J Biol Chem, Vol. 274, Issue 4, 1949-1956, January 22, 1999
The CDK-activating Kinase (Cak1p) from Budding Yeast Has an
Unusual ATP-binding Pocket*
Deborah A.
Enke,
Philipp
Kaldis
,
Jennifer K.
Holmes, and
Mark J.
Solomon§
From the Yale University School of Medicine, Department of
Molecular Biophysics and Biochemistry,
New Haven, Connecticut 06520-8024
 |
ABSTRACT |
Cak1p is an essential protein kinase that
phosphorylates and thereby activates the major
cyclin-dependent kinase in budding yeast, Cdc28p. The
sequence of Cak1p differs from other members of the protein kinase
superfamily in several conserved regions. Cak1p lacks the highly
conserved glycine loop motif (GXGXXG) that is
found in the nucleotide binding fold of virtually all protein kinases
and also lacks a number of conserved amino acids found at sites
throughout the protein kinase core sequence. We have used kinetic and
mutagenic analyses to investigate whether these sequence differences
affect the nucleotide-binding properties of Cak1p. Although Cak1p
differs dramatically from other protein kinases, it binds ATP with a
reasonable affinity, with a KM of 4.8 µM. Mutations of the putative invariant lysine in Cak1p (Lys-31), homologous to a residue required for activity in virtually all protein kinases and that interacts with the ATP phosphates, moderately reduced the ability of Cak1p to bind ATP but did not dramatically affect the catalytic rate of the kinase. Similarly, Cak1p
is insensitive to the ATP analog 5'-fluorosulfonylbenzoyladenosine, which inhibits most protein kinases through covalent modification of
the invariant lysine. We found that Cak1p is tolerant of mutations within its glycine loop region. Remarkably, Cak1p remains functional even following truncation of its first 31 amino acids, including the
glycine loop region and the invariant lysine. We conclude that the
Cak1p nucleotide-binding pocket differs significantly from those of
most other protein kinases and therefore might provide a specific
target for an inhibitory drug.
 |
INTRODUCTION |
Members of the protein kinase superfamily are related by several
highly conserved amino acid motifs that make up the catalytic core (1,
2). The degree of sequence identity found among residues within this
core is remarkable, and several of the motifs are considered to be
essentially invariant. The three-dimensional structures of these core
regions are predicted to be fundamentally the same (3), and for the
protein kinases that have been crystallized to date, this turns out to
be the case (4-11).
One extremely well conserved protein kinase motif is the glycine loop.
This motif, which contains the consensus sequence GXGXXG (where X is any amino acid), is located in subdomain I near
the amino terminus of the kinase domain (12-14). The glycine residues provide flexibility and allow the loop to fold over the nucleotide, thereby excluding solvent from the active site and anchoring the ATP
molecule. This interaction with the nucleotide occurs via the backbone
amides of the loop and the
- and
-phosphates of the ATP (13, 14).
The importance of this motif has been demonstrated by mutagenic
analysis of the cAMP-dependent protein kinase
(PKA).1 Mutation of either of
the first two glycine residues in the loop increased the
KM for ATP by 10-fold and reduced the catalytic rate
of the enzyme by severalfold, whereas mutation of the third glycine had
only minor effects (14). Similarly, substitution of the second glycine
of this motif in phosphorylase kinase reduced the
Vmax for the enzyme by more than 30-fold,
although the first glycine residue was less sensitive to substitution
(15). The importance of this motif is further underscored by the fact
that a mutation of the third glycine residue in the tyrosine kinase domain of the insulin receptor impairs protein kinase activity and has
been implicated in one form of human diabetes (16).
A second highly conserved feature of protein kinases is the so-called
invariant lysine residue, which is located 14-23 amino acid residues
carboxyl-terminal to the glycine loop within the ATP-binding pocket.
This residue interacts with the
- and
-phosphates of ATP and is
critical for the proper alignment of the triphosphate chain in the
active site. This lysine has been shown to be required for protein
kinase activity in both serine/threonine and tyrosine kinases (2) and
is a standard site of mutation in the construction of catalytically
inactive kinases. For example, mutation of this residue in PKA reduced
the catalytic rate of the enzyme by 99.9%, whereas the
KM for ATP was only moderately affected (17). Thus,
the invariant lysine generally seems to function primarily in
catalysis, rather than in nucleotide binding (17-19).
Due to the exceptional degree of sequence conservation among members of
the protein kinase superfamily, enzymes that lack one or more conserved
motifs are relatively unusual. One such protein kinase is Cak1p, the
Cdk Activating Kinase from
Saccharomyces cerevisiae. This essential protein is
responsible for activating the major cyclin-dependent
kinase in budding yeast, Cdc28p, by phosphorylating a conserved
threonine residue (Thr-169) in the activation loop (20-22). This
phosphorylation is absolutely required for the activity of Cdc28p in
the yeast cell cycle (23-25), and the activity of Cak1p is likewise
essential in vivo (21, 22). Cak1p, however, is only
distantly related to the identified CAK in higher eukaryotes, which is
a multi-subunit complex consisting of a kinase subunit,
p40MO15; a regulatory partner, cyclin H; and an assembly
factor, MAT1 (26). In contrast Cak1p functions as a
monomer2 (21) and is only
20-25% identical to p40MO15, its closest relative in vertebrates.
Several lines of evidence indicate that Cak1p contains an unusual
nucleotide binding region. Sequence alignment of Cak1p with other
protein kinases shows that it does not contain a glycine loop motif
near its amino terminus. We are aware of only two other protein
kinases, Vps15p and Mik1, that lack a glycine motif in this region (27,
28). In addition, mutational analysis of Cak1p has shown that the
"invariant lysine" residue (Lys-31) is not required for Cak1p
function in vivo (Refs. 22, 29, and this study).
In this paper, we characterize the nature of the nucleotide-binding
pocket of Cak1p by kinetic and mutagenic analyses. We have determined
the basic kinetic parameters for wild type Cak1p and for Cak1p
containing substitutions at the invariant lysine residue and in the
glycine loop region. We describe experiments that probe the role of the
invariant lysine residue of Cak1p using the nucleotide analog FSBA. The
conclusions drawn from these experiments indicate that the ATP-binding
site of Cak1p is functionally diverged from other members of the
protein kinase superfamily, especially with respect to the role of the
invariant lysine residue. Unlike other protein kinases, Cak1p is
relatively insensitive to substitutions in the glycine loop region.
 |
EXPERIMENTAL PROCEDURES |
Buffers--
CAK buffer is composed of 50 mM Tris,
pH 7.5, 15 mM MgCl2, 1 mg/ml ovalbumin, 10 mM DTT, 0.5% Tween 20, and 1× protease inhibitors. FSBA
buffer is composed of 50 mM K+-Hepes, pH 7.5, 50 mM NaCl, 10 mM MgCl2, 1 mg/ml
ovalbumin, 1× protease inhibitors. 1× protease inhibitors are
composed of 10 µg/ml each of leupeptin, chymostatin, and pepstatin.
