![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 39, 27975-27980, September 24, 1999
From the Previously, we mapped the novel CC chemokine
myeloid progenitor inhibitory factor 2 (MPIF-2)/eotaxin-2 to chromosome
7q11.23 (Nomiyama, H., Osborne, L. R., Imai, T., Kusuda, J.,
Miura, R., Tsui, L.-C., and Yoshie, O. (1998) Genomics 49, 339-340). Since chemokine genes tend to be clustered, unknown
chemokines may be present in the vicinity of those mapped to new
chromosomal loci. Prompted by this hypothesis, we analyzed the genomic
region containing the gene for MPIF-2/eotaxin-2 (SCYA24)
and have identified a novel CC chemokine termed eotaxin-3. The genes
for MPIF-2/eotaxin-2 (SCYA24) and eotaxin-3
(SCYA26) are localized within a region of ~40 kilobases.
By Northern blot analysis, eotaxin-3 mRNA was constitutively
expressed in the heart and ovary. We have generated recombinant
eotaxin-3 in a baculovirus expression system. Eotaxin-3 induced
transient calcium mobilization specifically in CC chemokine receptor 3 (CCR3)-expressing L1.2 cells with an EC50 of 3 nM. Eotaxin-3 competed the binding of
125I-eotaxin to CCR3-expressing L1.2 cells with an
IC50 of 13 nM. Eotaxin-3 was chemotactic for
normal peripheral blood eosinophils and basophils at high
concentrations. Collectively, eotaxin-3 is yet another functional
ligand for CCR3. The potency of eotaxin-3 as a CCR3 ligand seems,
however, to be ~10-fold less than that of eotaxin. Identification of
eotaxin-3 will further promote our understanding of the control of
eosinophil trafficking and other CCR3-mediated biological phenomena.
The strategy used in this study may also be applicable to
identification of other unknown chemokine genes.
Chemokines are a group of structurally related, mostly basic,
heparin-binding cytokines that play important roles in inflammatory and
immunological processes by their capacity to recruit selective subsets
of leukocytes (1-4). Chemokines are divided into two major
subfamilies, CXC and CC, based on the arrangement of the first two of the four conserved cysteine residues; the two cysteines are separated by a single amino acid in CXC chemokines and
are adjacent in CC chemokines. Furthermore, lymphotactin/single C motif
1, which retains only the second and fourth of the four cysteine
residues conserved in other chemokines, and fractalkine/neurotactin, a
transmembrane molecule with an N-terminal chemokine domain with a
unique CX3C motif, represent the new C and
CX3C subfamilies (1-4). Classically,
CXC chemokines mainly attract neutrophils, and their
genes are clustered on chromosome 4q12-q21, whereas CC chemokines
mainly attract monocytes, and their genes are clustered on chromosome
17q11.2. It is now known, however, that CXC chemokines with
an ELR motif just prior to the first cysteine residue are potent
chemoattractants for neutrophils, and their genes are clustered on
chromosome 4q12-q21, whereas those without the ELR motif act mainly on lymphocytes, and their genes are localized to different chromosomal loci. Similarly, a number of novel CC chemokines, which are
highly specific for lymphocytes and dendritic cells, have their genes
mapped to loci different from the major CC chemokine gene cluster at
chromosome 17q11.2 (3). Furthermore, there are several miniclusters of
chemokine genes outside the major chemokine gene clusters (3). Thus,
unknown chemokine genes may be present in the vicinity of chemokine
genes mapped to new chromosomal loci.
Accumulation of eosinophils in the blood and affected tissues is a
classical sign of inflammatory responses to helminths and allergens.
Even though eosinophils are important effector cells against helminths,
they are also implicated in tissue damages in allergic diseases.
Because of the pathologic potential of eosinophils, identification of
specific factors that regulate their accumulation in tissues is
important. Using an experimental model of asthma in guinea pigs, Jose
et al. (5) have identified a CC chemokine (eotaxin) that is
a potent and selective chemoattractant for eosinophils. Subsequently,
we (6) and others (7, 8) have identified the human homologue of eotaxin
and its specific receptor, now termed
CCR3.1 CCR3 has been shown to
be expressed selectively on eosinophils at high levels and also on
basophils and some Th2-type T cells (9-11). Furthermore, besides
eotaxin, many other CC chemokines have been listed as functional
ligands for CCR3 (7-9). Recently, the novel CC chemokine myeloid
progenitor inhibitory factor 2 (MPIF-2)/eotaxin-2 was reported as a new
ligand for CCR3 (12, 13). We have mapped the gene for MPIF-2/eotaxin-2
(SCYA24) to human chromosome 7q11.23 (14). Human chromosome
7 is one of the main sequencing targets of the Genome Sequencing Center
at Washington University. From the sequencing-in-progress data of the
center, we have identified a sequence that contains the gene for
MPIF-2/eotaxin-2. In an attempt to identify a novel chemokine gene, we
carried out an exon search on this sequence with the DNA sequence
analysis tool GRAIL (15). We have identified a novel CC chemokine in
the vicinity of eotaxin-2 and have shown that this chemokine is another
functional ligand for CCR3.
