HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bandoh, K. Articles by Inoue, K. Search for Related Content PubMed PubMed Citation Articles by Bandoh, K. Articles by Inoue, K. Social Bookmarking                      What's this?

J Biol Chem, Vol. 274, Issue 39, 27776-27785, September 24, 1999

Molecular Cloning and Characterization of a Novel Human G-protein-coupled Receptor, EDG7, for Lysophosphatidic Acid^*

Koji Bandoh^§, Junken Aoki^¶, Hiroyuki Hosono, Susumu Kobayashi, Tetsuyuki Kobayashi^**, Kimiko Murakami-Murofushi^**, Masafumi Tsujimoto^§, Hiroyuki Arai, and Keizo Inoue

From the  Graduate School of Pharmaceutical Sciences, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan, the  Faculty of Pharmaceutical Sciences, Science University of Tokyo, 12 Ichigaya-Funagawara-machi, Shinjuku-ku, Tokyo 162-0826, Japan, the ^** Department of Biology, Faculty of Science, Ochanomizu University, 2-1-1, Otsuka, Bunkyo-ku, Tokyo 112-8610, Japan, and the ^§ Laboratory of Cellular Biochemistry, The Institute of Physical and Chemical Research (RIKEN), 2-1, Hirosawa, Wako-shi, Saitama 351-0198, Japan

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Lysophosphatidic acid (LPA), together with sphingosine 1-phosphate, is a bioactive lipid mediator that acts on G-protein-coupled receptors to evoke multiple cellular responses, including Ca²⁺ mobilization, modulation of adenylyl cyclase, and mitogen-activated protein (MAP) kinase activation. In this study, we isolated a human cDNA encoding a novel G-protein-coupled receptor, designated EDG7, and characterized it as a cellular receptor for LPA. The amino acid sequence of the EDG7 protein is 53.7 and 48.8% identical to those of the human functional LPA receptors EDG2 and EDG4, respectively, previously identified. LPA (oleoyl) but not other lysophospholipids induced an increase in the [Ca²⁺]_i of EDG7-overexpressing Sf9 cells. Other LPA receptors, EDG4 but not EDG2, transduced the Ca²⁺ response by LPA when expressed in Sf9 cells. LPAs with an unsaturated fatty acid but not with a saturated fatty acid induced an increase in the [Ca²⁺]_i of EDG7-expressing Sf9 cells, whereas LPAs with both saturated and unsaturated fatty acids elicited a Ca²⁺ response in Sf9 cells expressing EDG4. In EDG7- or EDG4-expressing Sf9 cells, LPA stimulated forskolin-induced increase in intracellular cAMP levels, which was not observed in EDG2-expressing cells. In PC12 cells, EDG4 but not EDG2 or EDG7 mediated the activation of MAP kinase by LPA. Neither the EDG7- nor EDG4-transduced Ca²⁺ response or cAMP accumulation was inhibited by pertussis toxin. In conclusion, the present study demonstrates that EDG7, a new member of the EDG family of G-protein-coupled receptors, is a specific LPA receptor that shows distinct properties from known cloned LPA receptors in ligand specificities, Ca²⁺ response, modulation of adenylyl cyclase, and MAP kinase activation.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Lysophosphatidic acid (LPA)¹ and sphingosine 1-phosphate (S1P) are lipid mediators with diverse biological properties (1-3). The cellular responses elicited by LPA vary widely. The effects of LPA on the cell cycle are either mitogenic or antimitotic. LPA stimulates phospholipase C (PLC) activation and consequent Ca²⁺ mobilization, inhibits adenylyl cyclase, activates mitogen-activated protein (MAP) kinase, and stimulates the transcription of serum response element transcriptional reporter genes, such as c-fos, in various types of cells. It also exerts an effect on the cytoskeleton that can lead to changes in cell shapes and motility, which include inducing stress fiber production and stimulating chemotaxis, cell migration, and tumor cell invasiveness. These actions of LPA are believed to be mediated by seven-transmembrane G-protein-coupled receptor(s) (GPCR) on the cell surfaces. Some functional studies have suggested that multiple subtypes of LPA receptors with distinct signaling properties mediate the diverse cellular effects of LPA (4-6). Indeed, several subtypes of LPA receptors, which are GPCRs, were identified recently.

