HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Huang, S. S. Articles by Huang, J. S. Search for Related Content PubMed PubMed Citation Articles by Huang, S. S. Articles by Huang, J. S. Social Bookmarking                      What's this?

J Biol Chem, Vol. 274, Issue 39, 27754-27758, September 24, 1999

An Active Site of Transforming Growth Factor-₁ for Growth Inhibition and Stimulation^*

Shuan Shian Huang, Mi Zhou^§, Frank E. Johnson^§, Huey-Sheng Shieh^¶, and Jung San Huang

From the  Departments of Biochemistry and Molecular Biology and ^§ Surgery, St. Louis University School of Medicine, St. Louis, Missouri 63104 and the ^¶ Searle Discovery Research, Monsanto Company, St. Louis, Missouri 63198

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Transforming growth factor- (TGF-) is a bifunctional growth regulator. It inhibits growth of many cell types, including epithelial cells, but stimulates growth of others (e.g. fibroblasts). The active site on the TGF- molecule, which mediates its growth regulatory activity, has not been defined. Here, we show that antibody to a TGF-₁ peptide containing the motif WSLD (52nd to 55th amino acid residues) completely blocked both ¹²⁵I-TGF-₁ binding to TGF- receptors and TGF-₁-induced growth inhibition in mink lung epithelial cells. Site-directed mutagenesis analysis revealed that the replacement of Trp⁵² and Asp⁵⁵ by alanine residues diminished the growth inhibitory activity of TGF-₁ by ~90%. Finally, while wild-type TGF-₁ was able to stimulate growth of transfected NIH 3T3 cells, the double mutant TGF-₁ W52A/D55A was much less active. These results support the hypothesis that the WSLD motif is an active site of TGF-₁, which is important for growth inhibition of epithelial cells and growth stimulation of fibroblasts.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Transforming growth factor- (TGF-)¹ is a family of 25-kDa structurally homologous dimeric proteins containing one interchain and four intrachain disulfide bonds (1-3). It is a bifunctional growth regulator, inhibiting cell growth of most cell types (including epithelial cells, endothelial cells, smooth muscle cells, and lymphocytes) but stimulating proliferation of others (such as fibroblasts) (1-3). TGF- has many other biological activities, such as stimulation of extracellular matrix biosynthesis, angiogenesis, and differentiation of several cell lineages (1-3). It has been implicated in the processes of wound repair and morphogenesis (1-3).

Isoforms in mammalian species, including TGF-₁, TGF-₂, and TGF-₃, exhibit ~70% sequence homology and have similar biological activities (1-3). However, activities of the isoforms differ in certain cell types or systems (4-7). For example, TGF-₁ is more potent than TGF-₂ in inhibiting growth of endothelial cells (4-6), while TGF-₃ antagonizes the activities of TGF-₁ and TGF-₂ in an animal model system of wound healing (7). TGF-₂ appears to bind to ₂-macroglobulin more strongly than TGF-₁ (8). The molecular basis of the different activities of TGF- isoforms is not well understood (4-8). X-ray crystallographic and nuclear magnetic resonance spectroscopic analyses of TGF-₁ and TGF-₂ have revealed generally similar three-dimensional structures, with differences in certain regions of the molecule (9-14). Using a domain swap approach, Qian and her co-workers (15) demonstrated that residues 40-82 play important roles in the activity of a particular TGF- isoform. They subsequently showed that residues 45 and 47 determine the binding affinities of TGF- isoforms toward ₂-macroglobulin (16) and that residues 91-96 are important in the interaction of TGF-₁ with soluble type II TGF- receptor (17, 18).