Reagents--
MIP-1 Cells--
The panel of murine L1.2 pre-B cells stably
transfected with the known CC chemokine receptors and orphan receptors
was described previously (16). Peripheral blood eosinophils were
isolated as follows. Heparinized venous blood was obtained from healthy donors. After sedimentation with dextran, red blood cells were lysed by
hyposmotic treatment, and mononuclear cells were removed by
Ficoll-Paque sedimentation. Neutrophils were depleted by magnetic cell
sorting (Miltenyi Biotec, Bergisch, Germany) after labeling cells with
anti-CD16 microbeads. The purity of eosinophils thus obtained was
determined by standard cytological staining and was routinely >95%.
Basophils were semipurified from heparinized blood by Percoll density
gradient centrifugation as described previously (18). The purity of
basophils was routinely ~20%.
Human Genome Sequence Data Base Search--
The human genome
sequence data base of the Genome Sequencing Center at Washington
University was searched for the MPIF-2/eotaxin-2 nucleotide sequence
using BLAST Search. A sequence (H_RG356E01.seq) was found to contain
the genomic sequence of MPIF-2/eotaxin-2. Using the DNA sequence
analysis tool GRAIL (15), we identified the sequence of a novel
chemokine in this genomic sequence.
Isolation of Eotaxin-3 cDNA--
The full-length cDNA
sequence was obtained by the rapid amplification of cDNA ends
(RACE) method (19) using human lung Marathon-ReadyTM
cDNA (CLONTECH) as a template. Two-step
polymerase chain reaction (PCR) was carried out. The cDNA was first
amplified with the first gene-specific primer (5'-RACE primer,
CTTCAGAAAAGATTCCGCAGGCTCCCCAGAG; and 3'-RACE primer,
CATATCCAAGACCTGCTGCTTCCAATACAGCC) and AP1 primer
(CLONTECH), which is complementary to the adapter
ligated at both ends of the cDNA. PCR was performed in a 20-µl
reaction mixture containing 0.2 mM each dNTP, 4 pmol of
each primer, 0.625 units of AmpliTaq GoldTM (Perkin-Elmer),
and 1× buffer supplied with the polymerase. The amplification reaction
was carried out as follows: 94 °C for 5 min; then 40 cycles of
94 °C for 1 min, 68 °C for 2 min, and 72 °C for 1 min; and
finally, 72 °C for 5 min. Nested PCR was carried out using the
primary PCR products as templates. The cDNA was amplified with the
second gene-specific primer (5'-RACE primer, GCTCTAGACAATTGTTTCGGAGTTTTCAGTAAAGAA; and 3'-RACE primer,
TTCCCTGGACCTGGGTGCGAAGCTA) and the AP2 primer
(CLONTECH), which is complementary to the cDNA adapter ligated at both ends of the cDNA. PCR was performed in a
50-µl reaction mixture containing 0.2 mM each dNTP, 10 pmol of each primer, 1.25 units of AmpliTaq GoldTM, and 1×
buffer supplied with the polymerase. The amplification reaction was
carried out as follows: 94 °C for 5 min; then 30 cycles of 94 °C
for 1 min, 60 °C for 1 min, and 72 °C for 1 min; and finally,
72 °C for 5 min. The amplification products were cloned into the
pGEM-T Easy vector (Promega) by T-A ligation and sequenced on both strands.
Northern Blot Analysis--
This was carried out as described
previously (16). In brief, a multiple-tissue blot filter was purchased
from CLONTECH. The filter was hybridized with the
32P-labeled eotaxin-3 cDNA probe at 65 °C for 1 h in QuikHyb hybridization solution (Stratagene) containing denatured
salmon sperm DNA at 100 µg/ml. After washing at 65 °C for 30 min
in 0.1× SSC and 0.1% SDS, filters were exposed to x-ray films at
Production of Eotaxin-3 in a Baculovirus Expression
System--
Recombinant eotaxin-3 was prepared using the Bac-to-Bac
baculovirus expression system (Life Technologies, Inc.) following the
protocol recommended by the manufacturer. Briefly, the eotaxin-3 cDNA containing the entire coding region was excised with
BamHI and XhoI and subcloned into the
BamHI-XhoI sites of the pFastBac1 baculovirus
transfer vector downstream of the polyhedrin gene promoter. The
resulting recombinant plasmid, pFastBac-eotaxin-3, was transformed into
Escherichia coli DH10Bac containing a shuttle vector
"bacmid" with a mini-attTn7 target site and the helper plasmid. The
mini-Tn element on the pFastBac1 plasmid transposes to the mini-attTn7
target site on the bacmid in the presence of transposition protein
provided by the helper plasmid. Insertion of the mini-Tn7 element into
the mini-attTn7 target site disrupts the lacZ coding
sequence, making colonies containing recombinant bacmids white in the
presence of 5-bromo-4-chloro-3-indolyl
Calcium Mobilization Assay--
This was carried out as
described previously (16). In brief, cells were suspended at 3 × 106 cells/ml in buffer A (Hanks' balanced saline solution
supplemented with 1 mg/ml bovine serum albumin and 10 mM
HEPES (pH 7.4)) and incubated with 2 µM Fura-2/AM
(Molecular Probes, Inc., Eugene, OR) at 37 °C for 1 h in the
dark. Cells were washed twice with buffer A and resuspended at 2.5 × 106 cells/ml. To measure intracellular calcium, 2 ml of
the cell suspension was placed in a quartz cuvette. Emission
fluorescence at 510 nm was measured upon excitation at 340 and 380 nm
every 0.2 s on an LS 50B spectrofluorometer (Perkin-Elmer) to
obtain the ratio of fluorescence intensity
(R340/380 nm). To determine EC50, a
dose-response curve was generated.
