![]()
|
|
||||||||
J Biol Chem, Vol. 274, Issue 4, 2416-2423, January 22, 1999
From the Centre for Thrombosis and Vascular Research, Protein disulfide isomerase (PDI) facilitates
proper folding and disulfide bonding of nascent proteins in the
endoplasmic reticulum and is secreted by cells and associates with the
cell surface. We examined the consequence of over- or underexpression of PDI in HT1080 fibrosarcoma cells for the redox state of cell-surface protein thiols/disulfides. Overexpression of PDI resulted in
3.6-4.2-fold enhanced secretion of PDI and 1.5-1.7-fold increase in
surface-bound PDI. Antisense-mediated underexpression of PDI caused
38-53% decreased secretion and 10-33% decrease in surface-bound
PDI. Using 5,5'-dithio-bis(2-nitrobenzoic acid) to measure surface
protein thiols, a 41-50% increase in surface thiols was observed in
PDI-overexpressing cells, whereas a 29-33% decrease was observed in
underexpressing cells. Surface thiol content was strongly correlated
with cellular (r = 0.998) and secreted
(r = 0.969) PDI levels. The pattern of exofacial protein thiols was examined by labeling with the membrane-impermeable thiol reactive compound, 3-(N-maleimidylpropionyl)biocytin.
Fourteen identifiable proteins on HT1080 cells were labeled with
3-(N-maleimidylpropionyl)biocytin. The intensity of
labeling of 11 proteins was increased with overexpression of PDI,
whereas the intensity of labeling of 3 of the 11 proteins was clearly
decreased with underexpression of PDI. These findings indicated that
secreted PDI was controlling the redox state of existing exofacial
protein thiols or reactive disulfide bonds.
Protein disulfide isomerase
(PDI)1 catalyzes
thiol-disulfide interchanges that can result in formation, reduction,
or rearrangement of protein disulfide bonds. It is generally considered
that PDI is important for proper folding and disulfide bonding of
nascent proteins in the endoplasmic reticulum (1-4). PDI also
functions as the PDI contains a C-terminal KDEL anchor (9) that mediates interaction of
PDI with the KDEL receptor on membranes of the Golgi and the
intermediate compartment. The PDI·KDEL receptor complex is recycled
back to the endoplasmic reticulum (10). Despite this retrieval
mechanism, PDI is exported from cells and binds to the cell surface.
Secreted PDI retains the KDEL anchor (11, 12). Cultured rat hepatocytes
(12) and pancreatic cells (13) secrete PDI that associates with the
cell surface, and murine fibroblasts secrete PDI in response to
treatment with calcium ionophore (14). PDI is also on the surface of B
cells (15, 16) and platelets (17, 18).
Cell-surface PDI has been implicated in reduction of the
disulfide-linked diphtheria toxin heterodimer (19, 20), cell-surface events which trigger entry of the human immunodeficiency virus into
lymphoid cells (21), and shedding of the human thyrotropin receptor
ectodomain (22). PDI has also been implicated as a cell-surface
recognition/adhesion molecule during neuronal differentiation of the
retina (23) and in redox control of exofacial protein thiols/disulfides
of lymphocytes (16, 24).
In this study we examined the consequence of over- or underexpression
of PDI for the redox state of cell-surface protein thiols/disulfides. Human fibrosarcoma cells (HT1080) were stably transfected with a PDI
expression vector or with a PDI antisense construct. Overexpression of
PDI resulted in enhanced secretion of PDI but not two other KDEL-containing proteins and enhanced cell-surface association of PDI.
Similarly, antisense-mediated underexpression of PDI caused decreased
secretion and cell-surface localization of PDI. By using two different
membrane-impermeable thiol-specific reagents, we showed that increased
or decreased secretion of PDI correlated with increased or decreased
protein thiols on the cell surface. At least 14 proteins on the surface
of control and PDI-transfected cells contained redox-active
thiols/disulfides that were regulated by the level of secreted PDI.
These results demonstrated that secreted PDI was controlling the redox
state of certain cell-surface protein thiols/disulfides.
HT1080 Cell Culture--
HT1080 cells from ATCC (Rockville, MD)
were maintained in DMEM containing 10% fetal bovine serum (FBS), 2 mM glutamine, 10 units/ml penicillin G, and 10 µg/ml
streptomycin sulfate. All media components were from Life Technologies, Inc.
Generation of HT1080 Cells Overexpressing or Underexpressing
PDI--
A 1.7-kilobase pair PDI cDNA was isolated by reverse
transcriptase-polymerase chain reaction from total RNA extracted from primary human foreskin fibroblasts and cloned into the vector, pGEM-T
(Promega, Madison, WI). The PDI primers were
ATTGATGGATCCATGCTGCGCCGCGCTCTGCT (PDI sequence position 76-96) and
TTCAGGAAACAAGCCACCAG (position 1823-1803) (Bresatec, Adelaide,
Australia). The PDI cDNA contained the open reading frame of PDI
from nucleotides 76 to 1599 that codes for 508 amino acids, including
the 17 amino acid signal peptide. Moloney murine leukemia virus Reverse
transcriptase, DNA polymerase Expand High Fidelity, and reagents for
reverse transcriptase-polymerase chain reaction were from Boehringer
Mannheim, Australia. Integrity of the cDNA was confirmed by
automatic sequencing (ABI-377 Automatic Sequencer, Applied Biosystems)
and was the same as the reported sequence (25).
The PDI cDNA was derived as a BamHI fragment and
inserted into the mammalian expression vector pcDNA3 in either the
sense or antisense direction (Invitrogen, San Diego, CA). HT1080 cells were transfected with either 5 µg of unmanipulated vector or vector containing the sense or antisense PDI cDNA using calcium phosphate (Life Technologies, Inc.). Stably transfected control and over- or
underexpressing cells were selected by incubation with medium containing 400 µg/ml G418 that was reduced to 200 µg/ml after the
first passage. Stably transfected cells were cloned using cloning
plates (Greiner Labortechnik, Frickenhausen, Germany).
