![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 4, 1875-1878, January 22, 1999
From Tularik, Inc., South San Francisco, California 94080
| |
ABSTRACT |
|---|
|
|
|---|
The specificity of the various STAT SH2 domains
for different tyrosine-containing peptides enables cytokines to
activate different signaling pathways and to induce distinct patterns
of gene expression. We show that STAT4 has a unique peptide specificity
and binds to the peptide sequence pYLPSNID (where pY represents
phosphotyrosine). This motif is found at tyrosine residue 800 in the
IL-121 is a
heterodimeric cytokine secreted from antigen presenting cells in
response to bacteria and intracellular parasites and thus plays an
important role in host defense against bacterial pathogens (1). IL-12
promotes the proliferation of T cells and NK cells and is required for
the differentiation of T cells into the Th1 subset of T helper cells.
Th1 cells are critical for cell-mediated immune responses, because they
secrete IFN- IL-12 signals through the IL-12 receptor, which is composed of at least
two subunits designated Cytokine binding to its receptor leads to activation of JAK kinases
that phosphorylate the receptor on tyrosines located in the
intracellular domain. The phosphorylated regions are binding sites for
signal transduction molecules called STATs that are rapidly recruited
to the receptor and tyrosine phosphorylated by JAK kinases. Tyrosine
phosphorylation of STAT proteins induces their dimerization and
translocation to the nucleus where they bind to specific DNA sequences
and regulate transcription. IL-12 stimulation results in TYK2 and JAK2
phosphorylation and interaction of TYK2 with the In response to IL-12, STAT4 has been shown to be tyrosine
phosphorylated and activated in Th1 lymphocytes and NK cells (9, 13).
In addition, it has been reported that STAT1, STAT3, and STAT5 can be
activated in response to IL-12 (13-15).
STAT proteins, by way of their SH2 domains, interact with specific
phosphotyrosine residues on cytokine receptors (16). Although the
phosphotyrosine binding sites of all the other known STAT proteins have
been identified, the tyrosine docking site of STAT4 has not previously
been reported. The We determined that STAT4 is activated through interaction with the
tyrosine at amino acid 800 in the IL-12 receptor Constructs and Transfections--
pRK5-STAT4, a CMV promotor
vector, was used for STAT4 expression. A partial clone of IL-12R
Transfections were performed in 293 cells using the calcium phosphate
method (17). 10 µg of each construct (IL-12R EMSA--
Nuclear extracts were prepared from 293 cells 60 h following transfection by the method of Dignam et al.
s(18). EMSAs were performed by using 5 µl of nuclear extract, 5 µl
of binding buffer (100 mM KCl, 25 mM HEPES (pH
7.9), 0.1 mM EDTA, 5 mM MgCl2, 200 µg/ml bovine serum albumin, 10% glycerol), and 1 µg of poly(dI-dC) in a final volume of 15 µl. Reactions were incubated at room
temperature for 5 min before 1 µl of probe was added for 15 min at
room temperature. Oligonucleotides containing two high affinity
STAT consensus binding sites,
(5'-TAAAATTTTCCGGGAATTTTTTGAGTTTCCCGGAAAATTTTG-3' and its complement) were annealed and kinased to generate labeled DNA for the EMSA.