Chemokine Binding to L1.2 Cells Expressing CCR3--
A
displacement-type binding assay was carried out as described previously
(20). In brief, 1 × 106 cells were incubated for
1 h at 15 °C with 125I-labeled eotaxin (specific
activity, 2000 Ci/mmol; Amersham Pharmacia Biotech) in the presence of
increasing concentrations of unlabeled competitors in 200 µl of 25 mM HEPES (pH 7.6), 1 mM CaCl2, 5 mM MgCl2, 120 mM NaCl, and 0.5%
bovine serum albumin. After incubation, cells were separated from
unbound radiolabeled ligands by centrifugation through a mixture of
dibutyl phthalate/olive oil (4:1). All assays were done in duplicate.
Migration Assay--
The chemotaxis assay was performed using a
48-well microchemotaxis chamber as described previously (20). In brief,
chemoattractants were diluted in RPMI 1640 medium supplemented with 1 mg/ml bovine serum albumin and placed in the lower wells (25 µl/well). Cells were suspended in RPMI 1640 medium, 20 mM
HEPES (pH 7.6), and 1% bovine serum albumin at 2 × 106 cells/ml and added to the upper wells (50 µl/well),
which were separated from the lower wells by a
polyvinylpyrrolidone-free polycarbonate filter with 5-µm pores. The
chamber was incubated for 1 h at 37 °C in 5% CO2
and 95% air. Filters were removed, and cells that migrated were
stained with Diff-Quik. Basophils that migrated were stained with
toluidine blue (18). Cells that migrated were counted in 5-10 randomly
selected high-power fields (×400) per well. All assays were done in triplicate.
Search for a Novel Chemokine Gene--
Previously, we mapped the
gene for the novel CC chemokine MPIF-2/eotaxin-2 (SCYA24) to
chromosome 7q11.23 (14). By analyzing the human genomic DNA sequence
data base of the Genome Sequencing Center at Washington University by
BLAST Search, we identified the genomic sequence derived from
chromosome 7 that contains the gene for MPIF-2/eotaxin-2
(H_RG356E01.seq). In an attempt to identify a novel chemokine
gene in the vicinity of the gene for MPIF-2/eotaxin-2, we carried out
an exon search on this genomic sequence using the DNA sequence analysis
tool GRAIL (15). Two exon sequences corresponding to the second and
third exons of a chemokine-like protein were found at a site ~40
kilobases apart from the gene for MPIF-2/eotaxin-2. The sequencing of
H_RG356E01.seq (107 kilobases) has now been completed and deposited in
the GenBankTM/EBI Data Bank with accession number AC005102.
The physical map of the region is shown in Fig.
1.
Cloning of a Novel CC Chemokine cDNA--
To determine the
full-length cDNA sequence of a putative novel chemokine, we
generated primers based on these genomic sequences and carried out 5'-
and 3'-RACE (19) using human lung Marathon-ReadyTM cDNA
as a template. As shown in Fig. 2, the
full-length cDNA of 467 base pairs was obtained. Comparison of the
cDNA sequence with the genomic sequence (GenBankTM/EBI
Data Bank accession number AC005102) defines the exon-intron junctions:
exon 1, positions 95,006-95,105; exon 2, positions 95,206-95,320; and
exon 3, positions 97,420-97,670. The cDNA contained a long open
reading frame starting from the first methionine codon and encoding a
highly basic polypeptide of 94 amino acids with a calculated molecular
mass of 10,635 Da. The 3'-noncoding region contains a typical AATAAA
polyadenylation signal, but no ATTTA motif for rapid mRNA
degradation, which is frequently found in the 3'-noncoding regions of
cytokines and chemokines (21). The deduced polypeptide sequence
contains a highly hydrophobic amino-terminal region characteristic of a
signal peptide with a predicted cleavage site between Ala-23 and
Thr-24. The predicted mature protein of 71 amino acids has a molecular
mass of 8,386 Da and an isoelectric point of 10.86. There is no
potential N-glycosylation site. The mature protein is a CC
chemokine with four cysteine residues in the proper arrangement. The
amino acid identities of the mature protein to other known human CC
chemokines are ranged from 45% with MIP-1 Expression of Eotaxin-3 mRNA in Human Tissues--
We examined
constitutive expression of eotaxin-3 mRNA in various human tissues
by Northern blot analysis. Eotaxin-3 transcripts of ~0.8 kilobases
were detected at low levels in the heart and ovary (Fig.
4). By reverse transcription-PCR,
however, its transcripts were detected ubiquitously in various tissues
(data not shown).
Production of Recombinant Eotaxin-3 Protein--
To obtain
recombinant eotaxin-3, insect cells were infected with a recombinant
baculovirus encoding eotaxin-3 under the control of the polyhedrin
promoter. Recombinant eotaxin-3 was purified from pooled culture
supernatants by cation-exchange chromatography and reverse-phase high
performance liquid chromatography. Eotaxin-3 was eluted from the
reverse-phase column as a single major peak at an acetonitrile
concentration of 30% (Fig.
5A) and migrated as a single
band of ~12 kDa on SDS-polyacrylamide gel (Fig. 5B). Amino
acid sequence analysis demonstrated that the amino terminus of mature
eotaxin-3 starts at Thr-24 as predicted.