The EDG (endothelial cell differentiation gene) family of orphan receptors comprises EDG1 (7), EDG2/Rec1.3/Vzg-1 (8, 9), EDG3 (10), EDG4 (11), AGR16/H218 (12, 13), and EDG6 (14), and their amino acid sequences show 36-58% homology with one another. Hecht et al. (9) first reported that EDG2/Rec1.3/Vzg-1 increased responsiveness to LPA in cell rounding and adenylyl-cyclase inhibition assays when overexpressed in cerebral cortical cell lines, showing that EDG2/Rec1.3/Vzg-1 is a receptor for LPA. Because LPA and S1P are structurally related, this finding has enabled scientists to examine whether members of EDG family function as receptors for LPA and S1P. At present, according to their amino acid sequence homologies, ligand specificities, and genomic structures (15), these GPCRs of the EDG family fall into two major groups that interact either with LPA (EDG2 (9) and EDG4 (11)) or with S1P (EDG1 (16-18), EDG3 (19), and AGR16/H218 (20)). The ligand of EDG6, which is expressed predominantly in lymphoid tissue (14), has not been elucidated yet. A novel GPCR, named PSP24, which does not show significant sequence similarity with any member of the EDG family, has also been isolated from Xenopus oocytes as a functional receptor for LPA (21). Because some LPA-responsive cells do not express known LPA receptors (EDG2, EDG4, and PSP24), it was expected that unidentified subtypes of LPA receptors were suggested to be present in mammals (11, 22). To understand the biological functions of LPA fully, we attempted to identify novel subtypes of LPA receptors. In this study, we identified and characterized a novel GPCR, EDG7, the third functional LPA receptor belonging to the EDG family.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Lipids-- 1-Oleoyl-LPA, 1-palmitoyl-LPA, 1-stearoyl-LPA, 1-oleoyl-lysophosphatidylcholine (LPC), 1-oleoyl-lysophosphatidylethanolamine (LPE), 1-oleoyl-lysophosphatidylserine (LPS), porcine liver lysophosphatidylinositol (LPI), S1P, egg yolk phosphatidic acid (PA), dioleoyl-phosphatidylserine, and platelet-activating factor (PAF C16) were purchased from Avanti polar lipids (Alabaster, AL). 2-Acyl-1-lysophosphatidic acid (2-acyl-LPA) was prepared from egg yolk PA (5 nmol) as follows. PA was incubated with Rhizopus delemer lipase (20 mg/ml; Seikagaku-kogyo, Tokyo, Japan) in a 50 mM Tris-malate buffer, pH 5.7, at 37 °C for 2 h in the presence of one-quarter volume of diethyl ether. After the free fatty acids had been extracted with diethyl ether/petroleum ether (1:1 v/v) four times, the remaining lysophospholipids were extracted by the method of Bligh and Dyer (23). 2-Acyl-LPA contains mostly oleic acid and linoleic acid, because egg yolk PA is prepared from egg yolk phosphatidylcholine, which contains those fatty-acid chains at the sn-2 position. Because the 2-acyl-1-lysophospholipids were not stable, they were stored at 80 °C in chloroform/methanol (2:1 v/v) and used within 24 h after mixing with a buffer solution. Cyclic PA (cPA) and its analogs were prepared as described (24).

Amplification of the Novel G-protein-coupled Receptor with Degenerate Primers-- Total RNA was prepared from about 10⁷ human Jurkat T cells, and 5.0 µg was reverse-transcribed into DNA using the cDNA Cycle Kit (Invitrogen, Carlsbad, CA) with an oligo(dT) primer. The degenerate PCR primers were designed based on the amino acid sequences of the second and sixth of the seven transmembrane regions of the G-protein-coupled receptors EDG2 and EDG4. The oligonucleotides used were: GCIGCIGCIGA(C/T)(C/T)T(C/T)TTCGC (DP2; based on the second transmembrane region) and ACIAGICCIGGIGTCCAGCA (DP6; based on the sixth transmembrane region). Each PCR was carried out using 2.5 units Ex-Taq DNA polymerase (Takara Shuzo Co. Ltd., Kyoto, Japan) and 25% of the reverse-transcriptase reaction mixture in a 100-µl reaction mixture containing 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 2 mM MgCl₂, 200 µM dNTP, and 50 pmol of each degenerate oligonucleotide primer (DP2 and DP6). 35 PCR cycles, each consisting of 45 s at 94 °C (denaturation), 2 min at 55 °C (annealing), and 3 min at 72 °C (elongation) were performed, with the first cycle including an extended denaturation period (5 min), during which the polymerase was added. The 554-bp PCR products were purified by agarose gel electrophoresis and subcloned into a T-vector using the original TA-Cloning Kit (Invitrogen, Carlsbad, CA). Plasmid DNA was prepared using the Wizard Minipreps DNA Purification System (Promega, Madison, WI), and sequencing was performed by the dideoxy chain termination method using the ABI377 system (Perkin-Elmer, Branchburg, NJ).

5'- and 3'-RACE-- A Marathon^TM cDNA Amplification Kit (CLONTECH, Palo Alto, CA) was used to perform 5'- and 3'- RACE. Double-stranded cDNA was prepared from poly(A)+ RNA of human Jurkat T cells, and nested PCR was carried out using the cDNA as a template and AP1, AP2 (supplied in the Marathon 228 cDNA Amplification Kit), and internal oligonucleotide primers (FW1, FW2, RV1, and RV2, see below) as PCR primers under the conditions described above. The sequences of the oligonucleotides were: FW1, AACCAACGTCTTGTCTCCGCATAC (nucleotide positions 690-713); FW2, AGCTAATGAAGACGGTGATGACTG (nucleotide positions 749-772); RV1, GTCCAGAAGCCCCTGACGGAGAAA (nucleotide positions 349-372); and RV2, AGCAAGTTGGTGAGGGAAGCAGTC (nucleotide positions 381-404). The resulting DNA fragments were subcloned, and their DNA sequences were determined. Then the DNA fragment covering the open reading frame of EDG7 was amplified by reverse transcription-PCR using the cDNA from human Jurkat cells and oligonucleotide primers corresponding to the 5'- and 3'-noncoding regions and Pfu DNA polymerase (Toyobo, Tokyo, Japan). At least three independent reverse transcription-PCRs were carried out.

Cell Culture-- Sf9 insect cells were grown in a serum-free ExCell-420 insect cell medium (Nichirei, Tokyo, Japan) at 27 °C. PC12 cells were maintained in Dulbecco's modified Eagle's medium (high glucose) containing 10% horse serum and 5% fetal bovine serum in an atmosphere of 5% CO₂.

