![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 4, 1920-1927, January 22, 1999
Subunit and Is Responsible for the
Decreased Activity in Epithelial Cells*
,
,
From the Department of Molecular Medicine, Karolinska Institutet,
The Rolf Luft Center for Diabetes Research, Karolinska Hospital, S-171
76 Stockholm, Sweden, the
Department of Pharmacological
and Pharmaceutical Sciences, College of Pharmacy, University of
Houston, Houston, Texas 77204, the § Department of
Physiology, Texas Tech University, Lubbock, Texas 79430, the
¶ Department of Medicine, University of Chicago, Chicago, Illinois
60637, and the
Division de Néphrologie, Hôpital
Cantonal Universitaire, CH-1211 Geneva 14, Switzerland
| |
ABSTRACT |
|---|
|
|
|---|
Dopamine inhibits
Na+,K+-ATPase activity in renal tubule
cells. This inhibition is associated with phosphorylation and
internalization of the
subunit, both events being protein kinase
C-dependent. Studies of purified preparations, fusion
proteins with site-directed mutagenesis, and heterologous expression
systems have identified two major protein kinase C phosphorylation
residues (Ser-11 and Ser-18) in the rat
1 subunit
isoform. To identify the phosphorylation site(s) that mediates
endocytosis of the subunit in response to dopamine, we have performed
site-directed mutagenesis of these residues in the rat
1
subunit and expressed the mutated forms in a renal epithelial cell
line. Dopamine inhibited Na+,K+-ATPase activity
and increased
subunit phosphorylation and
clathrin-dependent endocytosis into endosomes in cells
expressing the wild type
1 subunit or the S11A
1 mutant, and both effects were blocked by protein
kinase C inhibition. In contrast, dopamine did not elicit any of these
effects in cells expressing the S18A
1 mutant. While Ser-18 phosphorylation is necessary for endocytosis, it does not affect
per se the enzymatic activity: preventing endocytosis with wortmannin or LY294009 blocked the inhibitory effect of dopamine on
Na+,K+-ATPase activity, although it did not
alter the increased
subunit phosphorylation induced by this agonist.
We conclude that dopamine-induced inhibition of
Na+,K+-ATPase activity in rat renal tubule
cells requires endocytosis of the Regulation of the Na+ channel (1),
H+,K+-ATPase (2) and
Na+,K+-ATPase (3, 4) activity appears to
involve removal from, or retention within, the plasma membrane of these
transport proteins: while Na+ channels and
H+,K+-ATPase activity in intact cells are
constitutively increased by the removal of specific endocytic signals,
internalization of Na+,K+-ATPase is associated
with activation of specific membrane receptors and depends on the
sequence of intracellular signals generated from this interaction (4,
5).
Endocytosis of integral membrane proteins is initiated by selective
recognition of the target protein followed by its transport, usually
via clathrin-coated vesicles
(CCV),1into endosomes (6-9).
While endocytosis of membrane receptors as part of their signaling
mechanism has been extensively studied, internalization of integral
membrane proteins triggered by a network of signals generated after
activation of G proteins-coupled receptors (GPCRs) is less well documented.
Inhibition of Na+,K+-ATPase activity by
activation of GPCRs (dopaminergic) in renal epithelial cells is
associated with the removal of active units from the basolateral plasma
membrane and their transport, via clathrin-coated vesicles, into early
(EE) and late endosomes (LE) (4). This process requires activation of
phosphatidylinositol 3-kinase (10) and is dependent on protein kinase C
(11). Protein kinase C (PKC) phosphorylates the
Na+,K+-ATPase In PCT (proximal convoluted tubule) segments phorbol esters (19, 20)
and diacylglycerol analogs (20, 21) inhibit
Na+,K+-ATPase activity. In OK (opossum kidney)
cells and Xenopus oocytes phorbol esters decrease
ouabain-sensitive Rb+ transport, and this decrease is
associated with phosphorylation of the
Na+,K+-ATPase Earlier experimental approaches often relied on the action of phorbol
esters as direct activators of protein kinase C. The variety of
Na+,K+-ATPase responses to these agents seen in
intact cells could represent compensatory homeostatic mechanisms due to
phosphorylation of numerous
substrates,2 resulting, for
example, in increased fluid phase endocytosis (27) that would affect
Na+,K+-ATPase function. Using a physiologic
ligand (dopamine) we have demonstrated that inhibition of
Na+,K+-ATPase activity in renal proximal tubule
cells was associated with phosphorylation and selective endocytosis of
the While these results indicate that phosphorylation of the Materials--
All chemicals were from Sigma, except
bisindolylmaleimide (Bis) and LY294009, which were purchased from
Calbiochem. Na+,K+-ATPase Preparation of PCT Cells--
PCT cells were prepared as
described before (11). Briefly, male Sprague-Dawley rats (BK Universal,
Sollentuna, Sweden) weighing between 150 and 200 g were used.
After the kidneys were removed and the cortex isolated, the tissue was
moistened on ice to a paste-like consistency. The cortical minceate was
incubated with 0.625 mg/ml collagenase (Type I, Sigma) in 50 ml of
Hanks' medium (Life Technologies, Inc.). The incubation was carried
out at 37 °C for 60 min, the solution being continuously exposed to
95% O2, 5% CO2 and was terminated by placing
the tissue on ice and pouring through graded sieves (75-53-38 µm
pore size) to obtain a cell suspension. The PCT cells were washed three
to four times by centrifugation at 100 × g for 4 min
in order to separate the remaining blood cells and traces of
collagenase and were then kept on ice. Cells were resuspended to yield
a protein concentration of approximately 3.5-5.0 mg/ml and were used
immediately after preparation.