Eotaxin-3 Induces Calcium Flux in CCR3-transfected Cells--
To
examine the interaction of eotaxin-3 with each cloned receptor, we
measured eotaxin-3-induced calcium mobilization in a panel of L1.2
cells stably expressing CCR1-7, CX3CR1, CXCR5,
XCR1, CCR9, GPR1, GPR15/BOB, GPR25, STRL33/BONZO, Mas, and
CMKR-L2 (16). As shown in Fig. 6,
eotaxin-3 induced calcium flux specifically in CCR3-expressing L1.2
cells. On the other hand, MIP-1 Cross-desensitization in CCR3-transfected Cells--
Using
CCR3-expressing L1.2 cells, we analyzed cross-desensitization between
eotaxin-3 and other known CCR3 ligands: eotaxin, eotaxin-2, MCP-4, and
RANTES. As shown in Fig. 8, eotaxin-3
desensitized the cells almost completely to eotaxin-3, eotaxin-2, and
RANTES and partially to eotaxin and MCP-4. Conversely, eotaxin and
MCP-4 almost completely desensitized the cells to eotaxin-3, whereas RANTES and eotaxin-2 only partially desensitized the cells to eotaxin-3. Thus, the rank order of potency for calcium mobilization in
CCR3-expressing L1.2 cells between eotaxin-3 and these other CCR3
ligands is as follows: eotaxin, MCP-4 > eotaxin-3 > eotaxin-2, RANTES.
Binding Studies--
To compare the binding affinity of eotaxin
and eotaxin-3 with that of CCR3, we carried out a displacement-type
binding experiment in which binding of 125I-eotaxin to
CCR3-expressing L1.2 cells was competed by unlabeled competitors. As
shown in Fig. 9, both eotaxin and
eotaxin-3 showed complete competition with IC50 values of
1.9 and 13 nM, respectively.
Chemotactic Activity--
We examined the chemotactic activity of
eotaxin-3 in comparison with eotaxin. As shown in Fig.
10, eotaxin induced chemotactic responses in eosinophils with a typical bell-shaped dose-response curve
and a maximum effect at 100 nM. On the other hand,
eotaxin-3 induced migration of eosinophils only at 1000 nM.
Similarly, eotaxin induced migration of basophils at 30-300
nM, whereas eotaxin-3 induced migration of basophils only
at 300 nM.
In the past few years, a number of novel chemokines, particularly
CC chemokines, have been discovered by searching the public and private
expressed sequence tag data bases. Some of the chemokines are of
particular interest because of their constitutive expression in
lymphoid tissues, their specific activities on lymphocytes and
dendritic cells, and their genes being mapped to chromosomal sites
different from the major chemokine gene clusters at chromosome 4 and 17 (3). Even though the expressed sequence tag data bases have been quite
useful for identification of many new chemokines, those that are
expressed in small amounts in tissues or by a restricted type of cells
may be rarely represented in expressed sequence tag data bases. Since
chemokine genes tend to be clustered, it may also be possible to
discover novel chemokines at chromosomal loci where some chemokines are
already mapped. Previously, we mapped the novel CC chemokine
MPIF-2/eotaxin-2 to chromosome 7q11.23 (14). In the present study, by
analyzing the genomic sequence containing MPIF-2/eotaxin-2
(H_RG356E01.seq/AC005102), we have indeed identified a novel human CC
chemokine termed eotaxin-3 (Fig. 2) in the vicinity of
MPIF-2/eotaxin-2. The genes for MPIF-2/eotaxin-2 (SCYA24)
and eotaxin-3 (SCYA26) are localized within a region of
~40 kilobases and thus represent a new cluster of chemokine genes at
chromosome 7q11.23 (Fig. 1). It is thus likely that MPIF-2/eotaxin-2 and eotaxin-3 were generated by gene duplication from a common ancestor. In a phylogenetic tree, they are indeed most closely related
to each other even though they also appear to have diversified a long
time ago (Fig. 3). Notably, the CC chemokines of the major chemokine
cluster at chromosome 17 appear to be mostly generated after
diversification of eotaxin-3 from a common ancestor (Fig. 3).
We have shown that eotaxin-3 is capable of inducing transient calcium
mobilization specifically in CCR3-expressing L1.2 cells (Fig. 6).
Eotaxin and eotaxin-3 induced transient calcium mobilization in
CCR3-expressing L1.2 cells with EC50 values of 0.4 and 3 nM, respectively (Fig. 7). Eotaxin-3 partially desensitized
CCR3-expressing L1.2 cells to eotaxin and MCP-4 and completely
desensitized these cells to eotaxin-2 and RANTES (Fig. 8). Eotaxin and
eotaxin-3 competed the binding of 125I-eotaxin to
CCR3-expressing L1.2 cells with IC50 values of 1.9 and 13 nM, respectively (Fig. 9). Collectively, eotaxin-3 is yet another functional ligand for CCR3. The potency of eotaxin-3 as a CCR3
ligand seems, however, to be ~10-fold less than that of eotaxin (Fig.
7). Consistently, eotaxin-3 was chemotactic for normal peripheral blood
eosinophils and basophils only at high concentrations (Fig. 10).
However, eotaxin-3 may have more relevant biological functions such as
myeloid progenitor inhibition shown for MPIF-2/eotaxin-2 (12).
Eotaxin-3 may also act on an unknown receptor different from CCR3 with
a higher potency.