Recently, we determined the TGF- antagonist activities of synthetic pentacosapeptides with overlapping amino acid sequences covering most of the TGF-₁ molecule (19). Of these seven pentacosapeptides, only the one containing residues 41-65 of TGF-₁ (termed ₁²⁵-(41-65)) exhibited potent TGF- antagonist activity (19). The replacement of both residues Trp⁵² and Asp⁵⁵ by alanine completely abrogated the TGF- antagonist activity of this pentacosapeptide (19). Multiple conjugation of ₁²⁵-(41-65) to the carrier proteins bovine serum albumin and carbonic anhydrase conferred TGF- agonist activity as measured by growth inhibition (19). These results led us to identify structurally unrelated TGF- partial agonists, which also possess two or more WXXD motifs per dimer or molecule (20, 21). Based on these studies, we hypothesized that the WSLD motif (52nd to 55th amino acid residues of TGF-₁) is an active site that interacts with TGF- receptors; this interaction leads to growth inhibition.

To test this hypothesis, we prepared an antibody that specifically reacts with ₁²⁵-(41-65) and determined its effect on the biological activities of TGF-₁. In addition, we generated TGF-₁ mutant proteins in which residues Trp⁵² and/or Asp⁵⁵ are replaced by alanine and compared the biological activity of wild type TGF-₁ with those of the mutants. In this communication, we show that this antibody blocks ¹²⁵I-TGF- binding to TGF- receptors and abolishes TGF-₁-induced growth inhibition in mink lung epithelial cells (Mv1Lu cells). We also demonstrate that the TGF-₁ mutant in which both Trp⁵² and Asp⁵⁵ are replaced with alanine residues has diminished growth inhibitory activity in Mv1Lu cells and has diminished ability to induce autocrine growth of transfected NIH 3T3 cells.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Materials-- Na¹²⁵I (17 Ci/mg) and [methyl-³H]thymidine (67 Ci/mmol) were purchased from ICN Radiochemicals (Irvine, CA). High molecular mass protein standards (myosin, 205 kDa; -galactosidase, 116 kDa; phosphorylase, 97 kDa; bovine serum albumin, 66 kDa) were purchased from Sigma. Disuccinimidyl suberate (DSS) was obtained from Pierce. TGF-₁ was purchased from Austral Biologicals (San Ramon, CA). Pan-specific TGF- neutralizing antibody and porcine TGF-₁ were purchased from R & D Systems, Inc. (Minneapolis, MN). TGF-₁ immunoassay kit was obtained from Promega (Madison, WI). The pentacosapeptide ₁²⁵-(41-65), whose amino acid sequence corresponds to the 41st to 65th amino acid residues of TGF-₁, was prepared as described previously (19). Porcine TGF-₁ cDNAs, pPTGFbeta1 and pSQneo-TGF-₁, were obtained from American Type Culture Collection (Manassas, VA) and Drs. Su Wen Qian and Anita B. Roberts (NCI), respectively. Diff-Quik solutions were obtained from American Scientific Products (McGraw Park, IL).

Preparation of Antibody to ₁²⁵-(41-65)-- ₁²⁵-(41-65) was conjugated to bovine thyroglobulin using glutaraldehyde according to the procedure described previously (22). ₁²⁵-(41-65)-thyroglobulin conjugate was injected subcutaneously with adjuvants into rabbits for generation of antiserum (22). The antibody (IgG) to ₁²⁵-(41-65) was purified with protein A-Sepharose using standard procedures. Its specificity was verified by Western blot analysis and enzyme-linked immunosorbent assay.

Specific Binding of ¹²⁵I-Labeled TGF-₁ (¹²⁵I-TGF-₁) to TGF- Receptors in Mv1Lu Cells-- ¹²⁵I-TGF-₁ was prepared by iodination of TGF-₁ with Na¹²⁵I and chloramine T as described previously (20, 23). The specific radioactivity of ¹²⁵I-TGF-₁ was 1-3 × 10⁵ cpm/ng. Mv1Lu cells grown on 24-well clustered dishes were incubated with 0.1 nM ¹²⁵I-TGF-₁ and various concentrations of antibody to ₁²⁵-(41-65) both with and without 10 µM ₁²⁵-(41-65), a specific TGF- peptide antagonist, in binding buffer (20, 23). ¹²⁵I-TGF-₁ was preincubated with antibody to ₁²⁵-(41-65) at room temperature for 1 h prior to incubation with cells. After 2.5 h at 0 °C, the cells were washed with binding buffer, and the cell-associated radioactivity was determined. The specific binding of ¹²⁵I-TGF-₁ to TGF- receptors in Mv1Lu cells was estimated by subtracting nonspecific binding (obtained in the presence of 10 µM ₁²⁵-(41-65)) from total binding. All experiments were carried out in quadruplicate.

