Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chibalin, A. V.
Right arrow Articles by Bertorello, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chibalin, A. V.
Right arrow Articles by Bertorello, A. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 4, 1920-1927, January 22, 1999


Dopamine-induced Endocytosis of Na+,K+-ATPase Is Initiated by Phosphorylation of Ser-18 in the Rat alpha  Subunit and Is Responsible for the Decreased Activity in Epithelial Cells*

Alexander V. Chibalin, Goichi Ogimoto, Carlos H. PedemonteDagger , Thomas A. Pressley§, Adrian I. Katz, Eric Férailleparallel , Per-Olof Berggren, and Alejandro M. Bertorello**

From the Department of Molecular Medicine, Karolinska Institutet, The Rolf Luft Center for Diabetes Research, Karolinska Hospital, S-171 76 Stockholm, Sweden, the Dagger  Department of Pharmacological and Pharmaceutical Sciences, College of Pharmacy, University of Houston, Houston, Texas 77204, the § Department of Physiology, Texas Tech University, Lubbock, Texas 79430, the  Department of Medicine, University of Chicago, Chicago, Illinois 60637, and the parallel  Division de Néphrologie, Hôpital Cantonal Universitaire, CH-1211 Geneva 14, Switzerland

    ABSTRACT
Top
Abstract
Introduction
References

Dopamine inhibits Na+,K+-ATPase activity in renal tubule cells. This inhibition is associated with phosphorylation and internalization of the alpha  subunit, both events being protein kinase C-dependent. Studies of purified preparations, fusion proteins with site-directed mutagenesis, and heterologous expression systems have identified two major protein kinase C phosphorylation residues (Ser-11 and Ser-18) in the rat alpha 1 subunit isoform. To identify the phosphorylation site(s) that mediates endocytosis of the subunit in response to dopamine, we have performed site-directed mutagenesis of these residues in the rat alpha 1 subunit and expressed the mutated forms in a renal epithelial cell line. Dopamine inhibited Na+,K+-ATPase activity and increased alpha  subunit phosphorylation and clathrin-dependent endocytosis into endosomes in cells expressing the wild type alpha 1 subunit or the S11A alpha 1 mutant, and both effects were blocked by protein kinase C inhibition. In contrast, dopamine did not elicit any of these effects in cells expressing the S18A alpha 1 mutant. While Ser-18 phosphorylation is necessary for endocytosis, it does not affect per se the enzymatic activity: preventing endocytosis with wortmannin or LY294009 blocked the inhibitory effect of dopamine on Na+,K+-ATPase activity, although it did not alter the increased alpha  subunit phosphorylation induced by this agonist.

We conclude that dopamine-induced inhibition of Na+,K+-ATPase activity in rat renal tubule cells requires endocytosis of the alpha  subunit into defined intracellular compartments and that phosphorylation of Ser-18 is essential for this process.

    INTRODUCTION
Top
Abstract
Introduction
References

Regulation of the Na+ channel (1), H+,K+-ATPase (2) and Na+,K+-ATPase (3, 4) activity appears to involve removal from, or retention within, the plasma membrane of these transport proteins: while Na+ channels and H+,K+-ATPase activity in intact cells are constitutively increased by the removal of specific endocytic signals, internalization of Na+,K+-ATPase is associated with activation of specific membrane receptors and depends on the sequence of intracellular signals generated from this interaction (4, 5).

Endocytosis of integral membrane proteins is initiated by selective recognition of the target protein followed by its transport, usually via clathrin-coated vesicles (CCV),1into endosomes (6-9). While endocytosis of membrane receptors as part of their signaling mechanism has been extensively studied, internalization of integral membrane proteins triggered by a network of signals generated after activation of G proteins-coupled receptors (GPCRs) is less well documented.

Inhibition of Na+,K+-ATPase activity by activation of GPCRs (dopaminergic) in renal epithelial cells is associated with the removal of active units from the basolateral plasma membrane and their transport, via clathrin-coated vesicles, into early (EE) and late endosomes (LE) (4). This process requires activation of phosphatidylinositol 3-kinase (10) and is dependent on protein kinase C (11). Protein kinase C (PKC) phosphorylates the Na+,K+-ATPase alpha 1 subunit in cell-free preparations (12-16) and this event is associated with a decrease in its catalytic activity (13, 15). However, because in some reports investigators have failed to demonstrate an effect of PKC on the hydrolytic activity of purified preparations (16, 17), or of phorbol esters in cell lines (18), it remains unclear whether Ser/Thr phosphorylation of the alpha 1 subunit represents a physiological mechanism responsible for Na+,K+-ATPase inhibition in intact cells.

In PCT (proximal convoluted tubule) segments phorbol esters (19, 20) and diacylglycerol analogs (20, 21) inhibit Na+,K+-ATPase activity. In OK (opossum kidney) cells and Xenopus oocytes phorbol esters decrease ouabain-sensitive Rb+ transport, and this decrease is associated with phosphorylation of the Na+,K+-ATPase alpha 1 subunit (22, 23). However, expression of a mutated form (Ser-18) alone or in combination with another mutation (Ser-11) in Xenopus oocytes revealed a variable response of Rb+ transport, depending on whether phorbol esters or purified PKC was used (23). Moreover, phorbol esters have been also associated with stimulation of ouabain-sensitive Rb+ transport in PCT segments (24, 25) and OK cells (26).

Earlier experimental approaches often relied on the action of phorbol esters as direct activators of protein kinase C. The variety of Na+,K+-ATPase responses to these agents seen in intact cells could represent compensatory homeostatic mechanisms due to phosphorylation of numerous substrates,2 resulting, for example, in increased fluid phase endocytosis (27) that would affect Na+,K+-ATPase function. Using a physiologic ligand (dopamine) we have demonstrated that inhibition of Na+,K+-ATPase activity in renal proximal tubule cells was associated with phosphorylation and selective endocytosis of the alpha 1 subunit (4, 11). Furthermore, these two events were connected, because the rat alpha 1 subunit carrying an amino-terminal deletion (first 28 residues) that includes the PKC target sites (Ser-11/Ser-18) was not internalized in response to dopamine (11).

While these results indicate that phosphorylation of the alpha  subunit in response to dopamine is necessary for internalization, it remains unclear whether inhibition of the enzymatic activity in intact cells results from phosphorylation of the subunit in the plasma membrane (so that Na+,K+-ATPase undergoes a conformational change in situ that decrease its activity) or from the endocytic process, i.e. inhibition occurs only as a result of decreased Na+,K+-ATPase units in the plasma membrane. In addition, because the two residues (Ser-11 and Ser-18) phosphorylated by PKC in purified preparations (16) are within the NH2 terminus of the alpha 1 subunit, in this study we have utilized site-directed mutagenesis to determine in intact cells whether Ser-11 or Ser-18, or both are phosphorylation targets involved in Na+,K+-ATPase endocytosis and inhibition of its catalytic activity in response to dopamine.

    EXPERIMENTAL PROCEDURES

Materials-- All chemicals were from Sigma, except bisindolylmaleimide (Bis) and LY294009, which were purchased from Calbiochem. Na+,K+-ATPase alpha  subunit abundance in clathrin vesicles and early and late endosomes was determined using a monoclonal antibody kindly provided by Dr. M. Caplan (Yale University). Immunoprecipitation of the Na+,K+-ATPase in the phosphorylation experiments was performed using a polyclonal antibody raised against the rat Na+,K+-ATPase alpha  subunit (25).

Preparation of PCT Cells-- PCT cells were prepared as described before (11). Briefly, male Sprague-Dawley rats (BK Universal, Sollentuna, Sweden) weighing between 150 and 200 g were used. After the kidneys were removed and the cortex isolated, the tissue was moistened on ice to a paste-like consistency. The cortical minceate was incubated with 0.625 mg/ml collagenase (Type I, Sigma) in 50 ml of Hanks' medium (Life Technologies, Inc.). The incubation was carried out at 37 °C for 60 min, the solution being continuously exposed to 95% O2, 5% CO2 and was terminated by placing the tissue on ice and pouring through graded sieves (75-53-38 µm pore size) to obtain a cell suspension. The PCT cells were washed three to four times by centrifugation at 100 × g for 4 min in order to separate the remaining blood cells and traces of collagenase and were then kept on ice. Cells were resuspended to yield a protein concentration of approximately 3.5-5.0 mg/ml and were used immediately after preparation.