Baculovirus System-- The cDNA encoding the coding region of EDG7 (nucleotide positions 38-1104) was inserted into the EcoRI/NotI site of the baculovirus transfer vector pFASTBAC1 (Life Technologies, Inc.). To achieve expression of FLAG-tagged EDG7, cDNA with a FLAG tag at its N-terminal was generated by the PCR using the following oligonucleotides: ATGCGAATTCATGGACTACAAAGACGATGACGATAAAAATGAGTGTCACTATGACAAGCAC and ATGCGCGGCCGCTCCAGAGTTTAGGAAGTGCTTTTA. The resulting DNA fragment was digested by EcoRI/NotI and ligated into pFASTBAC1. Recombinant viruses were prepared using the Bac-to-Bac system (Life Technologies, Inc.) according to the manufacturer's protocol. For infection, 6 × 10⁵ cells/ml were mixed with recombinant or wild-type Autographa californica nuclear polyhedrosis virus to produce a multiplicity of infection of 10 and incubated for 48 h at 27 °C. Expression of the FLAG-tagged protein was detected by Western blotting with an anti-FLAG monoclonal antibody (M5; Eastman Kodak Company, New Haven, CT). For preparation of recombinant baculoviruses to express FLAG-tagged EDG2 and FLAG-tagged EDG4, cDNAs with FLAG tag at their N-terminal were generated by the reverse transcription-PCR using human brain cDNA as template DNA and the following oligonucleotides: ATGCGAATTCATGGACTACAAAGACGATGACGATAAAGCTGCCATCTCTACTTCCATCCCT, ATGCGCGGCCGCCTAAACCACAGAGTGATCATTGCT (for EDG2) and ATGCGAATTCATGGACTACAAAGACGATGACGATAAAGTCATCATGGGCCAGTGCTACTAC, ATGCGCGGCCGCTCAGTCCTGTTGGTTGGGTTGAGC (for EDG4). The resulting DNA fragments were digested by EcoRI/NotI and ligated into pFASTBAC1, and baculoviruses were prepared as described above. DNA sequences of cDNAs prepared by reverse transcription-PCR were confirmed by DNA sequencing.

Ca²⁺ Measurements-- Sf9 cells were harvested 2 days after baculovirus infection, washed gently with an HBS buffer (20 mM Hepes, pH 7.4, containing 120 mM NaCl, 4.7 mM KCl, 1.2 mM MgCl_2,1.25 mM CaCl₂, 1.2 mM KH₂PO_4, and 10 mM glucose), and loaded with 2 µM Fura-2 acetoxymethyl ester (Fura-2 AM; Molecular Probes Inc., Eugene, OR) for 45 min. Free Fura-2 AM was washed out, and the cells were resuspended in the HBS buffer to produce a concentration of 10⁶ cells/ml. Agonist-induced Fura-2 AM fluorescence of samples in quartz cuvettes kept at 27 °C was monitored at excitation wavelengths of 340 and 380 nm and an emission wavelength of 300 nm using a CAF-110 spectrofluorimeter (Japan Spectroscopy, Inc., Tokyo, Japan). Fluorescence was recorded before and after addition of LPA and other phospholipids, which were dissolved in phosphate-buffered saline with 0.01% (w/v) of fatty acid-free bovine serum albumin (Sigma).

Pertussis Toxin and U73122 Treatment-- 24 h after baculovirus infection of the Sf9 cells, PTX (100 ng/ml; Calbiochem, La Jolla, CA) was added to the culture medium, and incubation was continued for an additional 24 h. Then the cells were collected, and their Ca²⁺ responses were tested as described above. The phospholipase C inhibitor U73122 (3 µM; Calbiochem, La Jolla, CA) was added to Sf9 cells 3 min before LPA was added.

[³H]LPA Binding-- Sf9 cells (5 × 10⁵) infected by each baculovirus for 48 h were washed with a binding buffer (phosphate-buffered saline containing 0.25% bovine serum albumin) and incubated for 60 min at 0 °C in the same buffer containing various concentration of [³H]LPA in a 96-well membrane filter plate (pore size, 65 nm; Millipore, Orlando, FL). Then the cells were washed three times with the wash buffer (phosphate-buffered saline containing 1% bovine serum albumin) using a Multi-screen Filtration System (Millipore), and the radioactivity bound to the cells was quantified using a -counter. Total and nonspecific binding was evaluated in the absence and presence of 10 µM nonradioactive LPA, respectively. To examine the specificity of LPA binding, the amounts of LPA bound (using 10 nM of [³H] LPA) in the presence of excess nonradioactive LPA (10 µM), LPS (10 µM), LPC (1 µM), LPI (10 µM), LPE (10 µM), S1P (10 µM), and PAF (1 µM) (10 µM of LPC or PAF caused cell lysis) were determined, and the specific binding value was calculated by subtracting the nonspecific binding value (cpm) from the total binding value (cpm).

cAMP Measurements-- Sf9 cells were infected with recombinant baculoviruses and harvested 2 days after infection. Cells were incubated with 5 µM forskolin in the presence of the phosphodiesterase inhibitor 3-isobutyl-1-methylxanthine (0.5 mM) for 10 min followed by a 20-min stimulation with 2.5 µM LPA with various acyl chains in an HBS buffer. cAMP levels were determined using a cAMP enzyme immunoassay system (Biotrak; Amersham Pharmacia Biotech), following the instructions of the manufacturer.

Assay for MAP Kinase-mediated Signal Transduction-- To measure MAP kinase-mediated signal transduction, we employed the PathDetect^TM Elk1 Trans-Reporting System (Stratagene, La Jolla, CA). This assay employs a fusion protein that contains the DNA-binding domain of GAL4 and the transactivation domain of Elk1 to induce expression of a luciferase reporter driven by an artificial promoter containing five GAL4-binding sites. Phosphorylation of the transactivation domain of Elk1 by MAP kinase, in turn, activates the transcription of the luciferase gene from the reporter plasmid. cDNAs encoding FLAG-tagged EDG7, EDG2, and EDG4 were inserted into EcoRI/NotI sites of the mammalian expression plasmid pcDNA3 (Invitrogen, Carlsbad, CA) (FLAG-EDG7-pcDNA3, FLAG-EDG2-pcDNA3, and FLAG-EDG4pcDNA3). Transient transfections were performed using SuperFect transfection reagent (Qiagen, Hilden, Germany). Briefly, 100,000 PC12 cells were seeded in 24-well plates 24 h before the transfection. Each point was transfected with 200 ng of FLAG-EDG7-pcDNA3 (or FLAG-EDG2-pcDNA3, FLAG-EDG4-pcDNA3, or empty pcDNA3 for the control experiment), 200 ng of pFR-Luc, 25 ng of pFA-Elk1 (as described by Stratagene), and 575 ng of the empty pcDNA3 vector. 12 h post-transfection, the cells were rinsed twice with phosphate-buffered saline and incubated in a serum-free medium for another 12 h. The cells were then stimulated with 10 µM of LPA (oleoyl) for 10 h at 37 °C and lysed in 500 µl of an extraction buffer, 100 µl of which was used to measure luciferase activity, following the instructions of the manufacturer. Expression of each protein was confirmed by immunofluorescence using anti-FLAG monoclonal antibody M5.

