JBC INTERFERin siRNA transfection reagent

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Naeger, L. K.
Right arrow Articles by Hoey, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Naeger, L. K.
Right arrow Articles by Hoey, T.

J Biol Chem, Vol. 274, Issue 4, 1875-1878, January 22, 1999

COMMUNICATION
Identification of a STAT4 Binding Site in the Interleukin-12 Receptor Required for Signaling*

Lisa K. Naeger, Judi McKinney, Anupama Salvekar, and Timothy HoeyDagger

From Tularik, Inc., South San Francisco, California 94080

    ABSTRACT
Top
Abstract
Introduction
References

The specificity of the various STAT SH2 domains for different tyrosine-containing peptides enables cytokines to activate different signaling pathways and to induce distinct patterns of gene expression. We show that STAT4 has a unique peptide specificity and binds to the peptide sequence pYLPSNID (where pY represents phosphotyrosine). This motif is found at tyrosine residue 800 in the beta 2 subunit of the interleukin-12 receptor and is required for DNA binding and transcriptional activity of STAT4. Our data demonstrate that transfection of interleukin-12 receptor beta 1 and beta 2 subunits is sufficient for STAT4 activation but not for STAT1 or STAT3 activation.

    INTRODUCTION
Top
Abstract
Introduction
References

IL-121 is a heterodimeric cytokine secreted from antigen presenting cells in response to bacteria and intracellular parasites and thus plays an important role in host defense against bacterial pathogens (1). IL-12 promotes the proliferation of T cells and NK cells and is required for the differentiation of T cells into the Th1 subset of T helper cells. Th1 cells are critical for cell-mediated immune responses, because they secrete IFN-gamma , which enhances the activity of cytotoxic T cells and NK cells (1-3). In addition to these essential functions, Th1-dominated responses are associated with pathologic autoimmune and inflammatory conditions such as rheumatoid arthritis and inflammatory bowel disease (4). Given this potential for immunopathology, it is important to understand the mechanisms that control the Th1 response to develop possible therapeutic interventions.

IL-12 signals through the IL-12 receptor, which is composed of at least two subunits designated beta 1 and beta 2 (5, 6). Both IL-12 receptor subunits are members of the hemapoietin receptor superfamily and have strong homology to the gp130 receptor (5). The beta 1 receptor, although a low affinity binder of IL-12, is not capable of transducing an IL-12-mediated signal (6). A second subunit of the IL-12 receptor was subsequently identified that when coexpressed with the beta 1 subunit forms a high affinity receptor for IL-12 and confers IL-12 signaling (6). IL-12R beta 2 expression is differentially regulated in Th1 versus Th2 cells (7). Th1 cells but not Th2 cells express the beta 2 subunit of the IL-12 receptor (8). Following T cell activation, IL-12 and IFN-gamma treatment induces beta 2 expression, whereas IL-4, a cytokine produced by Th2 cells, inhibits beta 2 expression resulting in loss of IL-12 signaling (7, 8). Therefore, expression of the beta 2 subunit of the IL-12 receptor is a crucial determinant of Th1 versus Th2 development.

Cytokine binding to its receptor leads to activation of JAK kinases that phosphorylate the receptor on tyrosines located in the intracellular domain. The phosphorylated regions are binding sites for signal transduction molecules called STATs that are rapidly recruited to the receptor and tyrosine phosphorylated by JAK kinases. Tyrosine phosphorylation of STAT proteins induces their dimerization and translocation to the nucleus where they bind to specific DNA sequences and regulate transcription. IL-12 stimulation results in TYK2 and JAK2 phosphorylation and interaction of TYK2 with the beta 1 subunit of the IL-12 receptor and interaction of JAK2 with the beta 2 subunit (9, 10). Unlike STAT4, whose expression is limited to lymphoid and spermatogonia cells, JAK2 and TYK2 are ubiquitously expressed (11, 12).

In response to IL-12, STAT4 has been shown to be tyrosine phosphorylated and activated in Th1 lymphocytes and NK cells (9, 13). In addition, it has been reported that STAT1, STAT3, and STAT5 can be activated in response to IL-12 (13-15).

STAT proteins, by way of their SH2 domains, interact with specific phosphotyrosine residues on cytokine receptors (16). Although the phosphotyrosine binding sites of all the other known STAT proteins have been identified, the tyrosine docking site of STAT4 has not previously been reported. The beta 2 subunit of the IL-12 receptor contains three tyrosines in its cytoplasmic domain, whereas the beta 1 subunit contains no tyrosine residues in its cytoplasmic domain (5, 6). Therefore, given the importance of tyrosine phosphorylation in cytokine signaling pathways, we focused on the three tyrosines of the beta 2 subunit as possible docking sites for the STAT4 signaling protein in response to IL-12.