GST-Cak1p Mutants--
QuikChange mutagenesis (Stratagene, La
Jolla, CA) was performed to introduce mutations into the
CAK1 sequence. The following primers were used to create the
K31A and glycine loop mutants (only the sense primer is indicated (5'
to 3')). Altered codons are underlined. K31A nucleotides 61-111 of
CAK1,
GGATTTATAGGTCGGATACATACGCCATTGCAGTCTAGCACTAGATTTCG; Gly1, nucleotides 3-50 of CAK1,
GAAACTGGATAGTATAGGCATTGGCCACTGTGGGTTGGTCAAATCTACTAG; Gly2, nucleotides 3-47 of CAK1,
GAAACTGGATAGTGGAGACGGTACACACGGCCAGTTGGTCAAATCTAC; Gly3, nucleotides 3-37 of CAK1,
GAAACTGGATAGTATAGGCGACGGTACACACGGCCAGTTGGTCAAATCTAC;
Gly, GACATTACACACGGATCCTTGGTCAAATCTAC. For the
Gly
oligonucleotide, the BamHI site in the vector
immediately 5' of the CAK1 sequence is shown (underlined). QuikChange
mutagenesis (Stratagene, La Jolla, CA) was performed using the
CAK1 sequence cloned into the BamHI-EcoRI sites of pGEX2T (21, 30) as a
template. Each clone was sequenced in its entirety.
The K31R mutant of CAK1 was amplified by polymerase chain
reaction from an existing clone in YCp50 (kindly provided by Ann Sutton). The sense and antisense primers used corresponded to the 5'
and 3' ends of the CAK1 sequence and introduced
BamHI (5') and EcoRI (3') sites (underlined):
5'-GGGGGATCCATGAAACTGGATAGTATAGAC; 3'-GCGGAATTCTTATCATGGCTTTTCTAATTC. The resulting fragments
were cloned into the pGEX2T vector. Mutations were confirmed by DNA sequencing.
Expression and Purification of Proteins--
Wild type and
mutant GST-Cak1p proteins were expressed in Escherichia coli
and purified as described previously for wild type GST-Cak1p (21). The
typical yield was 100 µg of GST-Cak1p per liter of culture. The
concentrations of purified GST-Cak1p were determined by comparing the
intensity of the Coomassie-stained proteins on an SDS-PAGE gel to
stained bovine serum albumin standards. Recombinant baculovirus
containing budding yeast Cak1p was generated by inserting a
BamHI-EcoRI fragment of GST-Cak1p (21) into
transfer vector BacPAK8 (CLONTECH, Palo Alto, CA).
The transfer vector was co-transfected into Sf21 cells with
BacPAK6 viral DNA (CLONTECH, Palo Alto, CA)
according to the manufacturer's instructions. The recombinant virus
was plaque-purified in three consecutive rounds and amplified. 2.7 × 109 High Five cells (Invitrogen, Pontiac, IL) were
infected with virus, harvested 48 h postinfection, and lysed using
hypotonic shock (31). Cak1p was purified as described (21) avoiding acetone precipitation and Mono P steps. The purified human CDK2 used in
this study was provided by Alicia Russo and Nikola Pavletich and was
purified as described (32).
Quantification of Results--
32P-Labeled CDK2 was
separated from free [
-32P]ATP on 10% polyacrylamide
gels and quantified using a Bio-Rad GS-250 PhosphorImager (Bio-Rad).
Imager units were converted to counts/min by excising bands from a
phosphorimaged gel and scintillation counting. Based on this data, a
conversion factor was calculated to convert PhosphorImager units to
counts/min. The PhosphorImager units were shown to be linear with
increasing signal and exposure times. In all assays, unless otherwise
noted, less than 10% of total substrate was phosphorylated.
KM Determinations--
To determine the
KM(ATP) for baculovirus-produced Cak1p,
5 µl of enzyme substrate mix containing 4 nM Cak1p and 6 µM human CDK2 was mixed with 5 µl of ATP or GTP mix
ranging in concentration from 1.25 µM to 1.28 mM with a specific activity of 10 µCi/pmol of nucleotide.
To determine the KM(CDK2), 5 µl of a
Cak1p/ATP mix containing 4 nM Cak1p, 200 µM
ATP, 1 µCi/ml [
-32P]ATP was added to 5 µl of CDK2
mix ranging in concentration from 0.06 to 15 µM. Samples
were prepared in CAK buffer and contained 150 mM NaCl.
Reactions were incubated for 10 min at room temperature and terminated
by the addition of 10 µl of 2× SDS-PAGE sample buffer.
Phosphorylated CDK2 was separated from free counts by SDS-PAGE.
Following PhosphorImager analysis, KM determinations were made by fitting the data sets to the Michaelis-Menten equation using the Kaleidagraph program (Version 2.1.3, Abelbeck Software, Stable Isotope Lab, University of Michigan).
KM determinations using E. coli produced
GST-Cak1p proteins (wild type and mutants) were performed as above with 360 nM GST-Cak1p in the enzyme substrate mix. For
KM(ATP) determinations the
concentrations of CDK2 were at least 5-fold in excess of the
KM(CDK2) for each GST-Cak1p protein unless otherwise indicated. KM(CDK2)
determinations for the K31A and
Gly mutants contained 1 mM ATP.
Competition Assays Using ATP Analogs--
To determine the
ability of FSBA and ADP to inhibit Cak1p, 5 µl of 4 nM
Cak1p and 3 µM CDK2 was added to 5 µl of 200 µM ATP, 0.5 µCi/µl [
-32P]ATP, 10 mM DTT, and FSBA or ADP ranging in concentration from 7.8 µM to 2 mM in FSBA buffer. Reactions were
incubated for 10 min at room temperature. Phosphorylated CDK2 was
quantified as described above.
To measure the ability of ADP and AMPPNP to inhibit Cak1p competitively
in buffer lacking Me2SO, 5 µl of a mixture containing Cak1p and CDK2 as described above was incubated with 5 µl containing 200 µM ATP, 0.5 µCi/µl [
-32P]ATP,
and ATP, ADP, or AMPPNP ranging in concentration from 7.8 µM to 2 mM in CAK buffer. Reactions were
incubated for 10 min at room temperature.
FSBA Assays--
To determine the sensitivity of Cak1p to FSBA,
2 nM Cak1p was incubated with 1 mM FSBA at room
temperature in FSBA buffer. At each time point, 5 µl was added to 5 µl of CAK buffer containing 20 mM DTT to inactivate the
FSBA, and the sample was then stored on ice. 5 µl of a mixture
containing 300 µM ATP, 1.0 µCi/µl
[
-32P]ATP, 220 ng of CDK2, 20 mM DTT in
CAK buffer was added. Reactions were incubated at room temperature for
10 min and terminated with the addition of 15 µl of 2× SDS-PAGE
sample buffer. Control samples contained FSBA buffer with 10%
Me2SO. To measure the sensitivity of human CDK2-cyclin A to
FSBA, a sample containing 455 nM CDK2-cyclin A was
incubated with 1 mM FSBA as described above. At each time point, 5 µl of the mixture was added to CAK buffer containing 20 mM DTT to inactivate the FSBA. 5 µl of the stopped
reaction was added to 5 µl of 1 mM ATP, 0.25 µCi/µl
[
-32P]ATP, and 267 µg/ml histone H1. Reactions were
incubated at room temperature for 10 min. Phosphorylated CDK2 was
quantified as described above.