Northern Blot Analysis-- Human Multiple Tissue Northern blots were purchased from CLONTECH (Palo Alto, CA), DNA probes (nucleotide positions 307-730) were labeled by random priming with [-³²P]dCTP, and hybridization was carried out at 65 °C for 4 h in a rapid hybridization buffer (Amersham Pharmacia Biotech). Each blot was rinsed with 2× SSC at room temperature for 5 min, washed twice with 0.5× SSC containing 0.1% SDS at 65 °C for 40 min, and then autoradiographed using Kodak X-Omat AR film at 80 °C with an intensifying screen for 12 h. Finally, each blot was rehybridized with a glyceraldehyde-3-phosphate dehydrogenase cDNA probe (CLONTECH, Palo Alto, CA) as an internal standard.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

PCR Amplification, Cloning, and Sequencing of EDG7 cDNA-- We investigated a previously unidentified GPCR belonging to the EDG family by subjecting cDNA of human Jurkat T cells to PCR amplification. Two blocks of conserved amino acid sequences in EDG2 and EDG4, one from the second and one from the sixth transmembrane domain, were chosen for the synthesis of the degenerate oligonucleotide primers DP2 and DP6 (see "Materials and Methods"). The PCR reaction was performed, yielding a 554-bp fragment containing a GPCR-like sequence distinct from those of known members of the EDG family. Using 5'- and 3'-RACE, we isolated a DNA fragment that covered the entire open reading frame of this novel gene. Complete sequencing of the DNA revealed a 1059-bp open reading frame flanked by a 42-bp 5'-untranslated region and a 44-bp 3'-untranslated region. The translational initiation site (ATG) was assigned to the first methionine codon (nucleotide positions 43-45), because an in-frame stop codon was present upstream of this methionine residue and flanking sequences (CCACA) were present, fulfilling Kozak's criteria for initiation (25). An in-frame translational termination codon (TAA) was present after nucleotide 1,101. Therefore, we concluded that this new GPCR contains 353 amino acids and that its molecular mass is 40,128 Da (Fig. 1A).

View larger version (93K): [in this window] [in a new window]   Fig. 1.   Amino acid sequences of EDG7. A, the cDNA and amino acid sequence of human EDG7. The first and second lines indicate the nucleotide and deduced amino acid sequences, respectively, with the nucleotide and amino acid positions shown on the left and right, respectively. The consensus sequences for N-linked glycosylation sites (amino acid numbers 172-174) are shown in italics, and the putative seventh transmembrane domains are underlined. B, the amino acid sequences of human EDG7, EDG2, and EDG4 were aligned by the GENETYX-MAC program. Identical amino acids in the three proteins are marked by an asterisk, the hyphens in each line show gaps, and the putative transmembrane domains (TM1-7) are underlined. C, phylogenetic tree of the EDG family. The phylogenetic tree depicted was derived by the neighbor joining method performed by the GENETYX-MAC program. The sequence divergence between any pair of sequences is equal to the sum of the lengths of the horizontal branches connecting the two sequences.

A comparison of the deduced amino acid sequence with those of known EDG sequences revealed that the primary structure of the predicted protein was similar to those of the GPCRs of the EDG family, with overall sequence identities to human EDG1, human EDG2 (Vzg-1), human EDG3, human EDG4, rat H218, and human EDG6 of 34.8, 53.7, 36.3, 48.8, 33.8, and 35.5%, respectively. Therefore, the protein encoded by the cloned cDNA was named EDG7 (Fig. 1B). A high degree of similarity between EDG2 and EDG4 (approximately 50%; Fig. 1B) was observed among EDG7, EDG2, and EDG4. To gain better understanding of the relationships involved in the molecular evolution of the EDG family, a phylogenetic tree was constructed using the neighbor joining method (Fig. 1C). According to this phylogenetic tree, the EDG family can be classified into two distinct groups: EDG1, EDG3, H218/AGR16, and EDG6 belong to one, and EDG2, EDG4, and EDG7 belong to the other. Because EDG1, EDG3, and H218/AGR16 have been reported to function as S1P receptors and EDG2 and EDG4 have been reported to function as LPA receptors, EDG7, EGD2, and EDG4 appear to form a subfamily of the EDG family, and EDG7 may function as a receptor for LPA.

Evaluation of EDG7 as an LPA Receptor by Measuring the Ca²⁺ Response-- To explore the hypothesis that EDG7 is a receptor for LPA, we expressed the recombinant receptor in Sf9 insect cells and measured the increases in the [Ca²⁺]_i evoked by LPA. We chose Sf9 cells because, although LPA does not affect their [Ca²⁺]_i, it induces rapid increases in the [Ca²⁺]_i of almost all types of mammalian cells. Western blotting analysis using anti-FLAG antibody M5 confirmed that an approximately 35-kDa protein containing the FLAG tag was expressed in cells infected with EDG7 baculovirus but not with the wild-type virus (Fig. 2A). The addition of 1 µM oleoyl-LPA to Sf9 cells infected with either the FLAG-EDG7-expressing (Fig. 2B) or EDG7-expressing recombinant baculovirus (data not shown) increased the [Ca²⁺]_i. However, no such Ca²⁺ response was observed in Sf9 cells infected with wild-type baculovirus (Fig. 2B) or in uninfected control cells (data not shown), even if the cells were treated with 10 µM LPA. The structurally related lipids 1-oleoyl-LPC, 1-oleoyl-LPE, 1-oleoyl-LPS, 2-oleoyl-LPS, 1-acyl-LPI, PAF, and S1P, each at a concentration of 1 µM, failed to elicit significant increases in the [Ca²⁺]_i (Fig. 2C).