Detection of PDI mRNA--
Northern analyses of PDI mRNA
were performed as follows. Control, PDI overexpressing (HT1080s) or
underexpressing (HT1080as) cells were grown to confluency, washed, and
incubated in DMEM without FBS for 6 h. Cells (5 × 106) were lysed in TRIZOL buffer (Life Technologies, Inc.)
and total RNA extracted as described by the manufacturer. Total RNA (20 µg) was blotted onto nylon Hybond transfer membrane (Amersham Australia, Sydney, Australia) and probed with a riboprobe complementary to PDI mRNA. The riboprobe was transcribed from the pcDNA3-PDI vector using SP6 polymerase. The riboprobes were visualized using digoxigenin detection (Boehringer Mannheim, Sydney, Australia).
Measurement of Total Cellular and Secreted Glutathione and
Cellular Protein-bound Glutathione and Protein Thiol
Levels--
Reduced glutathione (GSH) and oxidized glutathione (GSSG)
levels were determined as described by Vandeputte et al.
(26). For secreted GSH levels, HT1080 cells at 80% confluence were
washed twice with PBS and incubated in DMEM without FBS for 6 h
(0.7 × 106 cells per ml of medium). Conditioned media
were centrifuged at 3000 × g for 10 min to remove cell
debris. For cellular GSH levels, HT1080 cells (1.5 × 106) were detached from culture flasks using 5 mM EDTA in PBS, washed twice with PBS, resuspended in 0.3 ml of PBS, and snap-frozen in liquid nitrogen. Cellular protein was
precipitated with 5-sulfosalicylic acid according to Vandeputte
et al. (26), and the GSH and GSSG content of the supernatant
was determined. To determine protein-bound GSH, the pellets from the
acid precipitation were resuspended in 1% sodium borohydride,
incubated for 10 min at 4 °C, and centrifuged at 10,000 × g for 1 h at 25 °C. The resulting supernatant was neutralized with 100 mM potassium phosphate, pH 7.4 buffer,
and the GSH content determined. Total thiol content of HT1080 cell lysates was determined using 5,5'-dithio-bis(2-nitrobenzoic acid) (DTNB, Sigma) (27) after denaturing the proteins with 5% SDS. Cellular
protein thiol content was calculated by subtracting the cellular GSH
content from the total thiol content.
ELISA for PDI--
Affinity purified anti-PDI polyclonal
antibodies (100 µl of 5 µg/ml in 15 mM
Na2CO3, 35 mM NaHCO3,
0.02% azide, pH 9.6 buffer) were adsorbed to Nunc PolySorp 96-well
plates overnight at 4 °C in a humid environment. Wells were washed
once with phosphate-buffered saline (PBS) containing 0.05% Tween 20 (PBS/Tween), nonspecific binding sites blocked by adding 200 µl of
2% bovine serum albumin in PBS and incubating for 90 min at 37 °C,
and then washed two times with PBS/Tween. HT1080 cells (5 × 106) were detached from culture flasks using 5 mM EDTA in PBS, washed twice with PBS, resuspended in 1 ml
of ice-cold 50 mM Tris/HCl, pH 8, buffer containing 0.5 M NaCl, 1% Triton X-100, 10 µM leupeptin, 2 mM phenylmethylsulfonyl fluoride (Sigma), 5 mM
EDTA, and 10 µM aprotinin (Bayer Australia Ltd., Sydney,
Australia), and sonicated on ice. Purified placenta PDI and HT1080 cell
lysates were diluted in PBS/Tween and 100-µl aliquots added to
antibody-coated wells and incubated for 30 min at room temperature with
orbital shaking. Wells were washed three times with PBS/Tween and 100 µl of 5 µg/ml of the murine anti-PDI monoclonal antibody, M10,
added and incubated for 30 min at room temperature with orbital
shaking. The M10 antibody was a gift from Prof. Johan Stenflo, Lund
University, Sweden. Wells were washed three times with PBS/Tween, and
rabbit anti-mouse IgG horseradish peroxidase-conjugated antibody was
added at 1 in 500 dilution in 100 µl of PBS/Tween and incubated for
30 min at room temperature with orbital shaking. Wells were washed
three times with PBS/Tween and the color developed with 100 µl of
0.003% H2O2, 1 mg/ml
2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) in 50 mM citrate, pH 4.5 buffer, for 20 min at room temperature with orbital shaking. Absorbances were read at 405 nm using a Molecular
Devices Thermomax Kinetic Microplate Reader (Molecular Devices).
Results were corrected for control wells not coated with polyclonal
antibody. The ELISA is linear up to a PDI concentration of 200 ng/ml.
Detection of Total and Reduced Cell-surface PDI
Protein--
HT1080 cell-surface PDI was estimated by labeling with
either sulfosuccinimidobiotin (SSB) (Pierce) (28), or
3-(N-maleimidylpropionyl)biocytin (MPB) (Molecular Probes)
(28). Both SSB and MPB are membrane-impermeable. SSB labeled the
primary amines in PDI, and MPB labeled the reactive site sulfhydryls.
HT1080 control, HT1080s, or HT1080as cells (5 × 106)
were detached from culture flasks using 5 mM EDTA in PBS,
washed twice, resuspended in 1 ml of PBS containing 100 µM of either SSB or MPB, and incubated for 30 min at room
temperature. Unreacted SSB was quenched with 200 µM
glycine (Sigma) for 10 min at room temperature. Unreacted MPB was
quenched with 200 µM GSH (Sigma) for 10 min at room
temperature, and remaining sulfhydryl groups were quenched with 400 µM iodoacetamide (Sigma) for 10 min at room temperature.