¹²⁵I-TGF-₁-affinity Labeling of Cell Surface TGF- Receptors in Mv1Lu Cells-- Mv1Lu cells grown on 35-mm Petri dishes were incubated with 0.1 nM ¹²⁵I-TGF-₁ in the presence of various concentrations of control IgG or antibody to ₁²⁵-(41-65) or 10 µM ₁²⁵-(41-65) (for measurement of nonspecific binding) in binding buffer (20, 23). After 2.5 h at 0 °C, ¹²⁵I-TGF-₁-affinity labeling was carried out in the presence of DSS (20, 23). The ¹²⁵I-TGF-₁-affinity-labeled TGF- receptors were analyzed by 5% SDS-polyacrylamide gel electrophoresis under reducing conditions and autoradiography.

[methyl-³H]Thymidine Incorporation-- Various concentrations of TGF-₁ and 50 µg/ml antibody to ₁²⁵-(41-65) or control IgG were preincubated for 1 h at room temperature and then added to Mv1Lu cells grown on 24-well clustered dishes with DMEM containing 0.1% fetal calf serum. After 16 h at 37 °C, the cells were pulsed with 1 µCi/ml [methyl-³H]thymidine for 4 h. The cells were then washed twice with 10% trichloroacetic acid and once with ethanol:ether (2:1, v/v). The [methyl-³H]thymidine incorporation into cellular DNA was then determined by liquid scintillation counting.

Construction of TGF-₁ Mutant Expression Plasmid-- A two-step PCR procedure was used to generate point mutations. Primers included: A, 5' GAATTCAGATCTGAGATGGCGCCTTCGGGGCTGC (TGF-₁ 906-918); B, 5' GAATTCAGATCTTCAGCTGCACTTGCAGGAACGC (TGF-₁ 2057-2078); C, 5' CCCTACATCGCCAGCCTAGACACT; D, 5' CTGAGTGTCTAGGCTGGCGATGTA; E, 5' GGAGCCTAGCCACTCAGTACAGCAAGG; F, 5' GCTGTACTGAGTGGCTAGGCTCCAGATG; G, 5' CCCTACATCGCGAGCCTAGCCACTCAGTAC; H, 5' GTACTGAGTGGCTAGGCTCGCGATGTAGGG; I, 5' CCTACATCTGGGCGCTAGACACTCAG; J, 5'CTGAGTGTCTAGCGCCCAGATGTAGG. The underlined nucleotides indicate the mutations. To introduce the tryptophan 52 to alanine (W52A) mutation, porcine TGF-₁ cDNA (pPTGFbeta1 from American Type Culture Collection) and primers A/D and C/B were used in the first PCR reaction to generate ~1-kb and 200-bp fragments, respectively. The reaction mixture was treated with 5 units of Klenou fragment and gel-purified. The ~1-kb and 200-bp fragments were then used as templates in the second PCR reaction using Primers A and B to generate the full-length cDNA. The PCR product was cloned into the pT7 Blue T-Vector, and the plasmid was purified. The purified plasmid was cut with BsgI to produce a 340-base pair fragment containing the mutated sequence. This 340-base pair fragment was then ligated to pSV·SPORT 1-TGF-₁, which was digested with BsgI to delete the corresponding fragment. This ligated product was purified and identified. For D55A, S53A, and W52A/D55A mutants, the above procedure was repeated, but using A/F and E/B for D55A mutation, A/J and I/B for S53A mutation, and A/H and G/B for W52A/D55A mutation. The plasmids containing wild-type TGF-₁ and TGF-₁ mutant cDNAs in pSV·SPORT 1 were then cut with KpnI and XbaI. The ~1.6-kb cDNA insert was then ligated to the expression vector pMSXND.