View larger version (17K): [in this window] [in a new window]   Fig. 2.   LPA-induced increases in the intracellular [Ca2+]i of Sf9 cells expressing EDG7. A, expression of FLAG-tagged EDG7, EDG2, and EDG4 proteins in Sf9 cells. Sf9 cells were infected with each baculovirus, and FLAG-tagged protein expression was examined by Western blotting with an anti-FLAG (M5) monoclonal antibody. The predicted molecular mass of FLAG-EDG7 is about 35 kDa. The size of the molecular mass marker is shown on the right. B, Ca2+ response of FLAG-EDG7-, FLAG-EDG2-, and FLAG-EDG4-expressing Sf9 cells to LPA. Sf9 cells were infected with each baculovirus, loaded with the fluorescent Ca2+ indicator Fura-2 AM, and stimulated with 1-oleoyl-LPA. A result from cells infected with the wild-type virus is also shown. C, structurally related phospholipids did not evoke the Ca2+ response. Fura-2 AM-loaded Sf9 cells expressing FLAG-EDG7 were stimulated sequentially with 1 µM each phospholipid, and the Ca2+ response was examined as described in the legend to B.

We also expressed known LPA receptors EDG2 and EDG4 in Sf9 cells and compared their Ca²⁺ response. Protein expression was confirmed by Western blotting using anti-FLAG antibody (Fig. 2A). The expression of EDG2 protein was much higher than those of EDG4 and EDG7, but it failed to transmit a detectable Ca²⁺ signal in response to LPA (oleoyl) (Fig. 2B), consistently with the observation by Zondag et al. (17). On the other hand, EDG4 mediated a Ca²⁺ signal like EDG7 in Sf9 cells (Fig. 2B). Thus, both EDG4 and EDG7 but not EDG2 mediate the Ca²⁺ response by LPA in Sf9 cells.

LPA Binding-- We investigated the specific binding of [³H]oleoyl-LPA to Sf9 cells expressing FLAG-EDG7, FLAG-EDG2, and FLAG-EDG4 using various doses of LPA. EDG7- and EDG4-expressing Sf9 cells increased the specific binding of [³H]oleoyl-LPA in comparison with wild-type baculovirus and EDG2-infected cells (Fig. 3A). The apparent K_d values of EDG7 and EDG4 for [³H]LPA are 206 and 73.6 nM, respectively (Fig. 3B). Thus, the binding affinity for LPA of EDG7 is relatively lower than that of EDG4. We also examined the competition between the binding of [³H]LPA and related nonradioactive lipids to FLAG-EDG7-expressing Sf9 cells. LPA (10 µM) reduced [³H]LPA binding, whereas the other related lipids examined (LPC, LPE, LPS, LPI, S1P, and PAF) did not (Fig. 3C). These data clearly demonstrate that EDG7 represents a specific receptor for LPA.

View larger version (29K): [in this window] [in a new window]   Fig. 3.   [3H]LPA binding to Sf9 cells expressing EDG7. A, specific binding of [3H]LPA (12.5, 25, and 50 nM) to Sf9 cells infected with EDG7, EDG2, EDG4, and wild-type baculovirus. Specific binding is defined as binding in the absence of an unlabeled competitor minus binding in the presence of excess unlabeled ligand. B, LPA binding to EDG7 and EDG4 as a function of increasing concentration of LPA. Specific binding of [3H]LPA (defined as binding in the absence of an unlabeled competitor minus binding in the presence of excess unlabeled ligand) to Sf9 cells infected with each baculovirus expressing EDG7 (open circle) and EDG4 (closed circle) was determined as described under "Materials and Methods." Results are the means ± S.D. of triplicate determinations. Kd values were determined by Scatchard plot analysis. C, competition for [3H]LPA binding by related lipids. Sf9 cells expressing FLAG-EDG7 were incubated in the presence of 10 nM [3H]LPA without or with the indicated lipids (LPA (10 µM), LPS (10 µM), LPC (1 µM), LPI (10 µM), LPE (10 µM), S1P (10 µM), and PAF (1 µM)), and the total amount of [3H]LPA bound was measured. The values are the means ± S.E. of three determinations.

Ligand Specificity of EDG7-- Several molecular species of LPA with saturated (stearoyl- (18:0), palmitoyl- (16:0)) or unsaturated (oleoyl- (18:1), linoleoyl- (18:2), arachidonoyl- (20:4)) acyl chains have been detected in activated platelets (26). We then investigated which structural features of LPA are important for the EDG7-dependent activation of Ca²⁺ mobilization. 1-Oleoyl-LPA is a good ligand for EDG7 (Fig. 2B). As shown in Fig. 5, however, 1-acyl-2-lysophosphatidic acids with saturated acyl chains (1-stearoyl-, 1-palmitoyl-, and 1-myristoyl-LPA), at a concentration of 10 µM, failed to elicit significant increases in [Ca²⁺]_i. Furthermore, 2-acyl-LPA, which contains a mixture of oleic and linoleic acids at the sn-2 position (see "Materials and Methods"), elicited a significant increase in [Ca²⁺]_i (Fig. 4, A-E). No such Ca²⁺ response of Sf9 cells infected with wild-type baculovirus was induced by 2-acyl-LPA (data not shown). The ligand specificity of EDG4 was also examined in this system. In marked contrast with EDG7, 1-myristoyl-, 1-palmitoyl-, 1-stearoyl-, 1-oleoyl-, and 2-acyl-LPA equally elicited a significant increase in the [Ca²⁺]_i in Sf9 cells expressing EDG4 (Fig. 4, F-J).