The cells were washed three times with 1 ml of PBS, sonicated in lysis
buffer as described above, and incubated with 100 µl of a 50% slurry
of streptavidin-agarose (Sigma) for 60 min at 4 °C with rotary
mixing. Bound proteins were washed five times with 50 mM
Tris/HCl, pH 8, buffer containing 0.15 M NaCl and 0.05%
Triton X-100, resolved on 10% SDS-PAGE, transferred to PVDF membrane,
and the SSB- or MPB-labeled PDI detected by Western blot.
Detection of Secreted PDI Protein--
Secretion of PDI by
HT1080 control, HT1080s, or HT1080as cells was assessed by washing 80%
confluent cultures twice and incubating in DMEM without FBS for 6 h. Conditioned media were centrifuged at 3000 × g for
10 min to remove cell debris, and media from 3 × 104
cells were resolved on 10% SDS-PAGE, transferred to PVDF membrane, and
detected by Western blot.
Quantitation of HT1080 Cell-surface Protein Thiols--
Protein
thiols on control HT1080, HT1080s, or HT1080as cells were quantitated
using either DTNB (27) or MPB (see above). Cells at 80-90% confluence
were detached from culture flasks using 5 mM EDTA in
phosphate-buffered saline (PBS) and washed twice with PBS. For DTNB
labeling, 1.5 × 106 cells were resuspended in 1 ml of
PBS, DTNB added to a final concentration of 200 µM, and
the mixture incubated for 30 min at room temperature with gentle
rolling. Cells were pelleted at 300 × g for 5 min, and
2-nitro-5-thiobenzoic acid content of the supernatant was measured from
absorbance at 412 nM using an extinction coefficient of
14,150 M Electrophoresis and Blotting--
Samples were resolved on
either 10 or 5-15% SDS-PAGE under non-reducing conditions (32) and
transferred to PVDF membrane. Proteins were detected by Western blot
using affinity purified anti-human PDI rabbit polyclonal antibodies
(used at 3 µg/ml), a anti-human Grp78/Grp94 murine monoclonal
antibody (used at 5 µg/ml) from Stressgen, British Columbia, Canada,
or a anti-human thioredoxin murine monoclonal antibody (used at 5 µg/ml) from Dr. Frank Clarke, Griffith's University, Brisbane,
Australia. Swine anti-rabbit horseradish peroxidase-conjugated
antibodies and rabbit anti-mouse horseradish peroxidase-conjugated
antibodies (Dako Corporation, Carpinteria, CA) were used at 1:2000 and
1:1000 dilution, respectively. MPB-labeled proteins were blotted with streptavidin peroxidase (Amersham, Sydney, Australia) used at 1:500
dilution. Proteins were visualized using chemiluminescence (NEN Life
Science Products) according to the manufacturer's instructions. Chemiluminescence films were analyzed by densitometry (GS300
Transmittance/Reflectance Densitometer, Hoefer Scientific Instruments,
San Francisco, CA).
Characterization of PDI Messenger Levels and Protein in Control
Versus PDI Sense and Antisense Transfected Cells--
HT1080 cells
were transfected with either the unmanipulated pCDNA3 mammalian
expression vector (HT1080) or the vector containing PDI cDNA
inserted in either the sense (HT1080s) or antisense (HT1080as) direction. Stable transfectants were selected with G418 and cloned. One
control and two sense and two antisense clones were selected for
investigation. These clones have been called HT1080 control, HT1080s 1 and 2 and HT1080as 1 and 2, respectively. PDI mRNA in the control,
sense, and antisense clones is shown in Fig.
1A. HT1080s1 and HT1080s2
clones contained 2.9- and 3.0-fold more PDI mRNA than control
cells, respectively, whereas PDI mRNA in HT1080as1 and HT1080as2
clones was 42 and 40% that in control cells, respectively.
PDI protein in cell lysates of HT1080 control, HT1080s, or HT1080as
clones is shown in Figs. 1B. Consistent with the mRNA levels, HT1080s1 and HT1080s2 clones contained 1.9- and 2.1-fold more
PDI protein per mg of cell protein than control cells, respectively, whereas PDI protein in HT1080as1 and HT1080as2 clones was 53 and 37%
that in control cells, respectively.
There was no difference in the amount of urokinase plasminogen
activator receptor or Comparison of Cell Growth and Morphology in Control Versus PDI
Sense and Antisense Transfected Cells--
Control and PDI sense and
antisense transfected cells were plated at 3000 cells per well in
6-well plates, and cell number was determined each day for 4 days (Fig.
2A). The rate of proliferation of sense and antisense clones was marginally slower than control, although not statistically significant. The rate of proliferation of
control, HT1080s2, and HT1080as2 clones is shown in Fig. 2A. The rate of proliferation of the sense and antisense clone 1 cells was
indistinguishable from the clone 2 cells (not shown). Phase contrast
micrographs of control and HT1080s2 and HT1080as2 cells at high density
is shown in Fig. 2B. The control and sense cells had
indistinguishable morphology. In contrast, the antisense clones tended
to bunch in cell islands and never reached 100% confluency. The
morphology of the sense and antisense clone 1 cells was
indistinguishable from the clone 2 cells (not shown).
Characterization of the Total Cellular and Secreted GSH and
Cellular Protein-bound GSH and Protein Thiol Levels in Control Versus
PDI Sense and Antisense Transfected Cells--
The intracellular GSH
and protein-bound GSH content of control and PDI sense and antisense
transfected cells was very similar (Fig.
3). The intracellular GSSG content was
less than 1% of the GSH content and was also similar in all cells (not
shown). In contrast, the sense and antisense transfected cells secreted
an average 1.9- and 4.1-fold more GSH, respectively, than control cells. The total protein thiol content of sense transfected cells was
slightly higher than control cells, whereas it was slightly lower than
control in antisense transfected cells.