Immunoblot Analysis--
Transfected cells were lysed in TNT
buffer (200 mM NaCl, 20 mM Tris (pH 7.5), 1%
Triton X-100, 1 mM vanadate, 1 mM
Fluorescence Polarization--
Tyrosine phosphorylated forms of
IL-12R Transactivation Reporter Assay--
COS cells were plated at
2 × 105/well (35 mm) on 6-well plates. Cells were
transfected the next day using Profection Mammalian Transfection System
calcium phosphate method (Promega) with 1 µg/well of STAT4 expression
plasmid, 1.5 µg/well of each IL-12R subunit expression plasmid, and 1 µg/well of IRF-1 luciferase reporter plasmid. The IRF-1 reporter
contains two copies of the STAT4 Protein Has the Highest Affinity for pYLPSNID Sequence in
IL-12 Receptor--
It seemed likely that STAT4 phosphorylation in
response to IL-12 is dependent on interaction with one of the three
tyrosines in the cytoplasmic domain of the IL-12R The Tyrosine at Amino Acid 800 in the IL-12 Receptor Is Required
for STAT4 Activation--
We reconstituted IL-12 receptor signaling in
293 cells to determine whether the
IL-12R
IL-12-dependent transcriptional activation through STAT4
was also tested by co-transfecting the IL-12 receptor subunits, STAT4, and an IRF-1 luciferase reporter gene into cells and measuring luciferase assay following treatment with IL-12. STAT1 can induce the
IRF-1 gene (22), and STAT4 has the same DNA binding specificity as
STAT1 (23). Therefore, given that IL-12 stimulation has also been shown
to induce IRF-1 gene expression in human peripheral blood
lymphocytes,2 we used the
IRF-1 STAT binding site for our reporter assays. We determined that in
the transient transfection assays STAT4 transcriptional activation of
the IRF-1 gene was dependent on IL-12 and was induced 4-fold in IL-12
treated transfected cells (Fig.
2A). The IL-12 receptor
mutants IL-12R IL-12 stimulation results in activation of STAT4 through
interaction with the IL-12 receptor (13, 24). In response to IL-12
stimulation, STAT4 is tyrosine phosphorylated and is competent for DNA
binding and transcriptional activation of target genes. STAT4 function
is necessary for mediating the IL-12 response and is crucial for Th1
development and efficient IFN- Receptor binding by STAT proteins has been shown to be specific and
dictated by the SH2 domain of the STAT proteins (reviewed in Refs. 16,
27, and 28). STAT interaction with cytokine receptors depends on the
phosphotyrosine residue in the receptor and the amino acid residues
C-terminal to the phosphotyrosine that mediate specificity. In this
paper, we demonstrate that STAT4 is activated by interacting with the
IL-12 receptor and that the interaction of the STAT4 SH2 domain is
specific for the peptide sequence pYLPSNID, the peptide at tyrosine 800 in the IL-12R STAT1 and STAT3 are activated by a number of cytokines (28, 29).
Additionally, it has been reported that STAT1 and STAT3 are activated
in response to IL-12. Jacobson et al. (13) reported that
IL-12 induced weak tyrosine phosphorylation of STAT3 and DNA binding
activity of STAT3 in addition to STAT4. They showed that STAT3 was part
of a IL-12-induced DNA complex that included STAT4, suggesting that
STAT3 and STAT4 form heterodimers. Yu et al. (14)
demonstrated DNA-protein complexes containing STAT4, STAT1 For certain SH2-containing proteins, the +1 and +3 positions in
phosphotyrosine peptides have been shown to confer binding specificity
(30). All the known docking sites for STAT3, for instance, have a
glutamine residue at the +3 position relative to tyrosine. None of the
three tyrosine peptides in the IL-12 The specificity of the various STAT protein SH2 domains for different
tyrosine-containing peptides results in activation of specific cytokine
signaling pathways and the induction of distinct gene expression
patterns. We conclude that STAT4 has a unique peptide binding
specificity among the STAT family and binds to the peptide sequence
pYLPSNID. The unique specificity of STAT4 for its tyrosine-containing
peptide sequence helps explain the distinct effects of IL-12 signaling.
STAT binding peptides derived from cytokine receptors have the ability
to disrupt STAT dimers and inhibit STAT tyrosine phosphorylation in vivo (19, 31, 33). It may be possible to develop
therapeutically useful compounds that, analogous to the
receptor-derived peptides, will block the STAT-receptor interaction,
thus preventing STAT activation and subsequent signaling.