View larger version (19K): [in this window] [in a new window]   Fig. 4.   Substrate specificity of EDG7 and EDG4. The activities of LPA and its acyl chain analogs to induce rapid, transient increases in [Ca2+]i in Sf9 cells expressing EDG7 (A-E) or EDG4 (F-J) were measured. Cells, loaded with Fura-2 AM, were stimulated with various concentrations of LPAs, and changes in [Ca2+]i were analyzed using CAF-110 spectrofluorimeter. The means were calculated from the results of three separate experiments. A and F, 1-oleoyl-LPA; B and G, 2-acyl-LPA; C and H, 1-stearoyl-LPA; D and I, 1-palmitoyl-LPA; E and J, 1-myristoyl-LPA.

We also examined the ability of cPA, which was first isolated from the slime mold Physarum polycephalum (27), to increase the [Ca²⁺]_i. As shown in Fig. 5, cPA with oleoyl acid at the sn-1 position of the lipid (18:1 cPA, PHYLPA-8) increased the [Ca²⁺]_i, whereas 10 µM cPAs with palmitic acid (16:0 cPA, PHYLPA-5) and cyclopropane-containing hexadecanoic acid (PHYLPA-1) were inactive. These data demonstrated that EDG7 prefers LPA with unsaturated fatty-acyl chains at the sn-1 or sn-2 position.

View larger version (21K): [in this window] [in a new window]   Fig. 5.   Cyclic PA with oleic acid elicits Ca2+ response in Sf9 cells expressing EDG7. FLAG-EDG7-expressing Sf9 cells were loaded with the fluorescent Ca2+ indicator Fura-2 AM and stimulated sequentially with PHYLPA-1 (10 µM), PHYLPA-5 (palmitoyl (16:0)-cPA, 10 µM), PHYLPA-8 (oleoyl (18:1)-cPA, 10 µM), and 1-oleoyl-LPA (1 µM).

Characterization of the EDG7-transduced Ca²⁺ Response-- We next examined the effects of PTX and the PLC inhibitor U73122 on EDG7-transduced Ca²⁺ responses. As shown in Fig. 6, pretreatment of FLAG-EDG7-expressing Sf9 cells with 100 ng/ml PTX for 24 h did not affect the Ca²⁺ response evoked by 1 µM LPA, whereas U73122 inhibited effectively the Ca²⁺ response transduced by EDG7, demonstrating that EDG7 is coupled to PTX-insensitive G-protein(s). The Ca²⁺ response transduced by EDG4 was also inhibited by PLC inhibitor U73122 but unaffected by PTX pretreatment (Fig. 6).

View larger version (23K): [in this window] [in a new window]   Fig. 6.   Effects of PTX and PLC inhibitor (U73122) on the LPA-induced Ca2+ response of Sf9 cells expressing EDG7 (A and B) and EDG4 (C and D). A and C, Sf9 cells expressing FLAG-EDG7 (A) or FLAG-EDG4 (C) were pretreated with (open circle) or without (closed circle) PTX (100 ng/ml) for 24 h before the Ca2+ response was examined using various doses of oleoyl-LPA. B and D, Sf9 cells expressing FLAG-EDG7 (B) or FLAG-EDG4 (D) were pretreated with PLC inhibitor, U73122 (3 µM), for 3 min before the Ca2+ response was examined. Oleoyl-LPA (1 µM) was used.

Effect on cAMP Level-- It has been repeatedly demonstrated that LPA inhibits adenylyl cyclase via a G_i-mediated signaling event in mammalian cells. To examine whether EDG7 participates in the inhibition of adenylyl cyclase in response to LPA, Sf9 cells expressing each LPA receptor were pretreated with forskolin to raise the intracellular cAMP level and then treated with LPA. Unexpectedly, LPA did not suppress forskolin-induced cAMP accumulation but rather increased intracellular cAMP level in EDG7-expressing Sf9 cells (Fig. 7A). The increase in cAMP level by LPA in EDG7-expressing Sf9 cells was insensitive to PTX (Fig. 7B) and observed only when the cells were pretreated with forskolin (data not shown). The similar response was observed in EDG4-expressing Sf9 cells (Fig. 7B). cAMP level in EDG2-expressing Sf9 cells was unaffected upon stimulation with LPA (Fig. 7A), as described previously (17).

View larger version (49K): [in this window] [in a new window]   Fig. 7.   Effect of LPA on cAMP accumulation in Sf9 cells. A, Sf9 cells infected either with EDG7, EDG2, EDG4, or wild-type baculovirus were treated with forskolin (5 µM) to raise cAMP levels. LPAs with various fatty acids indicated (3 µM) were added, and, after 20 min, the cellular cAMP content was determined as described under "Materials and Methods." Data are the means ± S.E. for three separate experiments. B, effect of PTX pretreatment on cAMP accumulation by LPA (oleoyl) stimulation was examined as in A in EDG7- or EDG4-expressing Sf9 cells.

Effect on MAP Kinase-- MAP kinase in insect Sf9 cells has not been characterized yet. In addition we could not detect MAP kinase activity using anti-human MAP kinase antibodies or substrates for MAP kinase such as oligopeptide from human EGF-receptor (data not shown). Thus we used the mammalian expression system for this experiment. To determine whether EDG7 mediates MAP kinase activation, we used the PathDetect^TM Elk1 trans-Reporting System. Elk1 is a transcription factor that is phosphorylated and activated by MAP kinase (28). PC12 cells were transfected with FLAG-tagged EDG2, EDG4, or EDG7 and subjected to an assay of MAP kinase activation. Expressions of each receptor were confirmed by immunofluorescence in PC12 cells (data not shown). LPA activated the transcription of the luciferase gene through activation of the Elk1 in EDG4-expressing PC12 cells but not in EDG2- or EDG7-expressing cells (Fig. 8), suggesting that only EDG4 is coupled to MAP kinase activation among the cloned LPA receptors.