Expression and Purification of Wild-type and Mutant TGF-₁-- NIH 3T3 and Chinese hamster ovary (CHO) cells were transfected with pMSXND vector only or pMSXND containing the insert of wild-type or mutant TGF-₁ cDNA using the calcium phosphate-transfection method. NIH 3T3 and CHO cells stably expressing vector only, wild-type TGF-₁ cDNA, or mutant TGF-₁ cDNAs were selected with 800 µg/ml G418. Four or more clones for the expression of each construct were isolated. The production of wild-type and mutant TGF-₁ was carried out according to the procedure of Qian et al. (15). After acid activation and lyophilization, the conditioned media were subjected to reverse-phase high performance liquid chromatography (C8 column) using a linear gradient of acetonitrile (0 to 70%) in 10% trifluoroacetic acid. Wild-type and mutant TGF-₁ were eluted at ~30% acetonitrile. Wild-type and mutant TGF-₁ were quantitated by enzyme-linked immunoassay using the protocol provided by the manufacturer (Promega, Madison, WI). During the assay, an internal standard of porcine TGF-₁ was included in the samples.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The putative active-site motif (WSLD) is located in a loop (residues 46-56) of the TGF- molecule, which is accessible to solvent (9-14). We predicted that antibody raised to ₁²⁵-(41-65) containing this motif would block both TGF-₁ binding to TGF- receptors and the biological activities of TGF-₁. To test this, we prepared rabbit antiserum to ₁²⁵-(41-65) using the thyroglobulin conjugate of ₁²⁵-(41-65) as antigen. The effect of antibody to ₁²⁵-(41-65) on ¹²⁵I-TGF-₁ binding to TGF- receptors in Mv1Lu cells was then determined. As shown in Table I, the antiserum to ₁²⁵-(41-65) specifically immunoprecipitated ¹²⁵I-TGF-₁, while nonimmune serum did not significantly immunoprecipitate ¹²⁵I-TGF-₁. The purified antibody to ₁²⁵-(41-65) quantitatively inhibited ¹²⁵I-TGF-₁ binding to Mv1Lu cells (Fig. 1A). At ~75 µg/ml, the antibody to ₁²⁵-(41-65) completely abrogated the specific binding of 0.1 nM ¹²⁵I-TGF-₁ to TGF- receptors in Mv1Lu cells. By contrast, control IgG did not show any effect on ¹²⁵I-TGF-₁ binding to cells at the same concentration. The ¹²⁵I-TGF-₁-affinity labeling analysis revealed that, like ₁²⁵-(41-65), a TGF- antagonist, the antibody to ₁²⁵-(41-65) effectively blocked ¹²⁵I-TGF-₁ binding to all TGF- receptor types, including type I, II, III, and V TGF- receptors (TR-I, TR-II, TR-III, TR-V) (Fig. 1B, lanes 3 and 4). To define the functional significance of the inhibition of TGF-₁ binding to TGF- receptors, we determined the effect of antibody to ₁²⁵-(41-65) on TGF-₁-induced growth inhibition of Mv1Lu cells, as measured by [methyl-³H]thymidine incorporation into cellular DNA. As shown in Fig. 1C, the antibody blocked TGF-₁-induced inhibition of DNA synthesis in Mv1Lu cells. At 50 µg/ml, the antibody to ₁²⁵-(41-65) completely blocked the inhibition of DNA synthesis induced by 0.25-8 pM TGF-₁ in these cells. The control IgG did not affect the TGF-₁-induced inhibition of DNA synthesis. These results are consistent with the reports that the loop (residues 46-56, which contain the WSLD motif) included in amino acid residues 41-65 is exposed (9-14). The results also suggest that this loop may be involved in the interaction of TGF-₁ with TGF- receptors.