ATPase Assays--
To measure the rate of ATP hydrolysis by
baculovirus-produced GST-Cak1p,3 3.8 µM GST-Cak1p in 7.5 µl of CAK buffer was added to 7.5 µl of ATP mix containing 200 µM ATP, 2.5 µCi/µl
[
-32P]ATP in CAK buffer. At each time point, 1 µl of
the assay was added to 4 µl of Stop buffer containing 50 mM Tris, pH 7.5, 20 mM EDTA, 10 mM
DTT, 1 mg/ml ovalbumin, 0.1% Tween, and 1× protease inhibitors. 1 µl of the terminated reaction was spotted onto a polyethyleneimine
cellulose plate (Selecto Scientific, Norcross, GA), and ascending
chromatography was performed for 2 h in 50 mM HCl.
Plates were dried and chromatographed a second time under the same
buffer conditions. Plates were then dried under a lamp and subjected to
PhosphorImager analysis. Data are expressed as a percent of the total
ATP hydrolyzed after subtracting background orthophosphate present in
the [
-32P]ATP mix.
To determine the effect of FSBA on ATPase activity, 5 µl of mix
containing 2.9 µM baculovirus GST-Cak1p, 100 µM FSBA, 10 mM DTT in FSBA buffer or 4 µl
of mix lacking DTT was preincubated for 30 min at room temperature. 1 µl of 50 mM DTT was then added to the reaction lacking
DTT. 5 µl of ATP mix containing 100 µM ATP, 5 µCi/µl [
-32P]ATP in FSBA buffer was added, and the
reactions were incubated for 1 h at room temperature.
Chromatography and quantitation were performed as above.
Thermal Stability--
To determine the thermal stability of
wild type and mutant GST-Cak1p, 700 nM GST-Cak1p in CAK
buffer was incubated at a given temperature for 10 min and then stored
on ice until assay. 5 µl of 1.5 µM CDK2, 200 µM ATP, 0.5 µCi/µl [
-32P]ATP in CAK
buffer was added, and the samples were incubated for 10 min at room
temperature. CDK2 phosphorylation was analyzed as described above.
 |
RESULTS |
Determination of the Basic Kinetic Parameters for
Cak1p--
Because of the extensive differences between Cak1p and
other protein kinases, particularly within the ATP-binding site, we decided to characterize the ability of Cak1p to utilize nucleotides (ATP and GTP) and protein substrate. As a substrate, we used the human
cyclin-dependent kinase, CDK2, rather than the endogenous yeast CDK, Cdc28p. CDK2 can function in yeast in place of Cdc28p (23,
33, 34) and is thus a physiological Cak1p substrate. It is also widely
used as a Cak1p substrate in vitro (20-22). Finally, unlike
Cdc28p, CDK2 is soluble at the high concentrations necessary for the
analyses reported here. To determine the KM values for the nucleotides, we performed kinase assays over a wide range of
ATP or GTP concentrations at a fixed concentration of the CDK2 substrate equal to five times the
KM(CDK2) (~3.5 µM). The
extent of CDK2 phosphorylation was quantified with a PhosphorImager, and the data were fit directly to the Michaelis-Menten equation (Fig.
1). The
KM(ATP) for wild type Cak1p was 4.8 µM. The KM(GTP) for Cak1p
was over 200-fold higher than the KM(ATP), whereas the extrapolated
Vmax value was slightly lower (Fig.
1A). Similarly, we determined the
KM(CDK2) by performing assays at a
saturating ATP concentration while varying the concentration of CDK2
over a broad range (Fig. 1B). The
KM(CDK2) was determined to be 0.7 µM. The Vmax value was 56.8 pmol
of phosphate transferred per min per µg of Cak1p, which corresponds
to a kcat value of 2.6 per min.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 1.
Nucleotide and CDK2 utilization by
Cak1p. The phosphorylation of CDK2 by baculovirus-produced Cak1p
(2 nM) at various substrate concentrations in the presence
of radiolabeled ATP was determined by phosphorimaging following
SDS-PAGE. A, the concentration of ATP and GTP were varied at
a fixed, saturating concentration of CDK2 (3.5 µM).
B, the concentration of CDK2 was varied at a fixed,
saturating concentration of ATP (100 µM). The
curves in each panel represent the calculated best fits to
the Michaelis-Menten equation.
|
|
Insensitivity of Cak1p to FSBA--
Sequence alignment of Cak1p
with other protein kinases (20-22, 29) identified Lys-31 as the
invariant lysine that is required for catalytic activity in all protein
kinases (2). The role of this lysine in Cak1p may differ from that of
other protein kinases, since Cak1p containing substitutions at this
site have been reported to be functional in vivo and to have
partial activity in vitro (22, 29). In order to examine the
role of this residue in the active site of Cak1p, we tested the
sensitivity of Cak1p to the nucleotide analog
5'-fluorosulfonylbenzoyladenosine (FSBA). FSBA covalently modifies the
invariant lysine of protein kinases, thereby inhibiting their activity
(12, 35-37). We treated Cak1p or CDK2-cyclin A complexes with FSBA for
up to 2 h. At various time points, samples were removed and added
to buffer containing DTT to inactivate the remaining FSBA. Cak1p was
then assayed for its ability to phosphorylate CDK2; CDK2 was assayed
using histone H1 as a substrate (Fig.
2A). FSBA completely
inactivated the CDK2 within 20 min, whereas Cak1p was virtually
insensitive to FSBA over the entire 2-h time course. We also found that
the presence of saturating amounts of CDK2 did not make Cak1p sensitive
to FSBA (data not shown). Thus Lys-31 in Cak1p is positioned
differently from the equivalent lysine in other protein kinases,
resulting in either a reduced binding or reactivity to FSBA. We presume that Lys-31 also has an altered interaction with ATP.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 2.
Cak1p is insensitive to FSBA.
A, baculovirus-produced Cak1p (2 nM)
(circles) or CDK2-cyclin A complexes (455 nM)
(squares) were treated with (closed symbols) or
without (open symbols) FSBA for various times. Cak1p
activity was assayed by phosphorylation of CDK2, and CDK2-cyclin A
activity was assayed by phosphorylation of histone H1. Data are
expressed as the percentage of activity remaining after FSBA treatment.
B, FSBA competes for the ATP pocket of baculovirus-produced
Cak1p. The concentration of each competitor was varied, whereas the
radiolabeled ATP concentration was fixed at 100 µM.
Competition assays were performed as described under "Experimental
Procedures." C and D, comparison of nucleotide
usage between baculovirus-produced Cak1p (C) and CDK2
(D). The concentration of each cold nucleotide was varied,
and the radiolabeled ATP concentration was fixed at 100 µM.
|
|
It was possible that the insensitivity of Cak1p to FSBA was simply due
to the inability of the enzyme to bind the nucleotide analog. To test
this possibility, we performed competition assays using either
DTT-inactivated FSBA, ADP, or ATP (Fig. 2B). Both ADP and
FSBA competed with ATP. FSBA competed at least as well as ATP,
indicating that its inability to inactivate Cak1p is not due to lack of
binding to the ATP-binding pocket of Cak1p.
