirm that no base changes had been introduced
during amplification of the DNA. Fusion proteins were isolated by
passing bacterial lysates over glutathione-agarose as described
previously (8) and were dialyzed extensively against PBS prior to use.
Both GST-FnIII12,13 and GST-VnHBD bound avidly
to heparin-Sepharose (data not shown).
Recombinant vitronectins were produced using a baculovirus expression
system. Nonmutant and mutant vitronectins were PCR-amplified using the
sense primer 5'-GGCTACCGTTCACAACGA and the antisense primer
5'-GGGTCTAGACTACAGATGGCCAGGAGCTGG. The VnRGE
mutant was produced using recombinant PCR (41). The two mutagenic
primers were
5'-GCAAGCCCCAAGTGACTCGCGGGGAGGTGTTCACTATGCCGGAGGATGAGT (sense) and
5'-ACTCATCCTCCGGCATAGTGAACACCTCCCCGCGAGTCACTTGGGGCTTGC (antisense). The mutated bases are shown in boldface type. The two
outer primers used were the same as those used to amplify nonmutant
vitronectin. PCR-amplified DNA was cloned into the baculovirus expression vector, PVL1392 (Pharmingen), using the restriction enzymes
NotI and XbaI.
Recombinant viruses were generated according to established procedures
(42, 43). Viral stocks were prepared using SF21 cells grown in
serum-free SF900II medium (Life Technologies, Inc.). Supernatants from
infected cells were collected 72 h postinfection. To purify the
recombinant vitronectins, supernatants were treated with 8 M urea for 2 h at 20 °C and passed over columns of
heparin-Sepharose (Amersham Pharmacia Biotech). Resins were washed with
130 mM NaCl, 4 M urea in 25 mM
phosphate, pH 6.5, and bound proteins were eluted with 0.5 M NaCl, 4 M urea in 50 mM phosphate
buffer, pH 8. The recombinant vitronectins were dialyzed extensively
against PBS. Purity of the recombinant protein preparations was
assessed by SDS-polyacrylamide gel electrophoresis, and proteins were
frozen at 80 °C until use.
Cell Binding Assays--
The 70-kDa fibronectin fragment was
iodinated with 1.0 mCi of Na125I (NEN Life Science
Products) using chloramine T as described previously (3). Fibronectin,
laminin, vitronectin, thrombospondin, anti-integrin antibodies, and
FnIII9,10 were diluted to 10 µg/ml in PBS and coated onto
24-well tissue plates (Corning/Costar) for 3 h at 37 °C.
Thrombospondin was reduced with 20 mM dithiothreitol for 30 min at 20 °C prior to use (44). Fibrinogen was coated onto culture
plates at 100 µg/ml in PBS. Collagen was coated onto culture plates
in 0.02 N acetic acid at 50 µg/ml at 4 °C overnight. Protein-coated wells were washed three times with PBS before use. To
minimize endogenous fibronectin levels during experimental procedures,
cells were washed three times with serum-free DMEM and pretreated for
3.5 h with cycloheximide (20 µg/ml) (30) in DMEM containing
ITS+2 (Sigma) as described previously (15). Cells were seeded at
105 cells/well in DMEM/ITS+2 with 20 µg/ml cycloheximide.
Following an overnight incubation, cells were washed three times with
serum-free DMEM and incubated for 1 h with 0.5 × 106 cpm/ml 125I-labeled 70-kDa fragment (~20
ng/well) in DMEM containing 0.2% bovine serum albumin (45). Cell
adhesion was quantitated in parallel wells by staining with 0.5%
crystal violet as described previously (15).
Immunofluorescence Microscopy--
For fibronectin matrix
assembly assays, non-cycloheximide-treated fibroblasts were seeded onto
fibronectin-coated coverslips in 12-well cluster dishes at
105 cells/well in DMEM/ITS+2 in the absence or presence of
1.7 µM GST/VnHBD, GST/FnIII12,13,
or 0.75 µM recombinant vitronectin and incubated
overnight at 37 °C. Cells were fixed and permeabilized, and
fibronectin fibrils were visualized using a polyclonal anti-fibronectin antibody followed by a fluorescein isothiocyanate-conjugated goat anti-rabbit antibody (Cappel). Cells were examined using an Olympus BX60 microscope equipped with epifluorescence and photographed using a
spot digital camera (Diagnostic Instruments, Sterling Heights, MI).
To assay changes in actin distribution, confluent fibroblasts were
washed with serum-free media and incubated overnight in serum-free
DMEM. Cells were detached with trypsin/EDTA, washed, and seeded onto
fibronectin coverslips in 12-well cluster dishes at 1.5 × 104 cells/well in DMEM/ITS+2 in the absence or presence of
3.4 µM of GST/VnHBD,
GST/FnIII12,13, or GST. Following an overnight incubation at 37 °C, actin filaments were visualized by staining fixed and permeabilized cells with fluorescein isothiocyanate-phalloidin (Molecular Probes, Inc., Eugene, OR). Vinculin was visualized using an
anti-vinculin antibody (Sigma) followed by a Texas Red-conjugated goat
anti-mouse secondary antibody (Cappel).
Cellular Localization of Actin-associated Proteins--
To assay
changes in the cellular distribution of -actinin, talin, and
vinculin, serum-starved, non-cycloheximide-treated fibroblast cells
were fractionated into digitonin-soluble and -insoluble
(cytoskeletal-associated) fractions (46). Cells were seeded at 4 × 105 cell/well into fibronectin-coated six-well tissue
culture plates in the absence or presence of 1.7 × 10 6 M GST/VnHBD or
GST/FnIII12,13. Following an overnight incubation at
37 °C, cells were washed three times with cold PBS and incubated for
5 min on ice with 0.1% digitonin in 50 mM Hepes, pH 6.9, containing 1 mM MgCl2, 1 mM EDTA, 1 mM EDTA, and inhibitors (10 mM sodium pyrophosphate, 50 mM sodium fluoride, 25 mM
-glycerophosphate, 25 µg/ml leupeptin, 25 µg/ml aprotinin, 0.5 mM sodium orthovanadate, 1 mM
H2O2, 0.5 mg/ml soybean trypsin inhibitor, and
2 mM phenylmethylsulfonyl fluoride). Following removal of
the digitonin-soluble fractions, cells were washed two times with PBS
and incubated on ice with radioimmune precipitation buffer (1% Triton
X-100, 0.1% SDS, 1% sodium deoxycholate in 50 mM Tris, pH
7.6, with 150 mM NaCl and inhibitors). Lysates were
clarified by centrifugation at 15,000 × g for 10 min
at 4 °C. Supernatants were assayed for protein concentration using
bicinchroninic acid (BCA) reagents (Pierce) according to the
manufacturer's instructions. Samples (10 µg) were analyzed under
nonreducing conditions by SDS-polyacrylamide gel electrophoresis and
immunoblotting as described previously (8). Immunoblots were developed
using enhanced chemiluminescence (Amersham Pharmacia Biotech) according
to the manufacturer's protocol.