The ability to reconstitute IL-12 signaling by transfecting the
2 subunit of the interleukin-12 receptor and is required for
DNA binding and transcriptional activity of STAT4. Our data demonstrate
that transfection of interleukin-12 receptor
1 and
2 subunits is sufficient for STAT4 activation but not for STAT1 or STAT3 activation.
![]()
INTRODUCTION
Top
Abstract
Introduction
References
, which enhances the activity of cytotoxic T cells and
NK cells (1-3). In addition to these essential functions,
Th1-dominated responses are associated with pathologic autoimmune and
inflammatory conditions such as rheumatoid arthritis and inflammatory
bowel disease (4). Given this potential for immunopathology, it is important to understand the mechanisms that control the Th1 response to
develop possible therapeutic interventions.
1 and
2 (5, 6). Both IL-12 receptor
subunits are members of the hemapoietin receptor superfamily and have
strong homology to the gp130 receptor (5). The
1 receptor, although
a low affinity binder of IL-12, is not capable of transducing an
IL-12-mediated signal (6). A second subunit of the IL-12 receptor was
subsequently identified that when coexpressed with the
1 subunit
forms a high affinity receptor for IL-12 and confers IL-12 signaling
(6). IL-12R
2 expression is differentially regulated in Th1
versus Th2 cells (7). Th1 cells but not Th2 cells express
the
2 subunit of the IL-12 receptor (8). Following T cell
activation, IL-12 and IFN-
treatment induces
2 expression,
whereas IL-4, a cytokine produced by Th2 cells, inhibits
2
expression resulting in loss of IL-12 signaling (7, 8). Therefore,
expression of the
2 subunit of the IL-12 receptor is a crucial
determinant of Th1 versus Th2 development.
1 subunit of the
IL-12 receptor and interaction of JAK2 with the
2 subunit (9, 10).
Unlike STAT4, whose expression is limited to lymphoid and spermatogonia
cells, JAK2 and TYK2 are ubiquitously expressed (11, 12).
2 subunit of the IL-12 receptor contains three
tyrosines in its cytoplasmic domain, whereas the
1 subunit contains
no tyrosine residues in its cytoplasmic domain (5, 6). Therefore, given
the importance of tyrosine phosphorylation in cytokine signaling
pathways, we focused on the three tyrosines of the
2 subunit as
possible docking sites for the STAT4 signaling protein in response to
IL-12.
2 subunit. STAT4
activation depends on interaction with the peptide sequence pYLPSNID
(where pY represents phosphotyrosine), thus providing evidence for the
specificity of the STAT4 SH2 domain for a unique binding site in the
IL-12 receptor. In addition, we show that neither STAT1 nor STAT3 is
activated directly through the IL-12 receptor.
![]()
EXPERIMENTAL PROCEDURES
1
cDNA was isolated from a peripheral blood lymphocyte library and
cloned into NaeI and ApaI sites of pcDNA3
(Invitrogen). The N terminus of IL-12R
1 was generated using
polymerase chain reaction and cloned into BamHI and
NaeI sites. An IL-12R
2 cDNA was isolated from a
peripheral blood lymphocyte library and cloned into the ApaI
and NotI sites of pcDNA3. A deletion in this clone was
discovered in the 3' end; therefore, the C terminus was generated by
polymerase chain reaction and cloned into the SalI and
ApaI sites of pcDNA3. Mutations changing the tyrosine to
phenylalanine at amino acid 678, 767, or 800 in IL-12R
2 were
generated using QuikChange Site-Directed Mutagenesis (Stratagene). The
mutagenesis primers used to generate the mutations were: for
2 Y800F, 5'-CCCACCCATGATGGCTTCTTACCCTCC-3'
and 3'-GGGTGGGTACTACCGAAGAATGGGAGG-5'; for
2
Y767F,
5'-GGTGGATCTGTTTAAAGTGCTGGAGAGCAGGG-3' and
3'-CCACCTAGACAAATTTCACGACCTCTCGTCCC-5';
and for
2 Y678F,
5'-GCGCTAAGAAATTTCCCATTGCAGAGG-3' and
3'-CGCGATTCTTTAAAGGGTAACGTCTCC-5'. Mutations changing the tyrosine to phenylalanine are shown
in bold and underlined. Silent mutations that create a restriction site
and that were created to aid in screening for mutations are underlined.
