![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 4, 2009-2013, January 22, 1999
§,
¶,
From the Institut Cochin de Génétique Moléculaire, U.129 INSERM Unité de Recherches en Physiologie et Pathologie Génétiques et Moléculaires, 75014 Paris, France
| |
ABSTRACT |
|---|
|
|
|---|
In the liver, transcription of several genes
encoding lipogenic and glycolytic enzymes, in particular the gene for
fatty acid synthase (FAS), is known to be stimulated by dietary
carbohydrates. The molecular dissection of the FAS promoter pointed out
the critical role of an E box motif, located at position Fatty acid synthase
(FAS)1 plays a central role
in de novo lipogenesis in mammals, catalyzing all reaction
steps in the conversion of acetyl-CoA and malonyl-CoA to palmitate. As
for many other lipogenic and glycolytic genes involved in maintenance
of energy balance, the expression of the FAS gene is highly dependent
on nutritional conditions in liver and adipose tissue. Expression of
the gene is barely detectable in starved animals and is stimulated by
refeeding a high carbohydrate, fat-free diet (for review see Refs. 1
and 2). This fasting/refeeding transition is accompanied in
vivo by an increased circulating insulin level, and it is often difficult to differentiate the effects of insulin from those of carbohydrate metabolism in mediating the regulation of gene expression. To date, the role of insulin, either direct or indirect, in mediating FAS-activated gene expression, is still disputed. It has been proposed
that the effects of insulin could be only indirect (3-5), being
permissive to allow for effective glucose metabolism (1). In contrast,
others have provided evidence for a direct involvement of insulin both
ex vivo (6) and in vivo (7). In this respect, Sul
and co-workers (8) reported, by transfection experiments, that the
region between
65 with
respect to the start site of transcription, in mediating the glucose-
and insulin-dependent regulation of the gene. Upstream
stimulatory factors (USF1 and USF2) and sterol response element binding
protein 1 (SREBP1) were shown to be able to interact in
vitro with this E box. However, to date, the relative
contributions of USFs and SREBP1 ex vivo remain
controversial. To gain insight into the specific roles of these factors
in vivo, we have analyzed the glucose responsiveness of
hepatic FAS gene expression in USF1 and USF2 knock-out mice. In both
types of mouse lines, defective in either USF1 or USF2, induction of
the FAS gene by refeeding a carbohydrate-rich diet was severely
delayed, whereas expression of SREBP1 was almost normal and insulin
response unchanged. Therefore, USF transactivators, and especially
USF1/USF2 heterodimers, seem to be essential to sustain the dietary
induction of the FAS gene in the liver.
![]()
INTRODUCTION
Top
Abstract
Introduction
References
71/
50 was responsible for mediating the effects of
insulin on the rat FAS promoter (see Fig.
1). They further demonstrated that
upstream stimulatory factors (USFs), USF1 and USF2, were major
components of the complex binding to this region (called IRS for
insulin response sequence) (9). USFs are ubiquitous basic
helix-loop-helix-leucine zipper (b-HLH-Zip) transcription factors able
to interact as homo- and/or heterodimers on E boxes of CANNTG sequence
(for review see Ref. 10). The FAS promoter IRS contains such an E box
at position
65 (Fig. 1). Mutations impairing binding of USF1 and USF2
to this E box have been demonstrated to abolish the
insulin-dependent activation of the FAS promoter (11).
![]()
View larger version (8K):
[in a new window]
Fig. 1.
Nucleotide sequences of the IRS
from the FAS gene and the GlRE from L-PK and S14 genes. E boxes
corresponding to recognized USF-binding sites are indicated in
bold letters. The underlined regions represent
the two separate SREBP recognition sites described in the FAS IRS
(35).
In a recent paper, Kim et al. (12) reported data at variance
with the data of Wang and Sul (11), and the authors proposed SREBP1
(sterol response element binding protein 1), instead of USFs, as being
the key activator acting through the
65 E box (12). As the USFs,
SREBPs are b-HLH-Zip transcription factors (for review see Ref. 13).
Two members of this family, encoded by two separate genes, have been
characterized so far, SREBP1 and SREBP2 (14-16). Based on in
vivo and ex vivo experiments, it is now assumed that
SREBP2 is more specifically devoted to the control of genes involved in
cholesterol metabolism and SREBP1 in the control of genes involved in
fatty acid metabolism (17-20). Unlike other members of the b-HLH-Zip
family, SREBPs were shown to bind not only to their specific target
sites, namely the sterol response elements, but also to canonical E
boxes. This unusual ability to bind to two distinct DNA sequences is
due to the presence of an atypical tyrosine in the basic DNA-binding
domain at a key position that is occupied by an arginine in almost all
other b-HLH-Zip proteins (21).
In an effort to characterize the molecular mechanisms underlying the
regulation of gene expression by glucose in the liver, we previously
reported the generation of USF1 and USF2 knock-out mice (22, 23). To
gain insight into the respective roles of USFs and SREBPs in the
regulation of FAS gene expression by glucose and insulin, we have
investigated the glucose responsiveness of FAS in USF1 and USF2
knock-out mice. In this paper, we demonstrate that USFs are essential
components binding to the
65 E box of the FAS promoter and required
for a normal transcriptional response of the FAS gene to dietary
carbohydrates in vivo. In addition, we provide evidence that
this response is likely dependent on the presence of USF1/USF2
heterodimers, USF1 and USF2 homodimers being insufficient to promote a
rapid response of the FAS gene to dietary glucose.
| |
EXPERIMENTAL PROCEDURES |
|---|
Animals and Treatments--
USF1- and USF2-deficient mice were
generated by gene targeting as described previously (22, 23). To
generate the double heterozygous USF1+/
USF2+/
mice, USF1+/
mice
were bred with USF2+/
mice as previously reported (23).
For metabolic studies, animals were fed a high carbohydrate diet for
18 h after a 24-h fast. Mice were sacrificed between 10 and
12 a.m., and tissue samples were stored at
80 °C. Blood samples were collected from the orbital sinus.
Serum insulin levels were determined using an insulin radioimmunoassay kit (Behring Diagnostics) with human insulin as standard.
RNA Analysis--
Total RNA was purified by a modified guanidium
chloride procedure, and Northern blot analysis was conducted as
described previously (24). FAS (25) and SREBP1 (26) cDNA probes
were radiolabeled with [
-32P]dCTP using the High Prime
system (Boehringer Mannheim). Each Northern blot was stripped and
reprobed with a ribosomal 18 S cDNA to check for the integrity and
the amount of loaded RNAs. The amount of specific mRNA was
quantified using a PhosphorImager (Molecular Dynamics).
Protein Analysis-- Nuclear and whole cell extracts were prepared according to Viollet et al. (27) and Vallet et al. (22), respectively. Western blot analyses were performed with 15 µg of nuclear extracts or 60 µg of whole cell extracts using SREBP1 antibody (K-10, Santa Cruz Biotechnology) at a 1:100 dilution. To ensure comparable loading of the samples, blots performed with whole cell extracts were incubated with anti-annexin V antibody, and those performed with nuclear extracts were incubated with USF1-specific peptide antibody (Santa Cruz Biotechnology) or affinity-purified USF2 1-49 antibodies.
For electrophoretic mobility shift assays (EMSA), the DNA-binding
reaction was performed as described previously (27) in the presence of
either 5 µg of rat liver nuclear extracts or 30 µg of whole cell
extracts, 2.5 µg of poly(dI-dC), and 0.1-0.5 ng of end-labeled
double-stranded oligonucleotide corresponding to the
65 E box of the
FAS promoter (
75 to
52, 5' GCTGTCAGCCCATGTGGCGTGGCC). For
supershift experiments, USF1 and USF2 antibodies were included in the
binding reactions (27).
Data Analysis--
Statistical analysis was performed by the
Student's t test for unpaired data using the StatView
software. The significance has been considered at *p < 0.05, **p < 0.01, or ***p < 0.001.
| |
RESULTS AND DISCUSSION |
|---|
Dietary Carbohydrate-dependent Accumulation of the FAS
mRNA Is Altered in USF1- and USF2-deficient Mice--
To determine
the impact of USF1 and USF2 deficiency on glucose responsiveness of FAS
gene expression, a series of metabolic analyses were performed on
either wild type, USF1
/
, or USF2
/
mice. After a 24-h fast, mice
were refed a high carbohydrate diet for 18 h. Total liver RNA was
purified and analyzed by Northern blot to estimate the content of FAS
mRNA (Fig. 2A).
Quantification of this analysis (Fig. 2B) revealed that the
amount of FAS mRNA was dramatically reduced, to 23% in the liver
of USF1
/
mice and to 21% in the liver of USF2
/
mice, as
compared with wild type mice. This reduction in the abundance of FAS
mRNA was specific to the fasted/refed transition. Indeed, in
ad libitum fed mice or in mice fed a high carbohydrate diet
for 5 days, the amount of FAS mRNA was not significantly altered
(data not shown). In addition, this reduction was not due to altered
circulating insulin level in USFs-deficient mice. Insulin level was
indeed found to be similar between USF1
/
and wild type mice
(34.64 ± 15.44 (n = 8) and 32.20 ± 13.78 (n = 11) micro-UI/ml insulin for wild type and USF1
/
groups, respectively), and between USF2
/
and wild type mice
(22). Finally, glucose uptake and its utilization by the liver of
USF-deficient mice were previously shown to be normal (22, 23).
|
Taken together, these results indicate that USF1 and USF2 are likely to be specifically and directly involved in the dietary carbohydrate-dependent activation of FAS gene expression.
USFs Are Major Components Binding to the
65 E box of the FAS
Promoter--
To determine the nature of USF complexes binding to the
specific
65 E box of the FAS gene promoter, EMSA were performed with rat liver nuclear extracts. USF binding activity on this specific E box
was shown to be similar to the USF binding activity previously reported
on a canonical E box (27). Indeed, as presented in Fig.
3A, USF1/USF2 heterodimers
were largely predominant, whereas the amount of USF1 and USF2
homodimers, as determined after incubation with anti-USF1 (lane
2) and anti-USF2 (lane 3) antibodies, was very low
(i.e. <10% of total USF binding activity). The same band shift experiments were performed with liver cellular extracts from
USF1- and USF2-deficient mice. As shown in Fig. 3B, in
USF1-deficient mice, the USF binding activity on the
65 E box of FAS
promoter was accounted for by USF2 homodimers; anti-USF1 antibody was
without any effect on USF binding activity (lane 2), whereas
anti-USF2 antibody fully displaced the complex (lane 3).
Exactly the opposite was found in USF2-deficient mice (lanes
4-6), i.e. the USF binding activity was accounted for
by USF1 homodimers on the
65 E box of FAS promoter. The incapacity of
USF1 homodimers in USF2-deficient mice and USF2 homodimers in
USF1-deficient mice to support a normal dietary activation of FAS gene
transcription suggests that the heterodimeric species could have a
specific role in the regulation of the FAS gene compared with the
homodimeric species. This idea is strengthened by the fact that FAS
mRNA content was reduced to the same extent in both USF1
/
and
USF2
/
mice. Therefore, to address further the question of the
specific role of USF1/USF2 heterodimer, we examined FAS gene expression
in double heterozygous mice where the USF binding activity, mainly
accounted for by the heterodimer, was shown to be reduced to 46% (23).
We compared by Northern blot analysis the amount of hepatic FAS
mRNA in USF1+/
USF2+/
mice and wild type mice refed a high
carbohydrate diet for 18 h (Fig.
4A). As shown in Fig.
4B, the amount of FAS mRNA in the liver of double
heterozygous mice was reduced to 50% of normal, which is to say about
2-fold less than in homozygous USF1
/
and USF2
/
mice. We can
speculate that this better response of the FAS gene in double
heterozygous mice compared with homozygous mice reflects the higher
efficacy of the USF heterodimers compared with both types of
homodimers. Indeed, total residual USF binding activity is reduced to
the same extent (i.e. to 40-46% of normal) in the three
types of knock-out animals (23).
|
|
Interestingly, this is the first report enlightening the specific role
of USF heterodimer species in nutrient gene regulation. Indeed, for two
glucose-regulated genes previously investigated, namely
L-PK and S14 genes, the
glucose-dependent gene transcription was reported to be
impaired in USF2
/
mice but not in USF1
/
mice, suggesting that,
in these latter mice, residual USF2 homodimers are as efficient as the
heterodimers to allow for a normal glucose responsiveness of
L-PK and S14 genes (22, 23). The differential transactivating properties of USF1 and USF2 dimers in activating different sets of glucose-responsive genes could be functionally achieved through the different nature of USF-binding sites as well as
of flanking sequences. Indeed, the L-PK and S14 genes have
a regulatory element (termed glucose/carbohydrates response element,
GlRE) which presents striking similarities (Fig. 1). It consists of two
CACGTG type E box motifs whose precise spacing and orientation are
critical to create a functional glucose response element (2, 28). This
architecture is not found for the
65 FAS E box which is not
palindromic and, therefore, does not obey the criteria reported above
for the functional glucose/carbohydrates response elements (Fig. 1).
Thus, the requirements of these different types of USF-binding sites
for USF isoforms can be different. In addition, binding sites for
auxiliary factors have been shown to be essential for the S14 and
L-PK GlRE (28, 29) and could also be involved in the
functional specificity of USF dimers. Finally, it is noteworthy that
the role of the
65 FAS E box and of USFs in the dietary response of
the FAS gene does not signify that this element is itself the
"response element" but that it is required, perhaps with other
elements, for this response.
The USF-dependent Defect in Dietary Induction of the
FAS Gene Is Not Mediated by SREBP1--
Our present study seems to
establish the fundamental role of USFs in the response of FAS to
dietary glucose. However, following the recent report of Kim et
al. (12) on the predominant role of SREBP1 in the nutritional
control of FAS, it was important to establish whether SREBP1 level was
affected in USF1- and USF2-deficient mice. To this end, we measured by
Northern blot analysis the amount of SREBP1 mRNA in the liver of
USF1
/
and USF2
/
mice as compared with wild type mice. Fig.
5, A and B, shows
that the amount of SREBP1 mRNA was normal in USF1
/
mice and
only slightly reduced (30% decreased) in USF2
/
mice as compared
with wild type controls. To regulate gene transcription, SREBP must be
post-translationally activated by a proteolytic cascade; the mature
NH2-terminal domain of the protein is released from the
endothelial reticulum membranes into the cytosol and then rapidly
translocated into the nucleus (13). We therefore analyzed the
concentrations of mature SREBP1 in the liver of USF1- and
USF2-deficient mice. As shown in the Western blot of Fig.
6A, the amount of mature
SREBP1 seemed to be similar in liver cellular extracts from either wild
type, USF1-, or USF2-deficient mice, indicating that proteolytic
processing of SREBP1 was normal in USF-deficient mice. Furthermore,
this mature form of SREBP1 was properly translocated into the nucleus as demonstrated by the similar level of SREBP1 in nuclear extracts from
wild type and USF-deficient mice (Fig. 6B). Taken together, these results demonstrate that the absence of USFs is likely the primary event responsible for the dramatic decrease in FAS gene induction upon carbohydrate refeeding and that a normal level of mature
SREBP1, in absence of USFs, is unable to support a proper nutritional
activation of FAS gene expression.
|
|
Therefore, our results are in accordance with the data of Wang and Sul
(11) and strongly suggest that USFs are required for the
nutrition-dependent activity of the FAS promoter. Of
course, these results are not sufficient to rule out the possible
involvement of SREBP1. However, Shimano et al. (30) recently
reported that in the liver and adipocytes of SREBP1
/
mice, the
levels of mRNAs for fatty acid synthesis enzymes, including the FAS
mRNA, were normal. Although this could be related to compensatory
increase of SREBP2 expression in the liver, this factor was
undetectable in adipocytes of SREBP1
/
mice in which the abundance
of the FAS mRNA was normal (30). These results are consistent with the idea that, on a physiological point of view, SREBPs play a predominant role in regulating the cholesterol synthesis (through sterol response elements and not E box) and have an auxiliary role only
in fatty acid synthesis. In this line, Athanikar and Osborne (31)
recently suggested that FAS activation through the
65 E box must
occur through more specific regulators of fatty acid metabolism than
SREBPs factors to provide the mechanism to regulate independently as
well as coordinately the biosynthesis of fatty acids and cholesterol.
It is noteworthy that this interpretation of the respective role of USFs and SREBPs in dietary activation of lipogenic genes is not inconsistent with the observation that overproduction of truncated form of SREBP1 in the liver results in constitutive activation of these genes, especially the FAS gene (19, 32). In this case, indeed, it could be that processed SREBP1 in excess constitutively binds to the E box and activates transcription, bypassing the USF-dependent regulation.
How USFs manage to regulate the transcriptional response to dietary
glucose is not yet fully elucidated. Preliminary results in our
laboratory suggest that the transactivating potential of USFs is
modulated by a glucose-sensor complex interacting, as USFs, with
canonical GlREs.2 However,
whether the FAS gene contains authentic GlREs is not clear. Foufelle
et al. (33) reported an element in the FAS gene first intron
with similar properties to known glucose-responsive elements. However,
this element was demonstrated to be ineffective in supporting the
dietary gene regulation in the natural context (29) and to be
dispensable for in vivo response of a FAS transgene to
carbohydrate refeeding (34). As discussed above, the
65 E box,
essential in cell culture for the response to insulin, is not an
authentic palindromic GlRE, and its cis-effect has not been verified
in vivo. Whether this element is really involved in the
response to insulin or rather to insulin-dependent increase of the glycolytic flux is also not yet clear.
As a matter of fact, the sensitivity of the FAS gene to USF
deficiencies suggests that this gene belongs to the class of the glucose-responsive genes, such as the L-PK and S14
genes, rather than to that of the strictly
insulin-responsive genes, essentially represented by the glucokinase
gene (2). Indeed, regulation of the glucokinase gene is normal in USF1
and USF2 knock-out mice (22, 23). Further investigations on knock-out
mice are needed to firmly establish that the dependence of
dietary-regulated genes on USF really permits us to predict which of
them are authentic glucose-responsive genes and which are rather
regulated by insulin or other glucose-dependent hormones.
| |
ACKNOWLEDGEMENTS |
|---|
We thank M. Raymondjean for helpful discussions and advice and for providing the rat SREBP1 probe. Help was kindly supplied by M. Blache.
| |
FOOTNOTES |
|---|
* This work was supported in part by the Institut National de la Santé et de la Recherche Médicale.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Both authors contributed equally to this work.
§ Supported by grants from the European Commission.
¶ Supported by grants from the Ligue Nationale Contre le Cancer (Comité Départemental de la Vendée).
To whom correspondence should be addressed: ICGM, INSERM
U.129, 24, rue du Faubourg Saint-Jacques, 75014 Paris, France. Tel.: 33-1-44-41-24-08; Fax: 33-1-44-41-24-21; E-mail: vaulont{at}cochin.inserm.fr.
The abbreviations used are: FAS, fatty acid synthase; SREBP, sterol regulatory element-binding protein; b-HLH-Zip, basic helix-loop-helix leucine zipper; USF, upstream stimulatory factor; L-PK, L-type pyruvate kinase; S14, Spot 14; EMSA, electrophoretic mobility shift assay; IRS, insulin response sequence; GlRE, glucose/carbohydrates response element.
2 D-Q. Lou, M. Tannour, L. Selig, D. Thomas, A. Kahn, and M. Vasseur-Cognet, personal communication.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. Sekiya, N. Yahagi, T. Matsuzaka, Y. Takeuchi, Y. Nakagawa, H. Takahashi, H. Okazaki, Y. Iizuka, K. Ohashi, T. Gotoda, et al. SREBP-1-independent regulation of lipogenic gene expression in adipocytes J. Lipid Res., July 1, 2007; 48(7): 1581 - 1591. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Lu, Y. Zhou, K. Kaufman, R. Mott, and J.-x. Ma Rat strain-dependent susceptibility to ischemia-induced retinopathy associated with retinal vascular endothelial growth factor regulation J. Mol. Endocrinol., April 1, 2007; 38(4): 423 - 432. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Dickson, M. B. Zimmerman, K. Rahmouni, and C. D. Sigmund The -20 and -217 Promoter Variants Dominate Differential Angiotensinogen Haplotype Regulation in Angiotensinogen-Expressing Cells Hypertension, March 1, 2007; 49(3): 631 - 639. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Griffin, R. H. F. Wong, N. Pandya, and H. S. Sul Direct Interaction between USF and SREBP-1c Mediates Synergistic Activation of the Fatty-acid Synthase Promoter J. Biol. Chem., February 23, 2007; 282(8): 5453 - 5467. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. M. van der Vleuten, A. Isaacs, A. Hijmans, C. M. van Duijn, A. F. H. Stalenhoef, and J. de Graaf The involvement of upstream stimulatory factor 1 in Dutch patients with familial combined hyperlipidemia J. Lipid Res., January 1, 2007; 48(1): 193 - 200. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. K. Bayele, H. McArdle, and S. K.S. Srai Cis and trans regulation of hepcidin expression by upstream stimulatory factor Blood, December 15, 2006; 108(13): 4237 - 4245. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. da Silva Xavier, G. A. Rutter, F. Diraison, C. Andreolas, and I. Leclerc ChREBP binding to fatty acid synthase and L-type pyruvate kinase genes is stimulated by glucose in pancreatic {beta}-cells J. Lipid Res., November 1, 2006; 47(11): 2482 - 2491. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Imagawa, S. Fujii, J. Dong, T. Furumoto, T. Kaneko, T. Zaman, Y. Satoh, H. Tsutsui, and B. E Sobel Hepatocyte Growth Factor Regulates E Box-Dependent Plasminogen Activator Inhibitor Type 1 Gene Expression in HepG2 Liver Cells Arterioscler. Thromb. Vasc. Biol., October 1, 2006; 26(10): 2407 - 2413. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. J. Crusselle-Davis, K. F. Vieira, Z. Zhou, A. Anantharaman, and J. Bungert Antagonistic Regulation of {beta}-Globin Gene Expression by Helix-Loop-Helix Proteins USF and TFII-I. Mol. Cell. Biol., September 1, 2006; 26(18): 6832 - 6843. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Zeggini, C. M. Damcott, R. L. Hanson, M. A. Karim, N. W. Rayner, C. J. Groves, L. J. Baier, T. C. Hale, A. T. Hattersley, G. A. Hitman, et al. Variation Within the Gene Encoding the Upstream Stimulatory Factor 1 Does Not Influence Susceptibility to Type 2 Diabetes in Samples From Populations With Replicated Evidence of Linkage to Chromosome 1q Diabetes, September 1, 2006; 55(9): 2541 - 2548. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Dentin, P.-D. Denechaud, F. Benhamed, J. Girard, and C. Postic Hepatic Gene Regulation by Glucose and Polyunsaturated Fatty Acids: A Role for ChREBP J. Nutr., May 1, 2006; 136(5): 1145 - 1149. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Rada-Iglesias, O. Wallerman, C. Koch, A. Ameur, S. Enroth, G. Clelland, K. Wester, S. Wilcox, O. M. Dovey, P. D. Ellis, et al. Binding sites for metabolic disease related transcription factors inferred at base pair resolution by chromatin immunoprecipitation and genomic microarrays Hum. Mol. Genet., November 15, 2005; 14(22): 3435 - 3447. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Naukkarinen, M. Gentile, A. Soro-Paavonen, J. Saarela, H. A. Koistinen, P. Pajukanta, M.-R. Taskinen, and L. Peltonen USF1 and dyslipidemias: converging evidence for a functional intronic variant Hum. Mol. Genet., September 1, 2005; 14(17): 2595 - 2605. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Huertas-Vazquez, C. Aguilar-Salinas, A. J. Lusis, R. M. Cantor, S. Canizales-Quinteros, J. C. Lee, L. Mariana-Nunez, R.-M. L. Riba-Ramirez, A. Jokiaho, T. Tusie-Luna, et al. Familial Combined Hyperlipidemia in Mexicans: Association With Upstream Transcription Factor 1 and Linkage on Chromosome 16q24.1 Arterioscler. Thromb. Vasc. Biol., September 1, 2005; 25(9): 1985 - 1991. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhu, M. Casado, S. Vaulont, and K. Sharma Role of Upstream Stimulatory Factors in Regulation of Renal Transforming Growth Factor-{beta}1 Diabetes, July 1, 2005; 54(7): 1976 - 1984. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Nowak, A. Helleboid-Chapman, H. Jakel, G. Martin, D. Duran-Sandoval, B. Staels, E. M. Rubin, L. A. Pennacchio, M.-R. Taskinen, J. Fruchart-Najib, et al. Insulin-Mediated Down-Regulation of Apolipoprotein A5 Gene Expression through the Phosphatidylinositol 3-Kinase Pathway: Role of Upstream Stimulatory Factor Mol. Cell. Biol., February 15, 2005; 25(4): 1537 - 1548. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. E. Thomas and T. J. Thekkumkara Glucose Mediates Transcriptional Repression of the Human Angiotensin Type-1 Receptor Gene: Role for a Novel Cis-acting Element Mol. Biol. Cell, October 1, 2004; 15(10): 4347 - 4355. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Putt, J. Palmen, V. Nicaud, D.-A. Tregouet, N. Tahri-Daizadeh, D. M. Flavell, S. E. Humphries, P. J. Talmud, and on behalf of the EARSII group Variation in USF1 shows haplotype effects, gene : gene and gene : environment associations with glucose and lipid parameters in the European Atherosclerosis Research Study II Hum. Mol. Genet., August 1, 2004; 13(15): 1587 - 1597. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Weigert, K. Brodbeck, M. Sawadogo, H. U. Haring, and E. D. Schleicher Upstream Stimulatory Factor (USF) Proteins Induce Human TGF-{beta}1 Gene Activation via the Glucose-response Element-1013/-1002 in Mesangial Cells: UP-REGULATION OF USF ACTIVITY BY THE HEXOSAMINE BIOSYNTHETIC PATHWAY J. Biol. Chem., April 16, 2004; 279(16): 15908 - 15915. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Hadsell, S. Bonnette, J. George, D. Torres, Y. Klementidis, S. Gao, P. M. Haney, J. Summy-Long, M. S. Soloff, A. F. Parlow, et al. Diminished Milk Synthesis in Upstream Stimulatory Factor 2 Null Mice Is Associated With Decreased Circulating Oxytocin and Decreased Mammary Gland Expression of Eukaryotic Initiation Factors 4E and 4G Mol. Endocrinol., November 1, 2003; 17(11): 2251 - 2267. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. I. Rodriguez, N. Girones, and M. Fresno Cha, a Basic Helix-Loop-Helix Transcription Factor Involved in the Regulation of Upstream Stimulatory Factor Activity J. Biol. Chem., October 31, 2003; 278(44): 43135 - 43145. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-J. Latasa, M. J. Griffin, Y. S. Moon, C. Kang, and H. S. Sul Occupancy and Function of the -150 Sterol Regulatory Element and -65 E-Box in Nutritional Regulation of the Fatty Acid Synthase Gene in Living Animals Mol. Cell. Biol., August 15, 2003; 23(16): 5896 - 5907. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ganz Hepcidin, a key regulator of iron metabolism and mediator of anemia of inflammation Blood, August 1, 2003; 102(3): 783 - 788. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. V. Medvedev, J. Robidoux, X. Bai, W. Cao, L. M. Floering, K. W. Daniel, and S. Collins Regulation of the Uncoupling Protein-2 Gene in INS-1 beta -Cells by Oleic Acid J. Biol. Chem., November 1, 2002; 277(45): 42639 - 42644. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. S. Moon, M.-J. Latasa, M. J. Griffin, and H. S. Sul Suppression of fatty acid synthase promoter by polyunsaturated fatty acids J. Lipid Res., May 1, 2002; 43(5): 691 - 698. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-P. Yang, L. A. Freeman, C. L. Knapper, M. J. A. Amar, A. Remaley, H. B. Brewer Jr., and S. Santamarina-Fojo The E-box motif in the proximal ABCA1 promoter mediates transcriptional repression of the ABCA1 gene J. Lipid Res., February 1, 2002; 43(2): 297 - 306. [Abstract] [Full Text] [PDF] |
||||
![]() |
|