We determined that STAT4 is activated through interaction with the tyrosine at amino acid 800 in the IL-12 receptor beta 2 subunit. STAT4 activation depends on interaction with the peptide sequence pYLPSNID (where pY represents phosphotyrosine), thus providing evidence for the specificity of the STAT4 SH2 domain for a unique binding site in the IL-12 receptor. In addition, we show that neither STAT1 nor STAT3 is activated directly through the IL-12 receptor.

    EXPERIMENTAL PROCEDURES

Constructs and Transfections-- pRK5-STAT4, a CMV promotor vector, was used for STAT4 expression. A partial clone of IL-12R beta 1 cDNA was isolated from a peripheral blood lymphocyte library and cloned into NaeI and ApaI sites of pcDNA3 (Invitrogen). The N terminus of IL-12R beta 1 was generated using polymerase chain reaction and cloned into BamHI and NaeI sites. An IL-12R beta 2 cDNA was isolated from a peripheral blood lymphocyte library and cloned into the ApaI and NotI sites of pcDNA3. A deletion in this clone was discovered in the 3' end; therefore, the C terminus was generated by polymerase chain reaction and cloned into the SalI and ApaI sites of pcDNA3. Mutations changing the tyrosine to phenylalanine at amino acid 678, 767, or 800 in IL-12R beta 2 were generated using QuikChange Site-Directed Mutagenesis (Stratagene). The mutagenesis primers used to generate the mutations were: for beta 2 Y800F, 5'-CCCACCCATGATGGCTTCTTACCCTCC-3' and 3'-GGGTGGGTACTACCGAAGAATGGGAGG-5'; for beta 2 Y767F, 5'-GGTGGATCTGTTTAAAGTGCTGGAGAGCAGGG-3' and 3'-CCACCTAGACAAATTTCACGACCTCTCGTCCC-5'; and for beta 2 Y678F, 5'-GCGCTAAGAAATTTCCCATTGCAGAGG-3' and 3'-CGCGATTCTTTAAAGGGTAACGTCTCC-5'. Mutations changing the tyrosine to phenylalanine are shown in bold and underlined. Silent mutations that create a restriction site and that were created to aid in screening for mutations are underlined. Mutations were verified by sequencing, and then ApaI and SalI fragments containing the mutants were cloned into the parental IL-12R beta 2 construct in pBluescript-SK. The entire IL-12R beta 2 sequence containing the mutation was then cloned into the EcoRI and XbaI sites of pRK5-FLAG to FLAG tag the beta 2 subunit at the C-terminal end.

Transfections were performed in 293 cells using the calcium phosphate method (17). 10 µg of each construct (IL-12R beta 1, IL-12R beta 2, STAT4, STAT3, and STAT1) were transfected for immunoblot analysis and EMSAs.

EMSA-- Nuclear extracts were prepared from 293 cells 60 h following transfection by the method of Dignam et al. s(18). EMSAs were performed by using 5 µl of nuclear extract, 5 µl of binding buffer (100 mM KCl, 25 mM HEPES (pH 7.9), 0.1 mM EDTA, 5 mM MgCl2, 200 µg/ml bovine serum albumin, 10% glycerol), and 1 µg of poly(dI-dC) in a final volume of 15 µl. Reactions were incubated at room temperature for 5 min before 1 µl of probe was added for 15 min at room temperature. Oligonucleotides containing two high affinity STAT consensus binding sites, (5'-TAAAATTTTCCGGGAATTTTTTGAGTTTCCCGGAAAATTTTG-3' and its complement) were annealed and kinased to generate labeled DNA for the EMSA.

Immunoblot Analysis-- Transfected cells were lysed in TNT buffer (200 mM NaCl, 20 mM Tris (pH 7.5), 1% Triton X-100, 1 mM vanadate, 1 mM beta -glycerophosphate, 5 mM NaF, and a complete protease inhibitor tablet (Boehringer Mannheim)). Extracts were immunoprecipitated with anti-M2 Flag antibody (Kodak, Sigma) and 25 µl of protein G beads. Proteins were resolved on 12% SDS-polyacrylamide gels (Fisher) and transferred to Immobilon-P membrane (Millipore). Membranes were blocked with 5% milk, Tris-buffered saline, 0.06% Tween 20 and incubated with anti-M2 Flag antibody (10 µg/ml) and horseradish peroxidase-conjugated goat anti-mouse IgG (1:5000, Amersham Pharmacia Biotech). ECL (Amersham Pharmacia Biotech) was used for detection.