Mutations were verified by sequencing, and then ApaI and
SalI fragments containing the mutants were cloned into the parental IL-12R
2 construct in pBluescript-SK. The entire IL-12R
2 sequence containing the mutation was then cloned into the
EcoRI and XbaI sites of pRK5-FLAG to FLAG tag the
2 subunit at the C-terminal end.
1, IL-12R
2,
STAT4, STAT3, and STAT1) were transfected for immunoblot analysis and EMSAs.
-glycerophosphate, 5 mM NaF, and a complete protease
inhibitor tablet (Boehringer Mannheim)). Extracts were
immunoprecipitated with anti-M2 Flag antibody (Kodak, Sigma) and 25 µl of protein G beads. Proteins were resolved on 12%
SDS-polyacrylamide gels (Fisher) and transferred to Immobilon-P
membrane (Millipore). Membranes were blocked with 5% milk,
Tris-buffered saline, 0.06% Tween 20 and incubated with anti-M2 Flag
antibody (10 µg/ml) and horseradish peroxidase-conjugated goat
anti-mouse IgG (1:5000, Amersham Pharmacia Biotech). ECL (Amersham
Pharmacia Biotech) was used for detection.
2 peptides Tyr800 (SHEGpYLPSNID),
Tyr767 (LVDLpYKVLESR), and Tyr678
(CAKKpYPIAEEK) were synthesized as described previously (19). Peptides
were purified as described in Schindler et. al. (20). Fluorescence polarization was measured in an FPM-1 analyzer (Jolly Consulting and Research) as described (20). The sequence of the
fluorescent peptide was SFDpYDMPHVL. The binding affinity of STAT4 for
the fluorescent peptide is similar to its affinity for
Tyr800 peptide. A fluorescent peptide concentration of 10 nM and a STAT4 concentration of 190 nM were
used for STAT4-receptor peptide binding in assay buffer (50 mM NaCl, 10 mM HEPES (pH 7.6), 1 mM
EDTA, 0.1% Nonidet P-40, and 2 mM dithithreitol).
Full-length STAT4 was expressed with a C-terminal histidine tag in a
baculovirus expression system. The protein was purified to
approximately 95% homogeneity by nickel affinity chomatography (Qiagen).
-activated sequence
(AGCCTGATTTCCCCGAAATGACGGCACG) upstream of herpes simplex virus
thymidine kinase (
50 to +10) in pGL2 luciferase (Promega). 0.25 µg/well of CMV
-galactosidase plasmid was transfected as a
control. After 24 h, cells were treated with IL-12 at 5 ng/ml for
4-5 h and harvested for luciferase and
-galactosidase assays. Luciferase activity was measured using the Promega Luciferase Assay
system, and
-galactosidase activity was measured using Galacto-light
chemiluminescent reporter assay (Tropix Inc.). Luciferase activity was
normalized to
-galactosidase activity, and the average was taken of
three experiments.
![]()
RESULTS
2 subunit, because
the
1 subunit cytoplasmic domain contains no tyrosines. We tested the specificity of the STAT4 SH2 domain for phosphopeptides
corresponding to tyrosine-containing regions of the IL-12R
2 subunit
by fluorescence polarization competition binding assays. The sequence
of the fluorescent peptide was SFDpYDMPHVL. This is a mutated version
of the STAT1 binding site derived from the IFN-
receptor. STAT4
binds to the mutant peptide approximately 8-fold better than it does to
the wild-type sequence, SFpYDKPHVL. The peptide containing tyrosine 800 with the sequence pYLPSNID had an IC50 of 2.9 µM, whereas the other peptides pYKVLESR
(Tyr678) and pYPIAEEK (Tyr767) had
IC50 values of greater than 100 µM,
equivalent to nonspecific background binding (Fig.