Site-directed Mutagenesis-- Wild type and mutant forms of the Na+,K+-ATPase alpha 1 subunit of rat were prepared from complementary DNA for expression by mammalian cells in culture. Wild type alpha 1 cDNA was a gift of Dr. Jerry B. Lingrel (28). Wild type sequence was annealed with complementary oligonucleotides containing the desired change and then subjected to 10-15 cycles of amplification with Pfu polymerase, followed by restriction of the original wild type template with DpnI. The resulting mutant plasmids were then transformed into bacteria for recovery and analysis. Substitution of an alanine for the first serine, alpha 1 (S11A), was accomplished with the oligonucleotide TATGAGCCCGCAGCTGTGGCCGAACATGGGGACAAGAAGA and its complement. Substitution of an alanine for the second serine, alpha 1 (S18A), was accomplished with the oligonucleotide AGAACATGGGGACAAGAAGGCCAAGAAGGCGAAGAAGGAA and its complement. A diagnostic HaeIII site was introduced for both mutants. Structure of the resulting mutants was evaluated by restriction with the appropriate endonuclease and confirmed by dideoxynucleotide sequencing of the altered region. Mutant cDNAs were subcloned downstream from the immediate early promoter of human cytomegalovirus in pcDNA3.1 (Invitrogen, San Diego, CA).

Cell Transfection-- OK cells were transfected with the various cDNA plasmids using liposomes (26, 29). Two days after transfection, the cells were transferred to a medium containing 10 µM ouabain. Because the endogenous Na+,K+-ATPase of OK cells is sensitive to this level of ouabain, only OK cells that express the Na+,K+-ATPase containing the rodent alpha  subunit would be able to survive. After 10 days, resistant colonies were expanded and maintained all the time in medium containing 10 µM ouabain. Experiments were performed with a mix of at least 20 clones.

Determination of Na+,K+-ATPase Activity in OK Cells-- Transfected cells (maintained at all times in 10 µM ouabain) were incubated in modified Hanks' medium in the presence or absence of 1 µM DA at room temperature for 2.5 min. The incubation was terminated by placing the samples on ice. Cell aliquots (approximately 5-15 µg of protein) were transferred to the Na+,K+-ATPase assay medium (final volume, 100 µl) containing in mM: 50 NaCl, 5 KCl, 10 MgCl2, 1 EGTA, 50 Tris-HCl, 10 Na2ATP (Calbiochem) and [gamma -32P]ATP (NEN Life Science Products; specific activity, 3000 Ci/mmol) in tracer amounts (3.3 nCi/µl). Na+,K+-ATPase activity was then determined after permeabilization of the cells as described before (4). Total Na+,K+-ATPase activity was measured in samples containing 10 µM ouabain. Thus, cells remained exposed to this ouabain concentration at all times, including after permeabilization, the magnesium-dependent ATPase activity was measured in a medium containing 4 mM ouabain. The difference between these two groups represents the activity of the "transfected" ouabain-resistant isoform.

A portion of Na+,K+-ATPase molecules is located in intracellular organelles. The sum of their activities (nmol of Pi/mg of protein/min) in CCV, ~20 and EE, ~15, constitutes approximately 30% of total cell activity, 112 nmol of Pi/mg of protein/min (4). Because their presence in these compartments may affect the interpretation of activities obtained in whole cells, we have validated our method by comparing the Na+,K+-ATPase hydrolytic activity in PCT cells permeabilized by thermic shock (-20 °C) to a well established method for cell permeabilization, e.g. treatment with digitonin (30). In five separate experiments Na+,K+-ATPase activity (nmol of Pi/mg of protein/min) in PCT cells subjected to permeabilzation at -20 °C was 99 ± 8, not significantly different from that of PCT cells permeabilized by incubation with 50 µM digitonin during 10 min at 37 °C (116 ± 13, p = 0.313). When cells previously exposed to -20 °C for 10 min were incubated with digitonin, which now would also access the interior of the cell, the Na+,K+-ATPase activity was significantly increased (161 ± 9, n = 4, p < 0.05 versus digitonin alone). This increase (~38%) probably reflects to a large extent the contribution of pump activity in these organelles and suggests that incubation of intact cells at -20 °C or with digitonin alone results only in permeabilization of the plasma membrane but not of membranes from intracellular organelles, such as clathrin vesicles and early endosomes.

Phosphorylation and Immunoprecipitation of Na+,K+-ATPase in Intact Cells-- Renal PCT cells (4-6 mg of protein/3 ml) were labeled during 2 h at 32 °C in a buffer containing (in mM): 120 NaCl, 5 KCl, 4 NaHCO3, 1 CaCl2, 1 MgSO4, 0.2 NaH2PO4, 0.15 Na2HPO4, 5 glucose, 10 lactate, 1 pyruvate, 20 HEPES, and 1% bovine serum albumin, pH 7.45, with the addition of 250 µCi/ml [32P]orthophosphate (NEN Life Science Products). OK cells (2.0-2.5 mg of protein/dish) were labeled in the same buffer (2.5 ml/dish) containing 100 µCi/ml [32P]orthophosphate for 2.5 h at 37 °C. All incubations with different agonists were performed at room temperature. The incubation was terminated by removing the medium, addition of immunoprecipitation buffer (100 mM NaCl, 50 mM Tris-HCl, 2 mM EGTA, 30 mM NaF, 30 mM Na4O7P2, 1 mM Na3VO4, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, 4 µg/ml aprotinin, and 1% Triton X-100, pH 7.45) and placing the samples on ice. The cells were disrupted by gentle homogenization. Immunoprecipitation of the Na+,K+-ATPase alpha  subunit was performed as described (11). Briefly, aliquots (200 µg of protein) were incubated overnight at 4 °C with 50 µl of rabbit polyclonal antibody (preliminary experiments demonstrated that this antibody does not immunoprecipitate the wild type alpha  subunit) and the simultaneous addition of excess protein A-Sepharose beads (Pharmacia Biotech, Uppsala, Sweden). Samples were analyzed by SDS-polyacrylamide gel electrophoresis using the Laemmli buffer system (31). Proteins were transferred to polyvinylidene difluoride membranes (Immobilon-P, Millipore, Bedford, MA) and subjected to autoradiography. Phosphoproteins were analyzed by phosphoimaging, and quantitation was performed as described (4).

Quantitation of Na+,K+-ATPase alpha  Subunit Phosphorylation State-- In order to estimate the stoichiometry of the alpha  subunit phosphorylation we used the "back phosphorylation" technique (32). PCT cells were incubated in the presence or absence of 1 µM dopamine at 23 °C for 2.5 min. The incubation was terminated by addition of homogenization buffer, and immunoprecipitation of the alpha  subunit was performed as described above. The immunoprecipitated alpha  subunit (~0.25 µg) was phosphorylated by purified protein kinase C (70 ng/50 µl; 30 min at 30 °C) in the presence of [gamma -32P]ATP (NEN Life Science Products), 10 mM MgCl2, 0.4 mM CaCl2, 0.25 mM EGTA, 0.32 mg/ml phosphatidylserine, 0.03 mg/ml diacylglycerol, 0.1 mg/ml bovine serum albumin, 100 µM Na2ATP, 20 mM Tris-HCl, pH 7.5. Samples were analyzed by SDS-polyacrylamide gel electrophoresis. Gels were stained by Coomassie Blue. The radioactivity incorporated into the alpha  subunit excised from the gel was counted (Cherenkov), and the number of moles of phosphate incorporated per mole of alpha  subunit was calculated as described (13). The amount of immunoprecipitated alpha  subunit was calculated by scanning densitometry using bovine serum albumin as standard.