Fluorescence Polarization-- Tyrosine phosphorylated forms of IL-12R beta 2 peptides Tyr800 (SHEGpYLPSNID), Tyr767 (LVDLpYKVLESR), and Tyr678 (CAKKpYPIAEEK) were synthesized as described previously (19). Peptides were purified as described in Schindler et. al. (20). Fluorescence polarization was measured in an FPM-1 analyzer (Jolly Consulting and Research) as described (20). The sequence of the fluorescent peptide was SFDpYDMPHVL. The binding affinity of STAT4 for the fluorescent peptide is similar to its affinity for Tyr800 peptide. A fluorescent peptide concentration of 10 nM and a STAT4 concentration of 190 nM were used for STAT4-receptor peptide binding in assay buffer (50 mM NaCl, 10 mM HEPES (pH 7.6), 1 mM EDTA, 0.1% Nonidet P-40, and 2 mM dithithreitol). Full-length STAT4 was expressed with a C-terminal histidine tag in a baculovirus expression system. The protein was purified to approximately 95% homogeneity by nickel affinity chomatography (Qiagen).

Transactivation Reporter Assay-- COS cells were plated at 2 × 105/well (35 mm) on 6-well plates. Cells were transfected the next day using Profection Mammalian Transfection System calcium phosphate method (Promega) with 1 µg/well of STAT4 expression plasmid, 1.5 µg/well of each IL-12R subunit expression plasmid, and 1 µg/well of IRF-1 luciferase reporter plasmid. The IRF-1 reporter contains two copies of the gamma -activated sequence (AGCCTGATTTCCCCGAAATGACGGCACG) upstream of herpes simplex virus thymidine kinase (-50 to +10) in pGL2 luciferase (Promega). 0.25 µg/well of CMV beta -galactosidase plasmid was transfected as a control. After 24 h, cells were treated with IL-12 at 5 ng/ml for 4-5 h and harvested for luciferase and beta -galactosidase assays. Luciferase activity was measured using the Promega Luciferase Assay system, and beta -galactosidase activity was measured using Galacto-light chemiluminescent reporter assay (Tropix Inc.). Luciferase activity was normalized to beta -galactosidase activity, and the average was taken of three experiments.

    RESULTS

STAT4 Protein Has the Highest Affinity for pYLPSNID Sequence in IL-12 Receptor-- It seemed likely that STAT4 phosphorylation in response to IL-12 is dependent on interaction with one of the three tyrosines in the cytoplasmic domain of the IL-12R beta 2 subunit, because the beta 1 subunit cytoplasmic domain contains no tyrosines. We tested the specificity of the STAT4 SH2 domain for phosphopeptides corresponding to tyrosine-containing regions of the IL-12R beta 2 subunit by fluorescence polarization competition binding assays. The sequence of the fluorescent peptide was SFDpYDMPHVL. This is a mutated version of the STAT1 binding site derived from the IFN-gamma receptor. STAT4 binds to the mutant peptide approximately 8-fold better than it does to the wild-type sequence, SFpYDKPHVL. The peptide containing tyrosine 800 with the sequence pYLPSNID had an IC50 of 2.9 µM, whereas the other peptides pYKVLESR (Tyr678) and pYPIAEEK (Tyr767) had IC50 values of greater than 100 µM, equivalent to nonspecific background binding (Fig. 1A). These results indicate that STAT4 has the highest affinity for the peptide sequence that contains tyrosine 800 in the IL-12R beta 2 subunit, suggesting that this is the in vivo docking site for STAT4.


View larger version (45K):
[in this window]
[in a new window]
 
Fig. 1.   A, fluorescence polarization was used to measure binding selectivity (µM) of STAT4 to unlabeled peptides corresponding to regions containing the tyrosine at position 678, 767, or 800 in the IL-12R beta 2 subunit in competition with a fluorescently labeled STAT4 high affinity binding peptide, SFDpYMPHVL. An IC50 of greater than 100 µM is equivalent to nonspecific binding. B, 293 cells were transfected with constructs expressing the IL-12R beta 1 subunit (lanes 2-9), the IL-12R beta 2 subunit (lanes 2, 3, and 7), and STAT4 (lanes 2-11) and after 72 h were treated with no cytokine (lanes 1 and 2), IL-12 (lanes 3-9), or IFN-alpha (lanes 10 and 11) at 10 ng/ml for 4 h. Nuclear extracts were prepared and analyzed for STAT4 binding activity by EMSA using a high affinity double STAT consensus site as probe. Specificity of probe interaction was shown by adding anti-STAT4 antibody (Ab) to nuclear extract and probe mix (lanes 7-9 and 11), which specifically blocked the interaction of STAT4 protein with the probe. The arrow indicates the protein-DNA complex.

The Tyrosine at Amino Acid 800 in the IL-12 Receptor Is Required for STAT4 Activation-- We reconstituted IL-12 receptor signaling in 293 cells to determine whether the beta 1 and beta 2 subunits of the IL-12 receptor are sufficient for STAT4 activation in response to IL-12. Both subunits of the IL-12 receptor and STAT4 were transfected into 293 cells, and STAT4 activation was tested by EMSA using nuclear extracts isolated from the transfected cells after addition of IL-12. IFN-alpha stimulation has also been shown to activate STAT4 (21) and was used as a control for activation of STAT4 in these experiments. STAT4 was activated to bind DNA following IL-12 addition (Fig. 1B, lane 3) and IFN-alpha addition (Fig. 1B, lane 10) but was not activated in the absence of IL-12 addition (Fig. 1B, lane 2). The beta 1 and beta 2 subunits of the IL-12 receptor were sufficient for activation of STAT4 by IL-12 in 293 cells. Both of the IL-12 receptor subunits were required for activation of STAT4 because neither one alone resulted in STAT4 DNA binding (data not shown).