1A). These results indicate
that STAT4 has the highest affinity for the peptide sequence that
contains tyrosine 800 in the IL-12R
2 subunit, suggesting that this
is the in vivo docking site for STAT4.

View larger version (45K):
[in a new window]
Fig. 1.
A, fluorescence polarization was used to
measure binding selectivity (µM) of STAT4 to unlabeled
peptides corresponding to regions containing the tyrosine at position
678, 767, or 800 in the IL-12R
2 subunit in competition with a
fluorescently labeled STAT4 high affinity binding peptide, SFDpYMPHVL.
An IC50 of greater than 100 µM is equivalent
to nonspecific binding. B, 293 cells were transfected with
constructs expressing the IL-12R
1 subunit (lanes 2-9),
the IL-12R
2 subunit (lanes 2, 3, and
7), and STAT4 (lanes 2-11) and after 72 h
were treated with no cytokine (lanes 1 and 2),
IL-12 (lanes 3-9), or IFN-
(lanes 10 and
11) at 10 ng/ml for 4 h. Nuclear extracts were prepared
and analyzed for STAT4 binding activity by EMSA using a high affinity
double STAT consensus site as probe. Specificity of probe interaction
was shown by adding anti-STAT4 antibody (Ab) to nuclear
extract and probe mix (lanes 7-9 and 11), which
specifically blocked the interaction of STAT4 protein with the probe.
The arrow indicates the protein-DNA complex.
1 and
2 subunits of the IL-12
receptor are sufficient for STAT4 activation in response to IL-12. Both
subunits of the IL-12 receptor and STAT4 were transfected into 293 cells, and STAT4 activation was tested by EMSA using nuclear extracts isolated from the transfected cells after addition of IL-12. IFN-
stimulation has also been shown to activate STAT4 (21) and was used as
a control for activation of STAT4 in these experiments. STAT4 was
activated to bind DNA following IL-12 addition (Fig. 1B,
lane 3) and IFN-
addition (Fig. 1B, lane
10) but was not activated in the absence of IL-12 addition (Fig.
1B, lane 2). The
1 and
2 subunits of the
IL-12 receptor were sufficient for activation of STAT4 by IL-12 in 293 cells. Both of the IL-12 receptor subunits were required for activation
of STAT4 because neither one alone resulted in STAT4 DNA binding (data
not shown).
2 subunit mutants that each contain one of the tyrosines in
the cytoplasmic domain changed to phenylalanine were then analyzed for
their ability to recruit STAT4. IL-12
2 receptor mutants at both
tyrosine 678 and tyrosine 767 were capable of activating STAT4, whereas
the mutant at tyrosine 800 was not able to activate STAT4 (Fig.
1B, lanes 4-6). When anti-STAT4 antiserum was
added to the binding reactions, the STAT4 DNA binding complex was
removed, indicating that STAT4 protein was responsible for binding to
the probe (Fig. 1B, lanes 7-9 and
11). This evidence, along with the in vitro
peptide binding data, indicates that the STAT4 SH2 domain binds to a
specific phosphorylated tyrosine in the IL-12R
2 subunit that
contains the sequence pYLPSNID.
2-Y678F and
2-Y767F were also able to induce
transcriptional activation of the IRF-1 gene to levels equivalent to
wild-type IL-12
2 receptor (Fig. 2A). However,
STAT4-mediated transcriptional activation with the
2-Y800F mutant of
IL-12R
2 was not detected. Expression of each of the mutant
2
subunits was confirmed by Western blot (Fig. 2B). Protein levels of the IL-12R
1 subunit and STAT4 were also shown to be equivalent in each transfection (data not shown). We conclude that the
tyrosine at amino acid 800 in IL-12R
2 is necessary for efficient
activation of STAT4 for both DNA binding and transcriptional activation.