View this table: [in this window] [in a new window]   Table I Immunoprecipitation of 125I-TGF-1 by antiserum to 125-(41-65) 125I-TGF-1 (0.1 ng) was incubated with 5 µl of antiserum to 125-(41-65) or non-immune serum in 100 µl of 25 mM Hepes buffer, pH 7.4, or 0.15 M NaCl containing 0.2% bovine serum albumin. After 8 h at 4 °C, the immunocomplexes were precipitated with protein A-Sepharose (1.5 h, 4 °C), washed, and counted. The experiments were carried out in triplicate.

View larger version (30K): [in this window] [in a new window]   Fig. 1.   Blocking of 125I-TGF-1 binding to cell surface TGF- receptors (A, B) and TGF-1-induced DNA synthesis inhibition (C) by antibody to 125-(41-65) in Mv1Lu cells. A, cells were incubated with 0.1 nM 125I-TGF-1 in the presence of various concentrations of antibody to 125-(41-65) or control IgG. After 2.5 h at 0 °C, the specific binding of 125I-TGF-1 was determined. The specific binding of 125I-TGF-1 in the absence of the antibody was taken as 100% binding (6,780 ± 1, 230 cpm/well). The error bars are means ± S.D. of quadruplicate cell cultures. B, 125I-TGF-1-affinity labeling of cell surface TGF- receptors was performed using DSS as the cross-linking agent after incubation of cells with 125I-TGF-1 in the presence of 50 µg/ml antibody to 125-(41-65), control IgG, or 10 µM 125-(41-65) at 0 °C for 2.5 h. The 125I-TGF-1-affinity-labeled TGF- receptors were analyzed by 5% SDS-polyacrylamide gel electrophoresis under reducing conditions and autoradiography. The brackets indicate the locations of TR-I, TR-II, and TR-III. The arrow indicates the location of TR-V. C, cells were incubated with various concentrations of TGF-1 (0, 025, 0.5, 1, and 2 pM) both with and without 50 µg/ml antibody to 125-(41-65) or control IgG (50 µg/ml). After 16 h, [methyl-3H]thymidine incorporation into cellular DNA was determined. The [methyl-3H]thymidine incorporation in cells treated without TGF-1 or antibody to 125-(41-65) was taken as 0% inhibition (5,321 ± 1,121 cpm/well). The error bars are means ± S.D. of triplicate cell cultures.

To confirm that the WSLD motif (52nd to 55th residues) is important in the interaction of TGF-₁ with TGF- receptors, we generated porcine wild-type TGF-₁ and TGF-₁ mutants in which Trp⁵², Ser⁵³, and/or Asp⁵⁵ were replaced by alanine residues by stably expressing their cDNA constructs in NIH 3T3 and CHO cells. The residue Leu⁵⁴ was not replaced, since the corresponding residue is not conserved in TGF-₂, which has the motif WSSD. The growth inhibitory activities of wild-type and mutant TGF-₁ purified from the culture media of transfected NIH 3T3 and CHO cells were determined by measuring their inhibitory activity on DNA synthesis in Mv1Lu cells. As shown in Fig. 2, both wild-type TGF-₁ and TGF-₁ S53A mutant (in which the 53rd residue, serine, is replaced by alanine) inhibited [methyl-³H]thymidine incorporation into cellular DNA with identical IC₅₀ of 0.3 ± 0.1 pM and 0.3 ± 0.2 pM (mean ± S.E., n = 7 experiments), respectively. In contrast, the TGF-₁ mutants TGF-₁ W52A, TGF-₁ D55A, and TGF-₁ W52A/D55A had diminished activities in inhibition of DNA synthesis of Mv1Lu cells with IC₅₀ of 0.6 ± 0.2, 1.3 ± 0.4, and 3.0 ± 0.8 pM (mean ± S.E., n = 7 experiments), respectively. The double mutant TGF-₁ W52A/D55A appeared to possess only ~10% of the activity of wild-type TGF-₁. These results suggest that the WSLD motif plays an important role in the activity of TGF-₁.