IL-12R beta 2 subunit mutants that each contain one of the tyrosines in the cytoplasmic domain changed to phenylalanine were then analyzed for their ability to recruit STAT4. IL-12 beta 2 receptor mutants at both tyrosine 678 and tyrosine 767 were capable of activating STAT4, whereas the mutant at tyrosine 800 was not able to activate STAT4 (Fig. 1B, lanes 4-6). When anti-STAT4 antiserum was added to the binding reactions, the STAT4 DNA binding complex was removed, indicating that STAT4 protein was responsible for binding to the probe (Fig. 1B, lanes 7-9 and 11). This evidence, along with the in vitro peptide binding data, indicates that the STAT4 SH2 domain binds to a specific phosphorylated tyrosine in the IL-12R beta 2 subunit that contains the sequence pYLPSNID.

IL-12-dependent transcriptional activation through STAT4 was also tested by co-transfecting the IL-12 receptor subunits, STAT4, and an IRF-1 luciferase reporter gene into cells and measuring luciferase assay following treatment with IL-12. STAT1 can induce the IRF-1 gene (22), and STAT4 has the same DNA binding specificity as STAT1 (23). Therefore, given that IL-12 stimulation has also been shown to induce IRF-1 gene expression in human peripheral blood lymphocytes,2 we used the IRF-1 STAT binding site for our reporter assays. We determined that in the transient transfection assays STAT4 transcriptional activation of the IRF-1 gene was dependent on IL-12 and was induced 4-fold in IL-12 treated transfected cells (Fig. 2A). The IL-12 receptor mutants beta 2-Y678F and beta 2-Y767F were also able to induce transcriptional activation of the IRF-1 gene to levels equivalent to wild-type IL-12 beta 2 receptor (Fig. 2A). However, STAT4-mediated transcriptional activation with the beta 2-Y800F mutant of IL-12R beta 2 was not detected. Expression of each of the mutant beta 2 subunits was confirmed by Western blot (Fig. 2B). Protein levels of the IL-12R beta 1 subunit and STAT4 were also shown to be equivalent in each transfection (data not shown). We conclude that the tyrosine at amino acid 800 in IL-12R beta 2 is necessary for efficient activation of STAT4 for both DNA binding and transcriptional activation.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 2.   A, transcriptional activation of STAT4 via the IL-12R and the IL-12R beta 2 mutants was measured by transfecting 293 cells in duplicate with indicated IL-12R constructs, STAT4, IRF-1 luciferase, and CMV beta -galactosidase. After 24 h, indicated transfected cells were treated with IL-12 at 10 ng/ml for 4 h and assayed for luciferase assay. Relative luciferase activity was determined by normalizing for beta -galactosidase activity and taking the average of three experiments. B, immunoblot analysis was used to analyze expression of IL-12R beta 2 in 293 cells following transfection with wild-type IL-12R beta 2 (wt), beta 2-Y678F, beta 2-Y767F, or beta 2-Y800F. The sample in lane 1 was prepared from cells transfected with the empty expression vector.

IL-12Rbeta 1 and beta 2 Are Not Sufficient for STAT1 or STAT3 Activation-- It has previously been reported that IL-12 is able to induce tyrosine phosphorylation and DNA binding of STAT3 and STAT1 in addition to STAT4 (13, 14). We tested the ability of IL-12 to activate STAT1 and STAT3 through the IL-12 receptor in our 293 transfection system. Following transfection of 293 cells with the IL-12 receptor subunits and STAT4, STAT1, or STAT3, nuclear extracts were prepared and analyzed for DNA binding activity by EMSA using the STAT consensus probe. Although we detected STAT4 DNA binding following activation with IL-12, we were unable to detect DNA binding by STAT1 or STAT3 (Fig. 3), even though their expression levels were equivalent to STAT4 expression (data not shown). STAT1 was capable of being activated for DNA binding by IFN-gamma as seen in lane 7 of Fig. 3. Our results indicate that in this system, STAT1 and STAT3, unlike STAT4, cannot be activated by IL-12 through the IL-12 receptor. In addition, we also tested the ability of STAT1 or STAT3 to be activated when STAT4 is co-transfected into 293 cells. When extracts from IL-12 stimulated 293 cells co-transfected with the IL-12R subunits and STAT4 plus STAT1 or STAT4 plus STAT3 were analyzed by EMSA, supershift, and co-immunoprecipitation experiments, only STAT4 homodimer complexes were detected (data not shown). These data suggest that neither STAT1 nor STAT3 is activated by IL-12 through an interaction with STAT4.