Site-directed Mutagenesis--
Wild type and mutant forms of the
Na+,K+-ATPase Cell Transfection--
OK cells were transfected with the
various cDNA plasmids using liposomes (26, 29). Two days after
transfection, the cells were transferred to a medium containing 10 µM ouabain. Because the endogenous
Na+,K+-ATPase of OK cells is sensitive to this
level of ouabain, only OK cells that express the
Na+,K+-ATPase containing the rodent Determination of Na+,K+-ATPase Activity
in OK Cells--
Transfected cells (maintained at all times in 10 µM ouabain) were incubated in modified Hanks' medium in
the presence or absence of 1 µM DA at room temperature
for 2.5 min. The incubation was terminated by placing the samples on
ice. Cell aliquots (approximately 5-15 µg of protein) were
transferred to the Na+,K+-ATPase assay medium
(final volume, 100 µl) containing in mM: 50 NaCl, 5 KCl,
10 MgCl2, 1 EGTA, 50 Tris-HCl, 10 Na2ATP
(Calbiochem) and [
A portion of Na+,K+-ATPase molecules is located
in intracellular organelles. The sum of their activities (nmol of
Pi/mg of protein/min) in CCV, ~20 and EE, ~15,
constitutes approximately 30% of total cell activity, 112 nmol of
Pi/mg of protein/min (4). Because their presence in these
compartments may affect the interpretation of activities obtained in
whole cells, we have validated our method by comparing the
Na+,K+-ATPase hydrolytic activity in PCT cells
permeabilized by thermic shock ( Phosphorylation and Immunoprecipitation of
Na+,K+-ATPase in Intact Cells--
Renal PCT
cells (4-6 mg of protein/3 ml) were labeled during 2 h at
32 °C in a buffer containing (in mM): 120 NaCl, 5 KCl, 4 NaHCO3, 1 CaCl2, 1 MgSO4, 0.2 NaH2PO4, 0.15 Na2HPO4,
5 glucose, 10 lactate, 1 pyruvate, 20 HEPES, and 1% bovine serum
albumin, pH 7.45, with the addition of 250 µCi/ml
[32P]orthophosphate (NEN Life Science Products). OK cells
(2.0-2.5 mg of protein/dish) were labeled in the same buffer (2.5 ml/dish) containing 100 µCi/ml [32P]orthophosphate for
2.5 h at 37 °C. All incubations with different agonists were
performed at room temperature. The incubation was terminated by
removing the medium, addition of immunoprecipitation buffer (100 mM NaCl, 50 mM Tris-HCl, 2 mM EGTA,
30 mM NaF, 30 mM
Na4O7P2, 1 mM
Na3VO4, 1 mM phenylmethylsulfonyl
fluoride, 10 µg/ml leupeptin, 4 µg/ml aprotinin, and 1% Triton
X-100, pH 7.45) and placing the samples on ice. The cells were
disrupted by gentle homogenization. Immunoprecipitation of the
Na+,K+-ATPase Quantitation of Na+,K+-ATPase Preparation of Endosomes--
OK cells in suspension (1.5 mg of
protein/ml) were incubated under different protocols at room
temperature. Incubation was terminated by transferring the samples to
ice and addition of cold homogenization buffer containing 250 mM sucrose and 3 mM imidazole, 2 mM
EGTA, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, 4 µg/ml aprotinin, pH 7.4. Cells were gently homogenized (15-20 strokes) to minimize damage of the endosomes, using a pellet pestle motor homogenizer, and the samples were subjected to a brief (5 min) centrifugation (4 °C, 3000 × g). Endosomes
were fractionated on a flotation gradient as described (4), using essentially the technique of Gorvel et al. (33). These
fractions were not cross-contaminated, i.e. Rab5 was located
exclusively in EE, whereas mannose 6-phosphate receptor
immunoreactivity was located in LE (4).
Preparation of Clathrin-coated Vesicles--
Isolation of
clathrin vesicles was performed as described (4, 34). After
preincubation with or without 1 µM DA (3 min at
25 °C), OK cells were homogenized using a Potter homogenizer (three
strokes; 30 s) in 1 mM EGTA, 0.5 mM
MgCl2, 0.1 M MES, and 0.2 mg/ml
NaN3, titrated to pH 6.5 with NaOH. The homogenate was centrifuged at 85,000 × g for 1 h, and the pellet
was resuspended in the same buffer and applied to a discontinuous
sucrose gradient (w/v): 60, 50, 40, 10, and 5%. Samples were then
centrifuged at 80,000 × g for 75 min and collected
from the 10-40% interface; they were washed in homogenization buffer
and pelleted at 85,000 × g for 1 h. Wheat germ
agglutinin was added to a concentration of 1:10 mg of protein and
incubated overnight at 4 °C. The agglutinated material was
sedimented at 20,000 × g for 15 min. CCV were
negatively stained for both Rab5 and mannose 6-phosphate receptor
(4).
Preparation of Basolateral Plasma Membranes--
After
separation of early and late endosomes, another fraction (500 µl) was
collected at the 16 and 42% sucrose interface corresponding to cell
ghosts, mitochondria, and plasma membranes. Basolateral plasma
membranes were further purified as described (11).