 |
RESULTS |
Effect of Adhesive Substrates on Matrix Assembly Site
Expression--
The polymerization of a fibronectin matrix is a
cell-dependent process that is regulated by the expression
of specific matrix assembly sites on the surface of substrate-attached
cells (2). These sites have been identified by radioligand binding
assays using either 125I-labeled 70-kDa or
125I-labeled 27-kDa fragments derived from the amino
terminus of fibronectin (3, 4). Previous studies have demonstrated that cells adherent to vitronectin do not express matrix assembly sites (21,
25, 26). To examine further the effect of extracellular matrix
molecules on the expression of matrix assembly sites,
cycloheximide-pretreated fibroblasts were allowed to adhere and spread
on tissue culture wells coated with various adhesive proteins. Matrix
assembly site expression on these cells was then measured in a 1-h
binding assay using 125I-labeled 70-kDa fragment. Previous
studies have identified a homophilic binding site for the amino
terminus of fibronectin within the III1 module (8, 11).
Therefore, fibroblasts were also seeded onto the RGD-containing
III9,10 modules of fibronectin, which mediate cell adhesion
(9) but do not contain III1. As shown in Fig.
1A, cells adherent to
vitronectin bound significantly less 125I-labeled 70-kDa
fragment than cells adherent to either laminin, fibronectin,
FnIII9,10, collagen, thrombospondin, or fibrinogen. These
results suggest that among these adhesive proteins, vitronectin is
distinct in its ability to down-regulate matrix assembly sites.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 1.
Effect of adhesive substrates on 70-kDa
binding site expression. A, cycloheximide-pretreated
fibroblasts were seeded onto tissue culture wells precoated with
vitronectin (Vn), laminin (Ln), fibronectin
(Fn), recombinant III9 and III10
modules of fibronectin (FNIII9,10), collagen
(Col), thrombospondin (Tsp), or fibrinogen
(Fg) as described under "Experimental Procedures." Cells
were allowed to adhere and spread for 15 h at 37 °C.
125I-Labeled 70-kDa fragment binding assays were performed
as described under "Experimental Procedures." Similar numbers of
cells adhered to each substrate as assessed by staining parallel wells
with crystal violet (data not shown). B, cells were seeded
onto vitronectin (Vn) or FNIII9,10 and left
untreated (+PBS) or incubated with 100 nM PMA
(+PMA) or 2 µM LPA (+LPA) for
1 h prior to assay. Data are presented as the amount of
125I-labeled 70-kDa fragment bound per well ± S.E.
and represent one of three experiments done in triplicate.
|
|
Previous studies have shown that the expression of matrix assembly
sites on fibroblast monolayers is rapidly up-regulated either by
activation of protein kinase C with phorbol esters (47) or by
increasing Rho-stimulated contractility through treatment with either
LPA (18, 23) or nocodazole (24). To determine whether matrix assembly
site expression on vitronectin-adherent cells could be similarly
increased, cycloheximide-pretreated, vitronectin-adherent cells were
incubated with either PMA or LPA for 1 h, and the level of
125I-labeled 70-kDa fragment binding was assessed.
Treatment of vitronectin-adherent cells with 2 µM LPA
resulted in a 2-fold increase in 125I-labeled 70-kDa
fragment binding to levels similar to that observed on cells adherent
to FnIII9,10 (Fig. 1B). In contrast, treatment of vitronectin-adherent cells with PMA had no affect on
125I-labeled 70-kDa fragment binding (Fig. 1B).
These data indicate that matrix assembly site expression on
vitronectin-adherent cells can be up-regulated upon stimulation of
Rho-mediated signaling pathways.
Inhibition of 70-kDa Fragment Binding by Heparin-binding
Fragments of Vitronectin--
The ability of LPA to stimulate
125I-labeled 70-kDa fragment binding to
vitronectin-adherent cells suggests the possibility that the decreased
basal level of matrix assembly site expression on vitronectin-adherent
cells may be due to inhibitory signals generated upon cell adhesion to
vitronectin. Vitronectin is a modular glycoprotein that contains
domains that mediate binding to both cells and heparin (32). Cell
adhesion to vitronectin is mediated by the RGD sequence located in the
amino-terminal connecting sequence (32, 48-50), while vitronectin's
heparin-binding activity has been localized to a series of basic amino
acid residues in the carboxyl-terminal hemopexin II domain (32, 51). To
determine which regions of vitronectin are important for regulating
matrix assembly site expression, intact vitronectin was subjected to
limited proteolysis with formic acid. Cell- and heparin-binding
fragments were then separated by heparin affinity chromatography (32).
Cycloheximide-pretreated fibroblasts were seeded onto tissue culture
wells coated with either the 40-kDa cell-binding fragment of
vitronectin or intact fibronectin in the absence and presence of
various concentrations of heparin-binding vitronectin fragments. As
shown in Fig. 2A, cells
adherent to the cell-binding fragment of vitronectin bound 125I-labeled 70-kDa fragment to a similar extent as cells
adherent to intact fibronectin, suggesting that ligation of vitronectin binding integrins is permissive for the expression of matrix assembly sites. The addition of increasing amounts of heparin-binding fragments of vitronectin to cells adherent to either the cell-binding fragment of
vitronectin or intact fibronectin resulted in a
dose-dependent decrease in 125I-labeled 70-kDa
fragment binding (Fig. 2A). At the highest concentrations of
heparin-binding fragment tested, 125I-labeled 70-kDa
fragment binding to cells decreased to that observed on cells adherent
to intact vitronectin (Fig. 2A).

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 2.
Effect of heparin-binding fragments of
vitronectin on 125I-labeled 70-kDa fragment binding.
A, cycloheximide-pretreated fibroblasts were seeded onto
tissue culture wells precoated with 10 µg/ml of the 40-kDa
cell-binding fragment of vitronectin (hatched bars) or intact fibronectin (solid bars) in the absence (0) or presence of
increasing concentrations of heparin-binding fragments of vitronectin.