View larger version (40K):
[in this window]
[in a new window]
 
Fig. 3.   The DNA binding of STAT1 and STAT3 was analyzed following transfection of 293 cells with constructs expressing the IL-12R beta 1 subunit, the IL-12R beta 2 subunit, STAT4 (lanes 2 and 3), STAT1 (lanes 5 and 6), and STAT3 (lanes 8 and 9) and after 72 h were treated with no cytokine (lanes 2, 5, and 8) or IL-12 (lanes 3, 6, and 9). As a positive control, 293 cells were transfected with STAT4 alone and treated with IFN-alpha at 10 ng/ml for 5 h (lane 4) or transfected with STAT1 alone and treated with IFN-gamma at 10 ng/ml for 5 h (lane 7). Lane 1 is the mock-transfected control. Nuclear extracts were prepared and analyzed for STAT binding activity by EMSA using a high affinity double STAT consensus site as probe. The arrows indicate the protein-DNA complexes. STAT4 binds as a tetramer (upper arrow), and STAT1 binds as both a tetramer and a dimer (lower arrow).


    DISCUSSION

IL-12 stimulation results in activation of STAT4 through interaction with the IL-12 receptor (13, 24). In response to IL-12 stimulation, STAT4 is tyrosine phosphorylated and is competent for DNA binding and transcriptional activation of target genes. STAT4 function is necessary for mediating the IL-12 response and is crucial for Th1 development and efficient IFN-gamma production as shown by STAT4 knock-out studies (25, 26).

Receptor binding by STAT proteins has been shown to be specific and dictated by the SH2 domain of the STAT proteins (reviewed in Refs. 16, 27, and 28). STAT interaction with cytokine receptors depends on the phosphotyrosine residue in the receptor and the amino acid residues C-terminal to the phosphotyrosine that mediate specificity. In this paper, we demonstrate that STAT4 is activated by interacting with the IL-12 receptor and that the interaction of the STAT4 SH2 domain is specific for the peptide sequence pYLPSNID, the peptide at tyrosine 800 in the IL-12R beta 2 subunit. This tyrosine at amino acid 800 in the IL-12R beta 2 subunit is required for STAT4 DNA binding activity and transcriptional activation of the IRF-1 gene. STAT4 is not capable of binding the other peptide sequences at tyrosine residues 678 or 767 of the IL-12 beta 2 subunit, and these peptide sequences are not required for the activation of STAT4. The IL-12R peptide sequence pYLPSNID appears to be a specific protein binding site for STAT4. Other STATs, including STAT1, which has a closely related SH2 domain, cannot recognize the IL-12R pYLPSNID peptide.3

STAT1 and STAT3 are activated by a number of cytokines (28, 29). Additionally, it has been reported that STAT1 and STAT3 are activated in response to IL-12. Jacobson et al. (13) reported that IL-12 induced weak tyrosine phosphorylation of STAT3 and DNA binding activity of STAT3 in addition to STAT4. They showed that STAT3 was part of a IL-12-induced DNA complex that included STAT4, suggesting that STAT3 and STAT4 form heterodimers. Yu et al. (14) demonstrated DNA-protein complexes containing STAT4, STAT1alpha , and STAT3 following treatment of NK cells with IL-12. These reports, however, did not address the issue of whether STAT1, STAT3, or STAT4 directly interacts with the IL-12 receptor. Interestingly, in our experiments, neither STAT1 nor STAT3 was activated by IL-12 through the transfected IL-12 receptor subunits under conditions in which STAT4 was phosphorylated. Perhaps STAT1 and STAT3 could be recruited to the IL-12 receptor through another factor that functions as an adaptor protein and is not present in 293 cells.

For certain SH2-containing proteins, the +1 and +3 positions in phosphotyrosine peptides have been shown to confer binding specificity (30). All the known docking sites for STAT3, for instance, have a glutamine residue at the +3 position relative to tyrosine. None of the three tyrosine peptides in the IL-12 beta 2 receptor contain a glutamine in the +3 position, nor do they share amino acid sequence similarities to the STAT1 docking site in the IFN-gamma receptor, pYDKPH (31, 32). This is consistent with our results that STAT1 and STAT3 are not activated directly by contact with the IL-12 receptor.

The specificity of the various STAT protein SH2 domains for different tyrosine-containing peptides results in activation of specific cytokine signaling pathways and the induction of distinct gene expression patterns. We conclude that STAT4 has a unique peptide binding specificity among the STAT family and binds to the peptide sequence pYLPSNID. The unique specificity of STAT4 for its tyrosine-containing peptide sequence helps explain the distinct effects of IL-12 signaling.