View larger version (19K): [in this window] [in a new window]   Fig. 2.   Effects of wild-type TGF-1, TGF-1 W52A, TGF-1 S53A, TGF-1 D55A and TGF- W52A/D55A on DNA synthesis of Mv1Lu cells. Cells were incubated with various concentrations of wild-type and mutant TGF-1 for 16 h at 37 °C in DMEM containing 0.1% fetal calf serum. The [methyl-3H]thymidine incorporation into cellular DNA was then determined. The [methyl-3H]thymidine incorporation in the absence of TGF-1 was taken as 0% inhibition (6,914 ± 1,234 cpm/well). The error bars are means ± S.D. of triplicate cell cultures.

TGF- is a bifunctional growth regulator (1-3). It inhibits cell growth of most cell types but stimulates growth of other cell types such as NIH 3T3 cells (1-3). During culture of NIH 3T3 cells stably transfected with wild-type TGF-₁ cDNA, we noticed that these transfected cells proliferated faster than NIH 3T3 cells stably transfected either with vector only or with TGF- W52A/D55A cDNA. To see if the faster growth of the transfected cells is due to autocrine stimulation by the transfected wild-type TGF-₁, we determined the effect of neutralizing antibody to TGF-₁ on growth of NIH 3T3 cells stably transfected with wild-type TGF-₁ cDNA. As shown in Fig. 3, A, C, and E, NIH 3T3 cells expressing wild-type TGF-₁ proliferated faster than cells expressing TGF-₁ W52A/D55A and control cells (transfected with vector only) as determined by an autocrine growth assay in which autocrine-stimulated cells grow to form larger size colonies compared with cells without this stimulation. The order of the growth rates is: cells expressing wild-type TGF-₁ > cells expressing TGF-₁ W52A/D55A > control cells (Fig. 3, A, C, and E). Both cells expressing wild-type TGF-₁ and TGF-₁ W52A/D55A exhibited similar levels of wild-type and mutant TGF-₁ transcripts (data not shown). On the other hand, culture of NIH 3T3 cells expressing wild-type TGF-₁ and TGF-₁ W52A/D55A in the presence of a neutralizing antibody to TGF-₁ had diminished growth rates, which were comparable with that of NIH 3T3 cells transfected with vector only (Fig. 3, B, D, and F). These results indicate that the faster proliferation of NIH 3T3 cells expressing wild-type TGF-₁ is due to autocrine stimulation by expressed wild-type TGF-₁. These results also suggest that the TGF-₁ W52A/D55A mutant has significantly diminished ability to induce autocrine growth of transfected NIH 3T3 cells when compared with wild-type TGF-₁.

View larger version (103K): [in this window] [in a new window]   Fig. 3.   Effect of a neutralizing antibody to TGF- on growth of NIH 3T3 cells stably transfected with wild-type TGF-1 and TGF-1 W52A/D55A cDNAs and NIH 3T3 cells transfected with vector only. NIH 3T3 cells stably transfected with wild-type TGF-1 cDNA (A, B), TGF-1 W52A/D55A cDNA (C, D), and vector only (E, F) were grown in 35-mm Petri dishes (50,000-100,000 cells/dish) in DMEM containing 5% fetal calf serum both with (B, D, F) and without (A, C, F) a neutralizing antibody to TGF- (Pan-specific neutralizing antibody, 50 µg/ml). After 72 h at 37 °C, the cells were stained in blue with Diff-Quik solutions.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

We have shown that specific antibody to ₁²⁵-(41-65) at ~75 µg/ml completely blocks ¹²⁵I-TGF-₁ binding to TGF- receptors and also blocks TGF-₁-induced inhibition of DNA synthesis in Mv1Lu cells. The antibody reported here appears to be more potent than those reported by Flanders et al. (24). Of their five antisera to TGF-₁ peptide fragments, those directed against residues 50-75 and 78-109 blocked only 40 and 80% of ¹²⁵I-TGF-₁ binding to cells, respectively, at 450 µg/ml. So far, only antibodies raised to the intact TGF- dimer have been shown to completely block TGF- activities (24, 25). The potent TGF- antagonist activity of our antibody to ₁²⁵-(41-65) strongly suggests that the region of the amino acid residues 41-65 of TGF-₁ is exposed and may be involved in receptor binding.