View larger version (28K): [in this window] [in a new window]   Fig. 8.   Induction of MAP kinase-mediated Elk1 activation by LPA in PC12 cells. PC12 cells were cotransfected with a reporter construct containing a Gal4 element in a series immediately upstream of the luciferase gene (pFR-Luc) and the Elk1 protein activation domain (pFA-Elk1) together with indicated cDNA construct or empty pcDNA3 vector (for control experiment). The results of luciferase activities represent the average-fold activation of at least three transfections. Each transfection was done in triplicate. Data are the means ± S.E. for three separate experiments.

Tissue and Cellular Distributions of EDG7-- The tissue distribution of EDG7 was examined by subjecting several human tissues and cancer cell lines to Northern blot analysis. EDG7 transcripts of about 4.3 kilobases were detected in the heart, pancreas, prostate, and testis and, to a lesser extent, in the lung and ovary (Fig. 9). EDG7 transcripts were also found weakly in the human cancer cell lines HeLa, K562, SW480, A549, and G361, the last of which, a melanoma cell line, contained the highest level (data not shown).

View larger version (100K): [in this window] [in a new window]   Fig. 9.   Northern blot analysis of EDG7 in human tissues and blood cells. Poly(A)+ RNA (2 µg) from various human tissues (human Multiple Tissue Northern blots, CLONTECH) was hybridized with probes specific to human EDG7 (upper panel) and glyceraldehyde-3-phosphate dehydrogenase (lower panel) on a nylon membrane. The origin of each RNA is shown at the top, and the molecular mass of standard markers (in kilobases (kb)) is shown on the left.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

In this study, we isolated a new member of the EDG family of G-protein-coupled receptors, EDG7, and showed that it functions as a cellular receptor for LPA. Interestingly, EDG7 transduce increases in both [Ca²⁺]_i and the cAMP level upon stimulating only with LPA containing an unsaturated fatty-acyl chain at the sn-1 or sn-2 position but not with LPA containing any of saturated fatty acids. EDG7 also reacted with cPA with unsaturated fatty acid (Fig. 5). In contrast, EDG4 can be stimulated by LPAs with both an unsaturated and saturated fatty acid. Moreover, Hecht et al. (9) have previously demonstrated that both oleoyl- and stearoyl-LPA induce EDG2-dependent cell rounding in EDG2-transfected cells. Erickson et al. (29) also reported that LPAs with both saturated and unsaturated fatty acid activate EDG2 in the yeast pheromone response pathway. Thus, EDG2 seems to recognize LPAs with both saturated and unsaturated fatty acids like EDG4. It has been previously demonstrated that LPAs with unsaturated fatty acids evoked greater Ca²⁺ responses of the human epidermoid carcinoma cell line A431 than LPAs with saturated fatty acids (30). In addition, Tokumura et al. (31) reported that degree of unsaturation in the acyl moiety of LPA affects proliferation of cultured vascular smooth muscle cells from rat aorta by LPA. A newly identified LPA receptor, EDG7, may account for these response.

Several molecular species of LPA with saturated (stearoyl- (18:0), palmitoyl- (16:0)) or unsaturated (oleoyl- (18:1), linoleoyl- (18:2), arachidonoyl- (20:4)) acyl chains have been detected in activated platelets (26). The biochemical pathway for LPA formation has not been established with certainty but may involve, in part, the degradation of phosphatidic acid by a phospholipase A(s). Both phospholipase A2 and A1 may be involved in the production of LPA with saturated and unsaturated fatty acids, respectively. In this connection, it is interesting to note that in our preliminary work, mammalian tissues and possibly cells express PA-specific phospholipase A1, which possesses a primary structure distinct from that of known phospholipases and lipases. Such types of phospholipase A1 may participate in the production of LPA with an unsaturated fatty acid. It is also reasonable to assume that the pathways for the production of each LPA species are regulated differently and that only the process leading to the production of LPA with unsaturated fatty acid can activate EDG7-mediated signaling event.

One of the best documented cellular activities of LPA is its mobilization of [Ca²⁺]_i. It has been previously demonstrated that LPA-induced Ca²⁺ mobilization can be transduced through both PTX-sensitive (32) and PTX-insensitive (33-35) G-protein followed by activation of PLC. An et al. (36) used TAg-Jurkat T cells transiently transfected with human EDG2 or EDG4 to demonstrate that PTX completely blocks LPA-induced Ca²⁺ mobilization in EDG2-expressing cells, and partially blocks it in EDG4-expressing cells. They speculated from these data that EDG2 is coupled to PTX-sensitive G_i, whereas EDG4 is coupled to both G_i and G_q (36). In this study, we examined EDG7-transduced Ca²⁺ mobilization using Sf9 cells, because parent Sf9 cells appear not to contain endogenous LPA receptor and therefore does not respond to LPA stimulation. According to our observations, both EDG7 and EDG4 transduced the Ca²⁺ response by LPA in a PTX-insensitive manner in Sf9 cells, indicating that EDG7 and EDG4 are coupled to a PTX-insensitive G-protein(s), possibly G_q. Although the human EDG2 was expressed significantly in Sf9 cells, Ca²⁺ mobilization has not been observed in the cells, indicating that none of G-proteins in Sf9 cells can be coupled to human EDG2 (Ref. 17 and present study). It is interesting to note that no increase in the specific binding of LPA in EDG2-expressing Sf9 cells was observed either. Consistently with this observation, Figler et al. (37) demonstrated that specific binding site for ligand in GPCR was available only when appropriate G-protein(s) are coupled to the receptor.