Preparation of Endosomes-- OK cells in suspension (1.5 mg of protein/ml) were incubated under different protocols at room temperature. Incubation was terminated by transferring the samples to ice and addition of cold homogenization buffer containing 250 mM sucrose and 3 mM imidazole, 2 mM EGTA, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, 4 µg/ml aprotinin, pH 7.4. Cells were gently homogenized (15-20 strokes) to minimize damage of the endosomes, using a pellet pestle motor homogenizer, and the samples were subjected to a brief (5 min) centrifugation (4 °C, 3000 × g). Endosomes were fractionated on a flotation gradient as described (4), using essentially the technique of Gorvel et al. (33). These fractions were not cross-contaminated, i.e. Rab5 was located exclusively in EE, whereas mannose 6-phosphate receptor immunoreactivity was located in LE (4).

Preparation of Clathrin-coated Vesicles-- Isolation of clathrin vesicles was performed as described (4, 34). After preincubation with or without 1 µM DA (3 min at 25 °C), OK cells were homogenized using a Potter homogenizer (three strokes; 30 s) in 1 mM EGTA, 0.5 mM MgCl2, 0.1 M MES, and 0.2 mg/ml NaN3, titrated to pH 6.5 with NaOH. The homogenate was centrifuged at 85,000 × g for 1 h, and the pellet was resuspended in the same buffer and applied to a discontinuous sucrose gradient (w/v): 60, 50, 40, 10, and 5%. Samples were then centrifuged at 80,000 × g for 75 min and collected from the 10-40% interface; they were washed in homogenization buffer and pelleted at 85,000 × g for 1 h. Wheat germ agglutinin was added to a concentration of 1:10 mg of protein and incubated overnight at 4 °C. The agglutinated material was sedimented at 20,000 × g for 15 min. CCV were negatively stained for both Rab5 and mannose 6-phosphate receptor (4).

Preparation of Basolateral Plasma Membranes-- After separation of early and late endosomes, another fraction (500 µl) was collected at the 16 and 42% sucrose interface corresponding to cell ghosts, mitochondria, and plasma membranes. Basolateral plasma membranes were further purified as described (11).

Miscellaneous-- Protein content was determined according to Bradford (35). Western blots were developed with an ECL or ECL Plus (Amersham, Amersham, UK) detection kit. Scans were performed using a Scan Jet IIc scanner (Hewlett-Packard, Palo Alto, CA). Quantitation of the phosphorylated Na+,K+-ATPase alpha  subunit was performed as described (11) using a Fuji Bas 1000 Bio-imaging analyzer (Fuji Co., Tokyo, Japan), and the data (arbitrary units) were analyzed using a software Tina 2.07 ray test (Isotopenmessyeräte GmbH, Staulenhardt, Germany).

Statistics-- Comparison between two experimental groups were made by the nonpaired Student's t test. For multiple comparisons one way analysis of variance with Sheffe's correction was used. p < 0.05 was considered significant.

    RESULTS

Effect of Subunit Endocytosis on Na+,K+-ATPase Activity-- The Na+,K+-ATPase alpha  subunit is phosphorylated in response to dopamine, maximal phosphorylation (~40%) being achieved after 2.5-min incubation at 23 °C with 1 µM dopamine. Using back phosphorylation we have observed in two independent experiments that dopamine decreased the amount of dephospho-alpha subunit (dephosphoprotein, percent of control: 67 (experiment 1) and 70 (experiment 2), Fig. 1A). Because the total amount of immunoprecipitated Na+,K+-ATPase alpha  subunit was the same, the results further demonstrated that the alpha  subunit is phosphorylated in the presence of dopamine. The alpha  subunit immunoprecipitated from vehicle-treated cells was phosphorylated to a stoichiometry of 0.33 (experiment 1)/0.38 (experiment 2) mol/mol, whereas that from dopamine-treated cells to 0.20 (experiment 1)/0.25 (experiment 2) mol/mol, respectively. This indicates that in intact cells dopamine phosphorylates the Na+,K+-ATPase alpha  subunit with a stoichiometry of ~0.15 mol/mol (~40% of maximal).


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 1.   Effect of dopamine on PCT cells Na+,K+-ATPase activity, alpha 1 subunit phosphorylation, and endocytosis. A, amounts of dephospho-alpha subunit from cells incubated in the presence or absence of 1 µM dopamine (2.5 min at 23 °C). Autoradiograph of alpha  subunit phosphorylation and percent of dephosphoprotein from two independent experiments are shown. Equal amounts of immunoprecipitated alpha 1 subunit (0.25 µg) were loaded in each lane. B, the effect of 1 µM DA (2.5 min at 23 °C) on the state of phosphorylation of the immunoprecipitated alpha 1 subunit was determined after preincubation with or without 100 nM wortmannin (W or WT) or 25 µM LY 294009 (LY) for 20 min at 23 °C. Each bar represents the mean of three experiments + S.E. C, Na+,K+-ATPase activity was determined in PCT cells using the same protocols as described in A. Each bar represents the mean value of five experiments + S.E. performed in triplicate. *, p < 0.05; **, p < 0.01. Lanes C in A and B indicates control..

To determine the relative roles of alpha  subunit phosphorylation and internalization during inhibition of Na+,K+-ATPase activity in PCT cells, we examined the effect of dopamine on Na+,K+-ATPase activity and alpha  subunit phosphorylation under conditions where endocytosis was blocked. We have reported previously that preincubation with wortmannin or LY294009 prevented the endocytosis of alpha  subunits into clathrin vesicles and early and late endosomes induced by dopamine (10). In the present study we assessed the effect of 1 µM dopamine on Na+,K+-ATPase activity and alpha  subunit phosphorylation in PCT cells that have been treated with 100 nM wortmannin (W) or 25 µM LY 294009 (LY) for 20 min at 23 °C before incubation with the ligand (Fig. 1). Dopamine alone increased the state of phosphorylation of the immunoprecipitated alpha  subunit from the basolateral membrane (Fig. 1A) and decreased Na+,K+-ATPase activity (Fig. 1B). Dopamine-induced phosphorylation was not altered by wortmannin or LY294009 (Fig. 1A). However, the inhibition of Na+,K+-ATPase activity was blocked by pretreatment with either wortmannin or LY294009 (Fig. 1B). Wortmannin or LY294009 alone did not affect Na+,K+-ATPase activity or alpha  subunit phosphorylation. These results suggest that phosphorylation is a necessary, but not a sufficient, event for Na+,K+-ATPase inhibition, i.e. although it triggers the endocytosis, it is the removal of the subunits from the plasma membrane, rather than the increased phosphorylation per se that decreases Na+,K+-ATPase activity in intact cells.

Effect of S11A and S18A Mutations on Na+,K+-ATPase Activity-- To determine the role of putative PKC phosphorylation residues during inhibition of Na+,K+-ATPase activity by dopamine, OK cells were transfected with mutants of the rat alpha 1 subunit in which either Ser-11 or Ser-18 were substituted by Ala residues. OK cells expressing wild type (Wt) and the mutants S11A and S18A alpha 1 subunit expressed comparable amounts of alpha 1 subunits as determined by Western blot analysis (Fig. 2A), and the Na+,K+-ATPase activity determined in plasma membranes was also similar (Fig. 2B). In intact OK cells dopamine (1 µM; 3 min at 23 °C) decreased significantly (p < 0.01, n = 4) Na+,K+-ATPase activity (Fig. 2C), and this inhibition was abolished by coincubation with 1 µM Bis. In OK cells expressing the S11A isoform the inhibitory effect of 1 µM dopamine was slightly less than that in cells expressing the Wt isoform (Wt: ~40% versus S11A: ~30%), but it was still significant (p < 0.01, n = 6). This effect as well was abolished by 1 µM Bis. In contrast, dopamine failed to induce a significant change in Na+,K+-ATPase activity in cells expressing the S18A mutant (Fig. 2C).