Characterization of PDI Secretion Levels in Control Versus PDI
Sense and Antisense Transfected Cells--
PDI was secreted by the
control and transfected cells (Fig.
4A). The extent of PDI
secretion paralleled the PDI protein levels in cell lysates (see Fig.
1B). Purified placenta PDI is shown as control and migrated
with the expected Mr of ~57. HT1080s1 and
HT1080s2 clones secreted 3.6- and 4.2-fold more PDI than control cells,
respectively, whereas PDI secretion in HT1080as1 and HT1080as2 clones
was 62 and 47% that in control cells, respectively.
It has been suggested that PDI secretion by cells may be a consequence
of saturation of the KDEL retrieval receptor in the Golgi and
intermediate compartments (11, 12). If this was the case then other
C-terminal KDEL-tagged proteins would also be expected to be secreted
by cultured cells. To test this possibility, the presence of two other
KDEL-tagged proteins, Grp78 (Bip) and Grp94, in the supernatant of
control and the PDI-overexpressing clone was examined (Fig.
4B). Grp78 and Grp94 were not secreted by control HT1080 or
HT1080s2 cells within the limits of detection, which implied that PDI
secretion was a specific event and not simply "spillage" of PDI
from the Golgi and intermediate compartments. Comparison of secreted
PDI relative to cellular PDI content with the cellular content of
Grp78/Grp94 (from Figs. 1B and 4, A and B) indicated that if Grp78/Grp94 were secreted then the
level of secretion was <5% of the level of PDI secretion. Dorner
et al. (33) have similarly reported that PDI secretion was
not associated with secretion of other KDEL-containing proteins.
Thioredoxin is a 12-kDa redox active protein that can be secreted by
cultured cells (34). Interestingly, PDI sense transfected cells
contained ~40% less thioredoxin than control of antisense transfected cells (Fig. 4C). The reason for this is unknown
but may reflect coordinated expression of PDI and thioredoxin. For instance, overexpression of thioredoxin reduced expression of glutaredoxin in Escherichia coli and vice versa (35).
Thioredoxin was not secreted by control or transfected HT1080 cells
within the limits of detection of the Western blot (not shown).
Comparison of secreted PDI relative to cellular PDI content with the
cellular content of thioredoxin (from Figs. 1B and 4,
A and C) indicated that if thioredoxin was
secreted then the level of secretion was <10% of the level of PDI secretion.
Characterization of Cell-surface PDI Levels in Control Versus PDI
Sense and Antisense Transfected Cells--
PDI associates with the
cell surface after secretion (12, 13). To examine cell-surface
associated PDI, HT1080 control and sense and antisense cells were
labeled with either the membrane-impermeable amine-reactive reagent,
SSB, or the membrane-impermeable thiol-reactive reagent, MPB. PDI
contains two active site sulfhydryl groups in the common sequence
WCGPCK which have a redox potential of
HT1080 cell-surface SSB- or MPB-labeled proteins were collected on
streptavidin-agarose, separated on 12% SDS-PAGE, transferred to PVDF
membrane, and blotted with PDI polyclonal antibodies (SSB, Fig.
5A; MPB, Fig. 5B).
The results represent labeling of 5 × 105 HT1080
cells. SSB- or MPB-labeled placenta PDI is shown as control and
migrated with the expected mass of ~57 kDa. The amount of SSB- or
MPB-labeled cell-surface PDI paralleled the PDI protein levels in cell
lysates (see Fig. 1B) and secreted PDI protein (see Fig.
4A). HT1080s1 and HT1080s2 clones contained 1.5- and 1.7-fold more total PDI on their surface than control cells,
respectively, whereas total PDI levels on HT1080as1 and HT1080as2
clones were 90 and 67% that on control cells, respectively (Fig.
5A). A similar ratio was observed for reduced surface PDI
levels (Fig. 5B), although the absolute levels of reduced
PDI were approximately one-third of the total PDI levels. This result
implied that surface PDI was a mixture of reduced and oxidized forms,
although the level of reduced PDI may have be underestimated if the
efficiency of labeling by MPB was not optimal.
By having demonstrated that over- or underexpression of PDI in HT1080
cells correlated with increase or decrease, respectively, in secretion
and cell-surface levels of PDI, we were in the position to test whether
PDI controlled the redox state of cell-surface protein
thiols/disulfides. We used two different thiol-reactive reagents to
examine this question, DTNB and MPB. Both of these reagents are
membrane-impermeable and thiol-specific at neutral pH and have been
used previously to assess cell-surface thiol status (27, 29).
Quantitation of Cell-surface Protein Thiol Levels in Control Versus
PDI Sense and Antisense Transfected Cells--
HT1080 control and
HT1080s and HT1080as cells were reacted with DTNB, and the
2-nitro-5-thiobenzoic acid generated was quantitated from the
absorbance of the supernatant at 412 nm (Fig.
6). The concentration of protein thiols
are expressed per million cells. HT1080s1 and HT1080s2 cells contained
41 and 50% more surface protein thiols than control cells,
respectively, whereas protein thiols on HT1080as1 and HT1080as2 cells
were 71 and 67% that on control cells, respectively. Surface protein
thiol content was strongly correlated with total cellular
(r = 0.998, Fig.
7A) or surface
(r = 0.969, Fig. 7B) PDI.
The quantity of PDI on the sense cells was approximately 0.6 µg per
106 cells (see Fig. 5A). Assuming a maximum of 4 thiols per PDI molecule (two active site dithiols), the PDI on the
sense cells would account for no more than 0.1 nmol of the thiols
labeled by DTNB. In contrast, PDI sense cells contained up to 8 nmol
more thiol groups than control cells. Therefore, the contribution of
PDI to the total surface protein thiol content was = 1.3%. This
finding implied that PDI overexpression had resulted in the appearance
of additional protein thiols on the HT1080 surface.