Cells were also seeded onto intact vitronectin (open bars). B, cells were seeded onto either
vitronectin integrin receptor-specific peptides (GPenGRGD),
anti-integrin v 3 (LM609) or
v 5 (P1F6) antibodies in the absence
(solid bars) or presence (hatched bars) of 20 µg/ml heparin-binding fragments of
vitronectin. Cells were also seeded onto intact fibronectin
(Fn) or intact vitronectin (Vn). The
125I-labeled 70-kDa fragment binding assay was performed as
indicated in the legend to Fig. 1. Data are presented as
125I-labeled 70-kDa fragment bound per well ± range
(A) or S.E. (B).
|
|
Adhesion of fibroblasts to vitronectin is mediated primarily by the
v 3 and v 5
integrins (52, 53). To determine whether ligation of either
v 3 or v 5
integrins results in the expression of matrix assembly sites,
cycloheximide-pretreated cells were seeded onto tissue culture wells
coated with the vitronectin integrin receptor-specific peptide,
GPenGRGDSP (50), or the anti- v 3 (LM609)
and v 5 (P1F6) monoclonal antibodies in
the absence or presence of 20 µg/ml heparin-binding fragments.
Similar numbers of cells adhered to all wells, as assessed by crystal
violet staining (data not shown). As shown in Fig. 2B,
ligation of integrin receptor v 3 or
v 5 resulted in levels of
125I-labeled 70-kDa fragment binding that were similar to
the level observed on cells adherent to intact fibronectin. The
addition of vitronectin heparin-binding fragments decreased
125I-labeled 70-kDa fragment binding to cells adherent to
either GPenGRGDSP or to the anti- v 3 and
- v 5 monoclonal antibodies to that
observed on cells adherent to intact vitronectin (Fig. 2B).
To further characterize the ability of the heparin-binding region of
vitronectin to inhibit the cell surface expression of matrix assembly
sites, intact vitronectin was preincubated with increasing
concentrations of heparin prior to coating onto tissue culture wells.
Following a 3-h incubation, unbound protein was removed, and wells were
washed with PBS prior to the seeding of cycloheximide pretreated
fibroblasts. As demonstrated in Fig. 3,
pretreatment of vitronectin with heparin prevented the inhibitory effect of vitronectin on 125I-labeled 70-kDa fragment
binding and resulted in a dose-dependent restoration of
125I-labeled 70-kDa fragment binding to levels observed on
fibronectin-adherent cells. Taken together, these data indicate that
ligation of either v 3 or
v 5 integrins with the RGD sequence of
vitronectin is permissive for matrix assembly site expression, while
the interaction of cells with a region in or near the heparin-binding
domain of vitronectin leads to a down-regulation of cell surface matrix assembly site expression.

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 3.
Expression of 70-kDa binding sites on cells
adherent to heparin-treated vitronectin. Tissue culture wells were
coated with 10 µg/ml untreated fibronectin ( ) or vitronectin
preincubated for 30 min with increasing concentrations of heparin
( ). Wells were washed with PBS, and cycloheximide-pretreated
fibroblasts were seeded at 105 in DMEM/ITS+2 with 20 µg/ml cycloheximide and allowed to adhere and spread for 18 h.
The 125I-labeled 70-kDa fragment binding assay was
performed as indicated in the legend to Fig. 1. Data are presented as
the amount of 125I-labeled 70-kDa fragment bound per
well ± S.E.
|
|
Localization of the Inhibitory Effect of Vitronectin on Matrix
Assembly Site Expression to the Heparin-binding Domain--
To more
precisely localize the region of vitronectin responsible for the
inhibition of matrix assembly site expression, a recombinant GST fusion
protein containing a 39-amino acid sequence encompassing the
heparin-binding domain of vitronectin (32, 51) was constructed and
tested for its ability to alter 125I-labeled 70-kDa
fragment binding. As shown in Fig. 4, the
addition of increasing concentrations of the heparin-binding domain of vitronectin to cells seeded onto fibronectin-coated dishes resulted in
a dose-dependent decrease in 125I-labeled
70-kDa fragment binding. This inhibitory effect was maximal at 0.9 µM VnHBD and was specific to the
heparin-binding domain of vitronectin. The addition of equal molar
concentrations of either GST alone or the heparin-binding domain of
fibronectin (GST/FNIII12,13) (34, 54) to
fibronectin-adherent cells had no effect on 125I-labeled
70-kDa fragment binding (Fig. 4). In addition, incubation of
fibronectin-adherent cells with either intact recombinant vitronectin or a recombinant vitronectin in which the RGD sequence had been mutated
to RGE (rVnRGE) resulted in inhibition of
125I-labeled 70-kDa fragment binding (Fig. 4). This
inhibitory effect was maximal at 0.35 µM, providing
further evidence that the inhibitory effect of vitronectin on matrix
assembly site expression is not due to integrin ligation via the RGD
sequence of vitronectin. Taken together, these data indicate that the
interaction of cells with the heparin-binding domain of vitronectin
leads to a down-regulation of matrix assembly site expression.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 4.
Effect of the heparin-binding domain of
vitronectin on 125I-labeled 70-kDa fragment binding.
Cycloheximide-pretreated fibroblasts were seeded onto
fibronectin-coated tissue culture wells and allowed to adhere and
spread for 45 min prior to the addition of GST/VnHBD ( ),
recombinant vitronectin ( ), recombinant VnRGE ( ),
GST/FnIII12,13 ( ), or GST ( ). Cells were incubated an
additional 15 h at 37 °C. The 125I-labeled 70-kDa
fragment binding assay was performed as indicated in the legend to Fig.
1. Data are presented as the amount of 125I-labeled 70-kDa
fragment bound per well ± S.E.
|
|
Vitronectin's Heparin-binding Domain Inhibits Fibronectin
Polymerization--
Upon binding of the amino-terminal region of
fibronectin to the cell surface, fibronectin accumulates in the
extracellular matrix in the form of disulfide-stabilized aggregates
(45). As such, the ability of vitronectin's heparin-binding domain to down-regulate matrix assembly site expression indicates a role for the
heparin-binding domain of vitronectin in the regulation of fibronectin
polymerization. To determine whether the interaction of cells with the
heparin-binding domain of vitronectin inhibits endogenous fibronectin
matrix assembly, non-cycloheximide-treated fibroblasts were seeded onto
fibronectin-coated coverslips in the absence or presence of either the
heparin-binding domain of vitronectin (1.7 µM), the
heparin-binding domain of fibronectin (1.7 µM), or intact
recombinant vitronectin (0.75 µM). These concentrations were chosen to ensure maximum inhibition of 70-kDa fragment binding (see Fig. 4). As demonstrated in Fig.