View larger version (75K):
[in this window]
[in a new window]
 
Fig. 2.   Na+,K+-ATPase alpha 1 subunit abundance and activity in OK cells. A, Na+,K+-ATPase alpha 1 subunit abundance in plasma membranes from Wt, S11A, and S18A-transfected cells examined by Western blotting. Equal amounts of protein (50 µg) were loaded in each sample. B, Na+,K+-ATPase activity in plasma membranes from Wt, S11A, and S18A-transfected cells. Each bar represents the mean + S.E. of three experiments performed in duplicate. C, Na+,K+-ATPase activity in intact cells incubated for 3 min at 25 °C with or without 1 µM dopamine in the presence or absence of 1 µM bisindolylmaleimide. Basal Na+,K+-ATPase activity was similar in all groups. Open bars represent the mean + S.E. of eight (+DA) and solid bars that of three (+DA+bis) experiments performed in triplicate. **, p < 0.01; n.s., not significant. D, photomicrographs of OK cells transfected with the intact rat alpha 1 subunit (Wt) or the Ser-11 (S11A) and Ser-18 (S18A) mutants. Cells were grown in Dulbecco's modified Eagle's medium, seeded onto plastic coverslips at 350 (Wt), 250 (S11A), and 260 (S18A) cells/µl and grown in 2.5 ml of Dulbecco's modified Eagle's medium. Photographs were taken after 16 h of culture. Bars = 10 µm.

It has been reported recently (36) that COS-7 cells expressing the Na+,K+-ATPase alpha 1 isoform carrying a mutation in a protein kinase C phosphorylation residue (S23A, corresponding to Ser-18 in our study) fail to adhere properly to fibronectin or plastic matrix. We have therefore examined whether OK cells seeded on plastic coverslips at a density of 350 (Wt), 250 (S11A) and 260 (S18A) cells/µl and grown in 2.5 ml Dulbecco's modified Eagle's medium in plastic Petri dishes exhibit any culture abnormalities. A representative photomicrograph demonstrates that after 16 h of culture, all OK cell types (Wt, S11A, and S18A) adhere and establish cell-to-cell contacts (Fig. 2D) and reach confluence within 36 h. Although we have not determined the intracellular sodium concentration or pH of the different OK cells examined, they did not display any differences in cell shape or size, e.g. an enlargement that would indicate a change in cell volume due to an abnormal intracellular ionic composition. Thus, one can speculate that the difference between these two studies could reflect merely the different cell lines used (COS-7 versus OK) rather than lack of the residue phosphorylated by protein kinase C.

Na+,K+-ATPase alpha 1 Subunit Phosphorylation-- To examine the state of alpha 1 subunit phosphorylation OK cells were metabolically labeled with [32P]orthophosphate and then incubated with or without 1 µM dopamine (3 min; 23 °C). The degree of phosphorylation of the alpha 1 subunit was determined by autoradiography (Fig. 3A) and corrected for the amount of immunoprecipitated material assessed by Western blot (Fig. 3A, lower panel, and B). Dopamine increased significantly (p < 0.01, n = 6) the alpha 1 subunit phosphorylation in Wt cells as well as in OK cells expressing the S11A mutant. The increase in phosphorylation was similar in Wt and S11A cells, and both effects were blocked by Bis. Notably, dopamine failed to phosphorylate the alpha 1 subunit in OK cells expressing the S18A mutant.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 3.   Phosphorylation of Na+,K+-ATPase alpha 1 subunit in OK cells wild type and in S11A and S18A mutants. Cells were incubated with or without 1 µM DA and with DA in the presence of 1 µM bisindolylmaleimide at 23 °C for 3 min. The immunoprecipitated alpha 1 subunit was analyzed by autoradiography and Western blot (a representative experiment is shown in the left panel). The bar graph (right panel) represents the quantitative data + S.E. from five experiments. ** p < 0.01; n.s., not significant.

Endocytosis of Na+,K+-ATPase alpha 1 Subunit-- As reported earlier (Fig. 1 of Ref. 4) inhibition of Na+,K+-ATPase activity is the consequence of a redistribution of enzyme units between the plasma membrane and intracellular compartments. When we reexamined our data in quantitative fashion from three experiments (Fig. 4), it is shown that upon incubation with dopamine a similar proportion (~40%) of alpha 1 subunits that leave the plasma membrane-enriched fraction (B) appear in the endosome-enriched fraction (C), whereas the proportion of alpha 1 subunits in fraction A (lysosomes, mitochondria, endoplasmic reticulum) does not change significantly.


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 4.   Distribution of Na+,K+-ATPase alpha 1 subunit in plasma membrane- and endosome-enriched fractions in response to dopamine. Cells incubated in the presence (15 min at 23 °C) or absence of 1 µM dopamine were fractionated using sucrose density gradients, and samples were collected, separated by SDS-polyacrylamide gel electrophoresis, and analyzed by Western blotting as described (4). The quantitative analysis (Western blot scanning) of three experiments is shown. Each bar represents the mean + S.E.

While the analysis of such distribution using cell fractionation on sucrose gradients is useful to calculate the proportional shift of subunits between these two compartments, it does not allow the accurate identification of the specific organelles into which the subunits are incorporated. Thus, to better illustrate the destination of the endocytosed alpha  subunits, and the differences in distribution when mutants are used, we examined whether phosphorylation of Ser-18 is essential for endocytosis by assessing the abundance of alpha 1 subunits in early and late endosomes. OK cells (Wt, S11A, and S18A) in suspension were incubated with or without 1 µM dopamine at 23 °C (Fig. 5) for 10 min (although different from that used to measure phosphorylation (3 min), this incubation time was chosen to enable us to detect an increase of alpha 1 subunit abundance in both early and late endosomes (see Ref. 4)). Dopamine increased the abundance of alpha 1 subunits in early and late endosomes in Wt (p < 0.05, n = 4) and to a somewhat lesser extent in early endosomes from S11A (p < 0.05, n = 4); this effect was blocked in both groups by coincubation with the PKC inhibitor Bis. Bis alone had no significant effect on alpha 1 subunit abundance (not shown). However, in OK cells expressing the Na+,K+-ATPase alpha 1 subunit carrying the S18A mutation, dopamine failed to induce a significant change in alpha 1 subunit abundance in either early or late endosomes (Fig. 5, lower panel). This observation adds further support for a causal relationship between phosphorylation of Ser-18 and endocytosis of the alpha  subunit in response to dopamine.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 5.   Na+,K+-ATPase alpha 1 subunit abundance in endosomes of OK cells (wild type) and in those carrying the S11A and S18A mutants. Cells were incubated with or without 1 µM DA and with DA in the presence of 1 µM bisindolylmaleimide at 25 °C for 3 min. The alpha 1 subunit abundance was assessed by Western blotting. A representative experiment for each cell type is depicted in the left panels. The bar graphs (right panels) represent the mean + S.E. from five to seven experiments. Solid bars, +DA; open bars, +DA + Bis. *, p < 0.05.

Na+,K+-ATPase alpha 1 Subunit Abundance in Clathrin-coated Vesicles-- To determine whether phosphorylation of Ser-18 was also required for clathrin-dependent internalization of the alpha 1 subunit, CCVs were prepared from OK cells expressing the Wt or S18A alpha 1 subunit (Fig. 6). The S11A mutant was not studied in this protocol, because this mutation does not affect the ability of dopamine to phosphorylate the alpha  subunit nor to inhibit its activity. OK cells in suspension were incubated (2.5 min) with or without 1 µM DA at 23 °C. While dopamine treatment increased alpha 1 subunit abundance in CCV from Wt cells (p < 0.05, n = 4), it failed to do so in OK cells carrying the S18A mutation.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 6.   Na+,K+-ATPase alpha 1 subunit abundance in CCV prepared from OK cells transfected with the rat alpha 1 subunit isoform or the alpha 1 subunit carrying the S18A mutation. Cells were incubated with or without 1 µM DA for 2.5 min at 23 °C. Protein (alpha  subunit) abundance was analyzed by Western blot and quantitated by densitometer scanning. A representative blot is shown in the upper panel. Each bar represents the mean + S.E. of five experiments. *, p < 0.05; n.s., not significant.


    DISCUSSION

The results of this study demonstrate that dopamine-dependent inhibition of Na+,K+-ATPase activity in intact cells is caused by a reduced number of active units within the plasma membrane. Phosphorylation of the Na+,K+-ATPase alpha  subunit in the basolateral plasma membrane occurs at the Ser-18 residue, but this event per se does not modify the enzyme's catalytic activity. Rather, the decreased Na+,K+-ATPase activity in intact cells is caused by the removal of pump molecules from the basolateral plasma membrane and internalization by endocytosis, for which phosphorylation of the catalytic subunit appears to serve as a triggering signal.