The effect of LPA on the cell growth is either proliferative or antiproliferative. In most fibroblastic cell lines, LPA induces mitogenic responses and inhibits adenylyl cyclase via a G_i-mediated signaling event (33). In fact, LPA inhibited adenylyl cyclase in EDG2-transfected mammalian cells (9). On the other hand, in nonfibroblastic cell line Sp2/0-Ag14 myeloma, which does not express either EDG2 or EDG4 (22), LPA induced an increase in cAMP and inhibited cell proliferation in a PTX-insensitive manner, which is accompanied by an increase in cytoplasmic Ca²⁺ (4). They also indicated that LPA with a higher degree of unsaturation and longer acyl chains increased the antiproliferative effects (4). A newly identified EDG7, which enhanced adenylyl cyclase in a PTX-insensitive manner, may account for those responses. The idea is further supported by the observation that EDG7 is not coupled to MAP kinase activation, which leads to cell proliferation in various types of cells. In EDG7- and EDG4-expressing Sf9 cells increases in cAMP by LPA were observed only after adenylyl cyclase was first stimulated with forskolin (Fig. 7). Felder et al. (38) reported that accumulation of cAMP by CB1 antagonists in CB1-expressing Chinese hamster ovary cells was only observed when cells were pretreated with forskolin. Some isoforms of adenylyl cyclase(s) that are coupled to EDG7 and EDG4 in Sf9 insect cells may require an initial priming for activation like type II or IV adenylyl cyclases in mammalian cells as reported by Tang et al. (39). LPA is known to exert an effect on the cytoskeleton that can lead to changes in cell shapes and motility, which includes inducing the production of stress fiber through Rho-GTPase activation. We examined the effect of LPA stimulation on the formation of actin stress fiber in EDG7-expressing CHO-K1 and PC12 cells by staining an actin filament with FITC-phalloidin but did not observe any obvious differences between the EDG7-expressing and control cells (data not shown).

In conclusion, EDG7 is a specific LPA receptor that shows distinct properties from known cloned LPA receptors in ligand specificity, Ca²⁺ response, and modulation of adenylyl cyclase and MAP kinase. Further studies are definitely needed in understanding a physiological role of this receptor.

	ACKNOWLEDGEMENTS

We thank Dr. Tetsuro Urushidani for measurement of [Ca²⁺]_i. We also thank DAISO Co. Ltd. (Osaka, Japan) for donating the precursor compounds for the organic synthesis of cPA.

	FOOTNOTES

^* This work was supported in part by research grants from the Ministry of Education, Science, Sports, and Culture of Japan and by special coordination funds from the Science and Technology Agency of the Japanese Government.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank^TM/EMBL Data Bank with accession number(s) AF127138.

^¶ To whom correspondence should be addressed. Tel.: 81-3-5841-4722; Fax: 81-3-3818-3173; E-mail: jaoki@mol.f.u-tokyo.ac.jp.

	ABBREVIATIONS

The abbreviations used are: LPA, lysophosphatidic acid; GPCR, G-protein-coupled receptor; PTX, pertussis toxin; RACE, rapid amplification of cDNA ends; 2-acyl-LPA, 2-acyl-1-lysophosphatidic acid; MAP, mitogen-activated protein; PLC, phospholipase C; LPC, 1-oleoyl-lysophosphatidylcholine; LPE, 1-oleoyl-lysophosphatidylethanolamine; LPI, lysophosphatidylinositol; PA, phosphatidic acid; cPA, cyclic PA; PAF, platelet-activating factor; PCR, polymerase chain reaction; bp, base pair; AM, acetoxymethyl ester.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				S. Yu, M. M. Murph, Y. Lu, S. Liu, H. S. Hall, J. Liu, C. Stephens, X. Fang, and G. B. Mills Lysophosphatidic Acid Receptors Determine Tumorigenicity and Aggressiveness of Ovarian Cancer Cells J Natl Cancer Inst, November 19, 2008; 100(22): 1630 - 1642. [Abstract] [Full Text] [PDF]

				X. Ye Lysophospholipid signaling in the function and pathology of the reproductive system Hum. Reprod. Update, September 1, 2008; 14(5): 519 - 536. [Abstract] [Full Text] [PDF]

				R. A. Oyesanya, Z. P. Lee, J. Wu, J. Chen, Y. Song, A. Mukherjee, P. Dent, T. Kordula, H. Zhou, and X. Fang Transcriptional and post-transcriptional mechanisms for lysophosphatidic acid-induced cyclooxygenase-2 expression in ovarian cancer cells FASEB J, August 1, 2008; 22(8): 2639 - 2651. [Abstract] [Full Text] [PDF]

				K. M. Kassel, P. R. Dodmane, N. A. Schulte, and M. L. Toews Lysophosphatidic Acid Induces Rapid and Sustained Decreases in Epidermal Growth Factor Receptor Binding via Different Signaling Pathways in BEAS-2B Airway Epithelial Cells J. Pharmacol. Exp. Ther., June 1, 2008; 325(3): 809 - 817. [Abstract] [Full Text] [PDF]

				M. B. Friis, K. G. Vorum, and I. H. Lambert Volume-sensitive NADPH oxidase activity and taurine efflux in NIH3T3 mouse fibroblasts Am J Physiol Cell Physiol, June 1, 2008; 294(6): C1552 - C1565. [Abstract] [Full Text] [PDF]

				W. J. Valentine, J. I. Fells, D. H. Perygin, S. Mujahid, K. Yokoyama, Y. Fujiwara, R. Tsukahara, J. R. Van Brocklyn, A. L. Parrill, and G. Tigyi Subtype-specific Residues Involved in Ligand Activation of the Endothelial Differentiation Gene Family Lysophosphatidic Acid Receptors J. Biol. Chem., May 2, 2008; 283(18): 12175 - 12187. [Abstract] [Full Text] [PDF]