The putative active site WSLD of TGF-₁, which is included in the amino acid sequence of ₁²⁵-(41-65), was proposed based on the following observations. 1) Of seven synthetic pentacosapeptides with overlapping amino acid sequences covering most of the TGF-₁ molecule, only the peptide of residues 41-65 (₁²⁵-(41-65)) exhibits potent TGF- antagonist activity (19). 2) The ₁²⁵-(41-65) structural variant ₁²⁵-(41-65) W52A/D55A, in which both Trp⁵² and Asp⁵⁵ are replaced by alanine residues, does not show a significant TGF- antagonist activity (19). 3) Multiple conjugation of ₁²⁵-(41-65) to carrier proteins confers TGF- agonist activity as measured by growth inhibition but not transcriptional activation (19). Here we show that the double mutations of Trp⁵² and Asp⁵⁵ and single mutation of either Trp⁵² or Asp⁵⁵ of TGF-₁ diminish the growth inhibitory activity of TGF-₁ by 90 and 50-75%, respectively. Not only does the double mutant TGF-₁ W52A/D55A possess only 10% activity of wild-type TGF-₁, but it also appears to have significantly diminished ability to stimulate growth of transfected NIH 3T3 cells by an autocrine mechanism. These results support the hypothesis that the WSLD is an active site of TGF-₁ (Fig. 4). However, the inability of the double mutations of Trp⁵² and Asp⁵⁵ to completely abolish the TGF- activities implies that there are other binding sites in addition to the WSLD site. One candidate appears to be the region of residues 91-96, since this region is important for TGF-₁ binding to TR-II in solution and TGF- receptors in cells (17) and since antibodies to residues 78-109 block TGF-₁ binding to TGF- receptors in cells (23). The three-dimensional configuration of residues 91-96 seems to be required to constitute this binding site, because a synthetic pentacosapeptide ₁²⁵-(81-105) with amino acid residues 81-105 of TGF-₁ does not show any TGF- antagonist activity (18). It is noteworthy that the proposed receptor binding sites (Fig. 4), which are contributed by the two monomers in TGF-₁, are similar to those of vascular endothelial cell growth factor; the vascular endothelial cell growth factor receptor is in contact with both subunits of the ligand, a disulfide-linked homodimer protein (26).

View larger version (52K): [in this window] [in a new window]   Fig. 4.   An active site on the TGF-1 molecule. The ribbon diagram of TGF-1 is derived from the NMR structure of human TGF-1 (Protein Data Bank entry 1KLC). The two monomers of TGF-1 are shown in green and blue. The interchain disulfide bond is shown in yellow. Residues 41-65 and 91-96 are shown in red and orange, respectively. The side chains of residues Trp52 and Asp55, which are important for TGF-1 activities, are illustrated. Two views are shown, rotated by 90° with respect to each other.

The hypothesis of the two major binding sites (the WSLD motif and a C-terminal site, residues 91-96), which are contributed by the two TGF-₁ monomers, is supported by the following observations: 1) the formation of disulfide-linked dimers of TGF-₁ is important for its activities (27); 2) antibodies to these two binding sites block TGF-₁ binding to TGF- receptors and TGF-₁-stimulated activities (Ref. 24 and this study); 3) like TGF-₂, TGF-₁/TGF-₂ (92-98) hybrids fail to bind to the soluble type II TGF- receptor (18); and 4) the TGF-₁ W52A/D55A mutant exhibits diminished growth regulatory activities as compared with those of wild type TGF-₁ (this study). The importance of the WLSD motif in mediating growth regulatory activity of TGF-₁ is also supported by the findings that several structurally unrelated proteins that contain two or more WXXD motifs per dimer or molecule show TGF- agonist activity in growth inhibition (20, 21, 28) and that ₁²⁵-(41-65)-protein conjugates containing multiple WLSD motifs exhibit growth inhibitory activity (19).