Characterization of the Influence of Secreted PDI on the Pattern of
Cell-surface Proteins Containing Reactive Thiol Groups--
To examine
the influence of over- or underexpression of PDI on the pattern of
reactive cell-surface protein thiols on HT1080 cells, control, sense,
and antisense transfected cells were labeled with MPB. The MPB-labeled
proteins were resolved on SDS-PAGE, transferred to PVDF membrane,
blotted with streptavidin-peroxidase, and detected using
chemiluminescence. The results represent MPB-labeled cell-surface
proteins in 2.5 µg of cell lysates (approximately 1 × 104 cells). The relative intensity and pattern of
MPB-labeled cell-surface proteins of control, sense, and antisense
cells is shown in Fig. 8A.
The surface of HT1080s1 and HT1080s2 cells incorporated 2.9- and
3.0-fold more MPB than control cells, respectively, whereas MPB label
on the surface of HT1080as1 and HT1080as2 cells was 71 and 49% that on
control cells, respectively. Surface PDI level was strongly correlated
with extent of incorporation of MPB label (r = 0.969)
(Fig. 8B).
Densitometric analysis of the MPB-labeled proteins from HT1080 control
and HT1080s2 and HT1080as2 cells is shown in Fig. 8C. Fourteen identifiable proteins were labeled with MPB. Three proteins (1-3) were only labeled on sense transfected
cells. The intensity of labeling of 11 proteins (4-14) was
increased with overexpression of PDI, whereas the intensity of labeling
of 3 of the 11 proteins (5-7) was clearly decreased with
underexpression of PDI. Therefore, at least 14 proteins on the surface
of control and PDI transfected cells contained redox active
thiols/disulfides that were regulated by the level of secreted PDI.
To confirm that secreted PDI was controlling the redox state of
cell-surface protein thiols/disulfides, HT1080 control and HT1080s2
cells were incubated with either preimmune rabbit IgG or affinity
purified anti-PDI rabbit polyclonal antibodies for 48 h in
serum-free medium prior to labeling with MPB (Fig. 8D). Control HT1080 cells incubated with anti-PDI antibodies incorporated 4.1-fold less MPB label than cells incubated with preimmune IgG. Similarly, HT1080s2 cells incubated with anti-PDI antibodies
incorporated 3.4-fold less MPB label than cells incubated with control IgG.
Increase or decrease in cellular PDI levels equated with increased
or decreased secretion and cell-surface localization. The C-terminal
KDEL sequence in PDI is thought to trap PDI in the Golgi and
intermediate compartment and recycle it back to the endoplasmic
reticulum (11, 12). However, PDI is transported from the cell despite
the C-terminal KDEL anchor. Theories as to how PDI escapes recycling
and is secreted have been proposed (11, 12) and include saturation of
the KDEL receptor, a defect in the retention system, and escape from a
salvage compartment. These ideas imply unregulated leakage of PDI.
However, specific overexpression of PDI in Chinese hamster ovary cells
caused enhanced secretion of PDI but not other resident endoplasmic
reticulum proteins containing the KDEL sequence (33), and we have shown herein that overexpression of PDI in HT1080 cells caused enhanced secretion of PDI but not the KDEL-containing proteins, Grp78 and Grp94.
Also, appendage of the KDEL sequence to the C termini of two secretory
proteins retarded transport from the endoplasmic reticulum but did not
cause permanent retention (37). These observations argue against
saturation of the KDEL receptor as the cause of PDI secretion. These
findings and the diversity of cell types that express PDI on their
surface, including platelets, suggest that PDI secretion and
cell-surface localization is a specific event.
Antisense-mediated underexpression of PDI in HT1080 cells caused the
cells to accumulate in cell islands, and complete confluency was never
reached. In contrast, the morphology of HT1080 cells overexpressing PDI
was not obviously different from control cells. PDI expression in all
the antisense clones examined was never less than ~40% of control
cell expression. It may be that further decrease in PDI expression is
not compatible with cell survival. This notion is supported by the
observation that PDI is essential for yeast viability (38). The
intracellular GSH, GSSG, and protein-bound GSH content of control and
PDI sense and antisense transfected cells was very similar. In
contrast, the sense and antisense transfected cells secreted an average
1.9- and 4.1-fold more GSH, respectively, than control cells. The total
protein thiol content of sense transfected cells was slightly higher
than control cells, whereas it was slightly lower than control in
antisense transfected cells. The difference in PDI levels in the sense
versus antisense transfected cells would have probably
contributed to the small differences in cellular protein thiol.
The ability of PDI to manipulate disulfide bonds in proteins resides in
two very reactive dithiols/disulfides that share the common sequence
WCGHCK (3). These dithiols/disulfides catalyze thiol-disulfide
interchanges that can lead to the net formation, the net rearrangement,
or the net reduction of protein disulfide bonds depending on the nature
of the protein substrate, the redox conditions, and the presence of
other thiols and disulfides. Increase or decrease in surface protein
thiol groups strongly correlated with increase or decrease in total
cellular (r = 0.998) or cell surface (r = 0.969) PDI. A 41-51% increase in surface thiols was observed in
PDI-overexpressing cells using DTNB, whereas a 2.9-3.0-fold increase
was observed using MPB. The difference in quantitation between the two
thiol-reactive reagents probably related to the accessibility of the
reagents to protein thiols. DTNB is a bulky aromatic compound that
would have only reacted with exposed protein thiols, whereas the
maleimide moiety of MPB is attached through a propionyl spacer arm to
biotin which makes the maleimide more accessible to partly buried
protein thiols. Secreted PDI was responsible for the redox control of
surface protein thiols/disulfides as anti-PDI antibodies reduced
labeling of HT1080 surface thiols by MPB to less than control in both
control and sense transfected cells.