Miscellaneous--
Protein content was determined according to
Bradford (35). Western blots were developed with an ECL or ECL Plus
(Amersham, Amersham, UK) detection kit. Scans were performed using a
Scan Jet IIc scanner (Hewlett-Packard, Palo Alto, CA). Quantitation of
the phosphorylated Na+,K+-ATPase Statistics--
Comparison between two experimental groups were
made by the nonpaired Student's t test. For multiple
comparisons one way analysis of variance with Sheffe's correction was
used. p < 0.05 was considered significant.
Effect of Subunit Endocytosis on
Na+,K+-ATPase Activity--
The
Na+,K+-ATPase
To determine the relative roles of Effect of S11A and S18A Mutations on
Na+,K+-ATPase Activity--
To determine the
role of putative PKC phosphorylation residues during inhibition of
Na+,K+-ATPase activity by dopamine, OK cells
were transfected with mutants of the rat
It has been reported recently (36) that COS-7 cells expressing the
Na+,K+-ATPase Na+,K+-ATPase Endocytosis of Na+,K+-ATPase
While the analysis of such distribution using cell fractionation on
sucrose gradients is useful to calculate the proportional shift of
subunits between these two compartments, it does not allow the accurate
identification of the specific organelles into which the subunits are
incorporated. Thus, to better illustrate the destination of the
endocytosed Na+,K+-ATPase The results of this study demonstrate that
dopamine-dependent inhibition of
Na+,K+-ATPase activity in intact cells is
caused by a reduced number of active units within the plasma membrane.
Phosphorylation of the Na+,K+-ATPase Dopamine increased the state of Na+,K+-ATPase
We have shown previously that activation of GPCRs by dopamine inhibits
Na+,K+-ATPase activity in renal epithelial
cells and that this inhibition was associated with endocytosis of its
Failure of dopamine to inhibit Na+,K+-ATPase
activity when endocytosis was prevented is in agreement with previous
observations. Using a different approach, we have reported that
stabilizing the cortical actin cytoskeleton inhibited the traffic of
Na+,K+-ATPase subunits into CCV, EE, and LE and
that under these conditions dopamine failed to inhibit
Na+,K+-ATPase activity (4). Using the
microtubule depolymerizing agent nocodazole, Using site-directed mutagenesis we also demonstrated in this study that
endocytosis of Na+,K+-ATPase and inhibition of
its catalytic activity in response to DA require phosphorylation of the
Ser-18 residue located in the The Ser-11 and Ser-18 residues of the
Na+,K+-ATPase In summary, Na+,K+-ATPase activity in intact
cells represents the number of active units within the basolateral
plasma membrane. Decreased Na+,K+-ATPase
activity in response to GPCRs signals (dopamine) in renal epithelial
cells is determined by removal of the subunits from the plasma membrane
(Fig. 7). Phosphorylation occurs at
Ser-18 of the
subunit into defined
intracellular compartments and that phosphorylation of Ser-18 is
essential for this process.
![]()
INTRODUCTION
Top
Abstract
Introduction
References
1 subunit in
cell-free preparations (12-16) and this event is associated with a
decrease in its catalytic activity (13, 15). However, because in some
reports investigators have failed to demonstrate an effect of PKC on
the hydrolytic activity of purified preparations (16, 17), or of
phorbol esters in cell lines (18), it remains unclear whether Ser/Thr
phosphorylation of the
1 subunit represents a
physiological mechanism responsible for
Na+,K+-ATPase inhibition in intact cells.
1 subunit (22,
23). However, expression of a mutated form (Ser-18) alone or in
combination with another mutation (Ser-11) in Xenopus
oocytes revealed a variable response of Rb+ transport,
depending on whether phorbol esters or purified PKC was used (23).
Moreover, phorbol esters have been also associated with stimulation of
ouabain-sensitive Rb+ transport in PCT segments (24, 25)
and OK cells (26).
1 subunit (4, 11). Furthermore, these two events
were connected, because the rat
1 subunit carrying an
amino-terminal deletion (first 28 residues) that includes the PKC
target sites (Ser-11/Ser-18) was not internalized in response to
dopamine (11).
subunit in
response to dopamine is necessary for internalization, it remains
unclear whether inhibition of the enzymatic activity in intact cells
results from phosphorylation of the subunit in the plasma membrane (so
that Na+,K+-ATPase undergoes a conformational
change in situ that decrease its activity) or from the
endocytic process, i.e. inhibition occurs only as a result
of decreased Na+,K+-ATPase units in the plasma
membrane. In addition, because the two residues (Ser-11 and Ser-18)
phosphorylated by PKC in purified preparations (16) are within the
NH2 terminus of the
1 subunit, in this study
we have utilized site-directed mutagenesis to determine in intact cells
whether Ser-11 or Ser-18, or both are phosphorylation targets involved
in Na+,K+-ATPase endocytosis and inhibition of
its catalytic activity in response to dopamine.
![]()
EXPERIMENTAL PROCEDURES
subunit abundance
in clathrin vesicles and early and late endosomes was determined using
a monoclonal antibody kindly provided by Dr. M. Caplan (Yale
University). Immunoprecipitation of the
Na+,K+-ATPase in the phosphorylation
experiments was performed using a polyclonal antibody raised against
the rat Na+,K+-ATPase
subunit (25).
1 subunit of rat
were prepared from complementary DNA for expression by mammalian cells
in culture. Wild type
1 cDNA was a gift of Dr. Jerry
B. Lingrel (28). Wild type sequence was annealed with complementary oligonucleotides containing the desired change and then subjected to
10-15 cycles of amplification with Pfu polymerase, followed by restriction of the original wild type template with DpnI.