Northern blot analysis has shown that eotaxin-3 mRNA is
constitutively expressed in the heart and ovary (Fig. 4). By reverse transcription-PCR, however, its mRNA is detected ubiquitously in
various tissues (data not shown). This may indicate that eotaxin-3 is
expressed ubiquitously at low levels by cells in various tissues or by
only a minor fraction of cells present in various tissues. Previously,
MPIF-2/eotaxin-2 mRNA could not be detected in any human tissues by
Northern blot analysis (12). The transcripts were detected only by
reverse transcription-PCR in monocytes treated with
granulocyte/macrophage colony-stimulating factor and in T cells
activated by anti-CD3 antibody in the presence of interleukin-2 (12).
It remains to be seen which types of cells produce eotaxin-3 and
whether production of eotaxin-3 is up-regulated by some external stimuli. It is also notable that, like eotaxin-3, eotaxin is
constitutively expressed in the heart, in addition to the small
intestine and colon (6). Eosinophils are known to migrate
physiologically into intestinal tissues, but do not usually exist in
heart tissues except for rare complications associated with high blood
eosinophilia (22). Thus, eotaxin and eotaxin-3 may have some other
physiological roles in the heart. By its low potency on CCR3, eotaxin-3
may even negatively regulate migration of eosinophils into the heart.
In conclusion, identification of eotaxin-3 will further promote our
understanding of eosinophil trafficking and other CCR3-mediated pathophysiological phenomena. Furthermore, it remains to be seen whether eotaxin-3 has functions other than that of a low potency ligand
for CCR3. The strategy of identification of eotaxin-3 used in this
study may also be applicable to identification of other unknown chemokines.
We are grateful to Drs. Yorio Hinuma,
Masakazu Hatanaka, and Retsu Miura for constant support and encouragement.
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence reported in this paper has been submitted
to the DDBJ/GenBankTM/EBI Data Bank with accession number
AB010447.
**
To whom correspondence should be addressed: Dept. of
Biochemistry, Kumamoto University Medical School, 2-2-1 Honjo, Kumamoto 860-0811, Japan. Fax: 81-96-373-5066; E-mail:
nomiyama@gpo.kumamoto-u.ac.jp.
The abbreviations used are:
CCR3, CC
chemokine receptor 3;
MPIF-2, myeloid progenitor inhibitory factor 2;
RACE, rapid amplification of cDNA ends;
PCR, polymerase chain
reaction;
MES, 4-morpholineethanesulfonic acid;
HPLC, high performance
liquid chromatography.
Molecular Cloning of a Novel Human CC Chemokine (Eotaxin-3) That
Is a Functional Ligand of CC Chemokine Receptor 3*
,
,
,
,
**, and
Shionogi Institute for Medical Science,
Department of Biochemistry,
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
(macrophage
inflammatory protein 1
), RANTES
(regulated on activation normal
T expressed and secreted), MCP-4
(monocyte chemoattractant protein
4), and eotaxin-2 were purchased from Peprotech (Rocky
Hill, NJ). Eotaxin, MCP-1, TARC (thymus and
activation-regulated chemokine),
LARC (liver and
activation-regulated chemokine),
SLC (secondary lymphoid tissue
chemokine), and fractalkine were prepared as described
previously (16, 17).
80 °C with an intensifying screen for 1 week.
-D-galactopyranoside. The resulting recombinant bacmid
was transfected into Sf9 cells using Cellfectin reagent (Life
Technologies, Inc.), and the recombinant virus was obtained. High
FiveTM cells (Invitrogen) were infected with the
recombinant virus at a multiplicity of infection of 10-20. The culture
supernatants collected 2 days after infection were cleared by
filtration through 0.22-µm membranes and were dialyzed against 50 mM MES (pH 6.5) and 0.1 M NaCl and applied to a
1-ml cation-exchange HiTrap S column (Amersham Pharmacia Biotech)
equilibrated with 50 mM MES (pH 6.5) and 0.1 M
NaCl. The column in the fast protein liquid chromatography system
(Amersham Pharmacia Biotech) was eluted with 45 ml of a liner gradient
of 0.1-1.0 M NaCl in 50 ml of MES at a rate of 1 ml/min.
The fractions containing recombinant eotaxin-3 were pooled and injected
into a reverse-phase high performance liquid chromatography column
(4.6 × 250 mm Cosmocil 5C4-AR-300, Cosmo Bio, Tokyo, Japan)
equilibrated with 0.05% trifluoroacetic acid. The column was eluted
with 60 ml of 0-60% acetonitrile in 0.05% trifluoroacetic acid at a
flow rate of 1 ml/min. Fractions containing recombinant eotaxin-3 were
pooled and lyophilized. Protein concentrations were determined with a
BCA kit (Pierce). The amino-terminal sequence analysis was done in a
protein sequencer (Shimazu, Tokyo).
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
View larger version (5K):
[in a new window]
Fig. 1.
Physical map of the region at human
chromosome 7q11.23 that contains the genes for MPIF-2/eotaxin-2 and
eotaxin-3. The map is depicted based on the bacteral artificial
chromosome nucleotide sequence deposited by the Genome Sequence Center
at Washington University (GenBankTM/EBI Data Bank accession
number AC005102). Arrows indicate the transcriptional
orientation. kb, kilobases.
to 22% with LARC. We
also constructed a phylogenetic tree using the mature amino acid
sequences of all the known human CC chemokines (Fig.