Dopamine increased the state of Na+,K+-ATPase alpha  subunit phosphorylation by approximately 40% (Fig. 1B). In addition, back phosphorylation of the immunoprecipitated alpha  subunit demonstrated a reduced amount of dephosphoprotein of ~30% (Fig. 1A). PKC phosphorylated the immunoprecipitated alpha  subunit from vehicle treated cells to a stoichiometry of ~0.35 mol/mol and of ~0.20 mol/mol from dopamine-treated cells. Thus, we have estimated that dopamine phosphorylates the Na+,K+-ATPase to a stoichiometry of ~0.15 mol of phosphate/mol of alpha  subunit, which constitutes ~40% of maximal stoichiometry (~0.35 mol/mol). The stoichiometry of alpha  subunit phosphorylation has been reported to range between 0.33 and 1.0 mol/mol for the rat alpha  subunit, whereas in species lacking Ser-18 it has been shown to be no higher than 0.15 mol/mol (Ref. 18 and references therein). While those studies were performed using purified preparations (Na+,K+-ATPase and protein kinase C), the stoichiometry achieved in intact cells in response to a physiologic agonist has not been reported before.

We have shown previously that activation of GPCRs by dopamine inhibits Na+,K+-ATPase activity in renal epithelial cells and that this inhibition was associated with endocytosis of its alpha  and beta  subunits (4). Internalization occurs via clathrin vesicle formation and sequential transport into early and late endosomes. This process requires stimulation of phosphatidylinositol 3-kinase activity, the time course of which coincides with the increased appearance of alpha  subunits in the CCV compartment. The increased abundance of alpha  subunits in CCV, EE, and LE was blocked by two phosphatidylinositol 3-kinase inhibitors, wortmannin or LY294009 (10), which differ in their potency, selectivity, and mode of action. The use of these compounds provides therefore a convenient model for testing whether preventing endocytosis affects the degree of alpha  subunit phosphorylation in the plasma membrane and/or the changes in its catalytic activity in response to dopamine. In this study the magnitude of phosphorylation in the presence of dopamine was similar to that reported previously (11) and was not affected by the presence of either wortmannin or LY294009. However, the ability of dopamine to inhibit Na+,K+-ATPase activity was blunted if PCT cells were pretreated with either of the two phosphatidylinositol 3-kinase inhibitors (Fig. 1). The inhibitors by themselves did not significantly affect the degree of phosphorylation or of constitutive endocytosis, suggesting that during nonstimulated conditions these two processes have a relatively long half-life.

Failure of dopamine to inhibit Na+,K+-ATPase activity when endocytosis was prevented is in agreement with previous observations. Using a different approach, we have reported that stabilizing the cortical actin cytoskeleton inhibited the traffic of Na+,K+-ATPase subunits into CCV, EE, and LE and that under these conditions dopamine failed to inhibit Na+,K+-ATPase activity (4). Using the microtubule depolymerizing agent nocodazole, alpha  subunit incorporation was impaired only at the endosomal level, and under this condition dopamine efficiently inhibited Na+,K+-ATPase activity, suggesting that subunit internalization in CCVs is sufficient to cause a decrease in Na+,K+-ATPase activity. In aggregate, these observations strongly suggest that it is the removal of the alpha  subunit from the plasma membrane rather than its phosphorylation that results in decreased cell Na+,K+-ATPase activity, a mechanism perhaps analogous to that of other ion transport proteins such as the epithelial sodium channel (1) and H+/K+-ATPase (2).

Using site-directed mutagenesis we also demonstrated in this study that endocytosis of Na+,K+-ATPase and inhibition of its catalytic activity in response to DA require phosphorylation of the Ser-18 residue located in the alpha 1 subunit NH2 terminus. Mutation of Ser-11, another alpha 1 subunit residue phosphorylated in vitro by PKC (16), did not affect the ability of DA to increase phosphorylation and stimulate internalization of the alpha 1 subunit nor the inhibitory action of DA on the enzymatic activity.

The Ser-11 and Ser-18 residues of the Na+,K+-ATPase alpha 1 subunit that undergo phosphorylation have been identified either in cell-free preparations by utilizing purified PKC (16) or in intact cells after activation of PKC by phorbol esters (23, 37). The former study established that approximately 75% of the phosphorylated subunit corresponded to Ser-18, whereas the rest was localized to Ser-11 (16), a distribution whose physiological relevance is uncertain. Our study suggests that in response to a physiological agonist (dopamine) only Ser-18 in the rat alpha 1 subunit is phosphorylated and that this is essential for endocytosis of the alpha  subunit and inhibition of Na+,K+-ATPase activity. Substitution of Ser-11, although a PKC substrate (in cell-free preparations of Na+,K+-ATPase), did not affect its endocytosis in intact cells nor the changes in Na+,K+-ATPase activity elicited by dopamine, suggesting that the Ser-11 does not represent a regulatory site in this process in the rat. It is possible, however, as proposed by Vasilets (23), that in other species (lacking Ser-18) Ser-11 represents the PKC phosphorylation site that modulates Na+,K+-ATPase activity and perhaps alpha 1 subunits endocytosis.

In summary, Na+,K+-ATPase activity in intact cells represents the number of active units within the basolateral plasma membrane. Decreased Na+,K+-ATPase activity in response to GPCRs signals (dopamine) in renal epithelial cells is determined by removal of the subunits from the plasma membrane (Fig. 7). Phosphorylation occurs at Ser-18 of the alpha  subunit and triggers this process, but it does not in itself affect the intrinsic properties of the enzyme. Once the molecules are internalized they become inactive, as the increased abundance of alpha  and beta  subunits in intracellular compartments is not accompanied by a parallel increase in Na+,K+-ATPase catalytic activity (4). Finally, some of the subunits may become dephosphorylated in late endosomes (11). This may be a step that serves as a signal for their recruitment to the plasma membrane (existence of such a regulatory pathway has been recently described in lung epithelial cells (38)) and/or their function in these organelles may be necessary for controlling membrane potential and intracellular pH, important factors required for vesicle sorting (39, 40).


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 7.   Schematic representation of the postulated state of phosphorylation of the Na+,K+-ATPase alpha  subunit and activity during endocytosis (for explanations see "Discussion"). Early E., early endosomes; Late E., late endosomes.


    FOOTNOTES

* This work was supported in part by funds from the Swedish Medical Research Council (to A. M. B., and P.-O. B), the National Institutes of Health (to C. H. P. (Grant DK52273) and T. A. P.), FNRS (to E. F.), and from the American Heart Association (to C. H. P.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

** To whom correspondence should be addressed: The Rolf Luft Center L6B:01, Karolinska Hospital, S-171 76 Stockholm, Sweden. Tel.: 46-8-517-75727; Fax: 46-8-517-73658; E-mail: alejan{at}enk.ks.se.

The abbreviations used are: CCV, clathrin-coated vesicles; GPCRs, G protein-coupled receptors; PKC, protein kinase C; PCT, proximal convoluted tubules; OK, opossum kidney; Bis, bisindolylmaleimide; DA, dopamine; Wt, wild type; EE, early endosomes; LE, late endosomes; MES, 2-(N-morpholino)ethanesulfonic acid.