STAT binding peptides derived from cytokine receptors have the ability to disrupt STAT dimers and inhibit STAT tyrosine phosphorylation in vivo (19, 31, 33). It may be possible to develop therapeutically useful compounds that, analogous to the receptor-derived peptides, will block the STAT-receptor interaction, thus preventing STAT activation and subsequent signaling.

The ability to reconstitute IL-12 signaling by transfecting the beta 1 and beta 2 subunits of the IL-12 receptor will facilitate the analysis of IL-12 receptor structure and function. In addition to activation of the JAKs resulting in STAT tyrosine phosphorylation, IL-12 also stimulates STAT4 serine phosphorylation possibly by mitogen-activated protein kinase or Lck (21, 34, 35). It will be interesting to determine which regions of the receptor are required for triggering these signaling pathways.

    ACKNOWLEDGEMENTS

We thank Keith Williamson and Joanna Waszczuck for DNA sequencing, Mike Brasseur for peptide synthesis, and Holly Turner for performing the fluorescence polarization assays. We thank Uli Schindler, Robert Daly, Todd Dubnicoff, and Lin Wu for helpful comments and suggestions on the manuscript.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed: Tularik, Inc., 2 Corporate Dr., South San Francisco, CA 94080. Tel.: 650-829-4442; Fax: 650-829-4400; E-mail: hoey{at}tularik.com.

The abbreviations used are: IL, interleukin; IFN, interferon; IL-12R, IL-12 receptor; CMV, cytomegalovirus; EMSA, electrophoretic mobility shift assay.