5A, control fibroblasts elaborated an extensive fibrillar fibronectin matrix. Similar fibrillar
fibronectin staining was observed on cells that had been incubated in
the presence of GST/FnIII12,13 (Fig. 5B). In contrast, treatment of cells with either the heparin-binding domain of
vitronectin (Fig. 5C) or intact recombinant vitronectin
(Fig. 5D) markedly reduced the assembly of a fibronectin
matrix. These data demonstrate that the interaction of cells with the
heparin-binding domain of vitronectin inhibits endogenous fibronectin
fibril formation and suggests a role for vitronectin in the regulation
of fibronectin matrix assembly.

View larger version (211K):
[in this window]
[in a new window]
|
Fig. 5.
Effect of the heparin-binding domain of
vitronectin on endogenous fibronectin matrix assembly. Fibroblasts
(105 in DMEM/ITS+2) were seeded onto coverslips precoated
with 5 µg/ml of fibronectin and allowed to adhere and spread for 45 min prior to the addition of either PBS (A),
GST/FnIII12,13 (B), GST/VnHBD
(C), or recombinant vitronectin (D). Cells were
incubated an additional 15 h at 37 °C. Cells were processed for
immunofluorescence as indicated under "Experimental Procedures."
Fibronectin fibrils were visualized using a polyclonal anti-fibronectin
antibody followed by an fluorescein isothiocyanate-labeled goat
anti-rabbit antibody.
|
|
Inhibition of Matrix Assembly Site Expression on 1
Null Cells--
Several recent studies indicate that
fibronectin-binding integrins other than
5 1, including
3 1 (55), "activated"
v 3 (56), and "activated"
IIb 3 (22), can support fibronectin matrix
assembly. To determine whether the heparin-binding domain of
vitronectin also down-regulates non- 1 integrin-mediated
matrix assembly site expression, cycloheximide-pretreated
1-null (GD25) and 1-transfected
(GD25 1) cells were seeded onto fibronectin-coated tissue
culture wells in the absence or presence of either intact vitronectin
or the heparin-binding domain of vitronectin. These cells, which lack
1-containing integrin receptors due to a targeted knockout of the 1 gene (57), have been shown to assemble
a fibronectin matrix through a mechanism that is thought to be
dependent on the v 3 integrin (29). As
shown in Fig. 6A, the addition of vitronectin to either A1F fibroblasts, 1-null, or
1-transfected cells resulted in a similar inhibition of
125I-labeled 70-kDa fragment binding. Similar to the
results obtained using A1F fibroblasts (Figs. 1B and 4), the
inhibitory effect of vitronectin on 125I-labeled 70-kDa
fragment binding to GD25 and GD25 1 cells was mediated by
the heparin-binding domain of vitronectin and was reversed by treatment
of cells with LPA (Fig. 6B). These studies indicate that the
interaction of cells with the heparin-binding domain of vitronectin
down-regulates both 1 and non- 1
integrin-mediated matrix assembly site expression.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 6.
Effect of vitronectin on
125I-labeled 70-kDa fragment binding to 1-null cells. A,
cycloheximide-pretreated A1F fibroblasts, GD25, or GD25 1
cells were seeded at confluence onto fibronectin-coated tissue culture
wells and allowed to adhere and spread for 45 min prior to the addition
of either recombinant Vn (hatched bars) or an
equal volume of PBS (solid bars). The
125I-labeled 70-kDa fragment binding assay was performed as
indicated in the legend to Fig. 1. B, GD25 (solid bars) or GD25 1 cells (hatched bars) were seeded onto fibronectin-coated wells and treated
with either the heparin-binding domain of vitronectin
(+VnHBD) or PBS. One hour prior to the assay, some
cells treated with GST/VnHBD were incubated with 2 µM LPA
(+LPA). Data are presented as 125I-labeled
70-kDa fragment bound per well ± S.E.
|
|
The Heparin-binding Domain of Vitronectin Induces Actin Filament
Reorganization--
Several studies have correlated changes in the
organization of the actin cytoskeleton with changes in 70-kDa binding
site expression and fibronectin matrix deposition (18, 21-23). To determine whether the heparin-binding domain of vitronectin induced changes in the distribution of actin filaments, serum-starved, non-cycloheximide-treated fibroblasts were seeded onto
fibronectin-coated coverslips in the absence or presence of the
heparin-binding domains of either vitronectin or fibronectin. Cells
were allowed to adhere and spread overnight, and actin was visualized
by staining fixed and permeabilized cells with fluorescein
isothiocyanate-conjugated phalloidin. As shown in Fig.
7, in both GST-treated cells
(panel A) and GST/FnIII12,13-treated
cells (panel E), actin filaments were organized
into thickly bundled stress fibers commonly observed in
fibronectin-adherent cells. In contrast, treatment of cells with the
heparin-binding domain of vitronectin (3.4 µM) resulted in the organization of actin into loose, broadly distributed
microfilament nets (Fig. 7C). Under these conditions, 100%
of the cells exhibited changes in actin organization. At lower
concentrations of VnHBD (1.7 µM),
approximately 50% of the cells exhibited readily visible changes in
actin microfilament organization (data not shown). Vinculin, a protein
that is highly concentrated at focal adhesions (58), was clearly
visible under all experimental conditions (Fig. 7, B,
D, and F).

View larger version (112K):
[in this window]
[in a new window]
|
Fig. 7.
Effect of vitronectin's heparin-binding
domain on actin organization. Serum-starved,
non-cycloheximide-treated fibroblasts were resuspended in DMEM/ITS+2 at
2.5 × 104 cell/ml and seeded onto fibronectin-coated
coverslips in the presence of 3.4 µM of GST (A
and B), GST/VnHBD (C and
D), or GST/FnIII12,13 (E and
F). Following an 18-h incubation, cells were fixed and
permeabilized, and actin filaments were visualized by staining with
fluorescein isothiocyanate-phalloidin (A, C, and
E). Cells were co-stained for vinculin using an
anti-vinculin monoclonal antibody followed by a Texas Red-labeled goat
anti-mouse antibody (B, D, and F).