The resulting mutant plasmids were then transformed into bacteria for
recovery and analysis. Substitution of an alanine for the first serine,
1 (S11A), was accomplished with the oligonucleotide TATGAGCCCGCAGCTGTGGCCGAACATGGGGACAAGAAGA and its complement.
Substitution of an alanine for the second serine,
1
(S18A), was accomplished with the oligonucleotide
AGAACATGGGGACAAGAAGGCCAAGAAGGCGAAGAAGGAA and its complement. A
diagnostic HaeIII site was introduced for both mutants.
Structure of the resulting mutants was evaluated by restriction with
the appropriate endonuclease and confirmed by dideoxynucleotide
sequencing of the altered region. Mutant cDNAs were subcloned
downstream from the immediate early promoter of human cytomegalovirus
in pcDNA3.1 (Invitrogen, San Diego, CA).
subunit
would be able to survive. After 10 days, resistant colonies were
expanded and maintained all the time in medium containing 10 µM ouabain. Experiments were performed with a mix of at
least 20 clones.
-32P]ATP (NEN Life Science Products;
specific activity, 3000 Ci/mmol) in tracer amounts (3.3 nCi/µl).
Na+,K+-ATPase activity was then determined
after permeabilization of the cells as described before (4). Total
Na+,K+-ATPase activity was measured in samples
containing 10 µM ouabain. Thus, cells remained exposed to
this ouabain concentration at all times, including after
permeabilization, the magnesium-dependent ATPase activity
was measured in a medium containing 4 mM ouabain. The
difference between these two groups represents the activity of the
"transfected" ouabain-resistant isoform.
20 °C) to a well established
method for cell permeabilization, e.g. treatment with
digitonin (30). In five separate experiments Na+,K+-ATPase activity (nmol of
Pi/mg of protein/min) in PCT cells subjected to
permeabilzation at
20 °C was 99 ± 8, not significantly
different from that of PCT cells permeabilized by incubation with 50 µM digitonin during 10 min at 37 °C (116 ± 13, p = 0.313). When cells previously exposed to
20 °C
for 10 min were incubated with digitonin, which now would also access
the interior of the cell, the Na+,K+-ATPase
activity was significantly increased (161 ± 9, n = 4, p < 0.05 versus digitonin alone). This
increase (~38%) probably reflects to a large extent the contribution
of pump activity in these organelles and suggests that incubation of
intact cells at
20 °C or with digitonin alone results only in
permeabilization of the plasma membrane but not of membranes from
intracellular organelles, such as clathrin vesicles and early endosomes.
subunit was performed as
described (11). Briefly, aliquots (200 µg of protein) were incubated
overnight at 4 °C with 50 µl of rabbit polyclonal antibody
(preliminary experiments demonstrated that this antibody does not
immunoprecipitate the wild type
subunit) and the simultaneous
addition of excess protein A-Sepharose beads (Pharmacia Biotech,
Uppsala, Sweden). Samples were analyzed by SDS-polyacrylamide gel
electrophoresis using the Laemmli buffer system (31). Proteins were
transferred to polyvinylidene difluoride membranes (Immobilon-P,
Millipore, Bedford, MA) and subjected to autoradiography.
Phosphoproteins were analyzed by phosphoimaging, and quantitation was
performed as described (4).
Subunit Phosphorylation State--
In order to estimate the
stoichiometry of the
subunit phosphorylation we used the "back
phosphorylation" technique (32). PCT cells were incubated in the
presence or absence of 1 µM dopamine at 23 °C for 2.5 min. The incubation was terminated by addition of homogenization
buffer, and immunoprecipitation of the
subunit was performed as
described above. The immunoprecipitated
subunit (~0.25 µg) was
phosphorylated by purified protein kinase C (70 ng/50 µl; 30 min at
30 °C) in the presence of [
-32P]ATP (NEN Life
Science Products), 10 mM MgCl2, 0.4 mM CaCl2, 0.25 mM EGTA, 0.32 mg/ml
phosphatidylserine, 0.03 mg/ml diacylglycerol, 0.1 mg/ml bovine serum
albumin, 100 µM Na2ATP, 20 mM
Tris-HCl, pH 7.5. Samples were analyzed by SDS-polyacrylamide gel
electrophoresis. Gels were stained by Coomassie Blue. The radioactivity
incorporated into the
subunit excised from the gel was counted
(Cherenkov), and the number of moles of phosphate incorporated per mole
of
subunit was calculated as described (13). The amount of
immunoprecipitated
subunit was calculated by scanning densitometry
using bovine serum albumin as standard.
subunit
was performed as described (11) using a Fuji Bas 1000 Bio-imaging
analyzer (Fuji Co., Tokyo, Japan), and the data (arbitrary units) were
analyzed using a software Tina 2.07 ray test (Isotopenmessyeräte
GmbH, Staulenhardt, Germany).
![]()
RESULTS
subunit is phosphorylated in
response to dopamine, maximal phosphorylation (~40%) being achieved
after 2.5-min incubation at 23 °C with 1 µM dopamine.
Using back phosphorylation we have observed in two independent
experiments that dopamine decreased the amount of dephospho-
subunit
(dephosphoprotein, percent of control: 67 (experiment 1) and 70 (experiment 2), Fig. 1A).