Cak1p Binding to ATP Analogs: ADP and AMPPNP--
To examine
further the nature of the ATP-binding pocket of Cak1p, we compared the
ability of Cak1p and CDK2-cyclin A complexes to bind adenine
derivatives. Competition assays were performed in which ADP and AMPPNP
concentrations were varied while the concentration of ATP was held
constant (Fig. 2, C and D). The abilities of both ADP and AMPPNP to compete for ATP binding were similar for the two
enzymes. ADP competed more effectively than AMPPNP, which inhibited
only 60% of the activity of either enzyme when present in 5-fold
excess over ATP. By contrast, ADP competed with
[
-32P]ATP for binding to each enzyme nearly as well as
unlabeled ATP itself. A 5-fold excess of ADP inhibited CDK2 by 80% and
Cak1p by 60%. Therefore, although the two enzymes had similar overall binding specificities for ATP, ADP, and AMPPNP, Cak1p had slightly greater discrimination against ADP.
Kinetic Analysis of Mutations at the Invariant Lysine of
Cak1p--
The results of the above experiments indicated that the
orientation and/or reactivity of the invariant lysine within the
ATP-binding pocket of Cak1p was unusual. To examine the role of this
residue in more detail, mutant Cak1p proteins containing conservative (K31R) and non-conservative (K31A) mutations of Lys-31 were expressed as glutathione S-transferase fusions in E. coli.
We purified the mutant proteins and determined their kinetic parameters
after assaying them over a wide range of ATP and CDK2 concentrations. The results of these experiments for wild type and mutant GST-Cak1p proteins are shown in Fig. 3A
and Table I. The
KM(ATP) for wild type K31R and K31A
GST-Cak1p were 5.2, 44.9, and 248.0 µM, respectively,
indicating that mutations of the invariant lysine have a direct effect
on nucleotide binding and that loss of this positive charge in the
ATP-binding pocket reduces ATP binding by almost 98%. These mutants
also displayed modest increases in KM(CDK2), from 0.5 µM for
wild type GST-Cak1p to 0.9 and 4.1 µM for K31R and K31A,
respectively (Fig. 3B). The kcat values for the K31R (0.026 min
1) and K31A (0.021 min
1) GST-Cak1p mutants were between 91 and 113% of the
wild type kcat (0.023 min
1).
(Because the CDK2 concentration in the assays of the K31A mutant was
approximately equal to the KM(CDK2), the
true Vmax value of the K31A protein is about
2-fold higher than that indicated in Fig. 3A (see also Fig.
3B). (kcat values for the E. coli-produced GST-Cak1p proteins were significantly lower than
those observed for the baculovirus-produced Cak1p presumably because
only a small fraction of the molecules were catalytically active).)
Thus, mutation of Lys-31 had little effect upon catalysis but had a
significant effect on ATP binding.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 3.
ATP and CDK2 utilization by the Cak1p Lys-31
mutants. A, the concentration of ATP was varied at a
fixed, saturating concentration of CDK2 (3 µM) in assays
containing 360 nM bacterially produced GST-Cak1p. Note that
although the concentration of CDK2 is 3-5 times the
KM(CDK2) for wild type and K31R Cak1p,
it is only about equal to the KM(CDK2)
for the K31A mutant, resulting in a reduced reaction velocity.
B, the concentration of CDK2 was varied at a saturating
concentration of ATP (200 µM for wild type and K31R, 1 mM for K31A). The curves in each panel represent
the calculated best fits to the Michaelis-Menten equation.
|
|
View this table:
[in this window]
[in a new window]
|
Table I
Comparison of the KM and kcat values
of wild type and mutant Cak1p
KM values for wild type and mutant bacterially expressed
GST-Cak1p are expressed as µM and were determined by
standard Michaelis-Menten analysis as shown in Fig. 3 and Fig. 5.
kcat values are expressed per min.
|
|
ATPase Activity of Cak1p--
The glycine loop of protein kinases
creates a flexible flap that covers the nucleotide and excludes solvent
from the active site (13). This protection from solvent is important
for reducing the ATPase activity of the protein kinase, preventing
transfer of the
-phosphate of ATP to water. In PKA, mutation of
these glycine residues to serine or alanine increases the ATPase rate by more than an order of magnitude, indicating that the presence of the
glycine residues is critical for excluding water from the active site
(14). Cak1p, however, lacks an obvious glycine loop and therefore may
be unable to exclude water from its ATP-binding site. We tested this
possibility by measuring the ATPase rate of baculovirus-produced Cak1p
in the absence of protein substrate and comparing it to the ATPase
rates determined for other, more conventional, protein kinases. The
ATPase rate for Cak1p was found to be 0.13 min
1 under
standard assay conditions (Fig. 4), which
is somewhat lower than the reported ATPase activity of wild type PKA
(0.66 min
1) (14, 38).

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 4.
ATPase activity of Cak1p.
Baculovirus-produced Cak1p (3.8 µM) was incubated with
radiolabeled ATP for the indicated times. Samples were spotted onto TLC
plates and chromatographed as described under "Experimental
Procedures." The rate of ATP hydrolysis was quantitated by
phosphorimaging and found to be 0.13 min 1.
|
|
We determined the effect of FSBA on the ATPase activity in order to be
sure that it was not due to the presence of a contaminating ATPase.
Incubation of GST-Cak1p with FSBA did not decrease the ATPase activity
in the assay (data not shown). As FSBA has been shown to inhibit the
activity of ATPases (39-41), but not of Cak1p, this result is a strong
indication that the ATPase activity in this assay is specific to Cak1p.
The presence of any FSBA-insensitive ATPase contaminant would only
strengthen the conclusion that Cak1p does not have an unusually high
ATPase activity.
Analysis of Mutations in the Amino Terminus of Cak1p: Restoration
and Deletion of a Glycine Motif--
To investigate the role of the
divergent amino-terminal sequence of Cak1p, we introduced a canonical
glycine loop sequence into Cak1p in three slightly different registers
(Fig. 5A). We anticipated that
introduction of this motif might enhance ATP binding by increasing the
flexibility of the loop, resulting in a decreased
KM(ATP). The three mutants were chosen
based upon the two nearly identical published alignments of this region (20-22) and a third hybrid alignment. Any significantly different alignment of this region would disrupt the alignment of numerous other
essential motifs. The mutant proteins were expressed in bacteria as GST
fusion proteins. The KM(ATP) and
KM(CDK2) for the mutants were determined
and compared with the wild type values (Fig. 5, B and
C, and Table I). All three glycine mutants showed defects in
the ability to bind to both ATP and CDK2. Gly1, which contained the
inserted glycine motif at the DXTXXQ sequence in
Cak1p, exhibited a KM(ATP) of 16.4 µM, a 3-fold increase over the wild type value of 5.2 µM. The KM(CDK2) for the
Gly1 mutant also increased, to 1.9 µM compared with 0.5 µM for wild type GST-Cak1p. Similarly, Gly3 displayed a
2-fold increase in KM(ATP) to 11.0 µM and a 3.5-fold increase in
KM(CDK2) to 1.9 µM.