2 A. V. Chibalin, A. I. Katz, and A. M. Bertorello, unpublished observations.

    REFERENCES
Top
Abstract
Introduction
References

  1. Shimkets, R. A., Lifton, R. P., and Canessa, C. M. (1997) J. Biol. Chem. 272, 25537-25541[Abstract/Free Full Text]
  2. Courtois-Coutry, N. D., Roush, D., Rajendran, V., McCarthy, J. B., Geibel, J., Kashgarian, M., and Caplan, M. (1997) Cell 90, 501-510[CrossRef][Medline] [Order article via Infotrieve]
  3. Schmalzing, G., Eckard, P., Kröner, S., and Passow, H. (1990) Am. J. Physiol. 258, C179-C184[Abstract/Free Full Text]
  4. Chibalin, A. V., Katz, A. I., Berggren, P.-O., and Bertorello, A. M. (1997) Am. J. Physiol. 273, C1458-C1465[Abstract/Free Full Text]
  5. Bertorello, A. M., and Katz, A. I. (1993) Am. J. Physiol. 265, F743-F755[Abstract/Free Full Text]
  6. Pierce, B. M., and Robinson, M. S. (1990) Annu. Rev. Cell Biol. 6, 151-171[CrossRef]
  7. Lamaze, C., and Schmid, S. L. (1995) Curr. Opin. Cell Biol. 7, 573-580[CrossRef][Medline] [Order article via Infotrieve]
  8. Gruenberg, J., and Maxfield, F. R. (1995) Curr. Opin. Cell Biol. 7, 552-563[CrossRef][Medline] [Order article via Infotrieve]
  9. Kirchhausen, T., Bonifacino, J. S., and Reizman, H. (1997) Curr. Opin. Cell Biol. 9, 488-495[CrossRef][Medline] [Order article via Infotrieve]
  10. Chibalin, A. V., Zierath, J., Katz, A. I., Berggren, P.-O., and Bertorello, A. M. (1998) Mol. Biol. Cell 9, 1209-1220[Abstract/Free Full Text]
  11. Chibalin, A. V., Pedemonte, C. H., Katz, A. I., Feraille, E., Berggren, P.-O., and Bertorello, A. M. (1998) J. Biol. Chem. 273, 8814-8819[Abstract/Free Full Text]
  12. Lowndes, J. M., Hokin-Neaverson, M., and Bertics, P. J. (1990) Biochim. Biophys. Acta 1052, 143-151[Medline] [Order article via Infotrieve]
  13. Bertorello, A. M., Aperia, A., Walaas, I., Nairn, A. C., and Greengard, P. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 11359-11362[Abstract/Free Full Text]
  14. Chibalin, A. V., Vasilets, L. A., Hennekes, H., Pralong, D., and Geering, K. (1992) J. Biol. Chem. 267, 22378-22384[Abstract/Free Full Text]
  15. Nishi, A., Bertorello, A. M., and Aperia, A. (1993) Acta Physiol. Scand. 149, 377-384[Medline] [Order article via Infotrieve]
  16. Feschenko, M. S., and Sweadner, K. J. (1995) J. Biol. Chem. 270, 14072-14077[Abstract/Free Full Text]
  17. Feschenko, M. S., and Sweadner, K. J. (1994) J. Biol. Chem. 269, 30436-30444[Abstract/Free Full Text]
  18. Feschenko, M. S., and Sweadner, K. J. (1997) J. Biol. Chem. 272, 17726-17733[Abstract/Free Full Text]
  19. Bertorello, A. M., and Aperia, A. (1989) Am. J. Physiol. 256, F370-F373[Abstract/Free Full Text]
  20. Ominato, M., Satoh, T., and Katz, A. I. (1996) J. Membr. Biol. 152, 235-243[CrossRef][Medline] [Order article via Infotrieve]
  21. Bertorello, A. M. (1992) J. Cell Sci. 101, 343-347[Abstract/Free Full Text]
  22. Middleton, J. P., Khan, W. A., Collingsworth, G., Hannun, Y. A., and Medford, R. M. (1993) J. Biol. Chem. 268, 15958-15962[Abstract/Free Full Text]
  23. Vasilets, L. A. (1997) Cell. Physiol. Biochem. 7, 1-18
  24. Feraille, E., Carranza, M.-L., Buffin-Meyer, B., Rousselot, M., Doucet, A., and Favre, H. (1995) Am. J. Physiol. 268, C1277-C1283[Abstract/Free Full Text]
  25. Carranza, M.-L., Féraille, E., and Favre, H. (1996) Am. J. Physiol. 271, C136-C143[Abstract/Free Full Text]
  26. Pedemonte, C. H., Pressley, T. A., Cinelli, A. R., and Lokhandwala, M. F. (1997) Mol. Pharmacol. 52, 88-97[Abstract/Free Full Text]
  27. Beron, J., Foster, I., Beguin, P., Geering, K., and Verrey, F. (1997) Mol. Biol. Cell 8, 387-398[Abstract]
  28. Shull, G. E., Greeb, J., and Lingrel, J. B. (1986) Biochemistry 25, 8125-8132[CrossRef][Medline] [Order article via Infotrieve]
  29. Rose, J. K., Buonocore, L., and Whitt, M. A. (1991) BioTechniques 10, 520-525[Medline] [Order article via Infotrieve]
  30. Erusalimsky, J. D., Friedberg, I., and Rozengurt, E. (1988) J. Biol. Chem. 263, 19188-19194[Abstract/Free Full Text]
  31. Laemmli, U. K. (1970) Nature 227, 680-685[CrossRef][Medline] [Order article via Infotrieve]
  32. Nestler, E., and Greengard, P. (1980) Proc. Natl. Acad. Sci. U. S. A. 77, 7479-7483[Abstract/Free Full Text]
  33. Gorvel, J.-P., Chavrier, P., Zerial, M., and Gruenberg, J. (1991) Cell 64, 915-925[CrossRef][Medline] [Order article via Infotrieve]
  34. Hammond, T. G., and Verroust, P. G. (1994) Am. J. Physiol. 266, F554-F562[Abstract/Free Full Text]
  35. Bradford, M. M. (1974) Anal. Biochem. 72, 248-254[CrossRef]
  36. Belusa, R., Wang, Z.-M., Matsubara, T., Sahlgren, B., Dulubova, I., Nairn, A. C., Ruoslahti, E., Greengard, P., and Aperia, A. (1997) J. Biol. Chem. 272, 20179-20184[Abstract/Free Full Text]
  37. Logvinenko, N. S., Dulubova, I., Fedosova, N., Larsson, S. H., Nairn, A. C., Easman, M., Greengard, P., and Aperia, A. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 9132-9137[Abstract/Free Full Text]
  38. Bertorello, A. M., Ridge, K., Chibalin, A. V., Katz, A. I., and Sznajder, J. I. (1999) Am. J. Physiol., in press
  39. Fuchs, R., Schmid, S., and Mellman, I. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 539-543[Abstract/Free Full Text]
  40. Cain, C. C., Sipe, D. M., and Murphy, R. F. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 544-548[Abstract/Free Full Text]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Pharmacol. Rev.Home page
A. Y. Bagrov, J. I. Shapiro, and O. V. Fedorova
Endogenous Cardiotonic Steroids: Physiology, Pharmacology, and Novel Therapeutic Targets
Pharmacol. Rev., March 1, 2009; 61(1): 9 - 38.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. Scapin, S. Leoni, S. Spagnuolo, A. M. Fiore, and S. Incerpi
Short-term effects of thyroid hormones on Na+-K+-ATPase activity of chick embryo hepatocytes during development: focus on signal transduction
Am J Physiol Cell Physiol, January 1, 2009; 296(1): C4 - C12.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
A. Carranza, P. L. Musolino, M. Villar, and S. Nowicki
Signaling cascade of insulin-induced stimulation of L-dopa uptake in renal proximal tubule cells
Am J Physiol Cell Physiol, December 1, 2008; 295(6): C1602 - C1609.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
A. Fekete, K. Rosta, L. Wagner, A. Prokai, P. Degrell, E. Ruzicska, E. Vegh, M. Toth, K. Ronai, K. Rusai, et al.
Na+,K+-ATPase is modulated by angiotensin II in diabetic rat kidney - another reason for diabetic nephropathy?
J. Physiol., November 15, 2008; 586(22): 5337 - 5348.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
A. R. Cinelli, R. Efendiev, and C. H. Pedemonte
Trafficking of Na-K-ATPase and dopamine receptor molecules induced by changes in intracellular sodium concentration of renal epithelial cells
Am J Physiol Renal Physiol, October 1, 2008; 295(4): F1117 - F1125.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
B. Benziane and A. V. Chibalin
Frontiers: Skeletal muscle sodium pump regulation: a translocation paradigm
Am J Physiol Endocrinol Metab, September 1, 2008; 295(3): E553 - E558.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
H. Cai, L. Wu, W. Qu, D. Malhotra, Z. Xie, J. I. Shapiro, and J. Liu
Regulation of apical NHE3 trafficking by ouabain-induced activation of the basolateral Na+-K+-ATPase receptor complex
Am J Physiol Cell Physiol, February 1, 2008; 294(2): C555 - C563.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
T. Kimura, P. B. Allen, A. C. Nairn, and M. J. Caplan
Arrestins and Spinophilin Competitively Regulate Na+,K+-ATPase Trafficking through Association with a Large Cytoplasmic Loop of the Na+,K+-ATPase
Mol. Biol. Cell, November 1, 2007; 18(11): 4508 - 4518.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Sjostrom, K. Stenstrom, K. Eneling, J. Zwiller, A. I. Katz, H. Takemori, and A. M. Bertorello
SIK1 is part of a cell sodium-sensing network that regulates active sodium transport through a calcium-dependent process
PNAS, October 23, 2007; 104(43): 16922 - 16927.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
W. Schoner and G. Scheiner-Bobis
Endogenous and exogenous cardiac glycosides: their roles in hypertension, salt metabolism, and cell growth
Am J Physiol Cell Physiol, August 1, 2007; 293(2): C509 - C536.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
C. Kirchheimer, C. F. Mendez, A. Acquier, and S. Nowicki
Role of 20-HETE in D1/D2 dopamine receptor synergism resulting in the inhibition of Na+-K+-ATPase activity in the proximal tubule
Am J Physiol Renal Physiol, May 1, 2007; 292(5): F1435 - F1442.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
E. Lecuona, L. A. Dada, H. Sun, M. L. Butti, G. Zhou, T.-L. Chew, and J. I. Sznajder
Na,K-ATPase {alpha}1-subunit dephosphorylation by protein phosphatase 2A is necessary for its recruitment to the plasma membrane
FASEB J, December 1, 2006; 20(14): 2618 - 2620.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
J. F. Collawn
Unlocking the Mysteries of Na+-K+-ATPase Endocytosis: Phosphorylation Is the Key.
Am. J. Respir. Cell Mol. Biol., July 1, 2006; 35(1): 1 - 2.
[Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
