JBC Oz Biosciences

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hansen, J. B.
Right arrow Articles by Kristiansen, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hansen, J. B.
Right arrow Articles by Kristiansen, K.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 4, 2386-2393, January 22, 1999


Activation of Peroxisome Proliferator-activated Receptor gamma  Bypasses the Function of the Retinoblastoma Protein in Adipocyte Differentiation*

Jacob B. HansenDagger , Rasmus K. PetersenDagger , Berit M. LarsenDagger , Jirina Bartkova§, Jan Alsner, and Karsten KristiansenDagger parallel

From the Dagger  Department of Molecular Biology, Odense University, DK-5230 Odense M, § Danish Cancer Society, Division of Cancer Biology, DK-2100 Copenhagen Ø, and the  Department of Experimental Clinical Oncology, Aarhus University Hospital, DK-8000 Aarhus C, Denmark

    ABSTRACT
Top
Abstract
Introduction
References

The retinoblastoma protein (pRB) is an important regulator of development, proliferation, and cellular differentiation. pRB was recently shown to play a pivotal role in adipocyte differentiation, to interact physically with adipogenic CCAAT/enhancer-binding proteins (C/EBPs), and to positively regulate transactivation by C/EBPbeta . We show that PPARgamma -mediated transactivation is pRB-independent, and that ligand-induced transactivation by PPARgamma 1 present in RB+/+ and RB-/- mouse embryo fibroblasts is sufficient to bypass the differentiation block imposed by the absence of pRB. The differentiated RB-/- cells accumulate lipid and express adipocyte markers, including C/EBPalpha and PPARgamma 2. Interestingly, adipose conversion of pRB-deficient cells occurs in the absence of compensatory up-regulations of the other pRB family members p107 and p130. RB+/+ as well as RB-/- cells efficiently exit from the cell cycle after completion of clonal expansion following stimulation with adipogenic inducers. We conclude that ligand-induced activation of endogenous PPARgamma 1 in mouse embryo fibroblasts is sufficient to initiate a transcriptional cascade resulting in induction of PPARgamma 2 and C/EBPalpha expression, withdrawal from the cell cycle, and terminal differentiation in the absence of a functional pRB.

    INTRODUCTION
Top
Abstract
Introduction
References

The retinoblastoma protein (pRB)1 is a key regulator of the mammalian cell cycle. Through repression of the growth-promoting E2F transcription factors, pRB controls the transition from the G1 to the S phase (1). pRB function is regulated by cyclin-dependent kinases, which phosphorylate pRB in a characteristic cell cycle-dependent manner (2). In addition, pRB plays a pivotal role during development and differentiation. The multifunctional character of pRB has been demonstrated by targeted disruption of the retinoblastoma gene in mice. Homozygous mutant embryos die in utero and show abnormalities in hematopoiesis and neurogenesis (3).

Numerous ex vivo studies have established the importance of pRB in myocyte differentiation (4). pRB has been shown to interact physically and functionally with members of the myogenic MyoD family of basic helix-loop-helix transcription factors (5), and pRB-deficient cells fail to undergo terminal myogenesis (6, 7). This included a defect in expression of late differentiation markers, reduced myoblast fusion, a failure to terminally withdraw from the cell cycle, and an increased incidence of apoptosis (6-8). These observations have also been seen in vivo when pRB is expressed at subphysiological levels (9).

Adipocyte differentiation is a complex process regulated by CCAAT/enhancer-binding proteins (C/EBPs), peroxisome proliferator-activated receptors (PPARs), and the adipocyte determination and differentiation-dependent factor-1/sterol regulatory element-binding protein-1 (ADD1/SREBP1) (10-12). C/EBPbeta and C/EBPdelta are induced very early during differentiation and have been shown to promote adipogenesis, possibly through induction of C/EBPalpha and PPARgamma (13-15), and abrogation of their activity blocks adipose conversion (15, 16). Ectopic expression of C/EBPalpha is adipogenic in fibroblasts, and abrogation of C/EBPalpha expression blocks adipocyte differentiation (11). PPARs are members of the nuclear hormone receptor superfamily of ligand-activated transcription factors. Ligands for PPARgamma include the antidiabetic thiazolidinedione drugs and certain prostaglandin J2 derivatives (17-19). PPARgamma is induced early in adipocyte differentiation (20), and addition of ligands to fibroblasts expressing PPARgamma endogenously or ectopically induces or promotes adipose conversion (17-19, 21). ADD1/SREBP1 is also induced early in the differentiation program and promotes adipogenesis (22). Ectopic expression of ADD1/SREBP1 was recently shown to induce the synthesis of an unidentified PPARgamma activating ligand (23).

Adipocyte differentiation ex vivo requires growth arrest, usually obtained by growing cells to confluence. Following stimulation with adipogenic factors, density-arrested preadipocytes undergo several rounds of postconfluent cell divisions (clonal expansion), followed by terminal withdrawal from the cell cycle, expression of adipocyte markers, and accumulation of intracellular lipid (24). The importance of pRB in adipocyte differentiation has been amply demonstrated. It was shown that the ability of a truncated simian virus 40 large T antigen to block adipocyte differentiation is dependent on its ability to sequester the pRB family (pRB, p107, p130) (25), and recently it was demonstrated that lung fibroblasts from RB-/- mouse embryos are unable to undergo adipose conversion unless rescued by an RB transgene (26). Furthermore, pRB was shown to physically interact with C/EBPs, promote the binding of C/EBPbeta to its cognate DNA response element, and increase its transactivation capacity (26, 27). The functional interaction with C/EBPbeta suggests that pRB plays an important role early in the adipocyte differentiation program. Finally, regulated phosphorylation and expression of the three pRB family members during adipose conversion have recently been demonstrated (24, 28).

In this study, we used fibroblasts from normal and RB-/- mouse embryos to further characterize the importance and functions of pRB in adipocyte differentiation. We show that transactivation by PPARgamma is not dependent on pRB. Mouse embryo fibroblasts (MEFs) express PPARgamma 1 in the predifferentiated state, and the inability of pRB-deficient MEFs to differentiate is efficiently bypassed by addition of PPARgamma ligands. The differentiated RB-/- MEFs accumulate lipid and express adipocyte markers. Surprisingly, adipocyte differentiation of RB-/- MEFs was found not to be accompanied by compensatory up-regulation of p107 and p130 expression, and RB+/+ as well as RB-/- MEFs effectively withdraw from the cell cycle following clonal expansion.

    EXPERIMENTAL PROCEDURES

Cell Culture and Differentiation-- The preparation of wild-type and RB-/- mouse embryo fibroblasts (MEFs) has been described previously (29). MEFs were grown in AmnioMax basal medium (Life Technologies, Inc.) supplemented with 7.5% fetal bovine serum (FBS), 7.5% AmnioMax-C100 supplement, 2 mM glutamine, 62.5 µg/ml penicillin, and 100 µg/ml streptomycin (growth medium) in a humidified atmosphere of 5% CO2 at 37 °C. Medium was changed every other day. For differentiation, 2-day postconfluent cells (day 0) were treated with growth medium containing 1 µM dexamethasone (Sigma), 0.5 mM methylisobutylxanthine (Aldrich), 5 µg/ml insulin (Boehringer Mannheim), and BRL49653 (0.5 µM unless otherwise indicated) or vehicle (0.1% Me2SO) for 2 days. From day 2, medium contained 5 µg/ml insulin and BRL49653 or vehicle. MEFs were not used beyond passage 10. 3T3-L1 cells were cultured to confluence in Dulbecco's modified Eagle's medium (DMEM) with 10% bovine serum and differentiated as described (30). Briefly, 2-day postconfluent cells (day 0) were induced to differentiate with DMEM containing 10% FBS, 1 µM dexamethasone, 0.5 mM methylisobutylxanthine, and 1 µg/ml insulin. After 48 h, medium was replaced with DMEM containing 10% FBS and 1 µg/ml insulin, and the cells were subsequently fed every other day with DMEM containing 10% FBS.

PCR Analysis of RB Gene Status-- RB gene disruption via insertion of the hygromycin resistance gene in exon 19 was detected as described previously (29). Briefly, 50 ng of genomic DNA from individual MEFs were used for PCR amplification. To detect disruption of RB alleles, the following upstream and downstream primers were used: CGATCTTAGCCAGACGAGCG(within the hygromycin resistance gene) and TGAGGCTGCTTGTGTCTGTG (within exon 19 of RB). To detect wild-type RB alleles, the downstream exon 19 primer was used in combination with the following upstream primer: GACTAGGTGAAGGAATGCAGAG (within intron 18 of RB). As a control, we amplified part of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene using the following primers: ATTGGGCGCCTGGTCAC and CCAGAGGGGCCATCCAC. Following a 10-min denaturation/activation of DNA polymerase (AmpliTaq Gold, Perkin Elmer), 35 cycles were performed as follows: 94 °C for 20 s, 58 °C for 20 s (62 °C for GAPDH), 72 °C for 60 s. PCR products were resolved on 1.5% agarose gels.

Oil Red O Staining-- Dishes were washed in PBS and cells fixed in 3.7% formaldehyde for 1 h, followed by staining with Oil Red O for 1 h. Oil Red O was prepared by diluting a stock solution (0.5 g of Oil Red O (Sigma) in 100 ml of isopropanol) with water (6:4) followed by filtration. After staining, plates were washed twice in water and photographed.

Plasmids and Transfections-- The PPREx3-tk-luc reporter containing three copies of the peroxisome proliferator-activated receptor response element (PPRE) from the acyl-CoA oxidase promoter was kindly provided by Ronald M. Evans (31). The pSPORT-mPPARgamma 2 expression vector was kindly provided by Bruce M. Spiegelman (32). CMV-RB (33) and CMV-HA-E2F-1 (34) expression vectors and the 6xE2F-luc reporter containing six E2F binding sites (34) were kindly provided by Kristian Helin. The CMV-RB(H209) expression vector was kindly provided by Sibylle Mittnacht. It encodes a pRB mutant with a cysteine-to-phenylalanine substitution at amino acid 706 which abolishes the function of the pocket. The CMV-hBrm expression vector was kindly provided by Christian Muchardt (35). The CMV-r42-C/EBPalpha expression vector was kindly provided by M. Daniel Lane. The reporter containing the proximal part of the PPARgamma 2 promoter cloned in front of the luciferase gene was kindly provided by Jeffrey M. Gimble (36). The MSV-C/EBPbeta vector was kindly provided by Steven L. McKnight (37). The CMV-beta -galactosidase vector used for normalization is from CLONTECH. The human cervix carcinoma cell line C33A was grown in DMEM containing 10% FBS. Cells were transfected with the DC-Chol method as described (38). Cells were harvested approximately 48 h after transfection. The luciferase and beta -galactosidase activities in cell lysates were determined by standard techniques.

Whole Cell Extracts-- Plates were washed twice in TBS and cells were lysed on the plates by addition of an SDS sample buffer containing 2.5% SDS, 10% glycerol, 50 mM Tris-HCl (pH 6.8), 10 mM dithioerythritol, 10 mM beta -glycerophosphate, 10 mM NaF, 0.1 mM sodium orthovanadate, 1 mM phenylmethylsulfonyl fluoride, and the Complete protease inhibitor mixture (1/50 tablet per ml) (Boehringer Mannheim). Lysis of cells was immediately followed by 3 min of boiling. Lysates were subsequently treated with benzon nuclease (Merck). Whole cell extracts were stored at -80 °C. Protein concentrations were determined by the Bradford method (Bio-Rad).

Western Blotting-- One hundred µg of protein were loaded in each lane. After SDS-polyacrylamide gel electrophoresis, proteins were blotted onto polyvinylidene difluoride membranes (Micron Separation) using a Kem-En-Tec semidry blotter. Equal loading/transfer was confirmed by Ponceau S staining of membranes. Membranes were blocked overnight in PBS (or TBS) containing 5% nonfat dry milk and 0.1% Tween 20 (Sigma). Incubation with primary and secondary antibodies was performed in PBS (or TBS) containing 5% nonfat dry milk for 1-2 h. After incubation with antibodies, membranes were washed in PBS (or TBS) containing 0.1% Tween 20. PBS was used in all experiments except for those in which the mouse anti-human pRB antibody (G3-245, PharMingen) was used. Here, TBS was used instead. Other primary antibodies used were rabbit anti-human p107 (C-18, Santa Cruz Biotechnology), mouse anti-human p130 (Transduction Laboratories), rabbit anti-human TATA-binding protein (TBP) (Santa Cruz Biotechnology), rabbit anti-mouse aP2/adipocyte lipid-binding protein (ALBP) (kindly provided by David A. Bernlohr), rabbit anti-PPARgamma antibody recognizing both PPARgamma isoforms (kindly provided by Mitchell A. Lazar), and rabbit antibodies against mouse C/EBPalpha and C/EBPbeta (kindly provided by M. Daniel Lane). Secondary antibodies were horseradish peroxidase-conjugated anti-mouse or anti-rabbit antibodies (DAKO). Enhanced chemiluminescence (ECL) (Amersham Pharmacia Biotech) was used for detection. Stripping of membranes was done by boiling for 5-10 min in water.

RNA Purification and Reverse Transcription-- Total RNA was purified as described (39). The integrity of all RNA samples was confirmed by electrophoresis in denaturing formaldehyde-containing gels. Reverse transcriptions were performed in 25-µl reactions containing 1 µg of total RNA, 3 µg of random hexamers (Amersham Pharmacia Biotech), 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 10 mM dithiothreitol, 40 units of RNAguard (Amersham Pharmacia Biotech), 0.9 mM dNTPs (Amersham Pharmacia Biotech), and 200 units of Moloney murine leukemia virus reverse transcriptase (Life Technologies). Reactions were left 10 min at room temperature, followed by incubation at 37 °C for 1 h. After cDNA synthesis, reactions were diluted with 50 µl of water and frozen at -80 °C.

Multiplex RT-PCR-- Multiplex reverse transcription-polymerase chain reaction (RT-PCR) was performed essentially as described (40) with minor changes. PCR was done in 25-µl reactions containing 1.5 µl of diluted cDNA, 50 mM KCl, 10 mM Tris-HCl (pH 9.0), 1.5 mM MgCl2, 0.1% Triton X-100, 40 µM dATP, dTTP, and dGTP, 20 µM dCTP, 5 pmol of each primer, 1.25 units of Taq polymerase, and 1.25 µCi of [alpha -32P]dCTP (6000 Ci/mmol) (NEN Life Science Products). Reaction mixtures were denatured at 94 °C for 1 min. Denaturation was followed by 20 or 25 cycles (depending on the primers used) of 94 °C for 30 s, 55 °C for 60 s, 72 °C for 90 s. All reactions contained the TBP primer set as an internal standard together with one or two additional primer sets. In reactions coamplifying PPARgamma 1 and PPARgamma 2, 10 pmol of the common 3' primer was included. All reactions were performed with 25 cycles, except those containing the glycerol-3-phosphate dehydrogenase (GPDH) primer set for which 20 cycles were employed. Primers used were: C/EBPalpha , 5'-GAACAGCAACGAGTACCGGGTA, 3'- GCCATGGCCTTGACCAAGGAG (225 bp); GPDH, 5'-GTGGTACCCCATCAGTTCATTG, 3'-GTCCTTCAGGAGCTGTCCCTG (264 bp); PPARgamma 1, 5'-CACGTTCTGACAGGACTGTGT, 3'-CAGCAACCATTGGGTCAGCTC (288 bp); PPARgamma 2, 5'-CCAGAGCATGGTGCCTTCGCT, 3'-CAGCAACCATTGGGTCAGCTC (241 bp); TBP, 5'-ACCCTTCACCAATGACTCCTATG, 3'-ATGATGACTGCAGCAAATCGC (190 bp). Ten µl of each reaction were dried down and resuspended in formamide dye mix (98% deionized formamide, 10 mM EDTA (pH 8.0), 0.2% bromphenol blue, 0.2% xylene cyanol) and loaded onto 0.4 mm, 8 M urea, 1× TBE, 6% polyacrylamide gels. Electrophoresis was for 3 h at 50 watts. Gels were dried and exposed overnight to phosphorimage storage screens. Screens were scanned on a PhosphorImager (Molecular Dynamics).

Preparation of Cells for Flow Cytometry-- At the indicated time points, bromodeoxyuridine (BrdUrd) (Sigma) was added to the plates to a final concentration of 10 µM, and incubation was continued for 20 min. Cells were then harvested by trypsinization, washed in 0.9% NaCl, fixed in 75% ethanol, and stored at 4 °C until further analysis. Cells were treated with pepsin before incubation with a monoclonal anti-BrdUrd antibody (Becton Dickinson), followed by incubation with a fluorescein isothiocyanate-conjugated rabbit anti-mouse secondary antibody (DAKO). Cells were RNase-treated and stained with propidium iodide before loading onto an Epics Profile I flow cytometer.

    RESULTS

Transactivation by PPARgamma Is Independent of pRB-- Transcriptional activation by nuclear receptors is dependent on recruitment of coactivator proteins. pRB has recently been shown to modulate the activity of the thyroid hormone and glucocorticoid receptors by interaction with coactivators (41, 42). Trip230 was shown to be a thyroid hormone receptor (TR) coactivator and a pRB-interacting protein (41). pRB was able to sequester Trip230 from TR, thereby down-regulating the activity of TR. Contrary to the effect on TR, pRB was found to potentiate glucocorticoid receptor (GR)-mediated transactivation by direct interaction with hBrm (42), a previously identified GR coactivator (35). To examine whether the transcriptional activity of PPARgamma was modulated by pRB, we analyzed the transactivation potential of full-length PPARgamma 2 in the human cell line C33A which does not express functional pRB. C33A cells have previously been used to demonstrate potentiation of GR transactivation by pRB (42). As shown in Fig. 1A, PPARgamma is transactivating the reporter in C33A cells (column 3), and addition of the high affinity PPARgamma ligand BRL49653 further enhances its activity (column 4). Coexpression of pRB has little or no effect on either BRL49653-dependent or -independent transactivation by PPARgamma (compare columns 3 and 7 and columns 4 and 8). As expected, no effect on PPARgamma transactivation was observed by coexpressing the nonfunctional pRB mutant pRB(H209) (compare columns 3 and 11 and columns 4 and 12). Since C33A cells express no hBrm (35), we wanted to rule out the possibility that pRB affected PPARgamma transactivation via this coactivator. This appeared not to be the case, as we observed no effect on PPARgamma transactivation by coexpression of hBrm, neither in the presence nor in the absence of pRB (data not shown). As a positive control, we tested the effect of pRB on E2F-mediated transactivation. Fig. 1B shows that pRB represses basal reporter activity, probably by repressing endogenous E2F in C33A cells (compare columns 1 and 3). Furthermore, E2F-1-induced transactivation of the reporter (column 2) was partially repressed by coexpression of pRB (column 4). The pRB mutant failed to repress either basal reporter activity or E2F-1-induced reporter activity (compare columns 1 and 5 and columns 2 and 6). From these experiments, we conclude that transactivation by PPARgamma is independent of pRB in C33A cells.


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 1.   Transcriptional activation by PPARgamma is not dependent on pRB. A, C33A cells were transfected with the PPREx3-tk-luc reporter (0.7 µg) and CMV-beta -galactosidase (0.7 µg), together with combinations of expression vectors for mPPARgamma 2 (0.7 µg), wild-type human pRB (0.7 µg), and pRB(H209) (0.7 µg). Empty expression vector was added to ensure equal promoter load. Cells were subsequently treated with medium containing either BRL49653 (0.5 µM) or vehicle (0.1% Me2SO) for approximately 48 h before harvest. Reporter activity was normalized to beta -galactosidase values. Transfections were performed in triplicate, measured in duplicate and repeated three times. B, pRB represses E2F-mediated transactivation. C33A cells were transfected with the 6xE2F-luc reporter (0.35 µg) and CMV-beta -galactosidase (0.35 µg), together with combinations of expression vectors for E2F-1 (0.35 µg), wild-type human pRB (0.35 µg), and pRB(H209) (0.35 µg). Cells were harvested after approximately 48 h. Reporter activity was normalized to beta -galactosidase values. Transfections were performed in triplicate, measured in duplicate, and repeated three times.

Activation of PPARgamma Bypasses the Function of pRB in Adipocyte Differentiation-- The use of embryonic fibroblasts (MEFs) from mice with targeted disruptions of specific genes is a powerful tool in deciphering the importance and functions of proteins in cellular differentiation. By using lung fibroblasts from mouse embryos with targeted disruption of the RB gene, the importance of pRB in adipocyte differentiation was demonstrated (26). pRB and C/EBPs were shown to interact, and it was demonstrated that pRB potentiated transactivation by C/EBPbeta (26, 27).

To further characterize the importance and function of pRB in adipose conversion, we examined the potential of different known adipogenic inducers to support adipocyte differentiation of fibroblasts from normal and RB-/- mouse embryos (29). These experiments were performed with MEFs from one wild-type (MEFA) and two pRB-deficient (ME3 and ME8) mouse embryos. Genotypes were validated by genomic PCR (Fig. 2A), and the absence of pRB expression in RB-/- MEFs was confirmed by Western blotting (Fig. 2B) and immunostaining (data not shown). Using a standard differentiation protocol including treatment with dexamethasone, methylisobutylxanthine, and insulin (DMI treatment), only the RB+/+ MEFs differentiated to a significant degree (Fig. 3, A and B (a and c)). This is in agreement with previous results (26). However, we consistently observed some pRB-deficient cells accumulating lipid in response to the DMI treatment (Fig. 3B, e). In one of the RB-/- MEFs (ME8), only a few cells accumulated lipid in response to standard inducers, whereas, in the other (ME3), approximately 1% of the cells accumulated lipid. By RT-PCR and Western blotting, we found that all three MEFs express PPARgamma 1 mRNA and protein in the predifferentiated state (see Fig. 4). Therefore, we hypothesized that addition of a high affinity ligand for PPARgamma might be able to bypass the block in adipose conversion imposed by the absence of pRB. Addition of BRL49653 to the standard differentiation medium efficiently promoted differentiation of RB-/- as well as RB+/+ MEFs (Fig. 3, A and B (b and d)). The ligand concentration needed to bypass the defective differentiation in RB-/- MEFs was in agreement with the Kd of BRL49653 binding to PPARgamma (17) in that differentiation was promoted with 50 nM BRL49653 (data not shown). Furthermore, even though predifferentiated MEFs express low levels of PPARdelta and PPARalpha mRNA (data not shown), the concentration of BRL49653 used in this report (0.5 µM) is sufficient to activate only the PPARgamma subtype (17, 18). Therefore, we conclude that PPARgamma is the target receptor in the BRL49653-induced differentiation of pRB-deficient MEFs.


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 2.   Characterization of the mouse embryo fibroblasts. A, PCR was performed on genomic DNA from the MEFs. Primers amplifying mutated or wild-type RB alleles were used. MEFA contains only wild-type RB alleles whereas ME3 and ME8 contain only mutated alleles. Primers for GAPDH were used as a control. PCR products were resolved on 1.5% agarose gels. MW, marker DNA ladder (1000, 750, 500, and 300 bp); C, negative control without template. B, expression of pRB in MEFs analyzed by Western blotting. One hundred µg of protein from confluent MEF cultures were loaded in each lane. As expected, no expression of pRB is observed in the RB-/- MEFs (ME3 and ME8).


View larger version (93K):
[in this window]
[in a new window]
 
Fig. 3.   Morphological differentiation of normal and pRB-deficient MEFs. Cells were induced to differentiate as described under "Experimental Procedures." Dishes were photographed on day 10. A, representative dishes of RB+/+ and RB-/- MEFs stained with Oil Red O. Cells were differentiated in the absence (top) or presence (bottom) of BRL49653 (0.5 µM). B, micrographs of Oil Red O stained dishes containing wild-type (a and b) or RB-/- (c and d) fibroblasts differentiated in the absence (a and c) or presence (b and d) of BRL49653, and (e) micrograph showing a small cluster of lipid-accumulating RB-/- MEFs after a standard differentiation induction (DMI treatment) without addition of BRL49653.


View larger version (63K):
[in this window]
[in a new window]
 
Fig. 4.   Expression of adipocyte markers during differentiation of normal and pRB-deficient MEFs. A, RNA was harvested on the indicated days and the expression of PPARgamma 2, PPARgamma 1, C/EBPalpha , GPDH, and TBP was analyzed by multiplex RT-PCR. TBP was used as an internal standard. B, whole cell extracts were prepared on the indicated days. One hundred µg of protein were loaded in each lane. Expression of PPARgamma , C/EBPalpha , C/EBPbeta , aP2/ALBP, and TBP was analyzed by Western blotting. Equal loading/transfer was confirmed by Ponceau S staining of membranes and by incubation with anti-TBP antibody.

To characterize the differentiation of RB+/+ and RB-/- MEFs in more detail, gene expression was examined by multiplex RT-PCR and Western blotting. Treatment of MEFs with adipogenic inducers (DMI) resulted in a transient induction of C/EBPbeta with expression levels peaking on day 1, irrespective of RB status and supplementation of BRL49653 (Fig. 4B). A transient up-regulation of C/EBPbeta is also seen during differentiation of 3T3-L1 cells (15, 43). Treatment of RB+/+ MEFs with either DMI or DMI together with BRL49653 resulted in the induction of PPARgamma 2, C/EBPalpha , and GPDH mRNAs (Fig. 4A, left). However, induction was accelerated and expression levels were higher when cells were treated with the PPARgamma ligand. Western blotting showed that the induction of PPARgamma 2 mRNA was accompanied by synthesis of PPARgamma 2 protein. Similarly, a robust induction of aP2/ALBP was detected (Fig. 4B, left). Of interest, even though C/EBPalpha mRNA was induced in the differentiating RB+/+ cells in absence of the PPARgamma ligand, C/EBPalpha protein was detected only in cells treated with BRL49653 (Fig. 4B, left). Even extended exposure of the blots of protein from the DMI-treated RB+/+ cells challenged with antibodies against C/EBPalpha revealed no signals above background (data not shown). Considering the relatively strong induction of C/EBPalpha mRNA on day 6 in the DMI-treated cells, the absence of detectable C/EBPalpha protein suggests a posttranscriptional regulation of C/EBPalpha expression in MEFs. In pRB-deficient MEFs, PPARgamma 2, C/EBPalpha , and GPDH mRNAs were very weakly induced when cells were treated with DMI in the absence of BRL49653 (Fig. 4A, right). Treatment of RB-/- MEFs with DMI plus BRL49653, however, led to an induction of PPARgamma 2, C/EBPalpha , and GPDH mRNAs similar to that observed in RB+/+ MEFs (Fig. 4A). Robust induction of PPARgamma 2, C/EBPalpha , and aP2/ALBP proteins in pRB-deficient cells was also dependent on the PPARgamma ligand (Fig. 4B, right). As mentioned above, PPARgamma 1 (but not PPARgamma 2) mRNA and protein were expressed in confluent MEFs (day 0 in Fig. 4, A and B). Therefore, it appears that ligand-activation of endogenous PPARgamma 1 induces PPARgamma 2 expression and differentiation of RB-/- MEFs.

The Effect of pRB on C/EBPalpha - and C/EBPbeta -mediated Transactivation of the Proximal PPARgamma 2 Promoter-- pRB has been demonstrated to potentiate C/EBPbeta -mediated transactivation of reporter plasmids containing multimeric C/EBP binding sites, possibly by acting as a chaperone to induce binding of C/EBPbeta to its cognate DNA response element (26, 27). Whether pRB was capable of regulating the activity of natural promoters via C/EBP sites was not addressed in these studies. To investigate this, we analyzed the importance of pRB in the transactivation of a C/EBP-regulated gene which is induced during adipose conversion. The proximal part of the PPARgamma 2 promoter contains two C/EBP sites, which confer C/EBP-dependent activation in transient transfection studies (36). Using the proximal PPARgamma 2 promoter as a reporter plasmid (36), cotransfection with both C/EBPalpha and C/EBPbeta expression vectors was found to transactivate the reporter in the pRB-deficient C33A cells (Fig. 5, columns 3 and 7). The effect of coexpression of pRB on C/EBPalpha - or C/EBPbeta -mediated transactivation is shown in Fig. 5. In the case of C/EBPalpha , coexpression of pRB was found to have little or no effect (compare columns 3 and 4) in accordance with the previously noted pRB insensitivity of C/EBPalpha -dependent transactivation (44), and similarly, pRB only modestly increased the C/EBPbeta -mediated transactivation (compare columns 7 and 8). The pRB pocket mutant pRB(H209) did not significantly affect transactivation mediated by the C/EBPs (Fig. 5, compare columns 3 and 6 and columns 7 and 9). The absent or very moderate effect of pRB on C/EBP-mediated transactivation of the proximal PPARgamma 2 promoter is in contrast to the pronounced effect on reporters containing multimeric C/EBP binding sites (26, 27). The experiments in Fig. 5 were performed with the same ratio of transcription factor to pRB expression vectors as in Fig. 1, where pRB significantly repressed E2F-mediated transactivation. pRB has been shown to potentiate GR-mediated transactivation in C33A cells (42), but it cannot be excluded that the chaperone-like effect of pRB on C/EBP proteins may be sensitive to relative protein levels. Furthermore, cell lines may differ in their ability to support a functional pRB-C/EBP interaction. In conclusion, however, our results suggest that pRB may regulate adipogenesis through pathways in addition to those controlled by C/EBP proteins.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 5.   The effect of pRB on C/EBPalpha - and C/EBPbeta -mediated transactivation of the proximal PPARgamma 2 promoter. C33A cells were transfected with the proximal PPARgamma 2 promoter cloned in front of a luciferase reporter gene (36) (0.7 µg) together with combinations of expression vectors for C/EBPalpha (0.7 µg), C/EBPbeta (0.7 µg), pRB (0.7 µg), and pRB(H209) (0.7 µg). Empty expression vector was added to ensure equal promoter load. Luciferase values were not normalized to beta -galactosidase values in these experiments since coexpression of C/EBPs significantly increased expression from the CMV-beta -galactosidase vector (data not shown). Transfections were performed in triplicate, measured in duplicate, and repeated two times.

Regulation of pRB Family Members during Adipocyte Differentiation of RB+/+ and RB-/- MEFs-- During myocyte differentiation of RB+/+ cells, the levels of p107 and p130 are inversely regulated, with p107 being down-regulated (6, 7) and p130 up-regulated (7). Myogenic conversion of RB-/- cells, however, causes induction of both p107 (6, 7) and p130 (7). The pRB-deficient cells are impaired in expression of late myocyte differentiation markers and fail to terminally withdraw from the cell cycle (6, 7). However, the RB-/- cells do express early myocyte markers (6, 7), and it is therefore conceivable that the up-regulation of p107 in RB-/- cells promotes the early steps in the differentiation program.

To study possible compensatory regulations of p107 and p130 during adipose conversion of pRB-deficient MEFs, we compared expression profiles of the three pRB family members in differentiating RB+/+ and RB-/- MEFs by Western blotting. Fig. 6 (left) shows that pRB is present mainly in the hypophosphorylated state before stimulation with adipogenic factors (day 0). After 24 h, a significant fraction is hyperphosphorylated as seen by the reduced migration. After day 1, the majority of pRB is hypophosphorylated (Fig. 6). This pattern of phosphorylation is independent of the presence of BRL49653. Furthermore, the overall level of pRB does not change in these experiments. We found no significant differences in the expression profiles of p130 and p107 between RB+/+ and RB-/- MEFs (Fig. 6). The level of p130 was high at day 0, transiently reduced following stimulation with adipogenic inducers, and restored on days 4-6 (Fig. 6). The regulation of p130 was not significantly affected by addition of BRL49653. p107 showed two peaks of induction (days 1 and 3), which were also associated with an increased phosphorylation. Interestingly, addition of BRL49653 significantly reduced the level of p107 from day 4 in the differentiation program compared with control cells (Fig. 6). This was particularly prominent in wild-type cells, but a similar tendency was observed in both pRB-deficient MEFs (Fig. 6 and data not shown). Since BRL49653 effectively increases the number of differentiating cells (see Fig. 3), this indicates that adipose conversion is associated with decreased p107 expression, even in pRB-deficient cells.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 6.   Expression and phosphorylation of pRB family members during differentiation of normal and pRB-deficient MEFs. Whole cell extracts were prepared on the indicated days and the expression of pRB, p107, and p130 was analyzed by Western blotting. One hundred µg of protein were loaded in each lane. Equal loading/transfer was confirmed by Ponceau S staining of membranes.

To examine the importance of pRB in the cell divisions taking place after stimulation of confluent cells with adipogenic inducers, we used BrdUrd labeling to measure the percentage of cells in S phase. Fig. 7 shows the percentage of BrdUrd-positive RB+/+ and RB-/- MEFs every 12 h after stimulation with standard inducers (DMI treatment). The figure shows the result of one of two independent experiments. Two rounds of DNA synthesis are apparent, the first peaking on day 1 and the second peaking on day 2.5. Supplementation of 5 µM BRL49653 to the standard inducers did not significantly affect the distribution of neither RB+/+ nor RB-/- MEFs in S phase (data not shown). A similar distribution of cells in S phase was seen during adipocyte differentiation of 3T3-L1 cells, again with peaks on days 1 and 2.5.2 The percentage of cells in S phase was consistently higher in wild-type cells compared with RB-/- cells (Fig. 7). The flow cytometric analysis was performed with only one of the RB-/- MEFs (ME8), so whether the reduced number of cells in S phase extend to other pRB-deficient MEFs is not known at present. However, the fact that both RB+/+ and RB-/- MEFs underwent two rounds of DNA replication with approximately the same time course indicates that pRB is not critical for the timing of the clonal expansion phase. In addition, Fig. 7 shows that pRB is not essential for cell cycle exit during adipose conversion.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 7.   Time course of DNA synthesis during adipocyte differentiation of normal and pRB-deficient MEFs. At the indicated time points after stimulation with dexamethasone, methylisobutylxanthine, and insulin, cells were labeled with BrdUrd. The percentage of BrdUrd-positive cells was measured by flow cytometry.

A comparison of the time course of DNA synthesis (Fig. 7) and the expression profiles of pRB, p107, and p130 (Fig. 6) indicates that hyperphosphorylation of pRB in RB+/+ MEFs is coinciding with the first round of DNA replication on day 1. The peaks of DNA synthesis coincide approximately with the induction and hyperphosphorylation of p107 on days 1 and 3 in both pRB-positive and pRB-negative cells. The transient down-regulation of p130 after stimulation with adipogenic inducers in both RB+/+ and RB-/- MEFs indicate that the level of p130 is low during clonal expansion, followed by an up-regulation after the clonal expansion phase. Similar results have been reported for differentiating 3T3-L1 cells (24, 28).

    DISCUSSION

In this report we show that a high affinity PPARgamma ligand effectively bypasses the block in adipocyte differentiation imposed by pRB-deficiency. To show this we used fibroblasts from normal and RB-/- mouse embryos. A significant fraction of the RB+/+ cells differentiated in response to a standard differentiation protocol as determined by lipid accumulation and expression of adipocyte markers, whereas only few RB-/- cells differentiated when subjected to the same treatment. This is in agreement with previous work showing the importance of pRB in adipose conversion (25, 26). Addition of the high affinity PPARgamma ligand BRL49653 dramatically increased adipose conversion of RB-/- as well as RB+/+ MEFs. At the molecular level this was accompanied by induction of adipocyte markers, including the key transcription factors C/EBPalpha and PPARgamma 2. The ability of BRL49653 to induce differentiation in pRB-deficient cells was not strictly dependent on the standard inducers (dexamethasone, methylisobutylxanthine, and insulin) since exposure to PPARgamma ligand alone induced significant lipid accumulation (data not shown).

C/EBPbeta along with C/EBPdelta play crucial roles in adipocyte differentiation, as revealed by targeted disruptions (16), and are considered important for induction of PPARgamma 2 and C/EBPalpha expression (36, 45). In our experiments, BRL49653 did not significantly affect the level of C/EBPbeta protein but was required for induction of both PPARgamma 2 and C/EBPalpha mRNAs in RB-/- MEFs. Wild-type and pRB-deficient MEFs express PPARgamma 1, but no PPARgamma 2, in the predifferentiated state. Therefore, it is conceivable that the critical steps regulated by pRB early in the differentiation program are bypassed by ligand activation of PPARgamma 1. The differentiation-promoting effect of ligand-induced PPARgamma activation in the pRB-deficient fibroblasts is in agreement with our observation that PPARgamma transactivation is independent of pRB in C33A cells.

pRB was shown to stimulate binding of C/EBPbeta to DNA without being present in the C/EBP-DNA complex (26, 27). This indicates that pRB acts as a chaperone to enhance specific DNA binding of C/EBPs. Furthermore, pRB was shown to potentiate C/EBPbeta -mediated transactivation of a reporter construct containing multimerized C/EBP binding elements in the promoter (26, 27). Thus, it could be hypothesized that the lack of adipocyte differentiation of RB-/- MEFs was related to a severely reduced level of C/EBPbeta -dependent transactivation. We found that C/EBPbeta -mediated transactivation of the proximal PPARgamma 2 promoter was rather insensitive to the level of pRB expression. This indicates that the inability of pRB-deficient MEFs to undergo adipose conversion in response to a treatment that is sufficient to induce adipocyte differentiation of normal embryo fibroblasts may reflect impairment of additional processes involving pRB. Glucocorticoids play decisive roles during differentiation of most preadipocyte cell lines (15, 43), but surprisingly little is known about the molecular functions of GR in adipocyte differentiation. pRB has been shown to potentiate transactivation mediated by GR (42, 46, 47), suggesting that impaired GR function in the pRB-deficient cells may contribute to the refractoriness of these cells to undergo adipocyte conversion. Finally, our finding that addition of a high affinity PPARgamma ligand is required to induce adipose conversion of RB-/- MEFs leaves open the possibility that pRB participates in a pathway leading to the production of an endogenous ligand for PPARgamma . Such a pathway may involve ADD1/SREBP1, which was recently shown to play an important role in the production of an unidentified PPARgamma ligand (23). Both RB+/+ and RB-/- MEFs express ADD1/SREBP1 mRNA (data not shown), but whether pRB modulates the activity of ADD1/SREBP1 is not known.

To examine whether BRL49653-induced differentiation of RB-/- MEFs was accompanied by a compensatory regulation of p107 and p130, we compared the expression of these genes during differentiation of both RB+/+ and RB-/- cells. We found little or no difference in the expression pattern of p107 and p130 between normal and RB-/- MEFs. In the later stages of the differentiation program, we found that the level of p107 was lower in cells treated with BRL49653 compared with control cells. This indicates that down-regulation of p107 is related to the degree of adipose conversion, even in RB-/- MEFs. This is in contrast to the observed up-regulation of p107 during myocyte differentiation of RB-/- cells, an up-regulation not seen in RB+/+ cells (6, 7). However, even though p107 is down-regulated in the terminal stages of adipose conversion, it is transiently up-regulated during clonal expansion (Ref. 28 and this study). Furthermore, p130 is up-regulated during the late stages of adipocyte differentiation (Ref. 28 and this study). This raises the question as to whether p107 and p130 are important regulators of adipose conversion. Recent evidence from other differentiation systems suggests that members of the pRB family differ in their ability to regulate differentiation. Using the myocyte differentiation system, cells from wild-type, RB-/-, p107-/-, and p130-/- mouse embryos were compared (7). Only RB-/- cells had defects in expression of late differentiation markers and terminal cell cycle withdrawal. Furthermore, pRB was significantly more potent in activating MyoD-mediated transactivation than p107 and p130 (7). A similar increased activity of pRB compared with p107 and p130 was observed in flat cell formation of Saos-2 cells, a phenotype indicative of osteoblast differentiation (46). The in vivo importance of the three pRB family members has been addressed by gene targeting in mice. Whereas RB-/- embryos die in utero with defects in neurogenesis and erythropoiesis (3), p107-/- and p130-/- mice are viable, fertile, and show no apparent abnormalities (48, 49). These observations show that pRB is unique among the pRB family members in the regulation of differentiation of many lineages. Whether pRB is the key pocket protein positively regulating adipogenesis remains to be established, but evidence obtained so far indicates that this may very well be the case.

Terminal withdrawal from the cell cycle is an essential step in differentiation of many cell lineages. Little is known about the regulation of cell cycle withdrawal in adipocyte differentiation. Recent evidence suggests that hypophosphorylation of pRB is important for the commitment of cells to undergo adipose conversion (24, 50). Both of the major regulators of adipocyte differentiation, C/EBPalpha and PPARgamma , have been shown to inhibit cell proliferation (51, 52). Inhibition of proliferation by C/EBPalpha does not require the presence of pRB but is dependent on a functional activation domain (44). C/EBPalpha inhibits proliferation via transcriptional stimulation and posttranslational stabilization of the p21 cyclin-dependent kinase inhibitor (53, 54). Activation of PPARgamma has been shown to inhibit proliferation by down-regulation of the PP2A phosphatase, which in turn is accompanied by a decrease in E2F activity (52). The inhibition of cell proliferation by PPARgamma was also observed in cells expressing the simian virus 40 large T antigen, indicating that PPARgamma -mediated growth arrest does not require a functional pRB (52). In adipocyte differentiation, both C/EBPalpha and PPARgamma are present at the time when clonal expansion ceases, and therefore, they are both possible effectors of the cell cycle withdrawal. Evidently, the PPARgamma /C/EBPalpha initiated cell cycle withdrawal and adipocyte differentiation of MEFs may proceed in the absence of a functional pRB-dependent pathway, a notion in keeping with the finding that a certain cell cycle control prevails in pRB deficient cells (29, 55). How PPARgamma and C/EBPalpha function in such regulatory circuits remains to be established.

    ACKNOWLEDGEMENTS

We thank Drs. Ronald M. Evans, Bruce M. Spiegelman, M. Daniel Lane, Jeffrey M. Gimble, Steven L. McKnight, Christian Muchardt, Kristian Helin, and Sibylle Mittnacht for kind gifts of plasmids, and Drs. David A. Bernlohr, Mitchell A. Lazar, and M. Daniel Lane for kind gifts of antibodies. We thank Drs. Jiri Lukas and Jiri Bartek for helpful discussions. We thank Drs. Susanne Mandrup, Ez-Zoubir Amri, and Jiri Bartek for comments on the manuscript. We acknowledge technical assistance by Bente Kierkegaard, Inger-Marie Thuesen, and Helle Kamstrup Kjaer.

    FOOTNOTES

* This work was supported by the Danish Biotechnology Program, the Danish Natural Science Research Council, the Danish Cancer Society, and the NOVO Foundation.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

parallel To whom correspondence should be addressed: Dept. of Molecular Biology, Odense University, Campusvej 55, DK-5230 Odense M, Denmark. Tel.: 45-65572408; Fax: 45-65932781; E-mail: kak{at}molbiol.ou.dk.

The abbreviations used are: pRB, retinoblastoma protein; ADD1/SREBP1, adipocyte determination and differentiation-dependent factor-1; ALBP, adipocyte lipid-binding protein; bp, base pair(s); BrdUrd, bromodeoxyuridine; C/EBP, CCAAT/enhancer-binding protein; DMEM, Dulbecco's modified Eagle's medium; FBS, fetal bovine serum; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GPDH, glycerol 3-phosphate dehydrogenase; GR, glucocorticoid receptor; MEF, mouse embryo fibroblast; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; PPAR, peroxisome proliferator-activated receptor; PPRE, peroxisome proliferator-activated receptor response element; RT-PCR, reverse transcription-polymerase chain reaction; TBP, TATA-binding protein; TBS, Tris-buffered saline; TR, thyroid hormone receptor.

2 J. B. Hansen, J. Alsner, and K. Kristiansen, unpublished results.

    REFERENCES
Top
Abstract
Introduction
References

  1. Helin, K. (1998) Curr. Opin. Genet. Dev. 8, 28-35[CrossRef][Medline] [Order article via Infotrieve]
  2. Bartek, J., Bartkova, J., and Lukas, J. (1996) Curr. Opin. Cell Biol. 8, 805-814[CrossRef][Medline] [Order article via Infotrieve]
  3. Riley, D. J., Lee, E. Y.-H. P., and Lee, W.-H. (1994) Annu. Rev. Cell Biol. 10, 1-29[CrossRef]
  4. Walsh, K., and Perlman, H. (1997) Curr. Opin. Genet. Dev. 7, 597-602[CrossRef][Medline] [Order article via Infotrieve]
  5. Gu, W., Schneider, J. W., Condorelli, G., Kaushal, S., Mahdavi, V., and Nadal-Ginard, B. (1993) Cell 72, 309-324[CrossRef][Medline] [Order article via Infotrieve]
  6. Schneider, J. W., Gu, W., Zhu, L., Mahdavi, V., and Nadal-Ginard, B. (1994) Science 264, 1467-1471[Abstract/Free Full Text]
  7. Novitch, B. G., Mulligan, G. J., Jacks, T., and Lassar, A. B. (1996) J. Cell Biol. 135, 441-456[Abstract/Free Full Text]
  8. Wang, J., Guo, K., Wills, K. N., and Walsh, K. (1997) Cancer Res. 57, 351-354[Abstract/Free Full Text]
  9. Zacksenhaus, E., Jiang, Z., Chung, D., Marth, J. D., Phillips, R. A., and Gallie, B. L. (1996) Genes Dev. 10, 3051-3064[Abstract/Free Full Text]
  10. Brun, R. P., Kim, J. B., Hu, E., Altiok, S., and Spiegelman, B. M. (1996) Curr. Opin. Cell Biol. 8, 826-832[CrossRef][Medline] [Order article via Infotrieve]
  11. Mandrup, S., and Lane, M. D. (1997) J. Biol. Chem. 272, 5367-5370[Free Full Text]
  12. Fajas, L., Fruchart, J.-C., and Auwerx, J. (1998) Curr. Opin. Cell Biol. 10, 165-173[CrossRef][Medline] [Order article via Infotrieve]
  13. Wu, Z., Xie, Y., Bucher, N. L. R., and Farmer, S. R. (1995) Genes Dev. 9, 2350-2363[Abstract/Free Full Text]
  14. Wu, Z., Bucher, N. L. R., and Farmer, S. R. (1996) Mol. Cell. Biol. 16, 4128-4136[Abstract]
  15. Yeh, W.-C., Cao, Z., Classon, M., and McKnight, S. L. (1995) Genes Dev. 9, 168-181[Abstract/Free Full Text]
  16. Tanaka, T., Yoshida, N., Kishimoto, T., and Akira, S. (1997) EMBO J. 16, 7432-7443[CrossRef][Medline] [Order article via Infotrieve]
  17. Lehmann, J. M., Moore, L. B., Smith-Oliver, T. A., Wilkison, W. O., Willson, T. M., and Kliewer, S. A. (1995) J. Biol. Chem. 270, 12953-12956[Abstract/Free Full Text]
  18. Forman, B. M., Tontonoz, P., Chen, J., Brun, R. P., Spiegelman, B. M., and Evans, R. M. (1995) Cell 83, 803-812[CrossRef][Medline] [Order article via Infotrieve]
  19. Kliewer, S. A., Lenhard, J. M., Willson, T. M., Patel, I., Morris, D. C., and Lehmann, J. M. (1995) Cell 83, 813-819[CrossRef][Medline] [Order article via Infotrieve]
  20. Chawla, A., Schwarz, E. J., Dimaculangan, D. D., and Lazar, M. A. (1994) Endocrinology 135, 798-800[Abstract]
  21. Tontonoz, P., Hu, E., and Spiegelman, B. M. (1994) Cell 79, 1147-1156[CrossRef][Medline] [Order article via Infotrieve]
  22. Kim, J. B., and Spiegelman, B. M. (1996) Genes Dev. 10, 1096-1107[Abstract/Free Full Text]
  23. Kim, J. B., Wright, H. M., Wright, M., and Spiegelman, B. M. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 4333-4337[Abstract/Free Full Text]
  24. Shao, D., and Lazar, M. A. (1997) J. Biol. Chem. 272, 21473-21478[Abstract/Free Full Text]
  25. Higgins, C., Chatterjee, S., and Cherington, V. (1996) J. Virol. 70, 745-752[Abstract]
  26. Chen, P.-L., Riley, D. J., Chen, Y., and Lee, W.-H. (1996) Genes Dev. 10, 2794-2804[Abstract/Free Full Text]
  27. Chen, P.-L., Riley, D. J., Chen-Kiang, S., and Lee, W.-H. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 465-469[Abstract/Free Full Text]
  28. Richon, V. M., Lyle, R. E., and McGehee, R. E. (1997) J. Biol. Chem. 272, 10117-10124[Abstract/Free Full Text]
  29. Lukas, J., Bartkova, J., Rohde, M., Strauss, M., and Bartek, J. (1995) Mol. Cell. Biol. 15, 2600-2611[Abstract]
  30. Liao, K., and Lane, M. D. (1995) J. Biol. Chem. 270, 12123-12132[Abstract/Free Full Text]
  31. Kliewer, S. A., Umesono, K., Noonan, D. J., Heyman, R. A., and Evans, R. M. (1992) Nature 358, 771-774[CrossRef][Medline] [Order article via Infotrieve]
  32. Tontonoz, P., Hu, E., Graves, R. A., Budavari, A. I., and Spiegelman, B. M. (1994) Genes Dev. 8, 1224-1234[Abstract/Free Full Text]
  33. Qin, X.-Q., Chittenden, T., Livingston, D., and Kaelin, W. G. (1992) Genes Dev. 6, 953-964[Abstract/Free Full Text]
  34. Lukas, J., Herzinger, T., Hansen, K., Moroni, M. C., Resnitzky, D., Helin, K., Reed, S. I., and Bartek, J. (1997) Genes Dev. 11, 1479-1492[Abstract/Free Full Text]
  35. Muchardt, C., and Yaniv, M. (1993) EMBO J. 12, 4279-4290[Medline] [Order article via Infotrieve]
  36. Clarke, S. L., Robinson, C. E., and Gimble, J. M. (1997) Biochem. Biophys. Res. Commun. 240, 99-103[CrossRef][Medline] [Order article via Infotrieve]
  37. Cao, Z., Umek, R. M., and McKnight, S. L. (1991) Genes Dev. 5, 1538-1552[Abstract/Free Full Text]
  38. Gao, X., and Huang, L. (1991) Biochem. Biophys. Res. Commun. 179, 280-285[CrossRef][Medline] [Order article via Infotrieve]
  39. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156-159[Medline] [Order article via Infotrieve]
  40. Jensen, J., Serup, P., Karlsen, C., Nielsen, T. F., and Madsen, O. D. (1996) J. Biol. Chem. 271, 18749-18758[Abstract/Free Full Text]
  41. Chang, K.-H., Chen, Y., Chen, T.-T., Chou, W.-H., Chen, P.-L., Ma, Y.-Y., Yang-Feng, T. L., Leng, X., Tsai, M.-J., O'Malley, B. W., and Lee, W.-H. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 9040-9045[Abstract/Free Full Text]
  42. Singh, P., Coe, J., and Hong, W. (1995) Nature 374, 562-565[CrossRef][Medline]