View larger version (23K):
[in a new window]
Fig. 2.
A, transcriptional activation of STAT4
via the IL-12R and the IL-12R
2 mutants was measured by transfecting
293 cells in duplicate with indicated IL-12R constructs, STAT4, IRF-1
luciferase, and CMV
-galactosidase. After 24 h, indicated
transfected cells were treated with IL-12 at 10 ng/ml for 4 h and
assayed for luciferase assay. Relative luciferase activity was
determined by normalizing for
-galactosidase activity and taking the
average of three experiments. B, immunoblot analysis was
used to analyze expression of IL-12R
2 in 293 cells following
transfection with wild-type IL-12R
2 (wt),
2-Y678F,
2-Y767F, or
2-Y800F. The sample in lane 1 was prepared
from cells transfected with the empty expression vector.
1 and
2 Are Not Sufficient for STAT1 or STAT3
Activation--
It has previously been reported that IL-12 is able to
induce tyrosine phosphorylation and DNA binding of STAT3 and STAT1 in addition to STAT4 (13, 14). We tested the ability of IL-12 to activate
STAT1 and STAT3 through the IL-12 receptor in our 293 transfection
system. Following transfection of 293 cells with the IL-12 receptor
subunits and STAT4, STAT1, or STAT3, nuclear extracts were prepared and
analyzed for DNA binding activity by EMSA using the STAT consensus
probe. Although we detected STAT4 DNA binding following activation with
IL-12, we were unable to detect DNA binding by STAT1 or STAT3 (Fig.
3), even though their expression levels
were equivalent to STAT4 expression (data not shown). STAT1 was capable
of being activated for DNA binding by IFN-
as seen in lane
7 of Fig. 3. Our results indicate that in this system, STAT1 and
STAT3, unlike STAT4, cannot be activated by IL-12 through the IL-12
receptor. In addition, we also tested the ability of STAT1 or STAT3 to
be activated when STAT4 is co-transfected into 293 cells. When extracts
from IL-12 stimulated 293 cells co-transfected with the IL-12R subunits
and STAT4 plus STAT1 or STAT4 plus STAT3 were analyzed by EMSA,
supershift, and co-immunoprecipitation experiments, only STAT4
homodimer complexes were detected (data not shown). These data suggest
that neither STAT1 nor STAT3 is activated by IL-12 through an
interaction with STAT4.

View larger version (40K):
[in a new window]
Fig. 3.
The DNA binding of STAT1 and STAT3 was
analyzed following transfection of 293 cells with constructs expressing
the IL-12R
1 subunit, the IL-12R
2 subunit, STAT4 (lanes 2 and
3), STAT1 (lanes 5 and
6), and STAT3 (lanes 8 and
9) and after 72 h were treated with no cytokine
(lanes 2, 5, and 8)
or IL-12 (lanes 3, 6, and
9). As a positive control, 293 cells were
transfected with STAT4 alone and treated with IFN-
at 10 ng/ml for
5 h (lane 4) or transfected with STAT1 alone and
treated with IFN-
at 10 ng/ml for 5 h (lane 7).
Lane 1 is the mock-transfected control. Nuclear extracts
were prepared and analyzed for STAT binding activity by EMSA using a
high affinity double STAT consensus site as probe. The
arrows indicate the protein-DNA complexes. STAT4 binds as a
tetramer (upper arrow), and STAT1 binds as both a tetramer
and a dimer (lower arrow).
![]()
DISCUSSION
production as shown by STAT4
knock-out studies (25, 26).