Because the total amount of immunoprecipitated
Na+,K+-ATPase
subunit was the same, the
results further demonstrated that the
subunit is phosphorylated in
the presence of dopamine. The
subunit immunoprecipitated from
vehicle-treated cells was phosphorylated to a stoichiometry of 0.33 (experiment 1)/0.38 (experiment 2) mol/mol, whereas that from
dopamine-treated cells to 0.20 (experiment 1)/0.25 (experiment 2)
mol/mol, respectively. This indicates that in intact cells dopamine
phosphorylates the Na+,K+-ATPase
subunit
with a stoichiometry of ~0.15 mol/mol (~40% of maximal).

View larger version (20K):
[in a new window]
Fig. 1.
Effect of dopamine on PCT cells
Na+,K+-ATPase activity,
1
subunit phosphorylation, and endocytosis. A, amounts of
dephospho-
subunit from cells incubated in the presence or absence
of 1 µM dopamine (2.5 min at 23 °C). Autoradiograph of
subunit phosphorylation and percent of dephosphoprotein from two
independent experiments are shown. Equal amounts of immunoprecipitated
1 subunit (0.25 µg) were loaded in each lane.
B, the effect of 1 µM DA (2.5 min at 23 °C)
on the state of phosphorylation of the immunoprecipitated
1 subunit was determined after preincubation with or
without 100 nM wortmannin (W or WT)
or 25 µM LY 294009 (LY) for 20 min at
23 °C. Each bar represents the mean of three experiments + S.E. C, Na+,K+-ATPase activity was
determined in PCT cells using the same protocols as described in
A. Each bar represents the mean value of five
experiments + S.E. performed in triplicate. *, p < 0.05; **, p < 0.01. Lanes C in A
and B indicates control..
subunit phosphorylation and
internalization during inhibition of
Na+,K+-ATPase activity in PCT cells, we
examined the effect of dopamine on
Na+,K+-ATPase activity and
subunit
phosphorylation under conditions where endocytosis was blocked. We have
reported previously that preincubation with wortmannin or LY294009
prevented the endocytosis of
subunits into clathrin vesicles and
early and late endosomes induced by dopamine (10). In the present study
we assessed the effect of 1 µM dopamine on
Na+,K+-ATPase activity and
subunit
phosphorylation in PCT cells that have been treated with 100 nM wortmannin (W) or 25 µM LY
294009 (LY) for 20 min at 23 °C before incubation with
the ligand (Fig. 1). Dopamine alone increased the state of
phosphorylation of the immunoprecipitated
subunit from the
basolateral membrane (Fig. 1A) and decreased
Na+,K+-ATPase activity (Fig. 1B).
Dopamine-induced phosphorylation was not altered by wortmannin or
LY294009 (Fig. 1A). However, the inhibition of
Na+,K+-ATPase activity was blocked by
pretreatment with either wortmannin or LY294009 (Fig. 1B).
Wortmannin or LY294009 alone did not affect Na+,K+-ATPase activity or
subunit
phosphorylation. These results suggest that phosphorylation is a
necessary, but not a sufficient, event for
Na+,K+-ATPase inhibition, i.e.
although it triggers the endocytosis, it is the removal of the subunits
from the plasma membrane, rather than the increased phosphorylation
per se that decreases Na+,K+-ATPase
activity in intact cells.
1 subunit in
which either Ser-11 or Ser-18 were substituted by Ala residues. OK
cells expressing wild type (Wt) and the mutants S11A and S18A
1 subunit expressed comparable amounts of
1 subunits as determined by Western blot analysis (Fig.
2A), and the
Na+,K+-ATPase activity determined in plasma
membranes was also similar (Fig. 2B). In intact OK cells
dopamine (1 µM; 3 min at 23 °C) decreased
significantly (p < 0.01, n = 4)
Na+,K+-ATPase activity (Fig. 2C), and this
inhibition was abolished by coincubation with 1 µM Bis.
In OK cells expressing the S11A isoform the inhibitory effect of 1 µM dopamine was slightly less than that in cells
expressing the Wt isoform (Wt: ~40% versus S11A: ~30%), but it was still significant (p < 0.01, n = 6). This effect as well was abolished by 1 µM Bis. In contrast, dopamine failed to induce a
significant change in Na+,K+-ATPase activity in
cells expressing the S18A mutant (Fig. 2C).

View larger version (75K):
[in a new window]
Fig. 2.
Na+,K+-ATPase
1 subunit abundance and activity in OK cells.
A, Na+,K+-ATPase
1
subunit abundance in plasma membranes from Wt, S11A, and
S18A-transfected cells examined by Western blotting. Equal amounts of
protein (50 µg) were loaded in each sample. B,
Na+,K+-ATPase activity in plasma membranes from
Wt, S11A, and S18A-transfected cells. Each bar represents
the mean + S.E. of three experiments performed in duplicate.
C, Na+,K+-ATPase activity in intact
cells incubated for 3 min at 25 °C with or without 1 µM dopamine in the presence or absence of 1 µM bisindolylmaleimide. Basal
Na+,K+-ATPase activity was similar in all
groups. Open bars represent the mean + S.E. of eight
(+DA) and solid bars that of three
(+DA+bis) experiments performed in triplicate. **,
p < 0.01; n.s., not significant.
D, photomicrographs of OK cells transfected with the intact
rat
1 subunit (Wt) or the Ser-11
(S11A) and Ser-18 (S18A) mutants. Cells were
grown in Dulbecco's modified Eagle's medium, seeded onto plastic
coverslips at 350 (Wt), 250 (S11A), and 260 (S18A) cells/µl and grown in 2.5 ml of Dulbecco's
modified Eagle's medium. Photographs were taken after 16 h of
culture. Bars = 10 µm.