Fourteen identifiable proteins on HT1080 cells were labeled with MPB.
Three of the proteins (1-3, Mr of
>200, ~120, and ~80) were only labeled on sense transfected cells.
The intensity of labeling of the remaining 11 proteins (4-13,
Mr between 70 and 25) was increased with
overexpression of PDI, whereas the intensity of labeling of 3 of the 11 proteins (5-7, Mr of ~65, ~58,
and ~55) was clearly decreased with underexpression of PDI. This
result implied that certain protein disulfide bonds were more
susceptible to reduction by PDI than others. That is high levels of PDI
were required to reduce disulfide bond(s) in proteins 1-3,
whereas a proportion of proteins 4-14 contained reduced
disulfide bond(s) on control cells, but this proportion increased with
increasing PDI. Similarly, decrease in secreted PDI reduced the
proportion of proteins 5-7 that contained reduced disulfide bond(s).
The difference in susceptibility of different protein disulfide bonds to reduction by PDI was probably a consequence of the relative stability of the disulfide bond (39) and/or accessibility of the
disulfide bond to PDI.
These findings implied that the cell-surface environment favors net
disulfide bond reduction by PDI in certain proteins, which is in
accordance with reported functions of secreted PDI. Cell-surface PDI
has been implicated in reduction of the disulfide-linked diphtheria toxin heterodimer (20, 21) and reduction and shedding of the human
thyrotropin receptor ectodomain (22), and PDI can reduce disulfide
bonds in thrombospondin (31) and plasmin (36). It is possible that
dithiols/disulfides in other cell-surface proteins were also influenced
by secreted PDI but were not detected because of their paucity or
refractiveness to labeling by DTNB and/or MPB. PDI may have also
catalyzed isomerization of disulfide bonds in certain HT1080
cell-surface proteins; however, because isomerization does not change
sulfhydryl content, these proteins would not have been resolved by DTNB
or MPB labeling.
It was noteworthy that at least a third of the HT1080 surface PDI was
labeled with MPB. This finding implied that one or both of the active
site dithiols/disulfides of a substantial fraction of the surface PDI
was in the reduced dithiol form and suggested that a mechanism may
exist to maintain PDI in a reduced state on the cell surface. The
concentration of GSH in the medium of 1 × 106 HT1080
cells after 6 h of incubation was ~1 µM, which
would not be sufficient to reduce the active site dithiols of oxidized
PDI. One possibility is the plasma membrane NADH-oxidoreductase system (40) which has been implicated in reduction of extracellular protein
disulfide bonds.
A model for the effects of secreted PDI on exofacial protein
thiol(s)/disulfide(s) is shown in Fig. 9.
The figure is a cartoon of a transmembrane protein but could also be a
glycosylphosphatidylinositol-linked protein or a protein non-covalently
bound at the cell surface. The protein exists in one of two
configurations, a form in which an exofacial reactive dithiol is
oxidized to form a disulfide bond and the other in which the
disulfide bond is reduced. The exofacial thiol(s) on the reduced
form can be labeled with MPB. The two forms exist in equilibrium which
is influenced by the level of secreted PDI. The results of MPB labeling
support the equilibrium depicted in the cartoon.
It is becoming apparent that the function of some intracellular
proteins is controlled by the redox state of their cysteine residues
(41). We suggest that the function of certain extracellular proteins is
similarly controlled by the redox state of their cysteine/cystine residues. Our findings indicate that the cell can manipulate the redox
state of extracellular protein thiols/disulfides through secretion of
PDI. A scenario in which cell-surface redox potential is controlled by
PDI suggests that the rate of PDI secretion will vary with cellular
activity. In support of this hypothesis, heat shock has been shown to
inhibit secretion of PDI in primary rat hepatocytes (12), whereas
calcium ionophore enhanced secretion of PDI in NIH 3T3 cells (14) and
Chinese hamster ovary cells (33).
We thank Dr. Johan Stenflo for the anti-PDI
monoclonal antibody, M10, and Dr. Frank Clarke for the gift of the
anti-thioredoxin monoclonal antibody.
*
This work was supported by the National Health and Medical
Research Council of Australia, the National Heart Foundation of Australia, and the New South Wales Cancer Council.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed: Centre for Thrombosis
and Vascular Research, School of Pathology, University of New South
Wales, Sydney, New South Wales 2052, Australia. Tel.: 61-2 9385-1004;
Fax: 61-2 9385-1389; E-mail: p.hogg{at}unsw.edu.au.
The abbreviations used are:
PDI, protein
disulfide isomerase; FBS, fetal bovine serum; DTNB, 5,5'-dithio-bis(2-nitrobenzoic acid); MPB, 3-(N-maleimidylpropionyl)biocytin; PBS, phosphate-buffered
saline; PVDF, polyvinylidene difluoride; DMEM, Dulbecco's modified
Eagle's medium; PAGE, polyacrylamide gel electrophoresis; SSB, sulfosuccinimidobiotin; ELISA, enzyme-linked immunosorbent assay; PVDF, polyvinylidene difluoride.
Redox Control of Exofacial Protein Thiols/Disulfides by Protein
Disulfide Isomerase*
, and
CRC for Food Industry Innovation,
![]()
ABSTRACT
Top
Abstract
Introduction
References
![]()
INTRODUCTION
Top
Abstract
Introduction
References
subunits of prolyl-4-hydroxylase (5, 6) and the
subunit of triglyceride transfer protein complex (7, 8).