Results are representative of three separate experiments.
|
|
Modulation of Cytoskeletal Interactions by the Heparin-binding
Domain of Vitronectin--
To further characterize the
vitronectin-induced changes in actin cytoskeletal organization, the
subcellular distributions of actin-associated proteins from control and
GST/VnHBD-treated cells were examined. As demonstrated in
Fig. 8, treatment of cells with the
heparin-binding domain of vitronectin resulted in a significant decrease in the level of -actinin associated with the
digitonin-soluble pool as compared with levels observed in either
control or GST/FnIII12,13-treated cells. This decrease in
soluble -actinin was accompanied by an increase in the level of
-actinin associated with the digitonin-insoluble fraction (Fig. 8),
suggesting that stimulation of cells with the heparin-binding domain of
vitronectin triggers the redistribution of soluble -actinin to the
actin cytoskeleton. To examine the distribution of other
actin-associated proteins, immunoblots were stripped and sequentially
reprobed with antibodies directed against either talin or vinculin
(58). In contrast with the results obtained with -actinin (Fig. 8),
treatment of cells with the heparin-binding domain of vitronectin
resulted in an increase in the level of talin detected in the soluble
fraction when compared with either control or
GST/FnIII12,13-treated cells (Fig. 8). No significant
differences in the levels of vinculin staining were observed in the
soluble fractions obtained from either control or
GST/FnIII12,13- or GST/VnHBD-treated cells
(Fig. 8). Taken together, these data indicate that the interaction of
fibronectin-adherent cells with the heparin-binding domain of
vitronectin stimulates the organization of actin into microfilament
nets concomitant with the subcellular reorganization of specific
actin-associated proteins, including -actinin and talin.

View larger version (39K):
[in this window]
[in a new window]
|
Fig. 8.
Subcellular distribution of actin-associated
proteins. Serum-starved, non-cycloheximide-treated fibroblasts
were resuspended in DMEM/ITS+2 and seeded onto fibronectin-coated
coverslips in the presence of 3.4 µM of
GST/VnHBD (VnHBD),
GST/FnIII12,13 (FnIII12,13), or an equal
volume of PBS (PBS). Following an 18-h incubation, cells were washed
and extracted sequentially with digitonin (S) and
radioimmune precipitation (I) buffers. Fractions (10 µg/lane) were resolved by electrophoresis and analyzed by
immunoblotting with monoclonal antibody specific for -actinin. The
blot was then stripped and sequentially reprobed with monoclonal
antibodies specific for talin and vinculin. Results are representative
of three separate experiments.
|
|
 |
DISCUSSION |
In the present study, we demonstrate that the interaction of cells
with the heparin-binding region of vitronectin inhibits fibronectin
matrix assembly site expression and fibronectin deposition. The
inhibitory effect of vitronectin's heparin binding domain was seen in
both 1-dependent and
1-independent matrix assembly and could be overcome by
treatment of cells with LPA, an agent known to increase actin stress
fiber formation (18, 24). Moreover, the interaction of
fibronectin-adherent cells with the heparin-binding domain of
vitronectin resulted in changes in the cytoskeletal organization of
actin, as well as the actin-binding proteins -actinin and talin.
Several previous studies have demonstrated that modulation of the actin
cytoskeleton alters the ability of cells to assemble a fibronectin
matrix (18, 21-24). Our data indicate that inhibition of fibronectin
matrix assembly by the heparin-binding domain of vitronectin is
associated with the formation of microfilamentous nets of actin and a
marked redistribution of the actin binding protein -actinin to the
cytoskeleton associated pool. These cytoskeletal changes were specific
for the heparin-binding domain of vitronectin, since differences were
not observed upon treatment of cells with the heparin-binding domain of
fibronectin. Our findings are in agreement with the recent study by
Zhang et al. (27), which shows that the down-regulation of
matrix assembly by cells adherent to vitronectin is accompanied by
changes in cell morphology. Previous studies have demonstrated
agonist-induced redistribution of cytoskeletal and signaling proteins
in platelets (59, 60) and neutrophils (61). Thus, it is possible that
the redistribution of cytoskeletal components upon treatment of cells
with the heparin-binding domain of vitronectin serves to localize or
sequester signaling enzymes involved in regulating matrix assembly.
Recently, it has been shown that LPA up-regulates expression of matrix
assembly sites as well as fibronectin polymerization through the
Rho-dependent activation of cellular contraction (23, 24).
This finding suggests that one role for organized actin in matrix
assembly is to generate the contractile forces necessary for
fibronectin polymerization. Earlier studies have shown that in the
absence of 1 integrins, 3 integrins can
regulate matrix assembly (22, 29, 56). Vitronectin inhibited matrix
assembly site expression on 1 null cells, suggesting
that vitronectin is able to modulate fibronectin matrix assembly
regulated by either 3 or 1 integrins. The
ability of LPA to overcome vitronectin inhibition of matrix assembly
suggests that the inhibitory signal from vitronectin may be modulating
a pathway important in maintaining levels of contractility sufficient
to promote matrix assembly site expression. In contrast, treatment of
vitronectin-adherent cells with PMA, an agent that does not increase
fibroblast contractility (62), did not result in an increase in matrix
assembly site expression. Recent studies have shown that
vitronectin-mediated down-regulation of 70-kDa binding sites can be
partially reversed by the expression of the 1 integrin
and completely reversed when cells expressing 1 are
treated with LPA (27). Therefore, the results from our study as well as
the study by Zhang et al. (27) are consistent with a
mechanism in which maximum expression of fibronectin matrix assembly
sites requires both 1 integrin and appropriate levels of
cellular contractility.
The effect of vitronectin's heparin-binding domain on fibronectin
matrix assembly may be mediated by the v 5
integrin or by heparan sulfate proteoglycans. Vogel et al.
(63) have demonstrated by affinity chromatography that the
v 5 integrin receptor binds to a peptide
derived from the heparin-binding domain of vitronectin. This
non-RGD-containing peptide is composed of 12 amino acids that are also
contained within the GST/VnHBD construct. Vitronectin has
also been shown to colocalize with heparan sulfate proteoglycans on
endothelial cells (64). Removal of cell surface proteoglycans by
treatment with heparinase (36), -D-xyloside (36), or
sodium chlorate (65) inhibits the binding of multimeric vitronectin to
cell surfaces, suggesting that the binding of vitronectin to cells is
mediated by an interaction between heparan sulfate proteoglycans and
the heparin-binding domain of vitronectin.