1 isoform carrying
a mutation in a protein kinase C phosphorylation residue (S23A,
corresponding to Ser-18 in our study) fail to adhere properly to
fibronectin or plastic matrix. We have therefore examined whether OK
cells seeded on plastic coverslips at a density of 350 (Wt), 250 (S11A)
and 260 (S18A) cells/µl and grown in 2.5 ml Dulbecco's modified
Eagle's medium in plastic Petri dishes exhibit any culture
abnormalities. A representative photomicrograph demonstrates that after
16 h of culture, all OK cell types (Wt, S11A, and S18A) adhere and
establish cell-to-cell contacts (Fig. 2D) and reach
confluence within 36 h. Although we have not determined the
intracellular sodium concentration or pH of the different OK cells
examined, they did not display any differences in cell shape or size,
e.g. an enlargement that would indicate a change in cell
volume due to an abnormal intracellular ionic composition. Thus, one
can speculate that the difference between these two studies could
reflect merely the different cell lines used (COS-7 versus
OK) rather than lack of the residue phosphorylated by protein kinase C.
1 Subunit
Phosphorylation--
To examine the state of
1 subunit
phosphorylation OK cells were metabolically labeled with
[32P]orthophosphate and then incubated with or without 1 µM dopamine (3 min; 23 °C). The degree of
phosphorylation of the
1 subunit was determined by
autoradiography (Fig. 3A) and
corrected for the amount of immunoprecipitated material assessed by
Western blot (Fig. 3A, lower panel, and
B). Dopamine increased significantly (p < 0.01, n = 6) the
1 subunit
phosphorylation in Wt cells as well as in OK cells expressing the S11A
mutant. The increase in phosphorylation was similar in Wt and S11A
cells, and both effects were blocked by Bis. Notably, dopamine failed
to phosphorylate the
1 subunit in OK cells expressing
the S18A mutant.

View larger version (20K):
[in a new window]
Fig. 3.
Phosphorylation of
Na+,K+-ATPase
1 subunit in OK
cells wild type and in S11A and S18A mutants. Cells were incubated
with or without 1 µM DA and with DA in the presence of 1 µM bisindolylmaleimide at 23 °C for 3 min. The
immunoprecipitated
1 subunit was analyzed by
autoradiography and Western blot (a representative experiment is shown
in the left panel). The bar graph (right
panel) represents the quantitative data + S.E. from five
experiments. ** p < 0.01; n.s., not
significant.
1 Subunit--
As reported earlier (Fig. 1 of Ref. 4)
inhibition of Na+,K+-ATPase activity is the
consequence of a redistribution of enzyme units between the plasma
membrane and intracellular compartments. When we reexamined our data in
quantitative fashion from three experiments (Fig.
4), it is shown that upon incubation with
dopamine a similar proportion (~40%) of
1 subunits
that leave the plasma membrane-enriched fraction (B) appear
in the endosome-enriched fraction (C), whereas the
proportion of
1 subunits in fraction A (lysosomes,
mitochondria, endoplasmic reticulum) does not change significantly.

View larger version (15K):
[in a new window]
Fig. 4.
Distribution of
Na+,K+-ATPase
1 subunit in
plasma membrane- and endosome-enriched fractions in response to
dopamine. Cells incubated in the presence (15 min at 23 °C) or
absence of 1 µM dopamine were fractionated using sucrose
density gradients, and samples were collected, separated by
SDS-polyacrylamide gel electrophoresis, and analyzed by Western
blotting as described (4). The quantitative analysis (Western blot
scanning) of three experiments is shown. Each bar represents
the mean + S.E.
subunits, and the differences in distribution when
mutants are used, we examined whether phosphorylation of Ser-18 is
essential for endocytosis by assessing the abundance of
1 subunits in early and late endosomes. OK cells (Wt,
S11A, and S18A) in suspension were incubated with or without 1 µM dopamine at 23 °C (Fig.
5) for 10 min (although different from
that used to measure phosphorylation (3 min), this incubation time was
chosen to enable us to detect an increase of
1 subunit
abundance in both early and late endosomes (see Ref. 4)). Dopamine
increased the abundance of
1 subunits in early and late
endosomes in Wt (p < 0.05, n = 4) and
to a somewhat lesser extent in early endosomes from S11A
(p < 0.05, n = 4); this effect was
blocked in both groups by coincubation with the PKC inhibitor Bis. Bis
alone had no significant effect on
1 subunit abundance
(not shown). However, in OK cells expressing the
Na+,K+-ATPase
1 subunit carrying
the S18A mutation, dopamine failed to induce a significant change in
1 subunit abundance in either early or late endosomes
(Fig. 5, lower panel). This observation adds further support
for a causal relationship between phosphorylation of Ser-18 and
endocytosis of the
subunit in response to dopamine.

View larger version (26K):
[in a new window]
Fig. 5.
Na+,K+-ATPase
1 subunit abundance in endosomes of OK cells (wild type)
and in those carrying the S11A and S18A mutants. Cells were
incubated with or without 1 µM DA and with DA in the
presence of 1 µM bisindolylmaleimide at 25 °C for 3 min. The
1 subunit abundance was assessed by Western
blotting. A representative experiment for each cell type is depicted in
the left panels. The bar graphs (right
panels) represent the mean + S.E. from five to seven experiments.
Solid bars, +DA; open bars, +DA + Bis. *,
p < 0.05.