![]()
EXPERIMENTAL PROCEDURES
1 cm
1 (27). For MPB
labeling, 5 × 106 cells were resuspended in 1 ml of
PBS, MPB added to a final concentration of 100 µM MPB,
and the mixture incubated for 30 min at room temperature with gentle
rolling. Unreacted MPB was quenched with GSH and iodoacetamide as
described above. Labeled cells were sonicated in 1 ml of lysis buffer
as described above. Lysate corresponding to 2.5 µg of protein (approximately 1 × 104 cells) was resolved on
SDS-PAGE, transferred to PVDF membrane, and MPB-labeled proteins
detected by blotting with streptavidin peroxidase. On some occasions,
cells at 80-90% confluence were washed with PBS and incubated with
either 50 µg/ml preimmune rabbit IgG or affinity purified anti-PDI
rabbit polyclonal antibodies in serum-free DMEM for 48 h prior to
labeling with MPB. Rabbit polyclonal antibodies were developed against
purified human placenta PDI in New Zealand white rabbits and affinity
purified on a PDI-AffiGel 15 matrix (Bio-Rad). PDI was purified from
human placenta as described previously (30) with modifications
(31).
![]()
RESULTS

View larger version (30K):
[in a new window]
Fig. 1.
Characterization of PDI messenger levels and
protein in control versus PDI sense and antisense
transfected cells. A, PDI mRNA in HT1080 control
and PDI sense (HT1080s) and antisense (HT1080as) transfected cells was
detected by Northern blot. Total RNA (20 µg) was transferred to nylon
Hybond transfer membrane and probed with a riboprobe complementary to
PDI mRNA. Total RNA loading control is shown in the lower
panel. B, PDI content of HT1080 control and PDI sense
(HT1080s) and antisense (HT1080as) transfected cells, expressed as
nanograms of PDI per mg of cell protein, was determined by sandwich
ELISA. The values and error bars represent the
mean and S.E. or triplicate determinations.
1 integrin protein in whole cell
lysates, or plasminogen activator inhibitor-1 in the extracellular
matrix, of control versus HT1080s2 or HT1080as2 cells (not
shown). This suggested that PDI overexpression did not have a general
effect on protein synthesis.

View larger version (45K):
[in a new window]
Fig. 2.
Comparison of cell growth and morphology in
control versus PDI sense and antisense transfected
cells. A, HT1080 control and PDI sense (HT1080s2) and
antisense (HT1080as2) transfected cells were plated at 3000 cells per
well in 6-well plates, and cell number was determined each day for 4 days. The values and error bars represent the
mean and S.E. or triplicate determinations. B, phase
contrast micrographs of HT1080 control (a), HT1080s2
(b), and HT1080as2 (c) cells at high density.
Cells were plated at 3000 cells per well in 6-well plates, and
micrographs were taken after 5 days growth.

View larger version (32K):
[in a new window]
Fig. 3.
Characterization of the total cellular and
secreted GSH and cellular protein-bound GSH and protein thiol levels in
control versus PDI sense and antisense transfected
cells. The cellular and secreted GSH and cellular GSSG content of
HT1080 control and PDI sense (HT1080s) and antisense (HT1080as)
transfected cells was determined as described by Vandeputte et
al. (26). Protein-bound GSH (PSSG) was determined using
sodium borohydride. Total thiol content of HT1080 cell lysates
denatured in SDS was determined using DTNB. Cellular protein thiol
content (PSH) was calculated by subtracting the cellular GSH
content from the total thiol content.

View larger version (47K):
[in a new window]
Fig. 4.
Characterization of secreted PDI levels in
control versus PDI sense and antisense transfected
cells. A, PDI secreted by HT1080 control and PDI sense
(HT1080s) and antisense (HT1080as) cells was detected by Western blot
using PDI polyclonal antibodies. Lane 1 is 0.1 µg of
purified placenta PDI. Lanes 2-6 represent PDI in
conditioned medium collected for 6 h from 3 × 104 cells at 80-90% confluence. The positions of
Mr markers are shown at left.
B, secretion of the KDEL-containing proteins, Grp78 and
Grp94, from HT1080 control and HT1080s2 cells was detected by Western
blot using a Grp78/Grp94 monoclonal antibody. Lane 1 is
lysate from 3 × 104 control HT1080 cells. Lanes
2 and 3 represent Grp78 and Grp94 in conditioned medium
from 3 × 104 cells at 80-90% confluence. The
positions of Mr markers are shown at
left. C, the thioredoxin content of HT1080
control and PDI sense (HT1080s) and antisense (HT1080as) cells was
detected by Western blot using a anti-thioredoxin monoclonal antibody.
Lanes 1-5 represent thioredoxin in 13 µg of HT1080 cell
lysates. The positions of Mr markers are shown
at left.
110 mV (3) and can be labeled
with MPB (36). Therefore, SSB-labeled PDI is a measure of total
cell-surface PDI, whereas MPB-labeled PDI is a measure of reduced
cell-surface PDI.

View larger version (35K):
[in a new window]
Fig. 5.
Characterization of cell-surface PDI levels
in control versus PDI sense and antisense transfected
cells. PDI on the surface of HT1080 control and PDI sense
(HT1080s) and antisense (HT1080as) cells was detected by labeling cells
with either SSB or MPB, collecting the biotin-labeled proteins on
streptavidin-agarose, resolving the labeled proteins on SDS-PAGE, and
Western blotting using PDI polyclonal antibodies. A, results
of SSB labeling; B, results of MPB labeling. Lane
1 is 0.3 µg of purified placenta PDI. Lanes 2-6 are
SSB- or MPB-labeled cell-surface PDI from 5 × 105
cells. The positions of Mr markers are shown at
left.

View larger version (20K):
[in a new window]
Fig. 6.