Extrahepatic synthesis of vitronectin has been demonstrated to be
spatially and temporally regulated during development and progression
of certain tumors. Vitronectin synthesis is increased in association
with migrating cells (66, 67) and in several tumors (68-70). Our data
support the hypothesis that, in vivo, vitronectin may serve
as a physiologic ligand responsible for the down-regulation of
fibronectin matrix assembly sites on fibroblasts at the tumor-stromal
interface. Local synthesis of vitronectin would be expected to signal a
decrease in the levels of matrix assembly site expression by stromal
fibroblasts. Since previous studies have demonstrated that decreased
cell migration rates are associated with increased levels of
polymerized fibronectin (7), dampening of matrix assembly pathways by
vitronectin would provide a mechanism to facilitate tumor invasion of
local connective tissue. The synthesis and deposition of vitronectin
into the stroma of colorectal adenocarcinoma by stromal fibroblasts
(69) may reflect an autocrine mechanism that promotes fibroblast
remodeling of the stromal matrix. Recent studies have proposed that
maintenance of cellular and tissue architecture may repress the tumor
phenotype (71). The role of vitronectin in promoting the matrix
remodeling that contributes to the disruption of local tissue
architecture associated with tumor progression remains an important
avenue of future investigation.
 |
ACKNOWLEDGEMENTS |
We are grateful to Renotta Smith, Eiman
Sebald, and David Wagoner for providing technical assistance
and to Dr. Susan LaFlamme (Albany Medical College) for critically
reviewing this manuscript.
 |
FOOTNOTES |
*
This work was supported by National Institutes of Health
Grants CA-69612 and CA-58626 (to P. J. M.-L.) and HL-50549 (to
J. S.) and American Heart Association, New York State Affiliate, Grants 950210 (to D. H.) and 950318 (to J. S.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Present address: Dept. of Physiology and Pharmacology, University
of Rochester Medical Center, 601 Elmwood Ave., Rochester, NY
14642-8711.
¶
To whom correspondence should be addressed: Cell and Molecular
Biology Program, MC-165, Albany Medical College, Albany, NY 12208. Tel.: 518-262-5698; Fax: 518-262-5696; E-mail:
Paula_McKeownLongo@ccgateway.amc.edu.
 |
ABBREVIATIONS |
The abbreviations used are:
LPA, 1-oleoyl
lysophosphatidic acid;
GST, glutathionine S-transferase;
DMEM, Dulbecco's modified Eagle's medium;
PCR, polymerase chain
reaction;
PBS, phosphate-buffered saline;
PMA, phorbol 12-myristate
13-acetate;
FnIII, recombinant human fibronectin type III module;
Vn, vitronectin.
 |
REFERENCES |
| 1.
|
Hynes, R. O.
(1990)
Fibronectins
, pp. 335-364, Springer-Verlag, New York
|
| 2.
|
Mosher, D. F.,
Sottile, J.,
Wu, C.,
and McDonald, J. A.
(1992)
Curr. Opin. Cell Biol.
4,
810-818[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
McKeown-Longo, P. J.,
and Mosher, D. F.
(1985)
J. Cell Biol.
100,
364-374[Abstract/Free Full Text]
|
| 4.
|
Quade, B. J.,
and McDonald, J. A.
(1988)
J. Biol. Chem.
263,
19602-19609[Abstract/Free Full Text]
|
| 5.
|
Chernousov, M. A.,
Fogerty, F. J.,
Koteliansky, V. E.,
and Mosher, D. F.
(1991)
J. Biol. Chem.
266,
10851-10858[Abstract/Free Full Text]
|
| 6.
|
Morla, A.,
and Ruoslahti, E.
(1992)
J. Cell Biol.
118,
421-429[Abstract/Free Full Text]
|
| 7.
|
Morla, A.,
Zhang, Z.,
and Ruoslahti, E.
(1994)
Nature
367,
193-196[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Hocking, D. C.,
Sottile, J.,
and McKeown-Longo, P. J.
(1994)
J. Biol. Chem.
269,
19183-19191[Abstract/Free Full Text]
|
| 9.
|
Hocking, D. C.,
Smith, R. K.,
and McKeown-Longo, P. J.
(1996)
J. Cell Biol.
133,
431-444[Abstract/Free Full Text]
|
| 10.
|
Sottile, J.,
Schwarzbauer, J.,
Selegue, J.,
and Mosher, D. F.
(1991)
J. Biol. Chem.
266,
12840-12843[Abstract/Free Full Text]
|
| 11.
|
Aguirre, K. M.,
McCormick, R. J.,
and Schwarzbauer, J. E.
(1994)
J. Biol. Chem.
269,
27863-27868[Abstract/Free Full Text]
|
| 12.
|
Zhang, Q.,
and Mosher, D. F.
(1996)
J. Biol. Chem.
271,
33284-33292[Abstract/Free Full Text]
|
| 13.
|
Akiyama, S.,
Yamada, S. S.,
Chen, W.,
and Yamada, K. M.
(1989)
J. Cell Biol.
109,
863-875[Abstract/Free Full Text]
|
| 14.
|
Fogerty, F. J.,
Akiyama, S. K.,
Yamada, K. M.,
and Mosher, D. F.
(1990)
J. Cell Biol.
111,
699-708[Abstract/Free Full Text]
|
| 15.
|
Hocking, D. C.,
Sottile, J.,
and McKeown-Longo, P.
(1998)
J. Cell Biol.
141,
241-253[Abstract/Free Full Text]
|
| 16.
|
Allen-Hoffman, L. B.,
and Mosher, D. F.
(1987)
J. Biol. Chem.
262,
14361-14365[Abstract/Free Full Text]
|
| 17.
|
Checovich, W.,
and Mosher, D.
(1993)
Arterioscler. Thromb.
13,
1662-1667[Abstract/Free Full Text]
|
| 18.
|
Zhang, Q.,
Checovich, W. J.,
Peters, D. M.,
Albrecht, R. M.,
and Mosher, D. F.
(1994)
J. Cell Biol.
127,
1447-1459[Abstract/Free Full Text]
|
| 19.
|
Woods, A.,
and Couchman, J. R.
(1992)
J. Cell Sci.
101,
277-290[Abstract/Free Full Text]
|
| 20.
|
Lamb, N. J. C.,
Fernandez, A.,
Conti, M. A.,
Adlestein, R.,
Glass, D. B.,
Welch, W. J.,
and Feramisco, J. R.
(1988)
J. Cell Biol.
106,
1955-1971[Abstract/Free Full Text]
|
| 21.
|
Christopher, R. A.,
Kowalczyk, A. P.,
and McKeown-Longo, P. J.
(1997)
J. Cell Sci.
110,
569-581[Abstract]
|
| 22.
|
Wu, C.,
McDonald, J. A.,
Keivens, V. M.,
O'Toole, T. E.,
and Ginsberg, M. H.
(1995)
Cell
83,
715-724[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Zhong, C.,
Chrzanowska-Wodnicka, M.,
Brown, J.,
Shaub, A.,
Belkin, A. M.,
and Burridge, K.