Surprisingly, Gly2, which contains the inserted glycine loop in place
of IXIXXC, and which was seemingly the most
conservative mutant, showed the most severe binding defects: a 10-fold
increase in KM(ATP) to a value of 54.9 µM and a 5-fold increase in
KM(CDK2) to a value of 2.7 µM. The three mutants had similar
kcat values, ranging from 0.080 to 0.150 per min
(Table I).

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 5.
Analysis of the glycine loop mutants of
GST-Cak1p. A, sequence alignment of the glycine loop
region of Cak1p with mouse PKA, human CDK2, and human
p40MO15. The positions of the inserted glycine residues for
each of the three mutants are indicated by shading.
B, velocity versus ATP concentration plots for
the bacterially produced GST-Cak1p glycine mutants. The concentration
of ATP was varied in assays containing a fixed, saturating
concentration of CDK2 (10 µM). The concentration of the
glycine mutants was fixed at 360 nM. C, velocity
versus CDK2 concentration plots of the glycine mutants. The
concentration of CDK2 was varied in assays containing a fixed,
saturating concentration of ATP (1 mM). D,
thermal stability of the glycine mutants. Samples were incubated at
each temperature for 10 min and were then assayed for CAK activity.
Data are represented as the percent of activity remaining after each
incubation compared with the activity of a sample stored at 4 °C.
E, velocity versus ATP concentration plots for
the Gly mutant. The concentration of ATP was varied in assays
containing a fixed, saturating concentration of CDK2 (10 µM), and the data represent the calculated best fit to
the Michaelis-Menten equation. F, velocity versus
CDK2 concentration plot for the Gly mutant. The concentration of
CDK2 was varied in assays containing a fixed, saturating concentration
of ATP (1 mM). The data in B, C, E, and
F represent the calculated best fits to the Michaelis-Menten
equation.
|
|
We also assessed the thermostability of the glycine mutants compared
with wild type GST-Cak1p in order to determine the effect of these
mutations on overall protein stability. The mutants were incubated at
various temperatures for 10 min and then assayed for their ability to
phosphorylate CDK2 (Fig. 5D). All three mutants were
destabilized relative to the wild type protein with
Tm values that were approximately 10 °C lower
than for wild type GST-Cak1p. This effect was more dramatic than that
observed for the Lys-31 mutants (2-3 °C, data not shown) and
indicates that the amino terminus of Cak1p is required for
stabilization of the overall protein structure, perhaps via
interactions with other domains of the kinase.
Since the glycine mutants were surprisingly resilient substitutions, we
next examined the effect of completely deleting this region of Cak1p.
The deletion mutant,
Gly, lacks the first 12 amino acids of Cak1p,
including the proposed glycine loop region (through Gln-12), and was
expressed as a glutathione S-transferase fusion protein in
E. coli. The KM(ATP) for
Gly increased 21-fold over wild type Cak1p, to 110.9 µM (Fig. 5D, Table I). The
KM(CDK2) increased to 3.9 µM or 5-fold above wild type (Fig. 5E, Table
I). However, the catalytic rate of the kinase was barely affected
(kcat = 0.019 min
1). The
Gly
mutant was expressed in yeast from a low copy plasmid containing the
endogenous CAK1 promoter and was found to fully rescue a
strain deleted for its wild type copy of CAK1 (data not shown). The increased KM(ATP) of this
protein presumably has little effect in vivo since the
concentration of ATP is ~2 mM (42), well above the
measured KM(ATP). Remarkably, expression
from a strong GAL promoter on a high copy plasmid of a
mutant lacking the first 31 amino acids (through the invariant lysine)
also allowed growth of cells containing no other source of Cak1p. The
cells grew slowly, however, and lacked detectable CAK activity.
Recombinant GST-Cak1p
31 also lacked detectable activity in
vitro (data not shown).
 |
DISCUSSION |
Cak1p, the cyclin-dependent kinase-activating kinase
from budding yeast, is an essential protein that is responsible for
catalyzing the activating phosphorylation of Cdc28p. Cak1p is an
unusual protein kinase whose primary amino acid sequence is diverged
from members of the protein kinase superfamily. In this paper, we have examined the nature of the ATP-binding pocket of Cak1p by kinetic and
mutagenic analysis. We show that even though Cak1p binds ATP with an
affinity similar to that of other protein kinases, the sequence
requirements for this binding are highly unusual.
Determination of Kinetic Parameters--
The
KM(ATP) for Cak1p is 4.8 µM, which is somewhat lower than the reported
KM(ATP) values for other protein kinases. For example, the KM(ATP) for
p40MO15 and p34cdc2-cyclin B complexes are 40 (43) and 75 µM (44), respectively, and the
KM(ATP) for PKA, p38 mitogen-activated
protein kinase, and pp60c-Src are 17, 23, and 80 µM, respectively (45-47). We believe that the low
KM(ATP) for Cak1p is a consequence of
its low catalytic rate, as we have determined that the
KM(ATP) is approximately equal to the
Kd(ATP).4 Cak1p
can utilize GTP as a substrate, although its
KM(GTP) (1114 µM) is over
200-fold higher than the KM(ATP). A few
protein kinases, including p34Cdc2, CDK2, and casein
kinase, can also utilize GTP (35, 44). Cak1p and CDK2 (a more typical
protein kinase) bind other nucleotides such as ADP and AMPPNP with
similar specificities. Thus, Cak1p binds nucleotides relatively
normally, despite its unusual sequence and binding requirements (see below).
Analysis of the Invariant Lysine of Cak1p--
The role of the
invariant lysine in other protein kinases is to orient the
- and
-phosphates of ATP to promote the in-line phospho-transfer reaction
(2). The kinetic analysis of Cak1p mutants containing substitutions at
this residue shows that Lys-31 is involved primarily in nucleotide
binding; its role in catalysis is minimal. The conservative mutant,
K31R, displayed a 9-fold increase in
KM(ATP) and a 1.7-fold increase in
KM(CDK2). The K31A mutant, which removes
a positive charge in the ATP-binding pocket, showed a 42-fold increase
in KM(ATP) over wild type and a 7.6-fold
increase in KM(CDK2). However, neither mutation significantly affected Vmax.
In contrast, the equivalent mutation in other protein kinases primarily
affects kcat. For example, the K116A mutation of
Tpk1p, a yeast homologue of PKA, results in an 800-fold decrease in
kcat and only a 6-fold increase in
KM(ATP) (17). Similarly, the K52R and
K52A mutations in the mitogen-activated protein kinase ERK2 result in a
decrease in kcat to 0.5-5% of wild type (19). Most protein kinases containing substitutions at this residue are
completely unable to function in vivo (see, for example,
Refs. 48-53). In contrast, mutations of this residue in Cak1p are
fully capable of complementing a CAK1 deletion in S. cerevisiae3 (22, 29). Our biochemical results can
rationalize this complementation. Even though the
KM(ATP) for the K31A mutant (248 µM) is 50-fold higher than for wild type Cak1p, this
value is still far below the physiological concentration of ATP (~2
mM) (42). Thus, the K31R and K31A mutants should be bound
to ATP and fully active in vivo.