2 T. Hoey, unpublished results.

3 J. McKinney, unpublished results.

    REFERENCES
Top
Abstract
Introduction
References

  1. Trinchieri, G. (1995) Annu. Rev. Immunol. 13, 251-276[Medline] [Order article via Infotrieve]
  2. Hsieh, C., Macatonia, S. E., Tripp, C. S., Wolf, S. F., O'Garra, A., and Murphy, K. M. (1993) Science 260, 547-549[Abstract/Free Full Text]
  3. Manetti, R., Parronchi, P., Guidizi, M. G., Piccinni, M.-P., Maggi, E., Trinchieri, G., and Romagnani, S. (1993) J. Exp. Med. 177, 1199-1204[Abstract/Free Full Text]
  4. Romagnani, S. (1996) Clin. Immunol. Immunopathol. 80, 225-235[CrossRef][Medline] [Order article via Infotrieve]
  5. Chua, A. O., Chizzonite, R., Desai, B. B., Truitt, T. P., Nunes, P., Minetti, L. J., Warrier, R. J., Presky, D. H., Levine, J. F., Gately, M. K., and Gubler, U. (1994) J. Immunol. 153, 128-136[Abstract]
  6. Presky, D. H., Yang, H., Minetti, L. J., Chua, A. O., Nabavi, N., Wu, C. Y., Gately, M. K., and Gubler, U. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 14002-14007[Abstract/Free Full Text]
  7. Szabo, S. J., Dighe, A. S., Gubler, U., and Murphy, K. M. (1997) J. Exp. Med. 185, 817-824[Abstract/Free Full Text]
  8. Rogge, L., Barberis-Maino, L., Biffi, M., Passini, N., Presky, D. H., Gubler, U., and Sinigaglia, F. (1997) J. Exp. Med. 185, 825-831[Abstract/Free Full Text]
  9. Bacon, C. B., McVicar, D. W., Ortaldo, J. R., Rees, R. C., O'Shea, J. J., and Johnston, J. A. (1995) J. Exp. Med. 181, 399-404[Abstract/Free Full Text]
  10. Zou, J., Presky, D. H., Wu, C.-Y., and Gubler, U. (1997) J. Biol. Chem. 272, 6073-6077[Abstract/Free Full Text]
  11. Zhong, Z., Wen, Z., and Darnell, J. E., Jr. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 4806-4810[Abstract/Free Full Text]
  12. Yamamoto, K., Quelle, F. W., Thierfelder, W. E., Kreider, B. L., Gilbert, D. J., Jenkins, N. A., Copeland, N. G., Silvennoinen, O., and Ihle, J. N. (1994) Mol. Cell. Biol. 14, 4342-4349[Abstract/Free Full Text]
  13. Jacobson, N. G., Szabo, S. J., Weber-Nordt, R. M., Zhong, Z., Schreiber, R. D., and Murphy, K. M. (1995) J. Exp. Med. 181, 1755-1762[Abstract/Free Full Text]
  14. Yu, C.-R., Lin, J.-X., Fink, D. W., Akira, S., Bloom, E. T., and Yamauchi, A. (1996) J. Immunol. 157, 126-137[Abstract]
  15. Gollob, J. A., Murphy, E. A., Mahajan, S., Schnipper, C. P., Ritz, J., and Frank, D. A. (1998) Blood 91, 1341-1354[Abstract/Free Full Text]
  16. Schindler, U., Hoey, T., and McKnight, S. L. (1996) Genes Cells 1, 507-515[Abstract]
  17. Chen, C., and Okayama, H. (1987) Mol. Cell. Biol. 7, 2745-2752[Abstract/Free Full Text]
  18. Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983) Nucleic Acids Res. 11, 1475-1489[Abstract/Free Full Text]
  19. Hou, J., Schindler, U., Henzel, W. J., Ho, T. Z., Brasseur, M., and McKnight, S. L. (1994) Science 265, 1701-1706[Abstract/Free Full Text]
  20. Schindler, U., Wu, P., Rothe, M., Brasseur, M., and McKnight, S. L. (1995) Immunity 2, 689-697[CrossRef][Medline] [Order article via Infotrieve]
  21. Cho, S. S., Bacon, C. M., Sudarshan, C., Rees, R. C., Finbloom, D., Pine, R., and O'Shea, J. J. (1996) J. Immunol. 157, 4781-4789[Abstract]
  22. Muller, M., Laxton, C., Briscoe, J., Schindler, C., Improta, T., Darnell, J. E., Stark, G. R., and Kerr, I. M. (1993) EMBO J. 12, 4221-4228[Medline] [Order article via Infotrieve]
  23. Xu, X., Sun, Y.-L., and Hoey, T. (1996) Science 273, 794-797[Abstract]
  24. Bacon, C. M., Petricoin, E. F., III, Ortaldo, J. R., Rees, R. C., Larner, A. C., Johnston, J. A., and O'Shea, J. J. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 7307-7311[Abstract/Free Full Text]
  25. Kaplan, M. H., Sun, Y.-L., Hoey, T., and Grusby, M. J. (1996) Nature 382, 174-177[CrossRef][Medline] [Order article via Infotrieve]
  26. Thierfelder, W. E., van Duersen, J. M., Yamamoto, K., Tripp, R. A., Sarawar, S. R., Carson, R. T., Sangster, M. Y., Vignali, D. A., Doherty, P. C., Grosveld, G. C., and Ihle, J. N. (1996) Nature 382, 171-174[CrossRef][Medline] [Order article via Infotrieve]
  27. Darnell, J. E., Jr., Kerr, I. A., and Stark, G. R. (1994) Science 264, 1415-1421[Abstract/Free Full Text]
  28. Schindler, C., and Darnell, J. E., Jr. (1995) Annu. Rev. Biochem. 64, 621-651[Medline] [Order article via Infotrieve]
  29. Sadowski, H. B., Shuai, K., Darnell, J. E., Jr., and Gilman, M. Z. (1993) Science 261, 1739-1745[Abstract/Free Full Text]
  30. Stahl, N., Farruggella, T. J., Boulton, T. G., Zhong, Z., Darnell, J. E., Jr., and Yancopoulos, G. D. (1995) Science 267, 1349-1353[Abstract/Free Full Text]
  31. Greenlund, A. C., Farrar, M. A., Viviano, B. L., and Schreiber, R. D. (1994) EMBO J. 13, 1591-1600[Medline] [Order article via Infotrieve]
  32. Farrar, M. A., Campbell, J. D., and Schreiber, R. D. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 11706-11710[Abstract/Free Full Text]
  33. Yan, H., Greenlund, A. C., Gupta, S., Lim, J. T. E., Schreiber, R. D., Schindler, C., and Krowleski, J. J. (1996) EMBO J. 15, 1064-1074[Medline] [Order article via Infotrieve]
  34. Pignata, C., Sanghera, J. S., Cossette, L., Pelech, S. L., and Ritz, J. (1994) Blood 83, 184-190[Abstract/Free Full Text]
  35. Pignata, C., Prasad, K. V. S., Hallek, M., Druker, B., Rudd, C. E., Robertson, M. J., and Ritz, J. (1995) Cell. Immunol. 165, 211-216[CrossRef][Medline] [Order article via Infotrieve]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.



This article has been cited by other articles:


Home page
J. Gerontol. A Biol. Sci. Med. Sci.Home page
C. Tortorella, I. Stella, G. Piazzolla, V. Cappiello, O. Simone, A. Pisconti, and S. Antonaci
Impaired Interleukin-12-Dependent T-Cell Functions During Aging: Role of Signal Transducer and Activator of Transcription 4 (STAT4) and Suppressor of Cytokine Signaling 3 (SOCS3).
J. Gerontol. A Biol. Sci. Med. Sci., February 1, 2006; 61(2): 125 - 135.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
H Ohyama, K Ogata, K Takeuchi, M Namisato, Y Fukutomi, F Nishimura, H Naruishi, T Ohira, K Hashimoto, T Liu, et al.
Polymorphism of the 5' flanking region of the IL-12 receptor {beta}2 gene partially determines the clinical types of leprosy through impaired transcriptional activity
J. Clin. Pathol., July 1, 2005; 58(7): 740 - 743.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Dumoutier, A. Tounsi, T. Michiels, C. Sommereyns, S. V. Kotenko, and J.-C. Renauld
Role of the Interleukin (IL)-28 Receptor Tyrosine Residues for Antiviral and Antiproliferative Activity of IL-29/Interferon-{lambda}1: SIMILARITIES WITH TYPE I INTERFERON SIGNALING
J. Biol. Chem., July 30, 2004; 279(31): 32269 - 32274.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Toyoda, M. Ido, T. Hayashi, E. C. Gabazza, K. Suzuki, J. Bu, S. Tanaka, T. Nakano, H. Kamiya, J. Chipeta, et al.
Impairment of IL-12-Dependent STAT4 Nuclear Translocation in a Patient with Recurrent Mycobacterium avium Infection
J. Immunol., March 15, 2004; 172(6): 3905 - 3912.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. O'Sullivan, H.-C. Chang, Q. Yu, and M. H. Kaplan
STAT4 Is Required for Interleukin-12-induced Chromatin Remodeling of the CD25 Locus
J. Biol. Chem., February 20, 2004; 279(8): 7339 - 7345.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. Durali, M.-G. de Goer de Herve, J. Giron-Michel, B. Azzarone, J.-F. Delfraissy, and Y. Taoufik
In human B cells, IL-12 triggers a cascade of molecular events similar to Th1 commitment
Blood, December 1, 2003; 102(12): 4084 - 4089.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H.-C. Chang, S. Zhang, I. Oldham, L. Naeger, T. Hoey, and M. H. Kaplan
STAT4 Requires the N-terminal Domain for Efficient Phosphorylation
J. Biol. Chem., August 22, 2003; 278(34): 32471 - 32477.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
C. S. R. Lankford and D. M. Frucht
A unique role for IL-23 in promoting cellular immunity
J. Leukoc. Biol., January 1, 2003; 73(1): 49 - 56.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. M. Cleary, W. Tu, A. Enright, T. Giffon, R. Dewaal-Malefyt, K. Gutierrez, and D. B. Lewis
Impaired Accumulation and Function of Memory CD4 T Cells in Human IL-12 Receptor {beta}1 Deficiency
J. Immunol., January 1, 2003; 170(1): 597 - 603.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Nishikomori, T. Usui, C.-Y. Wu, A. Morinobu, J. J. O'Shea, and W. Strober
Activated STAT4 Has an Essential Role in Th1 Differentiation and Proliferation That Is Independent of Its Role in the Maintenance of IL-12R{beta}2 Chain Expression and Signaling
J. Immunol., October 15, 2002; 169(8): 4388 - 4398.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Parham, M. Chirica, J. Timans, E. Vaisberg, M. Travis, J. Cheung, S. Pflanz, R. Zhang, K. P. Singh, F. Vega, et al.
A Receptor for the Heterodimeric Cytokine IL-23 Is Composed of IL-12R{beta}1 and a Novel Cytokine Receptor Subunit, IL-23R
J. Immunol., June 1, 2002; 168(11): 5699 - 5708.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
V. A. Lawless, S. Zhang, O. N. Ozes, H. A. Bruns, I. Oldham, T. Hoey, M. J. Grusby, and M. H. Kaplan
Stat4 Regulates Multiple Components of IFN-{gamma}-Inducing Signaling Pathways
J. Immunol., December 15, 2000; 165(12): 6803 - 6808.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
T. L. Murphy, E. D. Geissal, J. D. Farrar, and K. M. Murphy
Role of the Stat4 N Domain in Receptor Proximal Tyrosine Phosphorylation
Mol. Cell. Biol., October 1, 2000; 20(19): 7121 - 7131.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
J. A. Gollob, K. G. Veenstra, H. Jyonouchi, A. M. Kelly, P. Ferrieri, D. J. Panka, F. Altare, C. Fieschi, J.-L. Casanova, D. A. Frank, et al.
Impairment of STAT Activation by IL-12 in a Patient with Atypical Mycobacterial and Staphylococcal Infections
J. Immunol., October 1, 2000; 165(7): 4120 - 4126.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Zhang and M. H. Kaplan
The p38 Mitogen-Activated Protein Kinase Is Required for IL-12-Induced IFN-{gamma} Expression
J. Immunol., August 1, 2000; 165(3): 1374 - 1380.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. D. Farrar, J. D. Smith, T. L. Murphy, and K. M. Murphy
Recruitment of Stat4 to the Human Interferon-alpha /beta Receptor Requires Activated Stat2
J. Biol. Chem., January 28, 2000; 275(4): 2693 - 2697.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Naeger, L. K.
Right arrow Articles by Hoey, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Naeger, L. K.
Right arrow Articles by Hoey, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.