3). Even though the amino acid identity
of the novel chemokine (indicated as eotaxin-3) to MPIF-2/eotaxin-2 is
only 33%, it has the closest relationship with MPIF-2/eotaxin-2 and is
located just at the branching point between the CC chemokines clustered
on chromosome 17q11.2 and those mapped mostly to different chromosomal
loci. Because of its close evolutionary and genetic relationship to
MPIF-2/eotaxin-2 and its specific activity on CCR3 (see below), we
termed this novel chemokine eotaxin-3.

View larger version (50K):
[in a new window]
Fig. 2.
Full-length cDNA of eotaxin-3. The
nucleotide and deduced amino acid sequences are shown. The signal
sequence is underlined. The polyadenylation signal is
double-underlined.

View larger version (23K):
[in a new window]
Fig. 3.
Phylogenetic tree of the human CC
chemokines. Evolutionary distances are estimated using the program
phylp (23) based on the protein alignment data generated by the program
prrp (23). The chromosome where each chemokine gene is mapped is
indicated on the right.

View larger version (42K):
[in a new window]
Fig. 4.
Northern blot analysis of eotaxin-3 mRNA
expression in various human tissues. A filter blotted with 2 µg/lane of poly(A)+ RNA from the indicated human tissues
(CLONTECH) was hybridized with
32P-labeled eotaxin-3 cDNA. After washing, a film was
exposed to the filter at
80 °C with an intensifying screen for 1 week. PBL, peripheral blood leukocytes.

View larger version (40K):
[in a new window]
Fig. 5.
Purification of recombinant eotaxin-3
produced by a baculovirus expression system. A, the
elution profile of eotaxin-3 on reverse-phase HPLC; B,
SDS-polyacrylamide gel electrophoresis and silver staining of eotaxin-3
in successive purification steps. Fractions containing eotaxin-3 were
subjected to electrophoresis on a 15-25% gradient SDS-polyacrylamide
gel and visualized by silver staining. Lane 1, the crude
culture supernatant; lane 2, the pass-through fraction of
HiTrap SP; lane 3, eotaxin-3 eluted from HiTrap SP;
lane 4, eotaxin-3 eluted by reverse-phase HPLC.
, MCP-1, TARC, RANTES, LARC, and SLC
properly induced calcium flux in L1.2 cells expressing their respective
receptors even after treatment with eotaxin-3. As shown in Fig.
7, eotaxin and eotaxin-3 induced calcium
mobilization in CCR3-expressing L1.2 cells with EC50 values of ~0.4 and ~3 nM, respectively. These results
demonstrate that eotaxin-3 is a specific functional ligand for CCR3,
but has a potency about one-tenth of that of eotaxin.

View larger version (32K):
[in a new window]
Fig. 6.
Calcium mobilization in CCR3-expressing L1.2
cells by eotaxin-3. Murine L1.2 pre-B cells stably transfected
with CCR1, CCR2B, CCR3, CCR4, CCR5, CCR6, CCR7, and
CX3CR1/V28 were loaded with Fura-2/AM and
stimulated with eotaxin-3 at 100 nM and then by cognate
ligands at 10 nM as indicated. Intracellular calcium
concentration was monitored by the fluorescence ratio
(R340/380 nm). The experiments were done twice,
and representative results are shown.

View larger version (15K):
[in a new window]
Fig. 7.
Dose-response curves of calcium mobilization
in CCR3-expressing L1.2 cells. Murine L1.2 pre-B cells stably
transfected with CCR3 were loaded with Fura-2/AM and stimulated with
the indicated concentrations of eotaxin (
) or eotaxin-3 (
). The
means ± S.E. from three separate experiments are plotted as
percent maximum response to eotaxin.

View larger version (32K):
[in a new window]
Fig. 8.
Cross-desensitization of CCR3-transfected
L1.2 cells. Murine L1.2 pre-B cells stably expressing CCR3 were
stimulated with each chemokine at 100 nM as indicated. The
experiments were done twice, and representative results are
shown.

View larger version (15K):
[in a new window]
Fig. 9.
Binding of eotaxin-3 to CCR3. Murine
L1.2 pre-B cells stably transfected with CCR3 were incubated at
16 °C for 1 h with 125I-eotaxin at 0.1 nM together with various concentrations of unlabeled
eotaxin (
) or eotaxin-3 (
). After washing, bound radioactivities
were measured. The assay was done in duplicate. The experiments were
done twice, and representative results are shown.

View larger version (24K):
[in a new window]
Fig. 10.
Chemotactic responses of eosinophils and
basophils to eotaxin and eotaxin-3. The assays were done in
triplicate to obtain the means ± S.E. The experiments were done
twice, and representative results are shown. HPF, high power
field.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
ACKNOWLEDGEMENTS
![]()
FOOTNOTES

To whom correspondence should be addressed: Dept. of
Bacteriology, Kinki University School of Medicine, 377-2 Ohno-Higashi, Osaka-Sayama, Osaka 589-8511, Japan. Fax: 81-723-67-3606; E-mail: o.yoshie@med.kindai.ac.jp.
![]()
ABBREVIATIONS
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Baggiolini, M.,
Dewald, B.,
and Moser, B.
(1997)
Annu. Rev. Immunol.
15,
675-705[CrossRef][Medline]
[Order article via Infotrieve]
2.
Rollins, B.
(1997)
Blood
90,
909-928 3.
Yoshie, O.,
Imai, T.,
and Nomiyama, H.