(1998)
J. Cell Biol.
141,
539-551[Abstract/Free Full Text]
|
| 24.
|
Zhang, Q.,
Magnusson, S.,
and Mosher, D. F.
(1997)
Mol. Cell Biol.
8,
1415-1425
|
| 25.
|
Dzamba, B. J.,
Bultmann, H.,
Akiyama, S. K.,
and Peters, D. M.
(1994)
J. Biol. Chem.
269,
19646-19652[Abstract/Free Full Text]
|
| 26.
|
Kowalczyk, A.,
and McKeown-Longo, P. J.
(1992)
J. Cell. Physiol.
152,
126-134[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Zhang, Q.,
Sakai, T.,
Nowlen, J.,
Hayashi, I.,
Fassler, R.,
and Mosher, D. F.
(1999)
J. Biol. Chem.
274,
368-375[Abstract/Free Full Text]
|
| 28.
|
Kowalczyk, A. P.,
Tulloh, R. H.,
and McKeown-Longo, P. J.
(1990)
Blood
75,
2335-2342[Abstract/Free Full Text]
|
| 29.
|
Wennerberg, K.,
Lohikangas, L.,
Gullberg, D.,
Pfaff, M.,
Johansson, S.,
and Fassler, R.
(1996)
J. Cell Biol.
132,
227-238[Abstract/Free Full Text]
|
| 30.
|
McKeown-Longo, P. J.,
and Etzler, C. A.
(1987)
J. Cell Biol.
104,
601-610[Abstract/Free Full Text]
|
| 31.
|
Yatohgo, T.,
Izumi, M.,
Kashiwagi, H.,
and Hayashi, M.
(1988)
Cell Struct. Funct.
13,
281-292[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Suzuki, S.,
Pierschbacher, M. D.,
Hayman, E. G.,
Nguyen, K.,
Ohgren, Y.,
and Ruoslahti, E.
(1984)
J. Biol. Chem.
259,
15307-15314[Abstract/Free Full Text]
|
| 33.
|
Kazal, L. A.,
Amsel, S.,
Miller, O. P.,
and Tocantins, L. M.
(1963)
Proc. Soc. Exp. Biol. Med.
113,
989-995
|
| 34.
|
Barkalow, F. J. B.,
and Schwarzbauer, J. E.
(1991)
J. Biol. Chem.
266,
7812-7818[Abstract/Free Full Text]
|
| 35.
|
Petersen, T. E.,
Skorstengaard, K.,
and Vibe-Pedersen, K.
(1989)
in
Fibronectin
(Mosher, D. F., ed)
, pp. 1-24, Academic Press, Inc., New York
|
| 36.
|
de Boer, H. C.,
Preissner, K. T.,
Bouma, B. N.,
and de Groot, P. G.
(1992)
J. Biol. Chem.
267,
2264-2268[Abstract/Free Full Text]
|
| 37.
|
Kost, C.,
Stuber, W.,
Ehrlich, H. J.,
Pannekoek, H.,
and Preissner, K. T.
(1992)
J. Biol. Chem.
267,
12098-12105[Abstract/Free Full Text]
|
| 38.
|
Jenne, D.,
and Stanley, K. K.
(1985)
EMBO J.
4,
3153-3157[Medline]
[Order article via Infotrieve]
|
| 39.
|
Suzuki, S.,
Oldberg, A.,
Hayman, E. G.,
Pierschbacher, M. D.,
and Ruoslahti, E.
(1985)
EMBO J.
4,
2519-2524[Medline]
[Order article via Infotrieve]
|
| 40.
|
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual
, pp. 1.74-1.87, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
|
| 41.
|
Higuchi, R.
(1992)
PCR Technology
, pp. 61-70, W. H. Freeman and Co., New York
|
| 42.
|
Lerch, R. A.,
and Friesen, P. D.
(1993)
Nucleic Acids Res.
21,
1753-1760[Abstract/Free Full Text]
|
| 43.
|
Summers, M. D.,
and Smith, G. E.
(1987)
Tex. Agric. Exp. Stn. Bull.
1555,
1-15
|
| 44.
|
Sun, X.,
Skorstengaard, K.,
and Mosher, D. F.
(1992)
J. Cell Biol.
118,
693-701[Abstract/Free Full Text]
|
| 45.
|
McKeown-Longo, P. J.,
and Mosher, D. F.
(1983)
J. Cell Biol.
97,
466-472[Abstract/Free Full Text]
|
| 46.
|
Belkin, A. M.,
Retta, S. F.,
Pletjushkina, O. Y.,
Balzac, F.,
Silengo, L.,
Fassler, R.,
Koteliansky, V. E.,
Burridge, K.,
and Tarone, G.
(1997)
J. Cell Biol.
139,
1583-1595[Abstract/Free Full Text]
|
| 47.
|
Somers, C. E.,
and Mosher, D. F.
(1993)
J. Biol. Chem.
268,
22277-22280[Abstract/Free Full Text]
|
| 48.
|
Hayman, E. G.,
Pierschbacher, M. D.,
and Ruoslahti, E.
(1985)
J. Cell Biol.
100,
1948-1954[Abstract/Free Full Text]
|
| 49.
|
Hayman, E. G.,
Pierschbacher, M. D.,
Suzuki, S.,
and Ruoslahti, E.
(1985)
Exp. Cell Res.
160,
245-258[CrossRef][Medline]
[Order article via Infotrieve]
|
| 50.
|
Pierschbacher, M. D.,
and Ruoslahti, E.
(1987)
J. Biol. Chem.
262,
17294-17298[Abstract/Free Full Text]
|
| 51.
|
Preissner, K. T.,
and Muller-Berghaus, G.
(1987)
J. Biol. Chem.
262,
12247-12253[Abstract/Free Full Text]
|
| 52.
|
Smith, J. W.,
Vestal, D. J.,
Irwin, S. V.,
Burke, T. A.,
and Cheresh, D. A.
(1990)
J. Biol. Chem.
265,
11008-11013[Abstract/Free Full Text]
|
| 53.
|
Smith, J. W.,
and Cheresh, D. A.
(1988)
J. Biol. Chem.
263,
18726-18731[Abstract/Free Full Text]
|
| 54.
|
Ingham, K. C.,
Brew, S. A.,
Migliorini, M. M.,
and Busby, T. F.
(1993)
Biochemistry
32,
12548-12553[CrossRef][Medline]
[Order article via Infotrieve]
|
| 55.
|
Wu, C.,
McDonald, J. A.,
and Chung, A. E.