Further evidence for a distinct role of the invariant lysine in the
ATP-binding pocket of Cak1p comes from its insensitivity to the
nucleotide analog FSBA. FSBA covalently modifies and thereby inactivates a number of kinases including PKA, pyruvate kinase, p34Cdc2, EGF receptor kinase, p60c-Src, casein
kinase II, calmodulin-dependent protein kinase II, and myosin light
chain kinase (35-37, 48-59). FSBA inactivates many other kinases
in vitro, presumably covalently (for example, see Refs. 43
and 60). FSBA competes with ATP for binding to Cak1p, indicating that
Cak1p can bind the adenine moiety of FSBA. However, whereas CDK2 is
rapidly and completely inhibited by FSBA, Cak1p is virtually
insensitive to treatment with the analog either in the presence or
absence of protein substrate. Thus, Lys-31 may not be properly oriented
or sufficiently reactive to allow modification by the sulfonyl fluoride
group of FSBA. A less likely alternative possibility is that Lys-31 may
be positioned in the ATP-binding pocket such that modification by FSBA
does not inhibit catalysis. A final possibility is that another charged
residue is located at the active site and can compensate for the
function of the invariant lysine in Cak1p. Such a situation occurs in
the protein kinase domain of the large subunit of herpes simplex virus
type 2 ribonucleotide reductase (ICP10), where two lysine residues (Lys-176 and Lys-259) can perform the role of the invariant lysine (61). Mutation of either one of these lysines reduces the activity of
the kinase by 80-90%, whereas a double mutation inactivates the
kinase. FSBA binding is reduced in either single mutant of ICP10 but is
not completely inhibited. The effect of FSBA binding on ICP10 protein
kinase activity was not examined. There are no obvious candidates for
such a second lysine in Cak1p.
The Glycine Loop Region of Cak1p--
We have determined the
ATPase rate for Cak1p. The sequence in Cak1p that aligns with the
position of the glycine loop in other protein kinases contains several
bulky amino acid side chains (IDITHCQ, see Fig.
5A). We thought that Cak1p might therefore be less able to
exclude solvent from the ATP site, resulting in an increased ATPase
activity. We found that the ATPase rate for Cak1p is 0.13 min
1. This value is somewhat less than the rate for p38
mitogen-activated protein kinase (0.36 min
1) and the
catalytic subunit of PKA (0.66 min
1) (14, 38, 62).
Therefore, the ATPase rate for Cak1p is not dramatically different from
other protein kinases. This result is quite surprising, since
substitution of the first or second glycines with serine in the
conserved loop in PKA results in a 12-fold increase in ATPase rate, to
8.1 min
1, indicating that the glycines of this loop are
required for the low intrinsic ATPase activity of PKA (14). Cak1p, by
contrast, can exclude water from the active site in the absence of a
glycine loop, presumably because the rest of the molecule has
accommodated itself to the absence of this motif.
Analysis of the Amino Terminus of Cak1p: Creation of a Glycine
Loop--
We introduced a canonical glycine loop motif near the amino
terminus of Cak1p in three contexts, anticipating that introduction of
a glycine loop into this region might increase the affinity for ATP.
However, for each of these mutants, the
KM(ATP) and
KM(CDK2) increased moderately,
indicating that the affinity of the protein for its substrates
decreased. The most dramatic effect, resulting from the replacement of
two isoleucine residues and a cysteine residue with glycines, increased
the KM(ATP) by 10-fold. This result
might be explained by examination of the crystal structure of PKA,
which indicates that the adenine ring is buried in a hydrophobic pocket
containing a leucine located in
-strand 1, whereas the ribose ring
associates with a conserved valine in
-strand 2 (63). The glycine
loop links these two strands, and the entire structure acts as a lid
that locks the nucleotide in place. Perhaps the isoleucine residues in
Cak1p are important for binding to the adenosine portion of ATP in a similar manner.
Despite the absence of a glycine loop motif and the tolerance of Cak1p
for mutations at the invariant lysine (Lys-31), it was remarkable that
proteins completely deleted for one or both of these regions could
function in vivo. The
Gly mutant had only a ~20-fold
increase in KM(ATP) and a normal
Vmax, whereas the
31 mutant had no detectable
activity in vitro. Both a normal glycine loop and the
invariant lysine help to position the ATP phosphates for catalysis.
Cak1p is a slow enzyme (kcat ~2.6
min
1) with a rate-limiting catalytic step.3
Depending on exactly what chemical step is rate-limiting, it is
possible that the less precise positioning of ATP in these mutants
could have little effect on the overall rate of catalysis. The Cak1p
mutants of the glycine loop (including the
Gly mutant) and of Lys-31
still bind ATP reasonably well. The reduction in binding presumably
reflects elimination of weaker interactions with the ATP phosphates. We
are not aware of other protein kinases that retain activity after
introduction of mutations comparable to
Gly and
31.
Each of the glycine loop mutants had a reduced thermostability compared
with wild type Cak1p. The temperature sensitivity of the three mutants
was similar, suggesting that the amino-terminal portion of Cak1p
confers stability on the protein structure and that Cak1p cannot
accommodate the flexibility induced by the introduction of glycine
residues into this region. Interestingly, mutation of the first and
second glycines to serine in the PKA glycine loop only increased the
thermostability of the protein by 1-2 °C (14). This result further
emphasizes that whereas other protein kinases may be able to compensate
for the flexibility introduced by the glycine loop in this region,
Cak1p may require a more anchored structure at its amino terminus.
In summary, Cak1p possesses an unusual ATP-binding motif. Despite the
lack of a conserved nucleotide-binding sequence near its amino
terminus, Cak1p binds ATP with reasonable affinity and effectively
excludes water from the active site. The mechanism by which catalysis
is mediated within the ATP-binding site of Cak1p may differ somewhat
from that described for other protein kinases, since the invariant
lysine appears to have an altered position and/or reactivity. The
number of protein kinases with these unusual properties appears to be
small, although only a limited number of kinases have been examined in
depth. There may well be a number of structural solutions to the
problem of excluding water from the active site. Elucidation of the
crystal structure of Cak1p will provide a more detailed understanding
of the structural differences that are responsible for the ability of
Cak1p to function in the absence of conserved motifs and may indicate
how general this mechanism is.
 |
ACKNOWLEDGEMENTS |
We thank Ann Sutton for discussion and for
providing the K31R mutant and Alicia Russo and Nikola Pavletich for
providing the CDK2 used in this study. We also thank the entire Solomon
laboratory for their advice and support.
 |
FOOTNOTES |
*
This work was supported in part by the Searle Scholars
Program/The Chicago Community Trust and by Grant GM47830 from the
National Institutes of Health.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Supported by a long term fellowship of the Swiss National Science Foundation.
§
Leukemia Society of America Scholar. To whom correspondence should
be addressed: Yale University School of Medicine, Dept. of Molecular
Biophysics and Biochemistry, 333 Cedar St., New Haven, CT 06520-8024. Tel.: 203-737-2702; Fax: 203-785-6404; E-mail: Mark.Solomon{at}yale.edu.
The abbreviations used are:
PKA, cAMP-dependent protein kinase; AMPPNP, 5'-adenylylimidodiphosphate; Cak1p, CDK-activating kinase; CDK, cyclin-dependent kinase; Me2SO, dimethyl
sulfoxide; DTT, dithiothreitol; FSBA, 5'-p-fluorosulfonylbenzoyladenosine; GST, glutathione
S-transferase; PAGE, polyacrylamide gel electrophoresis.
2
Kaldis, P., Pitluk, Z. W., Bany, I. A., Enke, D. A., Wagner, M., Winter, E., and Solomon, M. J. (1998) J. Cell
Sci. 111, 3585-3596
3
P. Kaldis and M. J. Solomon, unpublished results.
4
D. A. Enke and M. J. Solomon, manuscript in preparation.
 |
REFERENCES |
-
Taylor, S. S.,
Knighton, D. R.,
Zheng, J.,
Ten Eyck, L. F.,
and Sowadski, J. M.
(1992)
Annu. Rev. Cell Biol.
8,
429-462[CrossRef]
-
Hanks, S. K.,
and Hunter, T.
(1995)
FASEB J.
9,
576-596[Abstract]
-
Taylor, S. S.,
and Radzio-Andzelm, E.
(1994)
Structure
2,
345-355[Medline]
[Order article via Infotrieve]
-
Knighton, D. R.,
Zheng, J.,
Eyck, L. F. T.,
Ashford, V. A.,
Xuong, N.-H.,
Taylor, S. S.,
and Sowadski, J. M.
(1991)
Science
253,
407-414[Abstract/Free Full Text]
-
DeBondt, H. L.,
Rosenblatt, J.,
Jancarik, J.,
Jones, H. D.,
Morgan, D. O.,
and Kim, S.-H.
(1993)
Nature
363,
595-602[CrossRef][Medline]
[Order article via Infotrieve]
-
Hu, S.-H.,
Parker, M. W.,
Lei, J. Y.,
Wilce, M. C. J.,
Benian, G. M.,
and Kemp, B. E.
(1994)
Nature
369,
581-584[CrossRef][Medline]
[Order article via Infotrieve]
-
Zhang, F.,
Strand, A.,
Robbins, D.,
Cobb, M. H.,
and Goldsmith, E. J.
(1994)
Nature
367,
704-711[CrossRef][Medline]
[Order article via Infotrieve]
-
Xu, R.-M.,
Carmel, G.,
Sweet, R. M.,
Kuret, J.,
and Cheng, X.
(1995)
EMBO J.
14,
1015-1023[Medline]
[Order article via Infotrieve]
-
Kobe, B.,
Heierhorst, J.,
Feil, S. C.,
Parker, M. W.,
Benian, G. M.,
Weiss, K. R.,
and Kemp, B. E.
(1996)
EMBO J.
15,
6810-6821[Medline]
[Order article via Infotrieve]
-
Wilson, K. P.,
Fitzgibbon, M. J.,
Caron, P. R.,
Griffith, J. P.,
Chen, W.,
McCaffrey, P. G.,
Chambers, S. P.,
and Su, M. S.-S.
(1996)
J. Biol. Chem.
271,
27696-27700[Abstract/Free Full Text]
-
Jeffrey, P. D.,
Russo, A. A.,
Polyak, K.,
Gibbs, E.,
Hurwitz, J.,
Massagué, J.,
and Pavletich, N. P.
(1995)
Nature
376,
313-320[CrossRef][Medline]
[Order article via Infotrieve]
-
Hanks, S. K.,
Quinn, A. M.,
and Hunter, T.
(1988)
Science
241,
42-52[Abstract/Free Full Text]
-
Bossemeyer, D.
(1994)
Trends Biochem. Sci.
19,
201-205[CrossRef][Medline]
[Order article via Infotrieve]
-
Hemmer, W.,
McGlone, M.,
Tsigelny, I.,
and Taylor, S. S.
(1997)
J. Biol. Chem.
272,
16946-16954[Abstract/Free Full Text]
-
Lee, J.-H.,
Maeda, S.,
Angelos, K. L.,
Kamita, S. G.,
Ramachandran, C.,
and Walsh, D. A.
(1992)
Biochemistry
31,
10616-10625[CrossRef][Medline]
[Order article via Infotrieve]
-
Odawara, M.,
Kadowaki, T.,
Yamamoto, R.,
Shibasaki, Y.,
Tobe, K.,
Accili, D.,
Bevins, C.,
Mikami, Y.,
Matsuura, N.,
Akanuma, Y.,
Takaku, F.,
Taylor, S. I.,
and Kasuga, M.
(1989)
Science
245,
66-68[Abstract/Free Full Text]
-
Gibbs, C. S.,
and Zoller, M. J.
(1991)
J. Biol. Chem.
266,
8923-8931[Abstract/Free Full Text]
-
Taylor, S. S.,
Knighton, D. R.,
Zheng, J.,
Sowadski, J. M.,
Gibbs, C. S.,
and Zoller, M. J.
(1993)
Trends Biochem. Sci.
18,
84-89[CrossRef][Medline]
[Order article via Infotrieve]
-
Robinson, M. J.,
Harkins, P. C.,
Zhang, J.,
Baer, R.,
Haycock, J. W.,
Cobb, M. H.,
and Goldsmith, E. J.
(1996)
Biochemistry
35,
5641-5646[CrossRef][Medline]
[Order article via Infotrieve]
-
Espinoza, F. H.,
Farrell, A.,
Erdjument-Bromage, H.,
Tempst, P.,
and Morgan, D. O.
(1996)
Science
273,
1714-1717[Abstract/Free Full Text]
-
Kaldis, P.,
Sutton, A.,
and Solomon, M. J.
(1996)
Cell
86,
553-564[CrossRef][Medline]
[Order article via Infotrieve]
-
Thuret, J.-Y.,
Valay, J.-G.,
Faye, G.,
and Mann, C.
(1996)
Cell
86,
565-576[CrossRef][Medline]
[Order article via Infotrieve]
-
Deshaies, R. J.,
and Kirschner, M.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
1182-1186[Abstract/Free Full Text]
-
Lim, H. H.,
Loy, C. J.,
Zaman, S.,
and Surana, U.
(1996)
Mol. Cell. Biol.
16,
4573-4583[Abstract]
-
Cismowski, M. J.,
Laff, G. M.,
Solomon, M. J.,
and Reed, S. I.
(1995)
Mol. Cell. Biol.
15,
2983-2992[Abstract]
-
Solomon, M. J., and Kaldis, P. (1998) Results and Problems
in Cell Differentiation: Cell Cycle Control (Pagano, M., ed)
22, 79-109, Springer-Verlag, Berlin
-
Herman, P. K.,
Stack, J. H.,
DeModena, J. A.,
and Emr, S. D.
(1991)
Cell
64,
425-437[CrossRef][Medline]
[Order article via Infotrieve]
-
Lundgren, K.,
Walworth, N.,
Booher, R.,
Dembski, M.,
Kirschner, M.,
and Beach, D.
(1991)
Cell
64,
1111-1122[CrossRef][Medline]
[Order article via Infotrieve]
-
Chun, K. T.,
and Goebl, M. G.
(1997)
Mol. Gen. Genet.
256,
365-375[CrossRef][Medline]
[Order article via Infotrieve]
-
Smith, D. B.,
and Johnson, K. S.
(1988)
Gene (Amst.)