(1997)
J. Leukocyte Biol.
62,
634-644[Abstract]
4.
Zlotnik, A.,
Morales, J.,
and Hedrick, J. A.
(1999)
Crit. Rev. Immunol.
19,
1-47[Medline]
[Order article via Infotrieve]
5.
Jose, P. J.,
Griffiths-Johnson, D. A.,
Collins, P. D.,
Walsh, D. T.,
Moqbel, R.,
Totty, N. F.,
Truong, O.,
Hsuan, J. J.,
and Williams, T. J.
(1994)
J. Exp. Med.
179,
881-886 6.
Kitaura, M.,
Nakajima, T.,
Imai, T.,
Harada, S.,
Combadiere, C.,
Tiffany, H. L.,
Murphy, P. M.,
and Yoshie, O.
(1996)
J. Biol. Chem.
271,
7725-7730 7.
Ponath, P. D.,
Qin, S.,
Post, T. W.,
Wang, J.,
Wu, L.,
Gerard, N. P.,
Newman, W.,
Gerard, C.,
and Mackay, C. R.
(1996)
J. Exp. Med.
183,
2437-2448 8.
Daugherty, B. L.,
Siciliano, S. J.,
DeMartino, J. A.,
Malkowitz, L.,
Sirotina, A.,
and Springer, M. S.
(1996)
J. Exp. Med.
183,
2349-2354 9.
Heath, H.,
Qin, S.,
Rao, P.,
Wu, L.,
LaRosa, G.,
Kassam, N.,
Ponath, P. D.,
and Mackay, C. R.
(1997)
J. Clin. Invest.
99,
178-184[Medline]
[Order article via Infotrieve]
10.
Uguccioni, M.,
Mackay, C. R.,
Ochensberger, B.,
Loetscher, P.,
Rhis, S.,
LaRosa, G. J.,
Rao, P.,
Ponath, P. D.,
Baggiolini, M.,
and Dahinden, C. A.
(1997)
J. Clin. Invest.
100,
1137-1143[Medline]
[Order article via Infotrieve]
11.
Sallusto, F.,
Mackay, C. R.,
and Lanzavecchia, A.
(1997)
Science
277,
2005-2007 12.
Patel, V. P.,
Kreider, P. L.,
Li, Y.,
Li, H.,
Keung, K.,
Salcedo, T.,
Nardelli, B.,
Pippalla, V.,
Gentz, S.,
Thotakura, R.,
Parmelee, D.,
Gentz, R.,
and Garotta, G.
(1997)
J. Exp. Med.
185,
1163-1172 13.
Forssmann, U.,
Uguccioni, M.,
Loetscher, P.,
Dahinden, C. A.,
Langen, H.,
Thelen, M.,
and Baggiolini, M.
(1997)
J. Exp. Med.
185,
2171-2176 14.
Nomiyama, H.,
Osborne, L. R.,
Imai, T.,
Kusuda, J.,
Miura, R.,
Tsui, L.-C.,
and Yoshie, O.
(1998)
Genomics
49,
339-340[CrossRef][Medline]
[Order article via Infotrieve]
15.
Uberbacher, E. C.,
and Mural, R. J.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
11261-11265 16.
Yoshida, R.,
Nagira, M.,
Kitaura, M.,
Imagawa, N.,
Imai, T.,
and Yoshie, O.
(1998)
J. Biol. Chem.
273,
7118-7122 17.
Imai, T.,
Hieshima, K.,
Haskell, C.,
Baba, M.,
Nagira, M.,
Nishimura, M.,
Kakizaki, M.,
Takagi, S.,
Nomiyama, H.,
Schall, T. J.,
and Yoshie, O.
(1997)
Cell
91,
521-530[CrossRef][Medline]
[Order article via Infotrieve]
18.
Yamada, H.,
Hirai, K.,
Miyamasu, M.,
Iikura, M.,
Misaki, Y.,
Shoji, S.,
Takaishi, T.,
Kasahara, T.,
Morita, Y.,
and Ito, K.
(1997)
Biochem. Biophys. Res. Commun.
231,
365-368[CrossRef][Medline]
[Order article via Infotrieve]
19.
Frohman, M. A.
(1993)
Methods Enzymol.
218,
340-356[Medline]
[Order article via Infotrieve]
20.
Imai, T.,
Yoshida, T.,
Baba, M.,
Nishimura, M.,
Kakizaki, M.,
and Yoshie, O.
(1996)
J. Biol. Chem.
271,
21514-21521 21.
Shaw, G.,
and Kamen, R.
(1986)
Cell
46,
659-667[CrossRef][Medline]
[Order article via Infotrieve]
22.
Fauci, A. S.,
Harley, J. B.,
Roberts, W. C.,
Ferrans, V. J.,
Gralnick, H. R.,
and Bjornson, B. H.
(1982)
Ann. Intern. Med.
97,
78-92
23.
Gotoh, O.
(1995)
Comput. Appl. Biosci.