(1995)
J. Cell Sci.
108,
2155-2523
|
| 56.
|
Wu, C.,
Hughes, P. E.,
Ginsberg, M. H.,
and McDonald, J. A.
(1996)
Cell Adhes. Commun.
4,
149-158[Medline]
[Order article via Infotrieve]
|
| 57.
|
Fassler, R.,
Pfaff, J.,
Murphy, J.,
Noegel, A. A.,
Johansson, S.,
Timpl, R.,
and Albrecht, R.
(1995)
J. Cell Biol.
128,
979-988[Abstract/Free Full Text]
|
| 58.
|
Jockusch, B. M.,
Bubeck, P.,
Giehl, K.,
Kroemker, M.,
Moscher, J.,
Rothkegel, M.,
Rudiger, M.,
Schluter, K.,
Stanke, G.,
and Winkler, J.
(1995)
Annu. Rev. Cell Biol.
11,
379-416[CrossRef][Medline]
[Order article via Infotrieve]
|
| 59.
|
Fox, J. E. B.,
Lipfer, L.,
Clark, E. A.,
Reynolds, C. C.,
Austin, C. D.,
and Brugge, J. S.
(1998)
J. Biol. Chem.
268,
25973-25984[Abstract/Free Full Text]
|
| 60.
|
Clark, E. A.,
and Brugge, J. S.
(1993)
Mol. Cell Biol.
13,
1863-1871[Abstract/Free Full Text]
|
| 61.
|
Yan, S. R.,
Fumagallli, L.,
and Berton, G.
(1996)
FEBS Lett.
380,
198-203[CrossRef][Medline]
[Order article via Infotrieve]
|
| 62.
|
Danowski, B. A.,
and Harris, A. K.
(1988)
Exp. Cell Res.
177,
47-59[CrossRef][Medline]
[Order article via Infotrieve]
|
| 63.
|
Vogel, B. E.,
Lee, S.-J.,
Hildebrand, A.,
Craig, W.,
Pierschbacher, M. D.,
Wong-Staal, F.,
and Ruoslahti, E.
(1993)
J. Cell Biol.
121,
461-468[Abstract/Free Full Text]
|
| 64.
|
Volker, W.,
Hess, S.,
Vischer, P.,
and Preissner, K. T.
(1993)
J. Histochem. Cytochem.
41,
1823-1832[Abstract]
|
| 65.
|
Wilkins-Port, C. E.,
and McKeown-Longo, P.
(1996)
Biochem. Cell Biol.
74,
887-897[Medline]
[Order article via Infotrieve]
|
| 66.
|
Delannet, M.,
Martin, F.,
Bossy, B.,
Cheresh, D. A.,
Reichardt, L. F.,
and Duband, J. L.
(1994)
Development
120,
2687-2702[Abstract/Free Full Text]
|
| 67.
|
Seiffert, D.,
Iruela-Arispe, M. L.,
Sage, E. H.,
and Loskutoff, D. J.
(1995)
Dev. Dyn.
203,
71-79[Medline]
[Order article via Infotrieve]
|
| 68.
|
Gladson, C. L.,
and Cheresh, D. A.
(1991)
J. Clin. Invest.
88,
1924-1932
|
| 69.
|
Tomasini-Johansson, N. R.,
Sundberg, C.,
Lindmark, G.,
Gailit, J. O.,
and Rubin, K.
(1994)
Exp. Cell Res.
214,
303-312[CrossRef][Medline]
[Order article via Infotrieve]
|
| 70.
|
Gladson, C. L.,
Wilcox, J. N.,
Sanders, L.,
Gillespie, G. Y.,
and Cheresh, D. A.
(1995)
J. Cell Sci.
108,
947-956[Abstract]
|
| 71.
|
Weaver, V. M.,
Petersen, O. W.,
Wang, F.,
Larabell, C. A.,
Briand, P.,
Damsky, C.,
and Bissell, M. J.
(1997)
J. Cell Biol.
137,
231-245[Abstract/Free Full Text]
|
| 72.
|
Murphy-Ullrich, J.,
and Mosher, D. F.
(1985)
Blood
66,
1098-1104[Abstract/Free Full Text]
|
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
D. Vial and P. J. McKeown-Longo
PAI1 stimulates assembly of the fibronectin matrix in osteosarcoma cells through crosstalk between the {alpha}v{beta}5 and {alpha}5{beta}1 integrins
J. Cell Sci.,
May 15, 2008;
121(10):
1661 - 1670.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Bae, T. Sakai, and D. F. Mosher
Assembly of Exogenous Fibronectin by Fibronectin-null Cells Is Dependent on the Adhesive Substrate
J. Biol. Chem.,
August 20, 2004;
279(34):
35749 - 35759.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Monaghan, V. Gueorguiev, C. Wilkins-Port, and P. J. McKeown-Longo
The Receptor for Urokinase-type Plasminogen Activator Regulates Fibronectin Matrix Assembly in Human Skin Fibroblasts
J. Biol. Chem.,
January 9, 2004;
279(2):
1400 - 1407.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Kricker, C. L. Towne, S. M. Firth, A. C. Herington, and Z. Upton
Structural and Functional Evidence for the Interaction of Insulin-Like Growth Factors (IGFs) and IGF Binding Proteins with Vitronectin
Endocrinology,
July 1, 2003;
144(7):
2807 - 2815.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. C. Hocking and K. Kowalski
A cryptic fragment from fibronectin's III1 module localizes to lipid rafts and stimulates cell growth and contractility
J. Cell Biol.,
July 8, 2002;
158(1):
175 - 184.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Lim, I. Han, H. J. Kwon, and E.-S. Oh
Trichostatin A-induced Detransformation Correlates with Decreased Focal Adhesion Kinase Phosphorylation at Tyrosine 861 in ras-transformed Fibroblasts
J. Biol. Chem.,
April 5, 2002;
277(15):
12735 - 12740.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Pereira, B. J. Rybarczyk, T. M. Odrljin, D. C. Hocking, J. Sottile, and P. J. Simpson-Haidaris
The incorporation of fibrinogen into extracellular matrix is dependent on active assembly of a fibronectin matrix
J. Cell Sci.,
January 2, 2002;
115(3):
609 - 617.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J Sottile, D. Hocking, and K. Langenbach
Fibronectin polymerization stimulates cell growth by RGD-dependent and -independent mechanisms
J. Cell Sci.,
January 12, 2000;
113(23):
4287 - 4299.
[Abstract]
[PDF]
|
 |
|
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|