1 Subunit
Abundance in Clathrin-coated Vesicles--
To determine whether
phosphorylation of Ser-18 was also required for
clathrin-dependent internalization of the
1
subunit, CCVs were prepared from OK cells expressing the Wt or S18A
1 subunit (Fig. 6). The
S11A mutant was not studied in this protocol, because this mutation
does not affect the ability of dopamine to phosphorylate the
subunit nor to inhibit its activity. OK cells in suspension were
incubated (2.5 min) with or without 1 µM DA at 23 °C.
While dopamine treatment increased
1 subunit abundance
in CCV from Wt cells (p < 0.05, n = 4), it failed to do so in OK cells carrying the S18A mutation.

View larger version (18K):
[in a new window]
Fig. 6.
Na+,K+-ATPase
1 subunit abundance in CCV prepared from OK cells
transfected with the rat
1 subunit isoform or the
1 subunit carrying the S18A mutation. Cells were
incubated with or without 1 µM DA for 2.5 min at
23 °C. Protein (
subunit) abundance was analyzed by Western blot
and quantitated by densitometer scanning. A representative blot is
shown in the upper panel. Each bar represents the
mean + S.E. of five experiments. *, p < 0.05;
n.s., not significant.
![]()
DISCUSSION
subunit in the basolateral plasma membrane occurs at the Ser-18
residue, but this event per se does not modify the enzyme's
catalytic activity. Rather, the decreased
Na+,K+-ATPase activity in intact cells is
caused by the removal of pump molecules from the basolateral plasma
membrane and internalization by endocytosis, for which phosphorylation
of the catalytic subunit appears to serve as a triggering signal.
subunit phosphorylation by approximately 40% (Fig. 1B).
In addition, back phosphorylation of the immunoprecipitated
subunit
demonstrated a reduced amount of dephosphoprotein of ~30% (Fig.
1A). PKC phosphorylated the immunoprecipitated
subunit
from vehicle treated cells to a stoichiometry of ~0.35 mol/mol and of
~0.20 mol/mol from dopamine-treated cells. Thus, we have estimated
that dopamine phosphorylates the Na+,K+-ATPase
to a stoichiometry of ~0.15 mol of phosphate/mol of
subunit,
which constitutes ~40% of maximal stoichiometry (~0.35 mol/mol).
The stoichiometry of
subunit phosphorylation has been reported to
range between 0.33 and 1.0 mol/mol for the rat
subunit, whereas in
species lacking Ser-18 it has been shown to be no higher than 0.15 mol/mol (Ref. 18 and references therein). While those studies were
performed using purified preparations
(Na+,K+-ATPase and protein kinase C), the
stoichiometry achieved in intact cells in response to a physiologic
agonist has not been reported before.
and
subunits (4). Internalization occurs via clathrin vesicle
formation and sequential transport into early and late endosomes. This
process requires stimulation of phosphatidylinositol 3-kinase
activity, the time course of which coincides with the increased
appearance of
subunits in the CCV compartment. The increased
abundance of
subunits in CCV, EE, and LE was blocked by two
phosphatidylinositol 3-kinase inhibitors, wortmannin or LY294009 (10),
which differ in their potency, selectivity, and mode of action. The use
of these compounds provides therefore a convenient model for testing
whether preventing endocytosis affects the degree of
subunit
phosphorylation in the plasma membrane and/or the changes in its
catalytic activity in response to dopamine. In this study the magnitude
of phosphorylation in the presence of dopamine was similar to that
reported previously (11) and was not affected by the presence of either
wortmannin or LY294009. However, the ability of dopamine to inhibit
Na+,K+-ATPase activity was blunted if PCT cells
were pretreated with either of the two phosphatidylinositol 3-kinase
inhibitors (Fig. 1). The inhibitors by themselves did not significantly
affect the degree of phosphorylation or of constitutive endocytosis, suggesting that during nonstimulated conditions these two processes have a relatively long half-life.
subunit incorporation
was impaired only at the endosomal level, and under this condition
dopamine efficiently inhibited Na+,K+-ATPase
activity, suggesting that subunit internalization in CCVs is sufficient
to cause a decrease in Na+,K+-ATPase activity.
In aggregate, these observations strongly suggest that it is the
removal of the
subunit from the plasma membrane rather than its
phosphorylation that results in decreased cell Na+,K+-ATPase activity, a mechanism perhaps
analogous to that of other ion transport proteins such as the
epithelial sodium channel (1) and H+/K+-ATPase
(2).
1 subunit NH2
terminus. Mutation of Ser-11, another
1 subunit residue
phosphorylated in vitro by PKC (16), did not affect the
ability of DA to increase phosphorylation and stimulate internalization of the
1 subunit nor the inhibitory action of DA on the
enzymatic activity.
1 subunit that
undergo phosphorylation have been identified either in cell-free preparations by utilizing purified PKC (16) or in intact cells after
activation of PKC by phorbol esters (23, 37). The former study
established that approximately 75% of the phosphorylated subunit
corresponded to Ser-18, whereas the rest was localized to Ser-11 (16),
a distribution whose physiological relevance is uncertain. Our study
suggests that in response to a physiological agonist (dopamine) only
Ser-18 in the rat
1 subunit is phosphorylated and that
this is essential for endocytosis of the
subunit and inhibition of
Na+,K+-ATPase activity. Substitution of Ser-11,
although a PKC substrate (in cell-free preparations of
Na+,K+-ATPase), did not affect its endocytosis
in intact cells nor the changes in
Na+,K+-ATPase activity elicited by dopamine,
suggesting that the Ser-11 does not represent a regulatory site in this
process in the rat. It is possible, however, as proposed by Vasilets
(23), that in other species (lacking Ser-18) Ser-11 represents the PKC
phosphorylation site that modulates
Na+,K+-ATPase activity and perhaps
1 subunits endocytosis.