	ACKNOWLEDGEMENTS

We thank Drs. Su Wen Qian and Anita B. Roberts, NCI, for providing porcine TGF-₁ cDNA (in pSQneo vector). We also thank John McAlpin for typing the manuscript.

	FOOTNOTES

^* This work was supported by the National Institutes of Health Grant CA 38808.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: Dept. of Biochemistry and Molecular Biology, St. Louis University School of Medicine, 1402 South Grand Blvd., St. Louis, MO 63104. Tel.: 314-577-8135; Fax: 314-577-8156; E-mail: huangjs@slu.edu.

	ABBREVIATIONS

The abbreviations used are: TGF-₁, transforming growth factor-; DSS, disuccinimidyl suberate; DMEM, Dulbecco's modified Eagle's medium; PCR, polymerase chain reaction; kb, kilobase pair(s); bp, base pair; CHO, Chinese hamster ovary.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				C. L. Afonso, G. Delhon, E. R. Tulman, Z. Lu, A. Zsak, V. M. Becerra, L. Zsak, G. F. Kutish, and D. L. Rock Genome of Deerpox Virus J. Virol., January 15, 2005; 79(2): 966 - 977. [Abstract] [Full Text] [PDF]

				L. Shan, R. L. Emanuel, D. Dewald, J. S. Torday, N. Asokanathan, K. Wada, E. Wada, and M. E. Sunday Bombesin-like peptide receptor gene expression, regulation, and function in fetal murine lung Am J Physiol Lung Cell Mol Physiol, January 1, 2004; 286(1): L165 - L173. [Abstract] [Full Text] [PDF]

				E. Ogawa, W. M. Elliott, F. Hughes, T. J. Eichholtz, J. C. Hogg, and S. Hayashi Latent adenoviral infection induces production of growth factors relevant to airway remodeling in COPD Am J Physiol Lung Cell Mol Physiol, January 1, 2004; 286(1): L189 - L197. [Abstract] [Full Text] [PDF]

				E. V. Bocharov, D. M. Korzhnev, M. J. J. Blommers, T. Arvinte, V. Yu. Orekhov, M. Billeter, and A. S. Arseniev Dynamics-modulated Biological Activity of Transforming Growth Factor beta 3 J. Biol. Chem., November 22, 2002; 277(48): 46273 - 46279. [Abstract] [Full Text] [PDF]

				Q. Liu, T.-Y. Ling, H.-S. Shieh, F. E. Johnson, J. S. Huang, and S. S. Huang Identification of the High Affinity Binding Site in Transforming Growth Factor-beta Involved in Complex Formation with alpha 2-Macroglobulin. IMPLICATIONS REGARDING THE MOLECULAR MECHANISMS OF COMPLEX FORMATION BETWEEN alpha 2-MACROGLOBULIN AND GROWTH FACTORS, CYTOKINES, AND HORMONES J. Biol. Chem., November 30, 2001; 276(49): 46212 - 46218. [Abstract] [Full Text] [PDF]

				J. Nickel, M. K. Dreyer, T. Kirsch, and W. Sebald The Crystal Structure of the BMP-2:BMPR-IA Complex and the Generation of BMP-2 Antagonists J. Bone Joint Surg. Am., April 1, 2001; 83(90010): S7 - 14. [Abstract] [Full Text] [PDF]

				J. Nickel, M. K. Dreyer, T. Kirsch, and W. Sebald The Crystal Structure of the BMP-2:BMPR-IA Complex and the Generation of BMP-2 Antagonists J. Bone Joint Surg. Am., March 1, 2001; 83(1_suppl_1): S7 - S14. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Huang, S. S. Articles by Huang, J. S. Search for Related Content