11,
543-551
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
K. Polzer, T. Karonitsch, T. Neumann, G. Eger, C. Haberler, A. Soleiman, B. Hellmich, E. Csernok, J. Distler, B. Manger, et al. Eotaxin-3 is involved in Churg-Strauss syndrome - a serum marker closely correlating with disease activity Rheumatology, June 1, 2008; 47(6): 804 - 808. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Haley, M. E. Sunday, Y. Porrata, C. Kelley, A. Twomey, A. Shahsafaei, B. Galper, L. A. Sonna, and C. M. Lilly Ontogeny of the eotaxins in human lung Am J Physiol Lung Cell Mol Physiol, February 1, 2008; 294(2): L214 - L224. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. S. Whitehead, T. Wang, L. M. DeGraff, J. W. Card, S. A. Lira, G. J. Graham, and D. N. Cook The Chemokine Receptor D6 Has Opposing Effects on Allergic Inflammation and Airway Reactivity Am. J. Respir. Crit. Care Med., February 1, 2007; 175(3): 243 - 249. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tsuji, S. Yamamoto, W. Ou, N. Nishi, I. Kobayashi, M. Zaitsu, E. Muro, Y. Sadakane, T. Ichimaru, and Y. Hamasaki dsRNA enhances eotaxin-3 production through interleukin-4 receptor upregulation in airway epithelial cells Eur. Respir. J., November 1, 2005; 26(5): 795 - 803. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Chou, B. L. Daugherty, E. K. McKenna, W. M. Hsu, N. K. Tyler, C. G. Plopper, D. M. Hyde, E. S. Schelegle, L. J. Gershwin, and L. A. Miller Chronic Aeroallergen during Infancy Enhances Eotaxin-3 Expression in Airway Epithelium and Nerves Am. J. Respir. Cell Mol. Biol., July 1, 2005; 33(1): 1 - 8. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Yamamoto, I. Kobayashi, K. Tsuji, N. Nishi, E. Muro, M. Miyazaki, M. Zaitsu, S. Inada, T. Ichimaru, and Y. Hamasaki Upregulation of Interleukin-4 Receptor by Interferon-{gamma}: Enhanced Interleukin-4-Induced Eotaxin-3 Production in Airway Epithelium Am. J. Respir. Cell Mol. Biol., October 1, 2004; 31(4): 456 - 462. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Petkovic, C. Moghini, S. Paoletti, M. Uguccioni, and B. Gerber Eotaxin-3/CCL26 Is a Natural Antagonist for CC Chemokine Receptors 1 and 5: A HUMAN CHEMOKINE WITH A REGULATORY ROLE J. Biol. Chem., May 28, 2004; 279(22): 23357 - 23363. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. J. Erpenbeck, A. Hagenberg, Y. Dulkys, J. Elsner, R. Balder, H. Krentel, M. Discher, A. Braun, N. Krug, and J. M. Hohlfeld Natural Porcine Surfactant Augments Airway Inflammation after Allergen Challenge in Patients with Asthma Am. J. Respir. Crit. Care Med., March 1, 2004; 169(5): 578 - 586. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Ogilvie, S. Paoletti, I. Clark-Lewis, and M. Uguccioni Eotaxin-3 is a natural antagonist for CCR2 and exerts a repulsive effect on human monocytes Blood, August 1, 2003; 102(3): 789 - 794. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Phillips, V. E. L. Stubbs, M. R. Henson, T. J. Williams, J. E. Pease, and I. Sabroe Variations in Eosinophil Chemokine Responses: An Investigation of CCR1 and CCR3 Function, Expression in Atopy, and Identification of a Functional CCR1 Promoter J. Immunol., June 15, 2003; 170(12): 6190 - 6201. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. D. Shin, L. H. Kim, B. L. Park, J. H. Jung, J. Y. Kim, I.-Y. Chung, J. S. Kim, J. H. Lee, S. H. Chung, Y. H. Kim, et al. Association of Eotaxin gene family with asthma and serum total IgE Hum. Mol. Genet., June 1, 2003; 12(11): 1279 - 1285. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Shinkai, M. Komuta-Kunitomo, N. Sato-Nakamura, and H. Anazawa N-terminal domain of eotaxin-3 is important for activation of CC chemokine receptor 3 Protein Eng. Des. Sel., November 1, 2002; 15(11): 923 - 929. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.P. Badewa, C.E. Hudson, and A.S. Heiman Regulatory Effects of Eotaxin, Eotaxin-2, and Eotaxin-3 on Eosinophil Degranulation and Superoxide Anion Generation Experimental Biology and Medicine, September 1, 2002; 227(8): 645 - 651. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. E. L. Stubbs, P. Schratl, A. Hartnell, T. J. Williams, B. A. Peskar, A. Heinemann, and I. Sabroe Indomethacin Causes Prostaglandin D2-like and Eotaxin-like Selective Responses in Eosinophils and Basophils J. Biol. Chem., July 12, 2002; 277(29): 26012 - 26020. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Borchers, T. Ansay, R. DeSalle, B. L. Daugherty, H. Shen, M. Metzger, N. A. Lee, and J. J. Lee In vitro assessment of chemokine receptor-ligand interactions mediating mouse eosinophil migration J. Leukoc. Biol., June 1, 2002; 71(6): 1033 - 1041. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Watanabe, P. J. Jose, and S. M. Rankin Eotaxin-2 Generation Is Differentially Regulated by Lipopolysaccharide and IL-4 in Monocytes and Macrophages J. Immunol., February 15, 2002; 168(4): 1911 - 1918. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Cuvelier and K. D. Patel Shear-dependent Eosinophil Transmigration on Interleukin 4-stimulated Endothelial Cells: A Role for Endothelium-associated Eotaxin-3 J. Exp. Med., December 10, 2001; 194(12): 1699 - 1709. [Abstract] [Full Text] [PDF] |