subunit and triggers this process, but it does not in itself affect the intrinsic properties of the enzyme. Once the molecules are internalized they become inactive, as the increased abundance of
and
subunits in intracellular compartments is not
accompanied by a parallel increase in
Na+,K+-ATPase catalytic activity (4). Finally,
some of the subunits may become dephosphorylated in late endosomes
(11). This may be a step that serves as a signal for their recruitment
to the plasma membrane (existence of such a regulatory pathway has been recently described in lung epithelial cells (38)) and/or their function
in these organelles may be necessary for controlling membrane potential
and intracellular pH, important factors required for vesicle sorting
(39, 40).

View larger version (21K):
[in a new window]
Fig. 7.
Schematic representation of the postulated
state of phosphorylation of the Na+,K+-ATPase
subunit and activity during endocytosis (for explanations see
"Discussion"). Early E., early endosomes;
Late E., late endosomes.
| |
FOOTNOTES |
|---|
* This work was supported in part by funds from the Swedish Medical Research Council (to A. M. B., and P.-O. B), the National Institutes of Health (to C. H. P. (Grant DK52273) and T. A. P.), FNRS (to E. F.), and from the American Heart Association (to C. H. P.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
** To whom correspondence should be addressed: The Rolf Luft Center L6B:01, Karolinska Hospital, S-171 76 Stockholm, Sweden. Tel.: 46-8-517-75727; Fax: 46-8-517-73658; E-mail: alejan{at}enk.ks.se.
The abbreviations used are: CCV, clathrin-coated vesicles; GPCRs, G protein-coupled receptors; PKC, protein kinase C; PCT, proximal convoluted tubules; OK, opossum kidney; Bis, bisindolylmaleimide; DA, dopamine; Wt, wild type; EE, early endosomes; LE, late endosomes; MES, 2-(N-morpholino)ethanesulfonic acid.
2 A. V. Chibalin, A. I. Katz, and A. M. Bertorello, unpublished observations.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
H. Cai, L. Wu, W. Qu, D. Malhotra, Z. Xie, J. I. Shapiro, and J. Liu Regulation of apical NHE3 trafficking by ouabain-induced activation of the basolateral Na+-K+-ATPase receptor complex Am J Physiol Cell Physiol, February 1, 2008; 294(2): C555 - C563. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kimura, P. B. Allen, A. C. Nairn, and M. J. Caplan Arrestins and Spinophilin Competitively Regulate Na+,K+-ATPase Trafficking through Association with a Large Cytoplasmic Loop of the Na+,K+-ATPase Mol. Biol. Cell, November 1, 2007; 18(11): 4508 - 4518. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sjostrom, K. Stenstrom, K. Eneling, J. Zwiller, A. I. Katz, H. Takemori, and A. M. Bertorello SIK1 is part of a cell sodium-sensing network that regulates active sodium transport through a calcium-dependent process PNAS, October 23, 2007; 104(43): 16922 - 16927. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Schoner and G. Scheiner-Bobis Endogenous and exogenous cardiac glycosides: their roles in hypertension, salt metabolism, and cell growth Am J Physiol Cell Physiol, August 1, 2007; 293(2): C509 - C536. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Kirchheimer, C. F. Mendez, A. Acquier, and S. Nowicki Role of 20-HETE in D1/D2 dopamine receptor synergism resulting in the inhibition of Na+-K+-ATPase activity in the proximal tubule Am J Physiol Renal Physiol, May 1, 2007; 292(5): F1435 - F1442. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Lecuona, L. A. Dada, H. Sun, M. L. Butti, G. Zhou, T.-L. Chew, and J. I. Sznajder Na,K-ATPase {alpha}1-subunit dephosphorylation by protein phosphatase 2A is necessary for its recruitment to the plasma membrane FASEB J, December 1, 2006; 20(14): 2618 - 2620. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Collawn Unlocking the Mysteries of Na+-K+-ATPase Endocytosis: Phosphorylation Is the Key. Am. J. Respir. Cell Mol. Biol., July 1, 2006; 35(1): 1 - 2. [Full Text] [PDF] |
||||
![]() |
Z. Chen, R. T. Krmar, L. Dada, R. Efendiev, I. B. Leibiger, C. H. Pedemonte, A. I. Katz, J. I. Sznajder, and A. M. Bertorello Phosphorylation of Adaptor Protein-2 {micro}2 Is Essential for Na+,K+-ATPase Endocytosis in Response to Either G Protein-Coupled Receptor or Reactive Oxygen Species Am. J. Respir. Cell Mol. Biol., July 1, 2006; 35(1): 127 - 132. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Song, M. Y. Lee, S. P. Kinsey, D. J. Weber, and M. P. Blaustein An N-terminal Sequence Targets and Tethers Na+ Pump {alpha}2 Subunits to Specialized Plasma Membrane Microdomains J. Biol. Chem., May 5, 2006; 281(18): 12929 - 12940. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Efendiev and C. H. Pedemonte Contrary to Rat-Type, Human-Type Na,K-ATPase Is Phosphorylated at the Same Amino Acid by Hormones that Produce Opposite Effects on Enzyme Activity J. Am. Soc. Nephrol., January 1, 2006; 17(1): 31 - 38. [Abstract] |