2 subunit. This tyrosine at amino acid 800 in the
IL-12R
2 subunit is required for STAT4 DNA binding activity and
transcriptional activation of the IRF-1 gene. STAT4 is not capable of
binding the other peptide sequences at tyrosine residues 678 or 767 of the IL-12
2 subunit, and these peptide sequences are not required for the activation of STAT4. The IL-12R peptide sequence pYLPSNID appears to be a specific protein binding site for STAT4. Other STATs,
including STAT1, which has a closely related SH2 domain, cannot
recognize the IL-12R pYLPSNID
peptide.3
, and
STAT3 following treatment of NK cells with IL-12. These reports,
however, did not address the issue of whether STAT1, STAT3, or STAT4
directly interacts with the IL-12 receptor. Interestingly, in our
experiments, neither STAT1 nor STAT3 was activated by IL-12 through the
transfected IL-12 receptor subunits under conditions in which STAT4 was
phosphorylated. Perhaps STAT1 and STAT3 could be recruited to the IL-12
receptor through another factor that functions as an adaptor protein
and is not present in 293 cells.
2 receptor contain a glutamine
in the +3 position, nor do they share amino acid sequence similarities
to the STAT1 docking site in the IFN-
receptor, pYDKPH (31, 32).
This is consistent with our results that STAT1 and STAT3 are not
activated directly by contact with the IL-12 receptor.
1
and
2 subunits of the IL-12 receptor will facilitate the analysis of
IL-12 receptor structure and function. In addition to activation of the
JAKs resulting in STAT tyrosine phosphorylation, IL-12 also stimulates
STAT4 serine phosphorylation possibly by mitogen-activated protein
kinase or Lck (21, 34, 35). It will be interesting to determine which
regions of the receptor are required for triggering these signaling pathways.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Keith Williamson and Joanna Waszczuck for DNA sequencing, Mike Brasseur for peptide synthesis, and Holly Turner for performing the fluorescence polarization assays. We thank Uli Schindler, Robert Daly, Todd Dubnicoff, and Lin Wu for helpful comments and suggestions on the manuscript.
| |
FOOTNOTES |
|---|
* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed: Tularik, Inc., 2 Corporate Dr., South San Francisco, CA 94080. Tel.: 650-829-4442; Fax:
650-829-4400; E-mail: hoey{at}tularik.com.
The abbreviations used are: IL, interleukin; IFN, interferon; IL-12R, IL-12 receptor; CMV, cytomegalovirus; EMSA, electrophoretic mobility shift assay.
2 T. Hoey, unpublished results.
3 J. McKinney, unpublished results.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
C. Tortorella, I. Stella, G. Piazzolla, V. Cappiello, O. Simone, A. Pisconti, and S. Antonaci Impaired Interleukin-12-Dependent T-Cell Functions During Aging: Role of Signal Transducer and Activator of Transcription 4 (STAT4) and Suppressor of Cytokine Signaling 3 (SOCS3). J. Gerontol. A Biol. Sci. Med. Sci., February 1, 2006; 61(2): 125 - 135. [Abstract] [Full Text] [PDF] |
||||
![]() |
H Ohyama, K Ogata, K Takeuchi, M Namisato, Y Fukutomi, F Nishimura, H Naruishi, T Ohira, K Hashimoto, T Liu, et al. Polymorphism of the 5' flanking region of the IL-12 receptor {beta}2 gene partially determines the clinical types of leprosy through impaired transcriptional activity J. Clin. Pathol., July 1, 2005; 58(7): 740 - 743. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Dumoutier, A. Tounsi, T. Michiels, C. Sommereyns, S. V. Kotenko, and J.-C. Renauld Role of the Interleukin (IL)-28 Receptor Tyrosine Residues for Antiviral and Antiproliferative Activity of IL-29/Interferon-{lambda}1: SIMILARITIES WITH TYPE I INTERFERON SIGNALING J. Biol. Chem., July 30, 2004; 279(31): 32269 - 32274. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Toyoda, M. Ido, T. Hayashi, E. C. Gabazza, K. Suzuki, J. Bu, S. Tanaka, T. Nakano, H. Kamiya, J. Chipeta, et al. Impairment of IL-12-Dependent STAT4 Nuclear Translocation in a Patient with Recurrent Mycobacterium avium Infection J. Immunol., March 15, 2004; 172(6): 3905 - 3912. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. O'Sullivan, H.-C. Chang, Q. Yu, and M. H. Kaplan STAT4 Is Required for Interleukin-12-induced Chromatin Remodeling of the CD25 Locus J. Biol. Chem., February 20, 2004; 279(8): 7339 - 7345. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Durali, M.-G. de Goer de Herve, J. Giron-Michel, B. Azzarone, J.-F. Delfraissy, and Y. Taoufik In human B cells, IL-12 triggers a cascade of molecular events similar to Th1 commitment Blood, December 1, 2003; 102(12): 4084 - 4089. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-C. Chang, S. Zhang, I. Oldham, L. Naeger, T. Hoey, and M. H. Kaplan STAT4 Requires the N-terminal Domain for Efficient Phosphorylation J. Biol. Chem., August 22, 2003; 278(34): 32471 - 32477. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. R. Lankford and D. M. Frucht A unique role for IL-23 in promoting cellular immunity J. Leukoc. Biol., January 1, 2003; 73(1): 49 - 56. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Cleary, W. Tu, A. Enright, T. Giffon, R. Dewaal-Malefyt, K. Gutierrez, and D. B. Lewis Impaired Accumulation and Function of Memory CD4 T Cells in Human IL-12 Receptor {beta}1 Deficiency J. Immunol., January 1, 2003; 170(1): 597 - 603. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Nishikomori, T. Usui, C.-Y. Wu, A. Morinobu, J. J. O'Shea, and W. Strober Activated STAT4 Has an Essential Role in Th1 Differentiation and Proliferation That Is Independent of Its Role in the Maintenance of IL-12R{beta}2 Chain Expression and Signaling J. Immunol., October 15, 2002; 169(8): 4388 - 4398. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Parham, M. Chirica, J. Timans, E. Vaisberg, M. Travis, J. Cheung, S. Pflanz, R. Zhang, K. P. Singh, F. Vega, et al. A Receptor for the Heterodimeric Cytokine IL-23 Is Composed of IL-12R{beta}1 and a Novel Cytokine Receptor Subunit, IL-23R J. Immunol., June 1, 2002; 168(11): 5699 - 5708. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. A. Lawless, S. Zhang, O. N. Ozes, H. A. Bruns, I. Oldham, T. Hoey, M. J. Grusby, and M. H. Kaplan Stat4 Regulates Multiple Components of IFN-{gamma}-Inducing Signaling Pathways J. Immunol., December 15, 2000; 165(12): 6803 - 6808. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. L. Murphy, E. D. Geissal, J. D. Farrar, and K. M. Murphy Role of the Stat4 N Domain in Receptor Proximal Tyrosine Phosphorylation Mol. Cell. Biol., October 1, 2000; 20(19): 7121 - 7131. [Abstract] [Full Text] |
||||
![]() |
J. A. Gollob, K. G. Veenstra, H. Jyonouchi, A. M. Kelly, P. Ferrieri, D. J. Panka, F. Altare, C. Fieschi, J.-L. Casanova, D. A. Frank, et al. Impairment of STAT Activation by IL-12 in a Patient with Atypical Mycobacterial and Staphylococcal Infections J. Immunol., October 1, 2000; 165(7): 4120 - 4126. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Zhang and M. H. Kaplan The p38 Mitogen-Activated Protein Kinase Is Required for IL-12-Induced IFN-{gamma} Expression J. Immunol., August 1, 2000; 165(3): 1374 - 1380. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Farrar, J. D. Smith, T. L. Murphy, and K. M. Murphy Recruitment of Stat4 to the Human Interferon-alpha /beta Receptor Requires Activated Stat2 J. Biol. Chem., January 28, 2000; 275(4): 2693 - 2697. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |