J Biol Chem, Vol. 274, Issue 4, 2386-2393, January 22, 1999
Activation of Peroxisome Proliferator-activated Receptor
Bypasses the Function of the Retinoblastoma Protein in Adipocyte
Differentiation*
Jacob B.
Hansen
,
Rasmus K.
Petersen
,
Berit M.
Larsen
,
Jirina
Bartkova§,
Jan
Alsner¶, and
Karsten
Kristiansen
From the
Department of Molecular Biology, Odense
University, DK-5230 Odense M, § Danish Cancer Society,
Division of Cancer Biology, DK-2100 Copenhagen Ø, and the
¶ Department of Experimental Clinical Oncology, Aarhus University
Hospital, DK-8000 Aarhus C, Denmark
 |
ABSTRACT |
The retinoblastoma protein (pRB) is an important
regulator of development, proliferation, and cellular differentiation.
pRB was recently shown to play a pivotal role in adipocyte
differentiation, to interact physically with adipogenic
CCAAT/enhancer-binding proteins (C/EBPs), and to positively regulate
transactivation by C/EBP
. We show that PPAR
-mediated
transactivation is pRB-independent, and that ligand-induced
transactivation by PPAR
1 present in RB+/+
and RB
/
mouse embryo fibroblasts is
sufficient to bypass the differentiation block imposed by the absence
of pRB. The differentiated RB
/
cells
accumulate lipid and express adipocyte markers, including C/EBP
and
PPAR
2. Interestingly, adipose conversion of pRB-deficient cells
occurs in the absence of compensatory up-regulations of the other pRB
family members p107 and p130. RB+/+ as well as
RB
/
cells efficiently exit from the cell
cycle after completion of clonal expansion following stimulation with
adipogenic inducers. We conclude that ligand-induced activation of
endogenous PPAR
1 in mouse embryo fibroblasts is sufficient to
initiate a transcriptional cascade resulting in induction of PPAR
2
and C/EBP
expression, withdrawal from the cell cycle, and terminal
differentiation in the absence of a functional pRB.
 |
INTRODUCTION |
The retinoblastoma protein
(pRB)1 is a key regulator of
the mammalian cell cycle. Through repression of the growth-promoting E2F transcription factors, pRB controls the transition from the G1 to the S phase (1). pRB function is regulated by
cyclin-dependent kinases, which phosphorylate pRB in a
characteristic cell cycle-dependent manner (2). In
addition, pRB plays a pivotal role during development and
differentiation. The multifunctional character of pRB has been
demonstrated by targeted disruption of the retinoblastoma gene in mice.
Homozygous mutant embryos die in utero and show abnormalities in hematopoiesis and neurogenesis (3).
Numerous ex vivo studies have established the importance of
pRB in myocyte differentiation (4). pRB has been shown to interact physically and functionally with members of the myogenic MyoD family of
basic helix-loop-helix transcription factors (5), and pRB-deficient
cells fail to undergo terminal myogenesis (6, 7). This included a
defect in expression of late differentiation markers, reduced myoblast
fusion, a failure to terminally withdraw from the cell cycle, and an
increased incidence of apoptosis (6-8). These observations have also
been seen in vivo when pRB is expressed at subphysiological
levels (9).
Adipocyte differentiation is a complex process regulated by
CCAAT/enhancer-binding proteins (C/EBPs), peroxisome
proliferator-activated receptors (PPARs), and the adipocyte
determination and differentiation-dependent factor-1/sterol
regulatory element-binding protein-1 (ADD1/SREBP1) (10-12). C/EBP
and C/EBP
are induced very early during differentiation and have
been shown to promote adipogenesis, possibly through induction of
C/EBP
and PPAR
(13-15), and abrogation of their activity blocks
adipose conversion (15, 16). Ectopic expression of C/EBP
is
adipogenic in fibroblasts, and abrogation of C/EBP
expression blocks
adipocyte differentiation (11). PPARs are members of the nuclear
hormone receptor superfamily of ligand-activated transcription factors.
Ligands for PPAR
include the antidiabetic thiazolidinedione drugs
and certain prostaglandin J2 derivatives (17-19). PPAR
is induced early in adipocyte differentiation (20), and addition of
ligands to fibroblasts expressing PPAR
endogenously or ectopically
induces or promotes adipose conversion (17-19, 21). ADD1/SREBP1 is
also induced early in the differentiation program and promotes
adipogenesis (22). Ectopic expression of ADD1/SREBP1 was recently shown
to induce the synthesis of an unidentified PPAR
activating ligand
(23).
Adipocyte differentiation ex vivo requires growth arrest,
usually obtained by growing cells to confluence. Following stimulation with adipogenic factors, density-arrested preadipocytes undergo several
rounds of postconfluent cell divisions (clonal expansion), followed by
terminal withdrawal from the cell cycle, expression of adipocyte
markers, and accumulation of intracellular lipid (24). The importance
of pRB in adipocyte differentiation has been amply demonstrated. It was
shown that the ability of a truncated simian virus 40 large T antigen
to block adipocyte differentiation is dependent on its ability to
sequester the pRB family (pRB, p107, p130) (25), and recently it was
demonstrated that lung fibroblasts from RB
/
mouse embryos are unable to undergo adipose conversion unless rescued
by an RB transgene (26). Furthermore, pRB was shown to
physically interact with C/EBPs, promote the binding of C/EBP
to its
cognate DNA response element, and increase its transactivation capacity
(26, 27). The functional interaction with C/EBP
suggests that pRB
plays an important role early in the adipocyte differentiation program.
Finally, regulated phosphorylation and expression of the three pRB
family members during adipose conversion have recently been
demonstrated (24, 28).
In this study, we used fibroblasts from normal and
RB
/
mouse embryos to further characterize
the importance and functions of pRB in adipocyte differentiation. We
show that transactivation by PPAR
is not dependent on pRB. Mouse
embryo fibroblasts (MEFs) express PPAR
1 in the predifferentiated
state, and the inability of pRB-deficient MEFs to differentiate is
efficiently bypassed by addition of PPAR
ligands. The differentiated
RB
/
MEFs accumulate lipid and express
adipocyte markers. Surprisingly, adipocyte differentiation of
RB
/
MEFs was found not to be accompanied by
compensatory up-regulation of p107 and p130 expression, and
RB+/+ as well as RB
/
MEFs effectively withdraw from the cell cycle following clonal expansion.
 |
EXPERIMENTAL PROCEDURES |
Cell Culture and Differentiation--
The preparation of
wild-type and RB
/
mouse embryo fibroblasts
(MEFs) has been described previously (29). MEFs were grown in AmnioMax
basal medium (Life Technologies, Inc.) supplemented with 7.5% fetal
bovine serum (FBS), 7.5% AmnioMax-C100 supplement, 2 mM
glutamine, 62.5 µg/ml penicillin, and 100 µg/ml streptomycin (growth medium) in a humidified atmosphere of 5% CO2 at
37 °C. Medium was changed every other day. For differentiation,
2-day postconfluent cells (day 0) were treated with growth medium
containing 1 µM dexamethasone (Sigma), 0.5 mM
methylisobutylxanthine (Aldrich), 5 µg/ml insulin (Boehringer
Mannheim), and BRL49653 (0.5 µM unless otherwise
indicated) or vehicle (0.1% Me2SO) for 2 days. From day 2, medium contained 5 µg/ml insulin and BRL49653 or vehicle. MEFs were
not used beyond passage 10. 3T3-L1 cells were cultured to confluence in
Dulbecco's modified Eagle's medium (DMEM) with 10% bovine serum and
differentiated as described (30). Briefly, 2-day postconfluent cells
(day 0) were induced to differentiate with DMEM containing 10% FBS, 1 µM dexamethasone, 0.5 mM
methylisobutylxanthine, and 1 µg/ml insulin. After 48 h, medium
was replaced with DMEM containing 10% FBS and 1 µg/ml insulin, and
the cells were subsequently fed every other day with DMEM containing
10% FBS.
PCR Analysis of RB Gene Status--
RB gene
disruption via insertion of the hygromycin resistance gene in exon 19 was detected as described previously (29). Briefly, 50 ng of genomic
DNA from individual MEFs were used for PCR amplification. To detect
disruption of RB alleles, the following upstream and
downstream primers were used: CGATCTTAGCCAGACGAGCG(within the
hygromycin resistance gene) and TGAGGCTGCTTGTGTCTGTG (within exon 19 of
RB). To detect wild-type RB alleles, the
downstream exon 19 primer was used in combination with the following
upstream primer: GACTAGGTGAAGGAATGCAGAG (within intron 18 of
RB). As a control, we amplified part of the
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene using the
following primers: ATTGGGCGCCTGGTCAC and CCAGAGGGGCCATCCAC. Following a
10-min denaturation/activation of DNA polymerase (AmpliTaq Gold, Perkin
Elmer), 35 cycles were performed as follows: 94 °C for 20 s,
58 °C for 20 s (62 °C for GAPDH), 72 °C for 60 s.
PCR products were resolved on 1.5% agarose gels.
Oil Red O Staining--
Dishes were washed in PBS and cells
fixed in 3.7% formaldehyde for 1 h, followed by staining with Oil
Red O for 1 h. Oil Red O was prepared by diluting a stock solution
(0.5 g of Oil Red O (Sigma) in 100 ml of isopropanol) with water (6:4)
followed by filtration. After staining, plates were washed twice in
water and photographed.
Plasmids and Transfections--
The PPREx3-tk-luc reporter
containing three copies of the peroxisome proliferator-activated
receptor response element (PPRE) from the acyl-CoA oxidase promoter was
kindly provided by Ronald M. Evans (31). The pSPORT-mPPAR
2
expression vector was kindly provided by Bruce M. Spiegelman (32).
CMV-RB (33) and CMV-HA-E2F-1 (34) expression vectors and the 6xE2F-luc
reporter containing six E2F binding sites (34) were kindly provided by
Kristian Helin. The CMV-RB(H209) expression vector was kindly provided by Sibylle Mittnacht. It encodes a pRB mutant with a
cysteine-to-phenylalanine substitution at amino acid 706 which
abolishes the function of the pocket. The CMV-hBrm expression vector
was kindly provided by Christian Muchardt (35). The CMV-r42-C/EBP
expression vector was kindly provided by M. Daniel Lane. The reporter
containing the proximal part of the PPAR
2 promoter cloned in front
of the luciferase gene was kindly provided by Jeffrey M. Gimble (36). The MSV-C/EBP
vector was kindly provided by Steven L. McKnight (37).
The CMV-
-galactosidase vector used for normalization is from
CLONTECH. The human cervix carcinoma cell line C33A
was grown in DMEM containing 10% FBS. Cells were transfected with the
DC-Chol method as described (38). Cells were harvested approximately 48 h after transfection. The luciferase and
-galactosidase
activities in cell lysates were determined by standard techniques.
Whole Cell Extracts--
Plates were washed twice in TBS and
cells were lysed on the plates by addition of an SDS sample buffer
containing 2.5% SDS, 10% glycerol, 50 mM Tris-HCl (pH
6.8), 10 mM dithioerythritol, 10 mM
-glycerophosphate, 10 mM NaF, 0.1 mM sodium
orthovanadate, 1 mM phenylmethylsulfonyl fluoride, and the
Complete protease inhibitor mixture (1/50 tablet per ml) (Boehringer
Mannheim). Lysis of cells was immediately followed by 3 min of boiling.
Lysates were subsequently treated with benzon nuclease (Merck). Whole cell extracts were stored at
80 °C. Protein concentrations were determined by the Bradford method (Bio-Rad).
Western Blotting--
One hundred µg of protein were loaded in
each lane. After SDS-polyacrylamide gel electrophoresis, proteins were
blotted onto polyvinylidene difluoride membranes (Micron Separation)
using a Kem-En-Tec semidry blotter. Equal loading/transfer was
confirmed by Ponceau S staining of membranes. Membranes were blocked
overnight in PBS (or TBS) containing 5% nonfat dry milk and 0.1%
Tween 20 (Sigma). Incubation with primary and secondary antibodies was performed in PBS (or TBS) containing 5% nonfat dry milk for 1-2 h.
After incubation with antibodies, membranes were washed in PBS (or TBS)
containing 0.1% Tween 20. PBS was used in all experiments except for
those in which the mouse anti-human pRB antibody (G3-245, PharMingen)
was used. Here, TBS was used instead. Other primary antibodies used
were rabbit anti-human p107 (C-18, Santa Cruz Biotechnology), mouse
anti-human p130 (Transduction Laboratories), rabbit anti-human
TATA-binding protein (TBP) (Santa Cruz Biotechnology), rabbit
anti-mouse aP2/adipocyte lipid-binding protein (ALBP) (kindly provided
by David A. Bernlohr), rabbit anti-PPAR
antibody recognizing both
PPAR
isoforms (kindly provided by Mitchell A. Lazar), and rabbit
antibodies against mouse C/EBP
and C/EBP
(kindly provided by M. Daniel Lane). Secondary antibodies were horseradish
peroxidase-conjugated anti-mouse or anti-rabbit antibodies (DAKO).
Enhanced chemiluminescence (ECL) (Amersham Pharmacia Biotech) was used
for detection. Stripping of membranes was done by boiling for 5-10 min
in water.
RNA Purification and Reverse Transcription--
Total RNA was
purified as described (39). The integrity of all RNA samples was
confirmed by electrophoresis in denaturing formaldehyde-containing
gels. Reverse transcriptions were performed in 25-µl reactions
containing 1 µg of total RNA, 3 µg of random hexamers (Amersham
Pharmacia Biotech), 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 10 mM dithiothreitol, 40 units of RNAguard (Amersham Pharmacia
Biotech), 0.9 mM dNTPs (Amersham Pharmacia Biotech), and
200 units of Moloney murine leukemia virus reverse transcriptase (Life
Technologies). Reactions were left 10 min at room temperature, followed
by incubation at 37 °C for 1 h. After cDNA synthesis,
reactions were diluted with 50 µl of water and frozen at
80 °C.
Multiplex RT-PCR--
Multiplex reverse transcription-polymerase
chain reaction (RT-PCR) was performed essentially as described (40)
with minor changes. PCR was done in 25-µl reactions containing 1.5 µl of diluted cDNA, 50 mM KCl, 10 mM
Tris-HCl (pH 9.0), 1.5 mM MgCl2, 0.1% Triton
X-100, 40 µM dATP, dTTP, and dGTP, 20 µM
dCTP, 5 pmol of each primer, 1.25 units of Taq polymerase,
and 1.25 µCi of [
-32P]dCTP (6000 Ci/mmol) (NEN Life
Science Products). Reaction mixtures were denatured at 94 °C for 1 min. Denaturation was followed by 20 or 25 cycles (depending on the
primers used) of 94 °C for 30 s, 55 °C for 60 s,
72 °C for 90 s. All reactions contained the TBP primer set as
an internal standard together with one or two additional primer sets.
In reactions coamplifying PPAR
1 and PPAR
2, 10 pmol of the common
3' primer was included. All reactions were performed with 25 cycles,
except those containing the glycerol-3-phosphate dehydrogenase (GPDH)
primer set for which 20 cycles were employed. Primers used were:
C/EBP
, 5'-GAACAGCAACGAGTACCGGGTA, 3'- GCCATGGCCTTGACCAAGGAG (225 bp); GPDH, 5'-GTGGTACCCCATCAGTTCATTG, 3'-GTCCTTCAGGAGCTGTCCCTG (264 bp); PPAR
1, 5'-CACGTTCTGACAGGACTGTGT, 3'-CAGCAACCATTGGGTCAGCTC (288 bp); PPAR
2, 5'-CCAGAGCATGGTGCCTTCGCT, 3'-CAGCAACCATTGGGTCAGCTC (241 bp); TBP, 5'-ACCCTTCACCAATGACTCCTATG, 3'-ATGATGACTGCAGCAAATCGC (190 bp). Ten µl of each reaction were dried down and resuspended in
formamide dye mix (98% deionized formamide, 10 mM EDTA (pH 8.0), 0.2% bromphenol blue, 0.2% xylene cyanol) and loaded onto 0.4 mm, 8 M urea, 1× TBE, 6% polyacrylamide gels.
Electrophoresis was for 3 h at 50 watts. Gels were dried and
exposed overnight to phosphorimage storage screens. Screens were
scanned on a PhosphorImager (Molecular Dynamics).
Preparation of Cells for Flow Cytometry--
At the indicated
time points, bromodeoxyuridine (BrdUrd) (Sigma) was added to the plates
to a final concentration of 10 µM, and incubation was
continued for 20 min. Cells were then harvested by trypsinization,
washed in 0.9% NaCl, fixed in 75% ethanol, and stored at 4 °C
until further analysis. Cells were treated with pepsin before
incubation with a monoclonal anti-BrdUrd antibody (Becton Dickinson),
followed by incubation with a fluorescein isothiocyanate-conjugated
rabbit anti-mouse secondary antibody (DAKO). Cells were RNase-treated
and stained with propidium iodide before loading onto an Epics Profile
I flow cytometer.
 |
RESULTS |
Transactivation by PPAR
Is Independent of
pRB--
Transcriptional activation by nuclear receptors is dependent
on recruitment of coactivator proteins. pRB has recently been shown to
modulate the activity of the thyroid hormone and glucocorticoid receptors by interaction with coactivators (41, 42). Trip230 was shown
to be a thyroid hormone receptor (TR) coactivator and a pRB-interacting
protein (41). pRB was able to sequester Trip230 from TR, thereby
down-regulating the activity of TR. Contrary to the effect on TR, pRB
was found to potentiate glucocorticoid receptor (GR)-mediated
transactivation by direct interaction with hBrm (42), a previously
identified GR coactivator (35). To examine whether the transcriptional
activity of PPAR
was modulated by pRB, we analyzed the
transactivation potential of full-length PPAR
2 in the human cell
line C33A which does not express functional pRB. C33A cells have
previously been used to demonstrate potentiation of GR transactivation
by pRB (42). As shown in Fig.
1A, PPAR
is transactivating
the reporter in C33A cells (column 3), and addition of the high affinity PPAR
ligand BRL49653 further enhances its activity (column 4). Coexpression of pRB has
little or no effect on either BRL49653-dependent or
-independent transactivation by PPAR
(compare columns
3 and 7 and columns 4 and
8). As expected, no effect on PPAR
transactivation was
observed by coexpressing the nonfunctional pRB mutant pRB(H209)
(compare columns 3 and 11 and
columns 4 and 12). Since C33A cells
express no hBrm (35), we wanted to rule out the possibility that pRB
affected PPAR
transactivation via this coactivator. This appeared
not to be the case, as we observed no effect on PPAR
transactivation
by coexpression of hBrm, neither in the presence nor in the absence of
pRB (data not shown). As a positive control, we tested the effect of
pRB on E2F-mediated transactivation. Fig. 1B shows that pRB
represses basal reporter activity, probably by repressing endogenous
E2F in C33A cells (compare columns 1 and
3). Furthermore, E2F-1-induced transactivation of the
reporter (column 2) was partially repressed by
coexpression of pRB (column 4). The pRB mutant
failed to repress either basal reporter activity or E2F-1-induced
reporter activity (compare columns 1 and
5 and columns 2 and 6).
From these experiments, we conclude that transactivation by PPAR
is
independent of pRB in C33A cells.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 1.
Transcriptional activation by PPAR
is not dependent on pRB. A, C33A cells were
transfected with the PPREx3-tk-luc reporter (0.7 µg) and
CMV- -galactosidase (0.7 µg), together with combinations of
expression vectors for mPPAR 2 (0.7 µg), wild-type human pRB (0.7 µg), and pRB(H209) (0.7 µg). Empty expression vector was added to
ensure equal promoter load. Cells were subsequently treated with medium
containing either BRL49653 (0.5 µM) or vehicle (0.1%
Me2SO) for approximately 48 h before harvest. Reporter
activity was normalized to -galactosidase values. Transfections were
performed in triplicate, measured in duplicate and repeated three
times. B, pRB represses E2F-mediated transactivation. C33A
cells were transfected with the 6xE2F-luc reporter (0.35 µg) and
CMV- -galactosidase (0.35 µg), together with combinations of
expression vectors for E2F-1 (0.35 µg), wild-type human pRB (0.35 µg), and pRB(H209) (0.35 µg). Cells were harvested after
approximately 48 h. Reporter activity was normalized to
-galactosidase values. Transfections were performed in triplicate,
measured in duplicate, and repeated three times.
|
|
Activation of PPAR
Bypasses the Function of pRB in Adipocyte
Differentiation--
The use of embryonic fibroblasts (MEFs) from mice
with targeted disruptions of specific genes is a powerful tool in
deciphering the importance and functions of proteins in cellular
differentiation. By using lung fibroblasts from mouse embryos with
targeted disruption of the RB gene, the importance of pRB in
adipocyte differentiation was demonstrated (26). pRB and C/EBPs were
shown to interact, and it was demonstrated that pRB potentiated
transactivation by C/EBP
(26, 27).
To further characterize the importance and function of pRB in adipose
conversion, we examined the potential of different known adipogenic
inducers to support adipocyte differentiation of fibroblasts from
normal and RB
/
mouse embryos (29). These
experiments were performed with MEFs from one wild-type (MEFA) and two
pRB-deficient (ME3 and ME8) mouse embryos. Genotypes were validated by
genomic PCR (Fig. 2A), and the
absence of pRB expression in RB
/
MEFs was
confirmed by Western blotting (Fig. 2B) and immunostaining (data not shown). Using a standard differentiation protocol including treatment with dexamethasone, methylisobutylxanthine, and insulin (DMI
treatment), only the RB+/+ MEFs differentiated
to a significant degree (Fig. 3,
A and B (a and c)). This is
in agreement with previous results (26). However, we consistently
observed some pRB-deficient cells accumulating lipid in response to the
DMI treatment (Fig. 3B, e). In one of the
RB
/
MEFs (ME8), only a few cells accumulated
lipid in response to standard inducers, whereas, in the other (ME3),
approximately 1% of the cells accumulated lipid. By RT-PCR and Western
blotting, we found that all three MEFs express PPAR
1 mRNA and
protein in the predifferentiated state (see Fig.
4). Therefore, we hypothesized that
addition of a high affinity ligand for PPAR
might be able to bypass
the block in adipose conversion imposed by the absence of pRB. Addition
of BRL49653 to the standard differentiation medium efficiently promoted
differentiation of RB
/
as well as
RB+/+ MEFs (Fig. 3, A and
B (b and d)). The ligand concentration
needed to bypass the defective differentiation in
RB
/
MEFs was in agreement with the
Kd of BRL49653 binding to PPAR
(17) in that
differentiation was promoted with 50 nM BRL49653 (data not
shown). Furthermore, even though predifferentiated MEFs express low
levels of PPAR
and PPAR
mRNA (data not shown), the
concentration of BRL49653 used in this report (0.5 µM) is sufficient to activate only the PPAR
subtype (17, 18). Therefore, we
conclude that PPAR
is the target receptor in the BRL49653-induced differentiation of pRB-deficient MEFs.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 2.
Characterization of the mouse embryo
fibroblasts. A, PCR was performed on genomic DNA from
the MEFs. Primers amplifying mutated or wild-type RB alleles
were used. MEFA contains only wild-type RB alleles whereas
ME3 and ME8 contain only mutated alleles. Primers for GAPDH were used
as a control. PCR products were resolved on 1.5% agarose gels.
MW, marker DNA ladder (1000, 750, 500, and 300 bp);
C, negative control without template. B,
expression of pRB in MEFs analyzed by Western blotting. One hundred
µg of protein from confluent MEF cultures were loaded in each lane.
As expected, no expression of pRB is observed in the
RB / MEFs (ME3 and ME8).
|
|

View larger version (93K):
[in this window]
[in a new window]
|
Fig. 3.
Morphological differentiation of normal and
pRB-deficient MEFs. Cells were induced to differentiate as
described under "Experimental Procedures." Dishes were photographed
on day 10. A, representative dishes of
RB+/+ and RB / MEFs
stained with Oil Red O. Cells were differentiated in the absence
(top) or presence (bottom) of BRL49653 (0.5 µM). B, micrographs of Oil Red O stained
dishes containing wild-type (a and b) or
RB / (c and d)
fibroblasts differentiated in the absence (a and
c) or presence (b and d) of BRL49653,
and (e) micrograph showing a small cluster of
lipid-accumulating RB / MEFs after a standard
differentiation induction (DMI treatment) without addition of
BRL49653.
|
|

View larger version (63K):
[in this window]
[in a new window]
|
Fig. 4.
Expression of adipocyte markers during
differentiation of normal and pRB-deficient MEFs. A,
RNA was harvested on the indicated days and the expression of PPAR 2,
PPAR 1, C/EBP , GPDH, and TBP was analyzed by multiplex RT-PCR. TBP
was used as an internal standard. B, whole cell extracts
were prepared on the indicated days. One hundred µg of protein were
loaded in each lane. Expression of PPAR , C/EBP , C/EBP ,
aP2/ALBP, and TBP was analyzed by Western blotting. Equal
loading/transfer was confirmed by Ponceau S staining of membranes and
by incubation with anti-TBP antibody.
|
|
To characterize the differentiation of RB+/+ and
RB
/
MEFs in more detail, gene expression was
examined by multiplex RT-PCR and Western blotting. Treatment of MEFs
with adipogenic inducers (DMI) resulted in a transient induction of
C/EBP
with expression levels peaking on day 1, irrespective of
RB status and supplementation of BRL49653 (Fig.
4B). A transient up-regulation of C/EBP
is also seen
during differentiation of 3T3-L1 cells (15, 43). Treatment of
RB+/+ MEFs with either DMI or DMI together with
BRL49653 resulted in the induction of PPAR
2, C/EBP
, and GPDH
mRNAs (Fig. 4A, left). However, induction was
accelerated and expression levels were higher when cells were treated
with the PPAR
ligand. Western blotting showed that the induction of
PPAR
2 mRNA was accompanied by synthesis of PPAR
2 protein.
Similarly, a robust induction of aP2/ALBP was detected (Fig.
4B, left). Of interest, even though C/EBP
mRNA was induced in the differentiating
RB+/+ cells in absence of the PPAR
ligand,
C/EBP
protein was detected only in cells treated with BRL49653 (Fig.
4B, left). Even extended exposure of the blots of
protein from the DMI-treated RB+/+ cells
challenged with antibodies against C/EBP
revealed no signals above
background (data not shown). Considering the relatively strong
induction of C/EBP
mRNA on day 6 in the DMI-treated cells, the
absence of detectable C/EBP
protein suggests a posttranscriptional regulation of C/EBP
expression in MEFs. In pRB-deficient MEFs, PPAR
2, C/EBP
, and GPDH mRNAs were very weakly induced when
cells were treated with DMI in the absence of BRL49653 (Fig.
4A, right). Treatment of
RB
/
MEFs with DMI plus BRL49653, however,
led to an induction of PPAR
2, C/EBP
, and GPDH mRNAs similar
to that observed in RB+/+ MEFs (Fig.
4A). Robust induction of PPAR
2, C/EBP
, and aP2/ALBP proteins in pRB-deficient cells was also dependent on the PPAR
ligand (Fig. 4B, right). As mentioned above,
PPAR
1 (but not PPAR
2) mRNA and protein were expressed in
confluent MEFs (day 0 in Fig. 4, A and B).
Therefore, it appears that ligand-activation of endogenous PPAR
1
induces PPAR
2 expression and differentiation of
RB
/
MEFs.
The Effect of pRB on C/EBP
- and C/EBP
-mediated
Transactivation of the Proximal PPAR
2 Promoter--
pRB has been
demonstrated to potentiate C/EBP
-mediated transactivation of
reporter plasmids containing multimeric C/EBP binding sites, possibly
by acting as a chaperone to induce binding of C/EBP
to its cognate
DNA response element (26, 27). Whether pRB was capable of regulating
the activity of natural promoters via C/EBP sites was not addressed in
these studies. To investigate this, we analyzed the importance of pRB
in the transactivation of a C/EBP-regulated gene which is induced
during adipose conversion. The proximal part of the PPAR
2 promoter
contains two C/EBP sites, which confer C/EBP-dependent
activation in transient transfection studies (36). Using the proximal
PPAR
2 promoter as a reporter plasmid (36), cotransfection with both
C/EBP
and C/EBP
expression vectors was found to transactivate the
reporter in the pRB-deficient C33A cells (Fig.
5, columns 3 and
7). The effect of coexpression of pRB on C/EBP
- or
C/EBP
-mediated transactivation is shown in Fig. 5. In the case of
C/EBP
, coexpression of pRB was found to have little or no effect
(compare columns 3 and 4) in
accordance with the previously noted pRB insensitivity of
C/EBP
-dependent transactivation (44), and similarly, pRB
only modestly increased the C/EBP
-mediated transactivation (compare
columns 7 and 8). The pRB pocket
mutant pRB(H209) did not significantly affect transactivation mediated
by the C/EBPs (Fig. 5, compare columns 3 and
6 and columns 7 and 9). The
absent or very moderate effect of pRB on C/EBP-mediated transactivation
of the proximal PPAR
2 promoter is in contrast to the pronounced
effect on reporters containing multimeric C/EBP binding sites (26, 27).
The experiments in Fig. 5 were performed with the same ratio of
transcription factor to pRB expression vectors as in Fig. 1, where pRB
significantly repressed E2F-mediated transactivation. pRB has been
shown to potentiate GR-mediated transactivation in C33A cells (42), but
it cannot be excluded that the chaperone-like effect of pRB on C/EBP
proteins may be sensitive to relative protein levels. Furthermore, cell
lines may differ in their ability to support a functional pRB-C/EBP interaction. In conclusion, however, our results suggest that pRB may
regulate adipogenesis through pathways in addition to those controlled
by C/EBP proteins.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 5.
The effect of pRB on C/EBP - and
C/EBP -mediated transactivation of the proximal PPAR 2
promoter. C33A cells were transfected with the proximal PPAR 2
promoter cloned in front of a luciferase reporter gene (36) (0.7 µg)
together with combinations of expression vectors for C/EBP (0.7 µg), C/EBP (0.7 µg), pRB (0.7 µg), and pRB(H209) (0.7 µg).
Empty expression vector was added to ensure equal promoter load.
Luciferase values were not normalized to -galactosidase values in
these experiments since coexpression of C/EBPs significantly increased
expression from the CMV- -galactosidase vector (data not shown).
Transfections were performed in triplicate, measured in duplicate, and
repeated two times.
|
|
Regulation of pRB Family Members during Adipocyte Differentiation
of RB+/+ and RB
/
MEFs--
During myocyte
differentiation of RB+/+ cells, the levels of
p107 and p130 are inversely regulated, with p107 being down-regulated (6, 7) and p130 up-regulated (7). Myogenic conversion of
RB
/
cells, however, causes induction of both
p107 (6, 7) and p130 (7). The pRB-deficient cells are impaired in
expression of late myocyte differentiation markers and fail to
terminally withdraw from the cell cycle (6, 7). However, the
RB
/
cells do express early myocyte markers
(6, 7), and it is therefore conceivable that the up-regulation of p107
in RB
/
cells promotes the early steps in the
differentiation program.
To study possible compensatory regulations of p107 and p130 during
adipose conversion of pRB-deficient MEFs, we compared expression profiles of the three pRB family members in differentiating
RB+/+ and RB
/
MEFs by
Western blotting. Fig. 6
(left) shows that pRB is present mainly in the
hypophosphorylated state before stimulation with adipogenic factors
(day 0). After 24 h, a significant fraction is
hyperphosphorylated as seen by the reduced migration. After day 1, the majority of pRB is hypophosphorylated (Fig. 6). This pattern of
phosphorylation is independent of the presence of BRL49653. Furthermore, the overall level of pRB does not change in these experiments. We found no significant differences in the expression profiles of p130 and p107 between RB+/+ and
RB
/
MEFs (Fig. 6). The level of p130 was
high at day 0, transiently reduced following stimulation with
adipogenic inducers, and restored on days 4-6 (Fig. 6). The regulation
of p130 was not significantly affected by addition of BRL49653. p107
showed two peaks of induction (days 1 and 3), which were also
associated with an increased phosphorylation. Interestingly, addition
of BRL49653 significantly reduced the level of p107 from day 4 in the
differentiation program compared with control cells (Fig. 6). This was
particularly prominent in wild-type cells, but a similar tendency was
observed in both pRB-deficient MEFs (Fig. 6 and data not shown). Since
BRL49653 effectively increases the number of differentiating cells (see
Fig. 3), this indicates that adipose conversion is associated with
decreased p107 expression, even in pRB-deficient cells.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 6.
Expression and phosphorylation of pRB family
members during differentiation of normal and pRB-deficient MEFs.
Whole cell extracts were prepared on the indicated days and the
expression of pRB, p107, and p130 was analyzed by Western blotting. One
hundred µg of protein were loaded in each lane. Equal
loading/transfer was confirmed by Ponceau S staining of
membranes.
|
|
To examine the importance of pRB in the cell divisions taking place
after stimulation of confluent cells with adipogenic inducers, we used
BrdUrd labeling to measure the percentage of cells in S phase. Fig.
7 shows the percentage of BrdUrd-positive
RB+/+ and RB
/
MEFs
every 12 h after stimulation with standard inducers (DMI treatment). The figure shows the result of one of two independent experiments. Two rounds of DNA synthesis are apparent, the first peaking on day 1 and the second peaking on day 2.5. Supplementation of
5 µM BRL49653 to the standard inducers did not
significantly affect the distribution of neither
RB+/+ nor RB
/
MEFs in
S phase (data not shown). A similar distribution of cells in S phase
was seen during adipocyte differentiation of 3T3-L1 cells, again with
peaks on days 1 and 2.5.2 The
percentage of cells in S phase was consistently higher in wild-type
cells compared with RB
/
cells (Fig. 7). The
flow cytometric analysis was performed with only one of the
RB
/
MEFs (ME8), so whether the reduced
number of cells in S phase extend to other pRB-deficient MEFs is not
known at present. However, the fact that both
RB+/+ and RB
/
MEFs
underwent two rounds of DNA replication with approximately the same
time course indicates that pRB is not critical for the timing of the
clonal expansion phase. In addition, Fig. 7 shows that pRB is not
essential for cell cycle exit during adipose conversion.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 7.
Time course of DNA synthesis during adipocyte
differentiation of normal and pRB-deficient MEFs. At the indicated
time points after stimulation with dexamethasone,
methylisobutylxanthine, and insulin, cells were labeled with BrdUrd.
The percentage of BrdUrd-positive cells was measured by flow
cytometry.
|
|
A comparison of the time course of DNA synthesis (Fig. 7) and the
expression profiles of pRB, p107, and p130 (Fig. 6) indicates that
hyperphosphorylation of pRB in RB+/+ MEFs is
coinciding with the first round of DNA replication on day 1. The peaks
of DNA synthesis coincide approximately with the induction and
hyperphosphorylation of p107 on days 1 and 3 in both pRB-positive and
pRB-negative cells. The transient down-regulation of p130 after
stimulation with adipogenic inducers in both
RB+/+ and RB
/
MEFs
indicate that the level of p130 is low during clonal expansion, followed by an up-regulation after the clonal expansion phase. Similar
results have been reported for differentiating 3T3-L1 cells (24,
28).
 |
DISCUSSION |
In this report we show that a high affinity PPAR
ligand
effectively bypasses the block in adipocyte differentiation imposed by
pRB-deficiency. To show this we used fibroblasts from normal and
RB
/
mouse embryos. A significant fraction of
the RB+/+ cells differentiated in response to a
standard differentiation protocol as determined by lipid accumulation
and expression of adipocyte markers, whereas only few
RB
/
cells differentiated when subjected to
the same treatment. This is in agreement with previous work showing the
importance of pRB in adipose conversion (25, 26). Addition of the high
affinity PPAR
ligand BRL49653 dramatically increased adipose
conversion of RB
/
as well as
RB+/+ MEFs. At the molecular level this was
accompanied by induction of adipocyte markers, including the key
transcription factors C/EBP
and PPAR
2. The ability of BRL49653 to
induce differentiation in pRB-deficient cells was not strictly
dependent on the standard inducers (dexamethasone,
methylisobutylxanthine, and insulin) since exposure to PPAR
ligand
alone induced significant lipid accumulation (data not shown).
C/EBP
along with C/EBP
play crucial roles in adipocyte
differentiation, as revealed by targeted disruptions (16), and are
considered important for induction of PPAR
2 and C/EBP
expression (36, 45). In our experiments, BRL49653 did not significantly affect the
level of C/EBP
protein but was required for induction of both
PPAR
2 and C/EBP
mRNAs in RB
/
MEFs.
Wild-type and pRB-deficient MEFs express PPAR
1, but no PPAR
2, in
the predifferentiated state. Therefore, it is conceivable that the
critical steps regulated by pRB early in the differentiation program
are bypassed by ligand activation of PPAR
1. The
differentiation-promoting effect of ligand-induced PPAR
activation
in the pRB-deficient fibroblasts is in agreement with our observation
that PPAR
transactivation is independent of pRB in C33A cells.
pRB was shown to stimulate binding of C/EBP
to DNA without being
present in the C/EBP-DNA complex (26, 27). This indicates that pRB acts
as a chaperone to enhance specific DNA binding of C/EBPs. Furthermore,
pRB was shown to potentiate C/EBP
-mediated transactivation of a
reporter construct containing multimerized C/EBP binding elements in
the promoter (26, 27). Thus, it could be hypothesized that the lack of
adipocyte differentiation of RB
/
MEFs was
related to a severely reduced level of C/EBP
-dependent transactivation. We found that C/EBP
-mediated transactivation of the
proximal PPAR
2 promoter was rather insensitive to the level of pRB
expression. This indicates that the inability of pRB-deficient MEFs to
undergo adipose conversion in response to a treatment that is
sufficient to induce adipocyte differentiation of normal embryo
fibroblasts may reflect impairment of additional processes involving
pRB. Glucocorticoids play decisive roles during differentiation of most
preadipocyte cell lines (15, 43), but surprisingly little is known
about the molecular functions of GR in adipocyte differentiation. pRB
has been shown to potentiate transactivation mediated by GR (42, 46,
47), suggesting that impaired GR function in the pRB-deficient cells
may contribute to the refractoriness of these cells to undergo
adipocyte conversion. Finally, our finding that addition of a high
affinity PPAR
ligand is required to induce adipose conversion of
RB
/
MEFs leaves open the possibility that
pRB participates in a pathway leading to the production of an
endogenous ligand for PPAR
. Such a pathway may involve ADD1/SREBP1,
which was recently shown to play an important role in the production of
an unidentified PPAR
ligand (23). Both RB+/+
and RB
/
MEFs express ADD1/SREBP1 mRNA
(data not shown), but whether pRB modulates the activity of ADD1/SREBP1
is not known.
To examine whether BRL49653-induced differentiation of
RB
/
MEFs was accompanied by a compensatory
regulation of p107 and p130, we compared the expression of these genes
during differentiation of both RB+/+ and
RB
/
cells. We found little or no difference
in the expression pattern of p107 and p130 between normal and
RB
/
MEFs. In the later stages of the
differentiation program, we found that the level of p107 was lower in
cells treated with BRL49653 compared with control cells. This indicates
that down-regulation of p107 is related to the degree of adipose
conversion, even in RB
/
MEFs. This is in
contrast to the observed up-regulation of p107 during myocyte
differentiation of RB
/
cells, an
up-regulation not seen in RB+/+ cells (6, 7).
However, even though p107 is down-regulated in the terminal stages of
adipose conversion, it is transiently up-regulated during clonal
expansion (Ref. 28 and this study). Furthermore, p130 is up-regulated
during the late stages of adipocyte differentiation (Ref. 28 and this
study). This raises the question as to whether p107 and p130 are
important regulators of adipose conversion. Recent evidence from other
differentiation systems suggests that members of the pRB family differ
in their ability to regulate differentiation. Using the myocyte
differentiation system, cells from wild-type,
RB
/
, p107
/
, and
p130
/
mouse embryos were compared (7). Only
RB
/
cells had defects in expression of late
differentiation markers and terminal cell cycle withdrawal.
Furthermore, pRB was significantly more potent in activating
MyoD-mediated transactivation than p107 and p130 (7). A similar
increased activity of pRB compared with p107 and p130 was observed in
flat cell formation of Saos-2 cells, a phenotype indicative of
osteoblast differentiation (46). The in vivo importance of
the three pRB family members has been addressed by gene targeting in
mice. Whereas RB
/
embryos die in
utero with defects in neurogenesis and erythropoiesis (3),
p107
/
and p130
/
mice are viable, fertile, and show no apparent abnormalities (48, 49).
These observations show that pRB is unique among the pRB family members
in the regulation of differentiation of many lineages. Whether pRB is
the key pocket protein positively regulating adipogenesis remains to be
established, but evidence obtained so far indicates that this may very
well be the case.
Terminal withdrawal from the cell cycle is an essential step in
differentiation of many cell lineages. Little is known about the
regulation of cell cycle withdrawal in adipocyte differentiation. Recent evidence suggests that hypophosphorylation of pRB is important for the commitment of cells to undergo adipose conversion (24, 50).
Both of the major regulators of adipocyte differentiation, C/EBP
and
PPAR
, have been shown to inhibit cell proliferation (51, 52).
Inhibition of proliferation by C/EBP
does not require the presence
of pRB but is dependent on a functional activation domain (44).
C/EBP
inhibits proliferation via transcriptional stimulation and
posttranslational stabilization of the p21 cyclin-dependent kinase inhibitor (53, 54). Activation of PPAR
has been shown to
inhibit proliferation by down-regulation of the PP2A phosphatase, which
in turn is accompanied by a decrease in E2F activity (52). The
inhibition of cell proliferation by PPAR
was also observed in cells
expressing the simian virus 40 large T antigen, indicating that
PPAR
-mediated growth arrest does not require a functional pRB (52).
In adipocyte differentiation, both C/EBP
and PPAR
are present at
the time when clonal expansion ceases, and therefore, they are both
possible effectors of the cell cycle withdrawal. Evidently, the
PPAR
/C/EBP
initiated cell cycle withdrawal and adipocyte
differentiation of MEFs may proceed in the absence of a functional
pRB-dependent pathway, a notion in keeping with the finding
that a certain cell cycle control prevails in pRB deficient cells (29,
55). How PPAR
and C/EBP
function in such regulatory circuits
remains to be established.
 |
ACKNOWLEDGEMENTS |
We thank Drs. Ronald M. Evans, Bruce M. Spiegelman, M. Daniel Lane, Jeffrey M. Gimble, Steven L. McKnight,
Christian Muchardt, Kristian Helin, and Sibylle Mittnacht for kind
gifts of plasmids, and Drs. David A. Bernlohr, Mitchell A. Lazar, and
M. Daniel Lane for kind gifts of antibodies. We thank Drs. Jiri Lukas
and Jiri Bartek for helpful discussions. We thank Drs. Susanne Mandrup, Ez-Zoubir Amri, and Jiri Bartek for comments on the manuscript. We
acknowledge technical assistance by Bente Kierkegaard, Inger-Marie Thuesen, and Helle Kamstrup Kjaer.
 |
FOOTNOTES |
*
This work was supported by the Danish Biotechnology Program,
the Danish Natural Science Research Council, the Danish Cancer Society,
and the NOVO Foundation.The costs of publication of this article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of Molecular
Biology, Odense University, Campusvej 55, DK-5230 Odense M, Denmark.
Tel.: 45-65572408; Fax: 45-65932781; E-mail:
kak{at}molbiol.ou.dk.
The abbreviations used are:
pRB, retinoblastoma
protein; ADD1/SREBP1, adipocyte determination and
differentiation-dependent factor-1; ALBP, adipocyte
lipid-binding protein; bp, base pair(s); BrdUrd, bromodeoxyuridine; C/EBP, CCAAT/enhancer-binding protein; DMEM, Dulbecco's modified
Eagle's medium; FBS, fetal bovine serum; GAPDH, glyceraldehyde
3-phosphate dehydrogenase; GPDH, glycerol 3-phosphate dehydrogenase; GR, glucocorticoid receptor; MEF, mouse embryo fibroblast; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; PPAR, peroxisome proliferator-activated receptor; PPRE, peroxisome
proliferator-activated receptor response element; RT-PCR, reverse
transcription-polymerase chain reaction; TBP, TATA-binding protein; TBS, Tris-buffered saline; TR, thyroid hormone receptor.
2
J. B. Hansen, J. Alsner, and K. Kristiansen, unpublished results.
 |
REFERENCES |
-
Helin, K.
(1998)
Curr. Opin. Genet. Dev.
8,
28-35[CrossRef][Medline]
[Order article via Infotrieve]
-
Bartek, J.,
Bartkova, J.,
and Lukas, J.
(1996)
Curr. Opin. Cell Biol.
8,
805-814[CrossRef][Medline]
[Order article via Infotrieve]
-
Riley, D. J.,
Lee, E. Y.-H. P.,
and Lee, W.-H.
(1994)
Annu. Rev. Cell Biol.
10,
1-29[CrossRef]
-
Walsh, K.,
and Perlman, H.
(1997)
Curr. Opin. Genet. Dev.
7,
597-602[CrossRef][Medline]
[Order article via Infotrieve]
-
Gu, W.,
Schneider, J. W.,
Condorelli, G.,
Kaushal, S.,
Mahdavi, V.,
and Nadal-Ginard, B.
(1993)
Cell
72,
309-324[CrossRef][Medline]
[Order article via Infotrieve]
-
Schneider, J. W.,
Gu, W.,
Zhu, L.,
Mahdavi, V.,
and Nadal-Ginard, B.
(1994)
Science
264,
1467-1471[Abstract/Free Full Text]
-
Novitch, B. G.,
Mulligan, G. J.,
Jacks, T.,
and Lassar, A. B.
(1996)
J. Cell Biol.
135,
441-456[Abstract/Free Full Text]
-
Wang, J.,
Guo, K.,
Wills, K. N.,
and Walsh, K.
(1997)
Cancer Res.
57,
351-354[Abstract/Free Full Text]
-
Zacksenhaus, E.,
Jiang, Z.,
Chung, D.,
Marth, J. D.,
Phillips, R. A.,
and Gallie, B. L.
(1996)
Genes Dev.
10,
3051-3064[Abstract/Free Full Text]
-
Brun, R. P.,
Kim, J. B.,
Hu, E.,
Altiok, S.,
and Spiegelman, B. M.
(1996)
Curr. Opin. Cell Biol.
8,
826-832[CrossRef][Medline]
[Order article via Infotrieve]
-
Mandrup, S.,
and Lane, M. D.
(1997)
J. Biol. Chem.
272,
5367-5370[Free Full Text]
-
Fajas, L.,
Fruchart, J.-C.,
and Auwerx, J.
(1998)
Curr. Opin. Cell Biol.
10,
165-173[CrossRef][Medline]
[Order article via Infotrieve]
-
Wu, Z.,
Xie, Y.,
Bucher, N. L. R.,
and Farmer, S. R.
(1995)
Genes Dev.
9,
2350-2363[Abstract/Free Full Text]
-
Wu, Z.,
Bucher, N. L. R.,
and Farmer, S. R.
(1996)
Mol. Cell. Biol.
16,
4128-4136[Abstract]
-
Yeh, W.-C.,
Cao, Z.,
Classon, M.,
and McKnight, S. L.
(1995)
Genes Dev.
9,
168-181[Abstract/Free Full Text]
-
Tanaka, T.,
Yoshida, N.,
Kishimoto, T.,
and Akira, S.
(1997)
EMBO J.
16,
7432-7443[CrossRef][Medline]
[Order article via Infotrieve]
-
Lehmann, J. M.,
Moore, L. B.,
Smith-Oliver, T. A.,
Wilkison, W. O.,
Willson, T. M.,
and Kliewer, S. A.
(1995)
J. Biol. Chem.
270,
12953-12956[Abstract/Free Full Text]
-
Forman, B. M.,
Tontonoz, P.,
Chen, J.,
Brun, R. P.,
Spiegelman, B. M.,
and Evans, R. M.
(1995)
Cell
83,
803-812[CrossRef][Medline]
[Order article via Infotrieve]
-
Kliewer, S. A.,
Lenhard, J. M.,
Willson, T. M.,
Patel, I.,
Morris, D. C.,
and Lehmann, J. M.
(1995)
Cell
83,
813-819[CrossRef][Medline]
[Order article via Infotrieve]
-
Chawla, A.,
Schwarz, E. J.,
Dimaculangan, D. D.,
and Lazar, M. A.
(1994)
Endocrinology
135,
798-800[Abstract]
-
Tontonoz, P.,
Hu, E.,
and Spiegelman, B. M.
(1994)
Cell
79,
1147-1156[CrossRef][Medline]
[Order article via Infotrieve]
-
Kim, J. B.,
and Spiegelman, B. M.
(1996)
Genes Dev.
10,
1096-1107[Abstract/Free Full Text]
-
Kim, J. B.,
Wright, H. M.,
Wright, M.,
and Spiegelman, B. M.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
4333-4337[Abstract/Free Full Text]
-
Shao, D.,
and Lazar, M. A.
(1997)
J. Biol. Chem.
272,
21473-21478[Abstract/Free Full Text]
-
Higgins, C.,
Chatterjee, S.,
and Cherington, V.
(1996)
J. Virol.
70,
745-752[Abstract]
-
Chen, P.-L.,
Riley, D. J.,
Chen, Y.,
and Lee, W.-H.
(1996)
Genes Dev.
10,
2794-2804[Abstract/Free Full Text]
-
Chen, P.-L.,
Riley, D. J.,
Chen-Kiang, S.,
and Lee, W.-H.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
465-469[Abstract/Free Full Text]
-
Richon, V. M.,
Lyle, R. E.,
and McGehee, R. E.
(1997)
J. Biol. Chem.
272,
10117-10124[Abstract/Free Full Text]
-
Lukas, J.,
Bartkova, J.,
Rohde, M.,
Strauss, M.,
and Bartek, J.
(1995)
Mol. Cell. Biol.
15,
2600-2611[Abstract]
-
Liao, K.,
and Lane, M. D.
(1995)
J. Biol. Chem.
270,
12123-12132[Abstract/Free Full Text]
-
Kliewer, S. A.,
Umesono, K.,
Noonan, D. J.,
Heyman, R. A.,
and Evans, R. M.
(1992)
Nature
358,
771-774[CrossRef][Medline]
[Order article via Infotrieve]
-
Tontonoz, P.,
Hu, E.,
Graves, R. A.,
Budavari, A. I.,
and Spiegelman, B. M.
(1994)
Genes Dev.
8,
1224-1234[Abstract/Free Full Text]
-
Qin, X.-Q.,
Chittenden, T.,
Livingston, D.,
and Kaelin, W. G.
(1992)
Genes Dev.
6,
953-964[Abstract/Free Full Text]
-
Lukas, J.,
Herzinger, T.,
Hansen, K.,
Moroni, M. C.,
Resnitzky, D.,
Helin, K.,
Reed, S. I.,
and Bartek, J.
(1997)
Genes Dev.
11,
1479-1492[Abstract/Free Full Text]
-
Muchardt, C.,
and Yaniv, M.
(1993)
EMBO J.
12,
4279-4290[Medline]
[Order article via Infotrieve]
-
Clarke, S. L.,
Robinson, C. E.,
and Gimble, J. M.
(1997)
Biochem. Biophys. Res. Commun.
240,
99-103[CrossRef][Medline]
[Order article via Infotrieve]
-
Cao, Z.,
Umek, R. M.,
and McKnight, S. L.
(1991)
Genes Dev.
5,
1538-1552[Abstract/Free Full Text]
-
Gao, X.,
and Huang, L.
(1991)
Biochem. Biophys. Res. Commun.
179,
280-285[CrossRef][Medline]
[Order article via Infotrieve]
-
Chomczynski, P.,
and Sacchi, N.
(1987)
Anal. Biochem.
162,
156-159[Medline]
[Order article via Infotrieve]
-
Jensen, J.,
Serup, P.,
Karlsen, C.,
Nielsen, T. F.,
and Madsen, O. D.
(1996)
J. Biol. Chem.
271,
18749-18758[Abstract/Free Full Text]
-
Chang, K.-H.,
Chen, Y.,
Chen, T.-T.,
Chou, W.-H.,
Chen, P.-L.,
Ma, Y.-Y.,
Yang-Feng, T. L.,
Leng, X.,
Tsai, M.-J.,
O'Malley, B. W.,
and Lee, W.-H.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
9040-9045[Abstract/Free Full Text]
-
Singh, P.,
Coe, J.,
and Hong, W.
(1995)
Nature
374,
562-565[CrossRef][Medline]