67,
31-40[CrossRef][Medline]
[Order article via Infotrieve]
-
Desai, D.,
Gu, Y.,
and Morgan, D. O.
(1992)
Mol. Biol. Cell
3,
571-582[Abstract]
-
Russo, A. A.
(1997)
Methods Enzymol.
283,
3-12[CrossRef][Medline]
[Order article via Infotrieve]
-
Elledge, S. J.,
and Spottswood, M. R.
(1991)
EMBO J.
10,
2653-2659[Medline]
[Order article via Infotrieve]
-
Ninomiya-Tsuji, J.,
Nomoto, S.,
Yasuda, H.,
Reed, S. I.,
and Matsumoto, K.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
9006-9010[Abstract/Free Full Text]
-
Hathaway, G. M.,
Zoller, M. J.,
and Traugh, J. A.
(1981)
J. Biol. Chem.
256,
11442-11446[Abstract/Free Full Text]
-
Zoller, M. J.,
Nelson, N. C.,
and Taylor, S. S.
(1981)
J. Biol. Chem.
256,
10837-10842[Abstract/Free Full Text]
-
Kamps, M. P.,
Taylor, S. S.,
and Sefton, B. M.
(1984)
Nature
310,
589-592[CrossRef][Medline]
[Order article via Infotrieve]
-
Armstrong, R. N.,
Kondo, H.,
and Kaiser, E. T.
(1979)
Proc. Natl. Acad. Sci. U. S. A.
76,
722-725[Abstract/Free Full Text]
-
Esch, F. S.,
and Allison, W. S.
(1978)
J. Biol. Chem.
253,
6100-6106[Abstract/Free Full Text]
-
Hartog, A. F.,
Edel, C. M.,
Braham, J.,
Muijsers, A. O.,
and Berden, J. A.
(1997)
Biochim. Biophys. Acta
1318,
107-122[Medline]
[Order article via Infotrieve]
-
van der Zwet-de Graaf, I.,
Hartog, A. F.,
and Berden, J. A.
(1997)
Biochim. Biophys. Acta
1318,
123-132[Medline]
[Order article via Infotrieve]
-
Gonzalez, B.,
Francois, J.,
and Renaud, M.
(1997)
Yeast
13,
1347-1355[CrossRef][Medline]
[Order article via Infotrieve]
-
Solomon, M. J.,
Harper, J. W.,
and Shuttleworth, J.
(1993)
EMBO J.
12,
3133-3142[Medline]
[Order article via Infotrieve]
-
Erikson, E.,
and Maller, J. L.
(1989)
J. Biol. Chem.
264,
19577-19582[Abstract/Free Full Text]
-
Boerner, R. J.,
Barker, S. C.,
and Knight, W. B.
(1995)
Biochemistry
34,
16419-16423[CrossRef][Medline]
[Order article via Infotrieve]
-
Lew, J.,
Taylor, S. S.,
and Adams, J. A.
(1997)
Biochemistry
36,
6717-6724[CrossRef][Medline]
[Order article via Infotrieve]
-
LoGrasso, P. V.,
Frantz, B.,
Rolando, A. M.,
O'Keefe, S. J.,
Hermes, J. D.,
and O'Neill, E. A.
(1997)
Biochemistry
36,
10422-10427[CrossRef][Medline]
[Order article via Infotrieve]
-
Booher, R.,
and Beach, D.
(1986)
Mol. Cell. Biol.
6,
3523-3530[Abstract/Free Full Text]
-
Kamps, M. P.,
and Sefton, B. M.
(1986)
Mol. Cell. Biol.
6,
751-757[Abstract/Free Full Text]
-
Weinmaster, G.,
Zoller, M. J.,
and Pawson, T.
(1986)
EMBO J.
5,
69-76[Medline]
[Order article via Infotrieve]
-
Chen, W. S.,
Lazar, C. S.,
Poenie, M.,
Tsien, R. Y.,
Gill, G. N.,
and Rosenfeld, M. G.
(1987)
Nature
328,
820-823[CrossRef][Medline]
[Order article via Infotrieve]
-
Chou, C. K.,
Dull, T. J.,
Russell, D. S.,
Gherzi, R.,
Lebwohl, D.,
Ullrich, A.,
and Rosen, O. M.
(1987)
J. Biol. Chem.
262,
1842-1847[Abstract/Free Full Text]
-
Honegger, A. M.,
Dull, T. J.,
Felder, S.,
Van Obberghen, E.,
Bellot, F.,
Szapary, D.,
Schmidt, A.,
Ullrich, A.,
and Schlessinger, J.
(1987)
Cell
51,
199-209[CrossRef][Medline]
[Order article via Infotrieve]
-
Wyatt, J. L.,
and Colman, R. F.
(1977)
Biochemistry
16,
1333-1342[CrossRef][Medline]
[Order article via Infotrieve]
-
Zoller, M. J.,
and Taylor, S. S.
(1979)
J. Biol. Chem.
254,
8363-8368[Free Full Text]
-
Russo, M. W.,
Lukas, T. J.,
Cohen, S.,
and Staros, J. V.
(1985)
J. Biol. Chem.
260,
5205-5208[Abstract/Free Full Text]
-
King, M. M.,
Shell, D. J.,
and Kwiatkowski, A. P.
(1988)
Arch. Biochem. Biophys.
267,
467-473[CrossRef][Medline]
[Order article via Infotrieve]
-
Atherton-Fessler, S.,
Parker, L. L.,
Geahlen, R. L.,
and Piwnica-Worms, H.
(1993)
Mol. Cell. Biol.
13,
1675-1685[Abstract/Free Full Text]
-
Komatsu, H.,
and Ikebe, M.
(1993)
Biochem. J.
296,
53-58
-
Adams, P. D.,
and Parker, P. J.
(1992)
J. Biol. Chem.
267,
13135-13137[Abstract/Free Full Text]
-
Nelson, J. W.,
Zhu, J.,
Smith, C. C.,
Kulka, M.,
and Aurelian, L.
(1996)
J. Biol. Chem.
271,
17021-17027[Abstract/Free Full Text]
-
Young, P. R.,
McLaughlin, M. M.,
Kumar, S.,
Kassis, S.,
Doyle, M. L.,
McNulty, D.,
Gallagher, T. F.,
Fisher, S.,
McDonnell, P. C.,
Carr, S. A.,
Huddleston, M. J.,
Seibel, G.,
Porter, T. G.,
Livi, G. P.,
Adams, J. L.,
and Lee, J. C.
(1997)
J. Biol. Chem.
272,
12116-12121[Abstract/Free Full Text]
-
Narayana, N.,
Cox, S.,
Shaltiel, S.,
Taylor, S. S.,
and Xuong, N.
(1997)
Biochemistry
36,
4438-4448[CrossRef][Medline]
[Order article via Infotrieve]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
S. M. Pitson, P. A. B. Moretti, J. R. Zebol, R. Zareie, C. K. Derian, A. L. Darrow, J. Qi, R. J. D'Andrea, C. J. Bagley, M. A. Vadas, et al.
The Nucleotide-binding Site of Human Sphingosine Kinase 1
J. Biol. Chem.,
December 13, 2002;
277(51):
49545 - 49553.
[Abstract]
[Full Text]
[PDF]
|
 |
|