Z. Chen, R. T. Krmar, L. Dada, R. Efendiev, I. B. Leibiger, C. H. Pedemonte, A. I. Katz, J. I. Sznajder, and A. M. Bertorello
Phosphorylation of Adaptor Protein-2 {micro}2 Is Essential for Na+,K+-ATPase Endocytosis in Response to Either G Protein-Coupled Receptor or Reactive Oxygen Species
Am. J. Respir. Cell Mol. Biol., July 1, 2006; 35(1): 127 - 132.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Song, M. Y. Lee, S. P. Kinsey, D. J. Weber, and M. P. Blaustein
An N-terminal Sequence Targets and Tethers Na+ Pump {alpha}2 Subunits to Specialized Plasma Membrane Microdomains
J. Biol. Chem., May 5, 2006; 281(18): 12929 - 12940.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
R. Efendiev and C. H. Pedemonte
Contrary to Rat-Type, Human-Type Na,K-ATPase Is Phosphorylated at the Same Amino Acid by Hormones that Produce Opposite Effects on Enzyme Activity
J. Am. Soc. Nephrol., January 1, 2006; 17(1): 31 - 38.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
G. Bianchi
Genetic variations of tubular sodium reabsorption leading to "primary" hypertension: from gene polymorphism to clinical symptoms
Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2005; 289(6): R1536 - R1549.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
A. M. Bertorello and J. I. Sznajder
The Dopamine Paradox in Lung and Kidney Epithelia: Sharing the Same Target but Operating Different Signaling Networks
Am. J. Respir. Cell Mol. Biol., November 1, 2005; 33(5): 432 - 437.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
G. Ebensperger, R. Ebensperger, E. A Herrera, R. A Riquelme, E. M Sanhueza, F. Lesage, J. J Marengo, R. I Tejo, A. J Llanos, and R. V Reyes
Fetal brain hypometabolism during prolonged hypoxaemia in the llama
J. Physiol., September 15, 2005; 567(3): 963 - 975.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
A. M Woollhead, J. W Scott, D. G. Hardie, and D. L Baines
Phenformin and 5-aminoimidazole-4-carboxamide-1-{beta}-D-ribofuranoside (AICAR) activation of AMP-activated protein kinase inhibits transepithelial Na+ transport across H441 lung cells
J. Physiol., August 1, 2005; 566(3): 781 - 792.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Efendiev, Z. Chen, R. T. Krmar, S. Uhles, A. I. Katz, C. H. Pedemonte, and A. M. Bertorello
The 14-3-3 Protein Translates the NA+,K+-ATPase {alpha}1-Subunit Phosphorylation Signal into Binding and Activation of Phosphoinositide 3-Kinase during Endocytosis
J. Biol. Chem., April 22, 2005; 280(16): 16272 - 16277.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
R. Efendiev, R. T. Krmar, G. Ogimoto, J. Zwiller, G. Tripodi, A. I. Katz, G. Bianchi, C. H. Pedemonte, and A. M. Bertorello
Hypertension-Linked Mutation in the Adducin {alpha}-Subunit Leads to Higher AP2-{micro}2 Phosphorylation and Impaired Na+,K+-ATPase Trafficking in Response to GPCR Signals and Intracellular Sodium
Circ. Res., November 26, 2004; 95(11): 1100 - 1108.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
C. A. Hinojos and P. A. Doris
Altered Subcellular Distribution of Na+,K+-ATPase in Proximal Tubules in Young Spontaneously Hypertensive Rats
Hypertension, July 1, 2004; 44(1): 95 - 100.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Al-Khalili, O. Kotova, H. Tsuchida, I. Ehren, E. Feraille, A. Krook, and A. V. Chibalin
ERK1/2 Mediates Insulin Stimulation of Na,K-ATPase by Phosphorylation of the {alpha}-Subunit in Human Skeletal Muscle Cells
J. Biol. Chem., June 11, 2004; 279(24): 25211 - 25218.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. J. Khundmiri, A. M. Bertorello, N. A. Delamere, and E. D. Lederer
Clathrin-mediated Endocytosis of Na+,K+-ATPase in Response to Parathyroid Hormone Requires ERK-dependent Phosphorylation of Ser-11 within the {alpha}1-Subunit
J. Biol. Chem., April 23, 2004; 279(17): 17418 - 17427.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. S. Mihailidou, M. Mardini, and J. W. Funder
Rapid, Nongenomic Effects of Aldosterone in the Heart Mediated by {epsilon} Protein Kinase C
Endocrinology, February 1, 2004; 145(2): 773 - 780.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. Lei, S. Nowbar, C. N. Mariash, and D. H. Ingbar
Thyroid hormone stimulates Na-K-ATPase activity and its plasma membrane insertion in rat alveolar epithelial cells
Am J Physiol Lung Cell Mol Physiol, September 1, 2003; 285(3): L762 - L772.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Efendiev, C. E. Budu, A. R. Cinelli, A. M. Bertorello, and C. H. Pedemonte
Intracellular Na+ Regulates Dopamine and Angiotensin II Receptors Availability at the Plasma Membrane and Their Cellular Responses in Renal Epithelia
J. Biol. Chem., August 1, 2003; 278(31): 28719 - 28726.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. Alzamora, E. T. Marusic, M. Gonzalez, and L. Michea
Nongenomic Effect of Aldosterone on Na+,K+-Adenosine Triphosphatase in Arterial Vessels
Endocrinology, April 1, 2003; 144(4): 1266 - 1272.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
A. M. Bertorello, Y. Komarova, K. Smith, I. B. Leibiger, R. Efendiev, C. H. Pedemonte, G. Borisy, and J. I. Sznajder
Analysis of Na+,K+-ATPase Motion and Incorporation into the Plasma Membrane in Response to G Protein-coupled Receptor Signals in Living Cells
Mol. Biol. Cell, March 1, 2003; 14(3): 1149 - 1157.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
T. Hussain and M. F. Lokhandwala
Renal Dopamine Receptors and Hypertension
Experimental Biology and Medicine, February 1, 2003; 228(2): 134 - 142.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
V. A. Narkar, T. Hussain, and M. F. Lokhandwala
Activation of D2-like receptors causes recruitment of tyrosine-phosphorylated NKA alpha 1-subunits in kidney
Am J Physiol Renal Physiol, December 1, 2002; 283(6): F1290 - F1295.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Efendiev, G. A. Yudowski, J. Zwiller, B. Leibiger, A. I. Katz, P.-O. Berggren, C. H. Pedemonte, I. B. Leibiger, and A. M. Bertorello
Relevance of Dopamine Signals Anchoring Dynamin-2 to the Plasma Membrane during Na+,K+-ATPase Endocytosis
J. Biol. Chem., November 8, 2002; 277(46): 44108 - 44114.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. V. Pierre, M.-J. Duran, D. L. Carr, and T. A. Pressley
Structure/function analysis of Na+-K+-ATPase central isoform-specific region: involvement in PKC regulation
Am J Physiol Renal Physiol, November 1, 2002; 283(5): F1066 - F1074.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. Reinhardt, M. Kosch, M. Lerner, H. Bertram, D. Lemke, and H. Oberleithner
Stimulation of protein kinase C pathway mediates endocytosis of human nongastric H+-K+-ATPase, ATP1AL1
Am J Physiol Renal Physiol, August 1, 2002; 283(2): F335 - F343.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. C. Done, I. B. Leibiger, R. Efendiev, A. I. Katz, B. Leibiger, P.-O. Berggren, C. H. Pedemonte, and A. M. Bertorello
Tyrosine 537 within the Na+,K+-ATPase alpha -Subunit Is Essential for AP-2 Binding and Clathrin-dependent Endocytosis
J. Biol. Chem., May 3, 2002; 277(19): 17108 - 17111.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Efendiev, A. M. Bertorello, R. Zandomeni, A. R. Cinelli, and C. H. Pedemonte
Agonist-dependent Regulation of Renal Na+,K+-ATPase Activity Is Modulated by Intracellular Sodium Concentration
J. Biol. Chem., March 22, 2002; 277(13): 11489 - 11496.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. J. Khundmiri and E. Lederer
PTH and DA regulate Na-K ATPase through divergent pathways
Am J Physiol Renal Physiol, March 1, 2002; 282(3): F512 - F522.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
G. Sweeney, W. Niu, V. A. Canfield, R. Levenson, and A. Klip
Insulin increases plasma membrane content and reduces phosphorylation of Na+-K+ pump alpha 1-subunit in HEK-293 cells
Am J Physiol Cell Physiol, December 1, 2001; 281(6): C1797 - C1803.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
C. E. MAGYAR, Y. ZHANG, N.-H. HOLSTEIN-RATHLOU, and A. A. MCDONOUGH
Downstream Shift in Sodium Pump Activity along the Nephron during Acute Hypertension
J. Am. Soc. Nephrol., November 1, 2001; 12(11): 2231 - 2240.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
S. DJELIDI, A. BEGGAH, N. COURTOIS-COUTRY, M. FAY, F. CLUZEAUD, S. VIENGCHAREUN, J.-P. BONVALET, N. FARMAN, and M. BLOT-CHABAUD
Basolateral Translocation by Vasopressin of the Aldosterone-Induced Pool of Latent Na-K-ATPases Is Accompanied by {alpha}1 Subunit Dephosphorylation: Study in a New Aldosterone-Sensitive Rat Cortical Collecting Duct Cell Line
J. Am. Soc. Nephrol., September 1, 2001; 12(9): 1805 - 1818.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
R. M. Carey
Renal Dopamine System: Paracrine Regulator of Sodium Homeostasis and Blood Pressure
Hypertension, September 1, 2001; 38(3): 297 - 302.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
M. ASGHAR, V. KANSRA, T. HUSSAIN, and M. F. LOKHANDWALA
Hyperphosphorylation of Na-Pump Contributes to Defective Renal Dopamine Response in Old Rats
J. Am. Soc. Nephrol., February 1, 2001; 12(2): 226 - 232.
[Abstract] [Full Text]