Quantitation of cell-surface protein thiol
levels in control versus PDI sense and antisense
transfected cells. HT1080 control and PDI sense (HT1080s) and
antisense (HT1080as) cells were reacted for 30 min with 200 µM of the membrane-impermeable thiol-specific reagent,
DTNB. The 2-nitro-5-thiobenzoic acid generated was quantitated from
absorbance at 412 nm. The nanomoles of surface protein thiols are
expressed per million cells. The values and error
bars represent the mean and S.E. or triplicate
determinations.

View larger version (12K):
[in a new window]
Fig. 7.
Correlation between cellular or surface PDI
level and surface protein thiol content. Cellular PDI level was
taken from Fig. 1B, and surface PDI level was taken from
Fig. 5A. Surface thiol content was taken from Fig. 6. The
solid lines represent the linear regression fits to the
data. The r values are listed in the figures.

View larger version (39K):
[in a new window]
Fig. 8.
Characterization of the influence of secreted
PDI on the pattern of cell-surface proteins containing reactive thiol
groups. A, HT1080 control and PDI sense (HT1080s) and
antisense (HT1080as) transfected cells were reacted with the
membrane-impermeable thiol-specific reagent, MPB. The MPB-labeled
proteins were resolved on 10% SDS-PAGE, transferred to PVDF membrane,
blotted with streptavidin-peroxidase, and detected using
chemiluminescence. Lanes 1-5 are MPB-labeled cell-surface
proteins from 2.5 µg of cell lysate (1 × 104
cells). The positions of Mr markers are shown at
left. Fourteen identifiable proteins were labeled with MPB. These
proteins have been indicated by arrows. B,
correlation between surface PDI level and labeling by MPB. Surface PDI
level was taken from Fig. 5A. Total MPB label was estimated
by the total densitometry units of each lane in A. The
solid line represents the linear regression fit to the data
(r = 0.969). C, densitometric analysis of
the MPB-labeled proteins from HT1080 control and HT1080s2 and HT1080as2
cells shown in A. The individual protein peaks have been
identified by numbers and correspond to the
arrows in A. Three proteins (1-3)
were only labeled on sense transfected cells. The intensity of labeling
of 11 proteins (4-14) was increased with overexpression of
PDI, whereas the intensity of labeling of 3 of the 11 proteins
(5-7) was clearly decreased with underexpression of PDI.
D, effect of anti-PDI antibodies on labeling of control and
PDI sense transfected cells with MPB. HT1080 control and HT1080s2 cells
were incubated with either preimmune rabbit IgG or affinity purified
anti-PDI rabbit polyclonal antibodies (50 µg per ml) for 48 h in
serum-free medium. The cells were labeled with MPB and processed as
described in A. Total MPB label was estimated by the total
densitometry units of each lane.
![]()
DISCUSSION

View larger version (26K):
[in a new window]
Fig. 9.
Model for the effects of secreted PDI on
exofacial protein thiol(s)/disulfide(s).
![]()
ACKNOWLEDGEMENTS
![]()
FOOTNOTES
![]()
REFERENCES
Top
Abstract
Introduction
References
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
G. Liu, S. I. Zakharov, L. Yang, R. S. Wu, S.-X. Deng, D. W. Landry, A. Karlin, and S. O. Marx Locations of the {beta}1 transmembrane helices in the BK potassium channel PNAS, August 5, 2008; 105(31): 10727 - 10732. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Muller, S. Ley, I. Felger, A. Hemphill, and N. Muller Identification of differentially expressed genes in a Giardia lamblia WB C6 clone resistant to nitazoxanide and metronidazole J. Antimicrob. Chemother., July 1, 2008; 62(1): 72 - 82. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Liu, S. I. Zakharov, L. Yang, S.-X. Deng, D. W. Landry, A. Karlin, and S. O. Marx Position and Role of the BK Channel {alpha} Subunit S0 Helix Inferred from Disulfide Crosslinking J. Gen. Physiol., June 1, 2008; 131(6): 537 - 548. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Muller, M. Sterk, A. Hemphill, and N. Muller Characterization of Giardia lamblia WB C6 clones resistant to nitazoxanide and to metronidazole J. Antimicrob. Chemother., August 1, 2007; 60(2): 280 - 287. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Goplen, J. Wang, P. O. Enger, B. B. Tysnes, A.J.A. Terzis, O. D. Laerum, and R. Bjerkvig Protein disulfide isomerase expression is related to the invasive properties of malignant glioma. Cancer Res., October 15, 2006; 66(20): 9895 - 9902. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-M. Zhang, C. St. Croix, R. Cao, K. Wasserloos, S. C. Watkins, T. Stevens, S. Li, V. Tyurin, V. E. Kagan, and B. R. Pitt Cell-surface protein disulfide isomerase is required for transnitrosation of metallothionein by s-nitroso-albumin in intact rat pulmonary vascular endothelial cells. Experimental Biology and Medicine, October 1, 2006; 231(9): 1507 - 1515. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Janiszewski, L. R. Lopes, A. O. Carmo, M. A. Pedro, R. P. Brandes, C. X. C. Santos, and F. R. M. Laurindo Regulation of NAD(P)H Oxidase by Associated Protein Disulfide Isomerase in Vascular Smooth Muscle Cells J. Biol. Chem., December 9, 2005; 280(49): 40813 - 40819. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kwon, C.-S. Yoon, W. Jeong, S. G. Rhee, and D. M. Waisman Annexin A2-S100A10 Heterotetramer, a Novel Substrate of Thioredoxin J. Biol. Chem., June 24, 2005; 280(25): 23584 - 23592. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Jordan, J. M. Stevens, G. P. Hubbard, N. E. Barrett, T. Sage, K. S. Authi, and J. M. Gibbins A role for the thiol isomerase protein ERP5 in platelet function Blood, February 15, 2005; 105(4): 1500 - 1507. [Abstract] [Full Text] [PDF] |
||||
|
|