Home page
Mol. Biol. CellHome page
S. Gonin, G. Deschênes, F. Roger, M. Bens, P.-Y. Martin, J.-L. Carpentier, A. Vandewalle, A. Doucet, and E. Féraille
Cyclic AMP Increases Cell Surface Expression of Functional Na,K-ATPase Units in Mammalian Cortical Collecting Duct Principal Cells
Mol. Biol. Cell, February 1, 2001; 12(2): 255 - 264.
[Abstract] [Full Text]


Home page
Physiol. Rev.Home page
E. Feraille and A. Doucet
Sodium-Potassium-Adenosinetriphosphatase-Dependent Sodium Transport in the Kidney: Hormonal Control
Physiol Rev, January 1, 2001; 81(1): 345 - 418.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. Nowicki, M. S. Kruse, H. Brismar, and A. Aperia
Dopamine-induced translocation of protein kinase C isoforms visualized in renal epithelial cells
Am J Physiol Cell Physiol, December 1, 2000; 279(6): C1812 - C1818.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
A. G. Therien and R. Blostein
Mechanisms of sodium pump regulation
Am J Physiol Cell Physiol, September 1, 2000; 279(3): C541 - C566.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
E. Féraille, P. Béguin, M.-L. Carranza, S. Gonin, M. Rousselot, P.-Y. Martin, H. Favre, and K. Geering
Is Phosphorylation of the alpha 1 Subunit at Ser-16 Involved in the Control of Na,K-ATPase Activity by Phorbol Ester-activated Protein Kinase C?
Mol. Biol. Cell, January 1, 2000; 11(1): 39 - 50.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
M. S. Feschenko, E. Stevenson, and K. J. Sweadner
Interaction of Protein Kinase C and cAMP-dependent Pathways in the Phosphorylation of the Na,K-ATPase
J. Biol. Chem., October 27, 2000; 275(44): 34693 - 34700.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. A. Dunbar and M. J. Caplan
Ion Pumps in Polarized Cells: Sorting and Regulation of the Na+,K+- and H+,K+-ATPases
J. Biol. Chem., August 3, 2001; 276(32): 29617 - 29620.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
G. Ogimoto, G. A. Yudowski, C. J. Barker, M. Kohler, A. I. Katz, E. Feraille, C. H. Pedemonte, P.-O. Berggren, and A. M. Bertorello
G protein-coupled receptors regulate Na+,K+-ATPase activity and endocytosis by modulating the recruitment of adaptor protein 2 and clathrin
PNAS, March 28, 2000; 97(7): 3242 - 3247.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
G. A. Yudowski, R. Efendiev, C. H. Pedemonte, A. I. Katz, P.-O. Berggren, and A. M. Bertorello
Phosphoinositide-3 kinase binds to a proline-rich motif in the Na+,K+-ATPase alpha subunit and regulates its trafficking
PNAS, June 6, 2000; 97(12): 6556 - 6561.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
L. Yang, P. K. K. Leong, J. O. Chen, N. Patel, S. F. Hamm-Alvarez, and A. A. McDonough
Acute hypertension provokes internalization of proximal tubule NHE3 without inhibition of transport activity
Am J Physiol Renal Physiol, April 1, 2002; 282(4): F730 - F740.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
P. Gomes and P. Soares-da-Silva
Role of cAMP-PKA-PLC signaling cascade on dopamine-induced PKC-mediated inhibition of renal Na+-K+-ATPase activity
Am J Physiol Renal Physiol, June 1, 2002; 282(6): F1084 - F1096.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
K. M. Ridge, L. Dada, E. Lecuona, A. M. Bertorello, A. I. Katz, D. Mochly-Rosen, and J. I. Sznajder
Dopamine-induced Exocytosis of Na,K-ATPase Is Dependent on Activation of Protein Kinase C-epsilon and -delta
Mol. Biol. Cell, April 1, 2002; 13(4): 1381 - 1389.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chibalin, A. V.
Right arrow Articles by Bertorello, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chibalin, A. V.
Right arrow Articles by Bertorello, A. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1999 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement