J Biol Chem, Vol. 274, Issue 4, 2472-2482, January 22, 1999
Characterization of a Phycoerythrin without
-Subunits from a
Unicellular Red Alga*
Jean-Claude
Thomas
and
Chantal
Passaquet
From the Laboratoire de Photorégulation et Dynamique des
Membranes Végétales, CNRS, Unité de Recherche
Associée 1810, GDR 1002, Ecole Normale Supérieure,
46 rue d'Ulm, 75 230 Paris Cedex 05, France
 |
ABSTRACT |
We describe here the spectral and biochemical
properties of a novel biliprotein belonging to the phycoerythrin
family, purified from the phycobilisome of a unicellular red alga,
Rhodella reticulata strain R6. This biliprotein is
assembled from a unique
-type subunit, chloroplast-encoded, whose
hexameric or dodecameric aggregates are stabilized by unusually large
linkers (87 and 60 kDa) encoded by the nuclear genome. Although each
-type subunit bears two phycoerythrobilins and one
phycocyanobilin per chain, the linker polypeptides are
non-chromophorylated. The apoprotein of the
-subunit of the R. reticulata R6 phycoerythrin is specified by a monocistronic rpeB chloroplast gene that is split into three exons. We
discuss the relationships between R6
-phycoerythrin and the
previously published polypeptide sequences, the structural consequences
due to the absence of an
-subunit, and its evolutionary implications.
 |
INTRODUCTION |
Light is efficiently collected in the prokaryotic cyanobacteria
and the eukaryotic Rhodophyta (red algae) by phycobiliproteins (PBP)1 assembled into
macromolecular structures, the phycobilisomes (PBS), found on the outer
thylakoidal membranes as extrinsic components (1-10).
Phycobiliproteins are oligomeric proteins, built up from two
chromophore-bearing polypeptides belonging to two families (
and
) probably originating from a common ancestor but which apparently
diverged early in evolution (11, 12). In PBS, the phycobiliproteins are
stabilized by linker polypeptides (L) that are generally colorless. The
aggregation states of linker-biliprotein complexes have been typically
found as (
)3L or (
)6L. In
cyanobacteria and Rhodophyta, four main classes of biliproteins exist
as follows: allophycocyanin (APC), phycocyanin (PC), phycoerythrin
(PE), and phycoerythrocyanin (PEC); this last group was found only in
cyanobacteria. In other eukaryotes, the unicellular Cryptophyta (or
Cryptomonads), resulting from a secondary endosymbiosis (13, 14)
between a red algal cell and a colorless eukaryote (15), only one type of biliprotein is synthesized and localized in the thylakoid lumen (8,
16); the
-subunit is typical of the rhodophytan
-PE whereas the
-subunit is unlike other PBPs. It is isolated as dimeric
(
)2 aggregates. Recently, PE has been described at
the genomic level in another group of prokaryotic organisms, belonging to the cyanobacterial radiation, the prochlorophyte
Prochlorococcus marinus (17), but the biochemical
characteristics and the intracellular localization of this pigment have
not been investigated.
The spectral properties of PBP are due to bilins, linear tetrapyrroles
covalently linked to specific cysteinyl residues of the polypeptidic
chains by means of one (or less frequently two) thioether bonds. Due to
differences in PBP bilin composition, light may be efficiently
collected from the blue-green edge to the red part of the visible light
spectrum. Moreover, the light absorption properties of the different
tetrapyrroles are modulated by molecular interactions with the
apoprotein chains in monomers (
), in oligomers, and with the
specific linker polypeptides.
In prokaryotic organisms (cyanobacteria and Prochlorophyta), the genes
for the apoproteins of the two polypeptide chains of a given
biliprotein are polycistronic that can be transcribed with genes for
specific linker polypeptides as well as for subunits of lyases for
chromophore linkage. Cotranscription of the two genes encoding
apoproteins is always observed (1, 6, 9, 18). In the eukaryotic
Rhodophyta, the PBS apoproteins are encoded by the chloroplast genome,
but linkers of the outer PBP (for instance PE linkers, when this
pigment present) are nuclear-encoded (19-21). Data from Cryptophyta
showed that the
-subunit of the unique PBP is chloroplast-encoded
(22), whereas the
-subunit is specified by the nucleus (23) or by
the residual nucleus of the first eukaryotic red algal symbiont, the
so-called nucleomorph (as proposed in Ref. 9).
During the past 10 years, high resolution crystallographic data have
been obtained for representatives of the major groups of
phycobiliproteins mentioned above (PC, PEC, PE, and APC). To date, no
detailed crystallographic data have been published on cryptophytan
biliproteins. For each of the phycobiliproteins, details of the
structural interactions between the
- and
-subunits have been
delineated (24-31). Such interactions are essential for assembly of

monomers and of the higher order (
)3 trimers and (
)6 hexamers. It has generally been assumed that
phycobiliproteins cannot be assembled from only one type (
or
)
of subunit.
We describe here an unusual biliprotein belonging to the PE family from
the unicellular red alga Rhodella reticulata strain R6. This
unique PE, in association with C-PC and APC, forms phycobilisomes similar to the hemidiscoidal type found in cyanobacteria and in some
unicellular Rhodophyta. This PE can be purified as hexamers and
dodecamers containing only
-type subunits, which are stabilized by
unusually large, colorless, linker polypeptides (60 and 87 kDa,
respectively) specified by the nuclear genome. Moreover, we show that
the
-subunit is encoded by a monocistronic chloroplast gene,
interrupted by two large intronic sequences, one of which is related to
a typical group II intron.
 |
EXPERIMENTAL PROCEDURES |
Organisms and Culture Conditions--
R. reticulata
strain R6 (Rhodella grisea (Geitler) Fresnel et
al. (32)) was collected in 1983 by C. Billard (Caen University France) from seawater samples from Sarasota Bay, FL, and kindly provided by C. Billard. Two other closely related strains were obtained
from the UTEX collection: R. reticulata Deason (UTEX LB
2320) and Dixoniella grisea (Geitler) Scott et
al. (UTEX LB2615) (as R. reticulata Deason) for
comparison. The two last strains were independent isolates from the
U. S.
Culture Conditions--
All strains were grown on Erdschreiber
liquid medium (33) in Erlenmeyer flasks, bubbled with sterile
water-saturated air, and exposed to 50 µmol photons m
2
s
1 of cool fluorescent light under a 16/8 light-dark cycle.
Phycobiliprotein Purification--
Phycobilisomes were isolated
by modifications of the procedure of Yamanaka et al. (34).
Typically, exponentially growing cells from 1 liter of culture were
collected by centrifugation (4,500 × g, 10 min,
Kontron A8.24 rotor), rinsed twice with potassium/sodium phosphate
buffer 0.75 M, pH 7, 1 mM EDTA, 1 mM benzamidine (buffer I), resuspended in 40 ml of the same
buffer, dispersed with a Thoma homogenizer, and submitted to a French
press treatment (Aminco Corp.) operating at 12,000 p.s.i.
Phenylmethylsulfonyl fluoride in solution in isopropyl alcohol (1 mM final concentration) and Triton X-100 (5% w/v) were
added to the broken cells, and incubation with stirring was for 45 min
at room temperature. The cell lysate was centrifuged (27,000 × g, 15 min. 15 °C, Kontron A8.24 rotor). The pellet and
the upper "cream" were discarded while 3% Triton (w/v) was added
to the intermediate blue-violet layer, rapidly mixed, and layered (6 ml) onto a 0.25 to 1 M discontinuous sucrose gradient in
buffer I with 6-ml fractions of 0.25, 0.5, 0.625, 0.75- and 1 M sucrose and centrifuged (100,000 × g,
16 h 12 °C, Beckman SW 28 rotor). The intact PBS fraction
corresponding to >95% of the total pigments was collected in the
0.625 M sucrose layer and used for subsequent analysis,
whereas small aggregates (<5% total pigments) banded in the 0.25 to
0.5 M sucrose layers.
PBS dissociation was achieved as described for Rhodella
violacea (35) with modifications. The PBS fraction was diluted 1:3 with buffer I and pelleted by centrifugation (210,000 × g, 6 h, 4 °C, Beckman Ti60 rotor). The pellet was
dissolved in 5 mM potassium phosphate buffer, pH 7, containing 10% (v/v) glycerol (buffer II) and dialyzed overnight at
4 °C in the dark. Inhibitors of protease activity (1 mM
benzamidine, 1 mM EDTA, 1 mM
phenylmethylsulfonyl fluoride) were added at all experimental steps.
The dialysate was layered onto a linear sucrose density gradient
(5-20% sucrose, 20 mM phosphate, pH 7, 10% glycerol) and
centrifuged (100,000 × g, 15 h, 4 °C, Beckman
Ti60 rotor). Pigment aggregates banded in two main fractions and were
collected with a syringe; the upper third was blue-colored (fraction
A), and the lower two-thirds were pink-violet (fraction B). A small
pellet was also collected, but its composition was found similar to
fraction B. Fractions A and B were dialyzed separately against
potassium phosphate buffer (5 mM, pH 7) containing 10%
glycerol (v/v) (buffer III), and each fraction was subjected to
chromatography on a column (16 × 250 mm) of DEAE-cellulose
(Whatman DE52) prepared according to the manufacturer's instructions
and equilibrated with buffer II. The columns were developed with a
potassium phosphate linear gradient (5-150 mM, 120 ml
each) including 1 mM
-mercaptoethanol, protease inhibitors at the same concentration as above, and 10% glycerol at
4 °C in the dark (36). The pigment complexes from each major elution
peak were pooled and concentrated by centrifugation (160,000 × g, 15 h, Kontron TFT70 rotor) and resuspended in a
minimal volume of buffer II. Aliquots (4 ml) were then loaded onto
linear sucrose density gradients (5-20% sucrose w/v in buffer III;
total volume, 26 ml) and centrifuged (160,000 × g,
16 h 30, 4 °C, Kontron TFT70 rotor). The trimeric aggregates of
blue pigments (PC and APC) were collected from the middle third of the
gradient, whereas larger aggregates with pink-violet PE were in the
lower third.
Pure fractions of PE, as judged by their electrophoretic composition
were concentrated by centrifugation after 2-fold dilution with buffer
II (160,000 × g, 16 h 30, 4 °C, Kontron TFT70
rotor), and the pellets solubilized in a minimal volume of buffer II
were used for characterization of the two forms of PE (see below).
Separation of PE I (PE-LR60) and PE II
(PE-LR87) and Calibration--
The pure
PE-containing fraction was subjected to centrifugation (260,000 × g, 24 h, 4 °C, Beckman SW41 rotor) on a linear sucrose density gradient (5-20% sucrose w/v in buffer III). Proteins of known molecular mass: catalase (240 kDa), alcohol dehydrogenase (150 kDa), and bovine serum albumin (67 kDa) were used as standards. The
gradient was then fractionated using a Isco 185 density gradient fractionator. The absorbance of fractions (180 µl each) was measured at 550 and 280 nm. The apparent molecular weight of pigment aggregates were calculated according to Martin and Ames (37). Two forms of PE,
associated, respectively, with two different colorless polypeptides
(PE-LR60 and PE-LR87),
were thus separated.
Spectroscopic Studies--
Absorption spectra were recorded on a
DW2 Aminco spectrophotometer. 77 K fluorescence emission spectra were
obtained with a F3010 Hitachi spectrofluorometer equipped with a Dewar device.
Bilin Analyses--
Bilin quantitation was made with samples
denatured in 9 M urea at pH 2, using the millimolar
extinction coefficients of 53.7 and 0 mM
1
cm
1 for phycoerythrobilin at 550 and 662 nm,
respectively, and 6.0 and 35.4 mM
1
cm
1 for phycocyanobilin at the same wavelengths (38).
Chemical Cleavage by Cyanogen Bromide--
Aliquots (100-200
µg) of proteins in buffer II were precipitated with trichloroacetic
acid (10% w/v final concentration), and pellets were dissolved in 70 µl of 70% formic acid (v/v) in water and, after complete
solubilization, CNBr crystals were added (39). The reaction vessel was
flushed with gaseous N2 and sealed. The reaction was
carried out overnight at room temperature. The reaction was quenched by
addition of 630 µl of H2O, and the samples were
lyophilized. Control samples were subjected to the formic acid
treatment alone.
Gel Electrophoresis and Peptide Sequencing--
LiDS-PAGE was
performed on protein aliquots (20-100 µg) after precipitation with
trichloroacetic acid (10% final concentration) on 9-18% acrylamide
gradient gels (40). For the resolution of low molecular weight
polypeptides after CNBr cleavage, the Tris-Tricine system (41) was used
as described previously (40). For the visualization of
chromophore-bearing peptides, the gels were soaked in 20 mM
zinc acetate for 5 min (42). The fluorescent zinc-bilin complexes were
visualized at 312 nm with a transilluminator (Vilbert Lourmat France).
After electrophoresis, the peptides were stained in situ by
Coomassie Blue G-250 (0.1% in 9% acetic acid, 45% methanol) and
destained (7.5% acetic acid, 30% methanol) before blotting onto
Immobilon P membrane (Millipore, Bedford, MA) by a liquid transfer
system (TE, Hoefer, San Francisco) with Tris (50 mM) borate
(50 mM) in 10% methanol as electrophoresis buffer and a constant current of 6 mA for 2 h at room temperature. After
transfer, the peptides were stained with Amido Black (0.1% w/v) in
methanol/acetic acid (10:2%), and excess stain was removed (45%
methanol, 7% acetic acid), then 90:7% for 5 s. Sequence analyses
were performed on an Applied Biosystems 473 A sequencer at the
Laboratoire de Microséquençage des Proteines, Institut
Pasteur, Paris, France.
Genomic Library Construction and Hybridization--
Total DNA
from R. reticulata R6 was isolated by procedures described
for chromophyte algae (43) except the two CsCl density gradients were
adjusted to 1.570 g/cm3 to separate plastid and
mitochondrial DNA from nuclear DNA. Plastid DNA libraries were
constructed by respectively ligating DNA digests with EcoRI
or PstI into EcoRI or PstI cloning
sites in pTZ18. Standard methods (44) were used for Southern blotting
and in situ colony hybridization using randomly labeled probes.
rpeB Probe Preparation--
Two heterologous probes were
prepared from R. violacea DNA by PCR using four synthetic
oligonucleotides designed from the R. violacea rpeB gene
sequence (45) as follows: oligonucleotide I, 5'ATGCTAGATGCATTTTCAAGA3';
oligonucleotide II, 3'TAATCCGTTTAAACATCTGTCTTC5'; oligonucleotide III,
5'ATGGCTGCTTGCTTACGTGACGGA3'; and oligonucleotide IV,
3'TAAAGCTACAACAGAAGCTTTCAT5'. PCR amplification was done with R. violacea plastid DNA (0.5 mg, one cycle at 94 °C
for 5 min, 35 cycles at 94 °C, 55 and 72 °C for 45 s for
each step and one final elongation cycle for 5 min) using Tfi
polymerase (Promega Corp. Madison, WI). PCR products obtained
corresponding to 679 (probe I) or 189 (probe II) base pairs using the I
and II coupled oligonucleotides and III and IV, respectively, were used
in Southern or library heterologous hybridizations.
DNA Sequencing--
The DNA sequences of both strands were
determined by the dideoxyribonucleotide chain termination method using
the Sequenase 2.0 system (U. S. Biochemical Corp.) and
[
-33P]dATP with double-stranded DNA.
RNA Isolation and Northern Hybridization--
Total RNA was
isolated as described for cyanobacteria (46). RNA (5 µg) was
electrophoresed in 1.2% denaturing agarose gels in HF buffer (0.5 M Hepes, 10 mM EDTA, 16% formaldehyde) and
transferred to nylon membranes (Hybond-N, Amersham Pharmacia Biotech).
Hybridization was at 42 °C with probes as described under
"Results."
cDNA Cloning and Sequencing--
To sequence cDNA in the
junction between the exons and introns, we performed coupled reverse
transcription and PCR amplification; R. reticulata R6 total
RNA (5 mg) was used with 0.02 pmol of strict oligonucleotides (see
"Results": rpeB gene cloning and sequencing), 400 units
of reverse transcriptase (Life Technologies, Inc.) in the presence of
20 nmol of each dNTP and 20 units of RNasin (Promega). The reaction was
allowed to proceed for 30 min at 37 °C and then inhibited for 5 min
at 95 °C. Amplification was performed on the retrotranscription
product using a second complementary oligonucleotide as forward primer
and the first one as reverse primer. The PCR protocol was the same as above.
5' mRNA Determination--
Primer extension was performed
for mapping of the 5' terminus of the rpe mRNA using a
strictly complementary 24-mer synthetic oligonucleotide (from nt 1468 to 1441): 5'TCCGTCCCTTAAACAGGCGGCCAT3'. 30 µg of total RNA from an
R. reticulata R6 exponential culture were used in the primer
extension method described by Sambrook et al. (44) modified
as in Richaud and Zabulon (47). After ethanol precipitation, the sample
was loaded on a sequencing gel together with a sequence standard
(pTZ18) in a parallel lane to determine the size of the hybrid.
 |
RESULTS |
Phycobilisome and Biliprotein Characterization--
After release
of R. reticulata R6 phycobilisomes by Triton X-100 treatment
of cell lysates, they were recovered from the 0.625 M
sucrose layer. They exhibited characteristic absorption features of
PEB- and PCB- containing biliproteins (Fig.
1) with a single peak at 562 nm
originating from the PEB-containing putative phycoerythrin while
absorption maxima at 612 and 650 nm (as a shoulder) were attributed to
phycocyanin and allophycocyanin, respectively. No shoulder was observed
in the 495 nm region, indicating the probable absence of PUB-type
chromophores.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 1.
Absorption (293 K) and fluorescence (77 K)
emission spectra of R. reticulata R6 intact PBS in
0.75 M potassium/sodium-phosphate buffer, 0.625 M sucrose, pH 7. For fluorescence emission spectrum,
PBS at an OD560 nm = 0.1 were absorbed on Millipore
glass-fiber prefilters and directly cooled in liquid nitrogen.
Absorption spectrum, solid line. Fluorescence emission
spectrum, dotted line.
|
|
The 77 K fluorescence emission spectrum (Fig. 1) exhibited a main peak
at 685 nm from the terminal energy acceptors of the phycobilisome and
minor peaks at 629 and 651 nm and a 660 nm shoulder. The 651-nm
fluorescence peak and the 660 nm shoulder were attributable to
uncoupled phycocyanin and allophycocyanin, respectively, but it was not
possible before further subfractionation of the main biliproteins to
determine the origin of the 629-nm fluorescence peak.
We determined the R. reticulata R6 PBS polypeptide
composition by LiDS-PAGE (Fig. 2,
lane 7). The main biliprotein subunits were in the
15-20-kDa range, the LCM was at 95 kDa, and three linkers
were 87, 60, and 30 kDa apparent molecular mass, respectively (Fig. 2,
lane 7). After zinc acetate treatment, only the biliprotein subunits and the LCM appeared fluorescent (Fig. 2,
lane 8) under UV excitation. The three linker polypeptides
(87, 60 and 30 kDa) were clearly non-chromophorylated.

View larger version (65K):
[in this window]
[in a new window]
|
Fig. 2.
Polypeptide composition of PBS and PBP
fractions determined by LiDS-PAGE. Lanes 1-7,
Coomassie Blue staining. Lane 8, bilin fluorescence in
presence of zinc acetate. Lanes 1-6, purified PBP.
Lanes 7 and 8, PBS. Lane 1, PC + LRC 30. Lane 2, phycoerythrin.
Lanes 3 and 4, PE + LR60.
Lanes 5 and 6, PE + LR87.
Lanes 3-6, fractions 30, 35, 40, 45, respectively, from the
sucrose density gradient centrifugation (see Fig. 4, lower
panel).
|
|
We verified, by labeling experiments of PBS polypeptides in the
presence of chloroplastic and cytoplasmic ribosomal translational inhibitors (chloramphenicol and cycloheximide, respectively) as described previously for R. violacea (21), that all the
polypeptides of the R. reticulata R6 PBS were
chloroplast-encoded. Synthesis of the two PE colorless linkers was
blocked by cycloheximide but not by chloramphenicol and therefore are
nuclear-encoded (data not shown) as typically is the case for PE
linkers in red algae (19-21).
The R. reticulata R6 phycobilisome subcomponents were
resolved after gentle dissociation of purified intact particles. Two main fractions were obtained in continuous sucrose gradients. The upper
layer (fraction A) contained trimeric aggregates of C-phycocyanin and
allophycocyanin and also a minor PE component of low molecular weight
(data not shown). The lower part (fraction B) was largely enriched in
phycoerythrin but also contained LRC-PC complexes and a
LCM-APC complex (see below). Upon DEAE-cellulose chromatography of the fraction B, three main components were eluted (Fig. 3) with increasing phosphate
concentration (35, 65, and 110 mM respectively). The two
first peaks were identified as the LCM-APC and
LRC-PC complexes and the third one as a PE-like
pigment.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 3.
DEAE-cellulose chromatography elution profile
of the phycobiliproteins of the fraction B (from dissociation of
R. reticulata R6 phycobilisomes). The OD of each
fraction has been measured at 650 nm ( ), 615 nm (- - -), and 550 nm ( ). The phycobiliproteins were eluted by linear gradient of
potassium phosphate buffer, pH 7 (5-250 mM, 1 mM 2-mercaptoethanol), containing 10% glycerol. Three main
fractions corresponding to APC + LCM, PC-LRC
complexes, and PE fractions (PE-LR60 + PE-LR87) were eluted, respectively, at 35, 65, and 110 mM phosphate concentration (determined from the
conductivity curve (mS).
|
|
The different fractions were pelleted separately, and the final step of
PC and PE purification was carried out by ultracentrifugation on linear
(5-20%) sucrose density gradients (data not shown). Electrophoretic
data confirmed the purity of the LRC-PC fraction (Fig. 2,
lane 1), and in the PE fraction, two non-chromophoric linkers of 87- and 60-kDa apparent molecular mass (Fig. 2, lanes 2-6) were found in addition to the PE subunits in the 20-kDa
range. Surprisingly, as previously mentioned, the two PE linkers were clearly non-chromophorylated (Fig. 2, lane 8).
Two distinct complexes of PE (PE I and PE II) were successfully
resolved by sedimentation through a linear sucrose density gradient
(Fig. 4, lower panel). Based
on a calibration of the sucrose density gradient with proteins of known
molecular weight, PE I was determined to be 184 kDa and PE II to be 300 kDa. The 60-kDa linker (LR60) was found in PE I
and the 87-kDa linker (LR87) in PE II.
Consequently, these complexes have designated
PE-LR60 and PE-LR87,
respectively.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 4.
Sucrose density gradient purification of PE
fractions and their spectral analysis. Upper part,
sucrose density gradient centrifugation of
PE-LR60 and
PE-LR87, compared with standards as follows:
bovine serum albumin (Mr 67,000), alcohol
dehydrogenase (Mr 150,000), and catalase
(Mr 240,000). Lower part, absorbance
of PE fractions from sucrose gradient centrifugation at 280 nm. The
fractions (180 µl each) were collected and analyzed by LiDS-PAGE (see
Fig. 2).
|
|
Spectral Properties--
The spectral characteristics of the PC
and PE pigments were analyzed. The data clearly showed that PC is a
C-phycocyanin type, with
- and
-subunits bearing phycocyanobilin
chromophores with an absorption maximum at 622 nm and 77 K fluorescence
emission at 651 nm (not shown).
PE I and PE II pigments were indistinguishable with respect to their
spectral properties with absorption maxima at 562 and 604 nm,
respectively (Fig. 5). When denatured in
acidic 9 M urea, the protein absorption maxima were shifted
to 550 and 662 nm (data not shown), demonstrating that the 562-nm peak
in the native pigment originated from phycoerythrobilin and the 604-nm
peak from phycocyanobilin chromophores, with a PEB/PCB molar ratio of
1.9. The 77 K fluorescence emission peak at 630 nm (Fig. 5) clearly
arises from the phycocyanobilin chromophore of PE. Thus, we ascribe the
629 nm peak in the 77 K PBS fluorescence emission spectrum in Fig. 1 to
uncoupled phycoerythrin.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 5.
Absorption (293 K) and fluorescence (77 K)
emission spectra of R. reticulata R6
PE-LR87 in potassium phosphate buffer, pH 7, 10% glycerol. For fluorescence emission spectrum, PE at an
OD560 nm = 0.1 was absorbed on glass fiber Millipore
prefilters and directly cooled in liquid nitrogen. Solid
line, absorption. Dotted line, fluorescence. The two
forms (PE-LR60 and
PE-LR87) had identical spectral properties (not
illustrated for PE-LR60).
|
|
Characterization of PE Subunit Composition--
Because of two
types of chromophores linked to the subunits of R. reticulata R6 PE, we examined the chromophore composition of each
putative subunit (
and
). Pure PE I and PE II fractions were
separately denatured by acidic 2 M urea and submitted to weak cation exchange chromatography on Bio-Rex 70. In each case, a
single colored fraction was eluted with 9 M urea (data not
shown). No pigmented polypeptides were obtained with 8 M urea.
Microsequencing and Chemical Cleavage of PE Subunit--
CNBr
chemical cleavage was performed on the 9 M urea Bio-Rex
fraction. The electrophoretic pattern of cleavage products is shown in
Fig. 6. All peptides were
chromophore-linked (Fig. 6), and their amino-terminal sequences were
determined. The main fragments (6 and 4 kDa) gave the amino sequences
MAACLRD and MKASSVA, respectively. The amino-terminal sequence of the
minor components (14 and 5 kDa) were identical to the unique
amino-terminal sequence of the native polypeptide, i.e.
MLDAFKSSVA. We infer that these two peptides were generated by partial
cleavage. The amino-terminal sequence was unequivocally of a
-PE
type (Fig. 7).

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 6.
Cyanogen bromide (CNBr) chemical
cleavage of the R. reticulata R6
-PE polypeptide. Left, Coomassie Blue
G-250 staining. Right, bilin fluorescence in the presence of
zinc acetate. Lane 1, native -PE. Lane 2, CNBr
peptides derived from -PE. Molecular mass markers are on the
left; the peptides used for microsequencing are indicated on
the right and noted by their apparent molecular weight.
frag., fragment.
|
|

View larger version (87K):
[in this window]
[in a new window]
|
Fig. 7.
Comparison of amino acid sequences of
-PE apoproteins from different organisms.
Sequences were aligned with the Citi 2 program (Pierre et Marie Curie
University, Paris) and optimized by introduction of gaps ( ). Amino
acid positions are indicated by numbers above the sequences.
Dashed lines under the R. violacea
deduced amino acid sequence indicated peptides used to design synthetic
degenerated oligonucleotides, respectively, residues 1-7
(oligonucleotide I), residues 113 to 106 (oligonucleotide II), residues
79-86 (oligonucleotide III), and residues 141 to 134 (oligonucleotide
IV). Identical residues are indicated by asterisks.
Underlined sequences in R. reticulata R6 were
also obtained by protein microsequencing. Arrows with
top letters above the deduced amino acid sequence noted the
putative helical segments. Red algae: R.r., R. reticulata R6 (this work); R.v., R. violacea
(45); P.c., P. cruentum (64); P.b.,
Polysiphonia boldii (65); A.n., Aglaothamnion
neglectum (66). Cyanobacteria: C. 7601, Calothrix PCC 7601 (46); S.6701,
Synechocystis PCC 6701 (67); S.WH 8020 II and
I, Synechococcus sp. WH 8020 (59, 60, 69);
S.WH 7803, Synechococcus 7803 (69); P.m.,
Prochlorococcus marinus (17). Cryptophyta: C. ,
Cryptomonas (22).
|
|
Although the 4-kDa peptide was found to be blue colored, with an
absorption maximum at 662 nm originating from PCB chromophores, the
other peptides were red colored absorbing at 550 nm and so are linked
to PEB chromophores (data not shown).
rpeB Gene Cloning and Sequencing--
The biochemical studies led
us to suppose the R. reticulata R6 PE was lacking an
-type subunit. Therefore, we undertook the identification and the
sequencing of the rpe operon. The close relationship between
the red algal
-PEs known facilitated cloning of the R. reticulata R6 rpe genes by heterologous DNA
hybridization experiments using probes from R. violacea
plastid DNA corresponding to the first half of the rpeB gene
(see "Experimental Procedures"). To confirm the plastidic origin of
the rpe operon in R. reticulata R6, a Southern
blot of EcoRI fragments from isolated nuclear and plastidic
DNA was performed. With probe I (corresponding to the first half of the
gene), the only strong signal was with a 2.9-kb plastid DNA fragment
(data not shown). This result suggested that a rpeB gene is
present as a single copy in the chloroplastic genome of R. reticulata R6.
With probe I, we identified positive clones in the EcoRI
R. reticulata R6 plastid DNA library. One was sequenced
using forward and reverse universal primers and internal primers
designed upon walking through the insert. The nucleotide and deduced
amino acid sequences are shown in Fig. 8.
The deduced amino acid sequences revealed a
-type PE amino-terminal
sequence and one of the three microsequences obtained from the R6 PE
CNBr cleavage products (MAACLRD), but the two coding parts were
separated by many stop codons. We concluded that the coding sequences
were interrupted by an intron which was confirmed by cDNA
sequencing (see below). Furthermore, comparison with other reported
-PE sequences showed that the 3' region of the rpeB gene
was missing in this insert.

View larger version (37K):
[in this window]
[in a new window]

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 8.
Nucleotide and deduced amino acid sequences
of the rpeB gene encoding -PE
apoprotein from R. reticulata R6. The amino acids
in bold correspond to the PE microsequenced fragments.
Nucleotide and amino acid positions are given at right. The
transcription start determined by 5' extension from the synthetic
oligonucleotide complementary (nt 1468 to 1441) is noted by an
asterisk. The proposed 10 and 35 sequences are in
bold. ° indicates the stop codon, and solid
arrows marked the putative terminator. The two
homologous oligonucleotides (I and II) used for reverse
transcription-PCR and sequencing of the cDNA are indicated by
solid lines. The group II intron domains are noted by
dashed arrows (GenBankTM AF114823).
|
|
Because of a unique PstI site (positions 1568-1574, Fig. 8)
in the insert we prepared a PstI library that was screened
with another heterologous probe (probe II) corresponding to the central part of the gene. Recombinant plasmids containing a 4.8-kb fragment in
the pTZ8 PstI cloning site were found to contain the 3' end of the second intron and the rpeB 3'-coding sequence. The
third microsequence (MKASSVA) obtained from the CNBr cleavage products (see above) is present in the deduced amino acid sequence. Intervening sequences and the splicing sites were identified by synthesizing the
cDNA by reverse transcription-PCR with R. reticulata R6
total RNA as template, using an oligonucleotide corresponding to the complementary 2800-2820 nucleotide sequence as the reverse primer and
the sequence of the 5' end coding region (nt 490 to 511) as the forward
one. The amplification product, 415 nt long, was sequenced (data not
shown) and confirmed the junctions between the exon and intron
sequences shown in Fig. 8.
A physical map of the two overlapping sequenced clones is shown Fig.
9, and the entire sequence of the
rpeB gene is presented in Fig. 8.

View larger version (7K):
[in this window]
[in a new window]
|
Fig. 9.
Physical map of the rpeB
gene and flanking regions. Physical map of EcoRI
and PstI inserts from PTZ18 plasmids carrying the
rpeB gene from R. reticulata R6 plastid DNA. Only
the sites used for subcloning are noted. The open reading parts are in
boldface.
|
|
The first exon is very short and corresponds to the amino-terminal 27 amino acids. The following 0.7-kb intron exhibits the main features of
group II introns (48) in which we recognize six putative domains shared
by this intron group (Fig. 8). The 5' end sequence GTAAGC, although
unusual, is the exact sequence found in the two Rhodella
plastid introns known so far, i.e. in the rpeB
(45) and pbsA R. violacea genes (47). In addition, the
highly conserved nucleotide required for lariat formation, an A located
7 nucleotides upstream from the 3'-splicing site is found (Fig. 8;
A+).
Another 1.2-kb intron follows the 180-nt exon 2. It possesses the
typical 5' end of group II introns, GTGCG, but of other characteristic
domains only a very weak domain V is present between the 2537 and 2560 nucleotides. None of the specific characteristics for the group I
introns were observed.
The organization of the rpeB gene in R. reticulata R6 is as follows: 5'rpeb(80 nt)-intron(718
nt)-rpeb(183 nt)-intron(1195 nt)-rpeb(135
nt)3'.
Thus, only 13% of the nucleotide sequence corresponds to the
rpeB coding region. We cannot identify other open reading
frames in the introns or on the opposite DNA strand. The three exons of
rpeB exhibit a strong AT bias with GC being 30 to 34%,
whereas the first intron shows a smaller value of 20%. Similar values have been observed in the rpeB gene from R. violacea (45). The second intron in R. reticulata R6,
although without apparent open reading frame, has a significantly
higher percentage of GC (32%). Downstream from the third exon, we
observed an inverted repeat of 34 nucleotides able to form a hairpin
(nt 2967 to 3035; Fig. 8) followed by a stretch of Ts that would
correspond to a rho-independent transcription terminator.
rpeB Transcription--
The rpeB gene transcript size
was determined by Northern blot analysis with total RNA using a PCR
product (324 base pairs long) as a homologous probe. The two
oligonucleotides used as primers were nt 2800 to 2820 and nt 3123 to
3103, respectively. The PCR product obtained with these two primers
avoided amplification of the first part (amino acids 91-135, Fig. 7)
of the third exon which is very close to
PC. The operon transcript
size is 0.7 kb as shown in Fig. 10. For
comparison, a Northern blot analysis was also performed with a partial
sequence of the R. reticulata R6 cpc operon (not
shown), 239 nt corresponding to the cpc B 3' end, the
intergenic part and the 5' end of cpc A. The transcript size
for cpc BA is 1.5 kb, in agreement with the expected size for a transcript covering the entire dicistronic cpcBA. In
contrast, the rpe B transcript is significantly shorter.

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 10.
Northern analysis of total RNA from R. reticulata R6 hybridized with rpeB probe
(lane A) and cpcBA (lane
B). The measured transcript sizes are indicated on the
left. kbp, kilobase pair.
|
|
The 5' end of the mature RNA, determined by primer extension from a
strictly complementary oligonucleotide, is at nucleotide A420 (Fig. 8; A*). The sequences TATTAT (nt
406-411) and TTGCGT (nt 381-387), upstream from the transcription
start site, are proposed to be the
10 and
35 promoter elements. The
GGAG sequence, 7 nt upstream from the coding ATG, is homologous to the
Shine-Dalgarno ribosome-binding site.
 |
DISCUSSION |
We have presented biochemical and molecular evidence of the
occurrence of a PE-type pigment assembled from only a
-subunit in
the unicellular red alga R. reticulata R6. Two other
rhodophytan strains (mentioned under "Experimental Procedures"),
related to R. reticulata R6, isolated independently, have an
identical biliprotein composition and synthesize a similar PE pigment.
PBS were purified and electron microscope observations indicate that
they belong to the hemidiscoidal type. It has been clearly demonstrated
that a 95-kDa LCM permits the assembly of three cylinder cores (49, 50), whereas a 72-kDa LCM is associated with two cylinder cores (49, 50) and a 128-kDa LCM corresponds to
the so-called four cylinder core (51). The apparent LCM
molecular weight (95 kDa) in R. reticulata R6 PBS suggests
that the R6 PBS is assembled with a tricylindrical core as in many
cyanobacteria and some Rhodophyta (52, 53). Preliminary ultrastructural observations (not shown) are in agreement with this hypothesis, but the
rod organization remains to be established.
Purification of the major biliproteins after PBS dissociation and
DEAE-cellulose chromatography allowed us to purify, in addition to
allophycocyanin (APC) and C-phycocyanin (C-PC), a phycoerythrin-type pigment. The occurrence of a C-PC has been similarly described in other
unicellular or filamentous Rhodophyta as follows: R. violacea (54), Cyanidium caldarium (55),
Compsopogon coeruleus (56), and Audouinella species
(57). The third pigment, purple-violet in color and responsible for the
absorption at 562 nm observed in the phycobilisome fractions from
R. reticulata R6, was exhaustively purified. The absorption
maxima at 562 and 604 nm originate from PEB and PCB chromophores as
shown by the spectral properties obtained after denaturation with acid
9 M urea (absorption maxima at 550 and 662 nm,
respectively). No peaks or shoulders were visible in the 495 nm region,
indicating that the R. reticulata R6 PE is devoid of
PUB. The 77 K fluorescence emission spectrum exhibits a peak at 630 nm
that we attribute to the PCB chromophore functioning as a terminal
energy acceptor. Surprisingly, zinc-enhanced fluorescence from
bilin-linked chromophores was associated only with a 20-kDa subunit.
The 60- and 87-kDa linkers were non-fluorescent, thus appearing devoid
of chromophore. Two different linkers could correspond to two different
PE forms, but we find they account for two different aggregation states.
The spectral properties of the R. reticulata R6 PE are
distinct from other previously described PEs from red algae (9). First,
the R. reticulata R6 PE subunits are linked to unusually large colorless polypeptides. In all other rhodophytan PEs studied so
far, chromophoric linkers (the so-called
-type subunits), bearing
several PEB and PUB chromophores, were found (58), thus acting as
linkers as well as light-harvesting polypeptides (9). In contrast, the
PEs found in cyanobacteria are generally stabilized by colorless linker
polypeptides, although some exceptions are now known (59, 60). This
property shared by the majority of cyanobacterial PE linkers together
with the R. reticulata R6 PE linkers may reflect a primitive situation.
Until recently, all PEs were shown to utilize phycoerythrobilins acting
as terminal energy acceptors. However, in the primitive red algal
Audouinella and Chantransia strains (57), PEs
have been described with a 1:3:1 PCB/PEB/PUB chromophore ratio in which the blue chromophore (PCB) acts as the terminal energy acceptor of PE.
The spectral properties we observed for PCB in the R. reticulata R6 PE (absorption maximum at 604 nm and fluorescence
emission maximum at 630 nm) are very similar to those described for the Audouinella and Chantransia counterparts.
Although we did not directly determine the chromophore-binding site,
the PCB in the R. reticulata R6 PE is linked to the distal
CNBr fragment (from amino acids 135 to 177). Its deduced sequence
contains only one C (residue 158) homologous to the
-155 cysteinyl
residue which generally is a chromophore ligator. The spectral
properties for R6 PCB (absorption maximum at 604 nm and fluorescence
maximum at 629 nm) are similar to those deduced for the
-155 PCB
chromophore, in the C-phycocyanin of the cyanobacterium
Synechococcus sp. PCC 7002, as deduced by comparison to the
spectral properties of a cpcB/C155S mutant lacking PCB in
the
-155 position (61). To our knowledge, R6 PE is the first
reported exception to the rule (62, 63) of the
-84 chromophores
acting as the terminal energy acceptor in PBPs. It is likely that the
unique PCB chromophore is located also in the
-155 position in
Audouinella and Chantransia PEs.
That the
-subunit could be lacking from the R. reticulata
R6 PE was totally unexpected. Until now, no exception has been found to
a requirement of
- and
-subunits for phycobiliprotein assembly.
After Edman degradation, only one amino-terminal sequence was
identified, MLDAFSKVAVN, which is clearly related to a
-type amino-terminal sequence (17, 22, 45, 46, 59, 60, 64-69; see Fig. 7 for
sequence alignment). The five first amino acids (MLDAF) are shared by
almost all rhodophytan
-PE and
-PC subunit biliproteins, by
-PEC found only in cyanobacteria, and by some cyanobacterial
-PC
(12). Serine as the sixth residue is a universal marker for
-PEs,
including the prochlorophytan Prochlorococcus PE (17) and
for
-PEC. However,
-PEC has a negatively charged amino residue in
the tenth position, instead of an aliphatic one in
-PE.
Of the two internal sequences determined after CNBr cleavage, one
(MAACLRDGE) is characteristic of red algal PE (Fig. 7) but also is
found in marine cyanobacteria and Prochlorococcus
-PE (17, 68, 69). The corresponding sequence in cyanobacterial
-PEC is
GAACIRDLG (12). The second microsequence MKASSVAFV is not highly conserved.
Cloning and sequencing the plastid rpe operon from R. reticulata R6 confirms the occurrence of a unique rpeB
gene split into three exons. The occurrence of split genes is not
general in plastid rhodophytan genes. However, the R. violacea plastid rpeB gene (45) also has one group II
intron (340 nt), and a cis-splicing mechanism produces the
mature transcript. The same mechanism seems likely for R. reticulata R6 rpeB although no pre-mRNAs were
detected. By primer extension, the transcription start of R. reticulata R6 rpeB gene is localized 71 nt upstream
from the ATG initiation codon. Northern analyses using a part of the
downstream exon as a probe revealed only one 0.7-kb long transcript,
the expected size for the mature transcript between the determined
transcription start and the proposed terminator. There is no open
reading frame related to a rpeA gene following the
rpeB sequence. The size of the mature transcript is
consistent with a monocistronic rpe operon and the absence
of
-PE in R. reticulata R6.
Analysis of the R. reticulata R6
-PE amino acid sequence
shows it is 84-87% homologous to those of the
-PE subunits of
diverse cyanobacteria, red algae, and cryptomonads (Fig. 7; see Refs. 17, 22, 45, 46, 59, 60, and 64-69). Including conservative substitutions of amino acids, the sequence homology with red algal
-PE subunits ranges from 90 to 95%. The central portions (Fig. 7;
residues 71-140) of all
-PE subunits are particularly conserved, with homology reaching 95% in this region. This central region is also
highly conserved in the
-PC subunits, and there is 84% homology
between
-PE and
-PC subunits in R. reticulata
R6.2
Rhodophytan (58, 71) and cyanobacterial
-PE (63, 72) subunits carry
three bilin chromophores. Two of these are linked through single
thioether bonds to Cys-82 and Cys-159, and one bilin is doubly attached
at Cys-50 and Cys-61 (58, 63, 71, 72). In cyanobacterial and red algal
-PE sequences, only PEB has been found at Cys-82. Either PEB or PUB
is found at the other two bilin attachment sites (see Ref. 63). The
same bilin attachment sites are found in cryptophytan
-PE, but a
greater variety of bilins are found at these sites (16).
The bilins in the R. reticulata R6
-PE subunit were
localized by sequencing and spectral analysis of four fragments (14, 5, 6, and 4 kDa) obtained by CNBr cleavage. The first two (14 and 5 kDa)
shared the same amino-terminal sequence indicating that the 14-kDa
polypeptide results from incomplete CNBr cleavage. PEB was associated
with 14-, 5-, and 6-kDa CNBr peptides. Its spectral properties show
that the 4-kDa fragment represents the COOH terminus of the subunit and
that it bears the sole PCB in the R. reticulata R6
-PE
subunit, presumably at the sole cysteine residue in this region,
Cys-158 (Fig. 7). The only other instance of a phycoerythrin carrying a
PCB chromophore is that of the Audouinella and
Chantransia sp. phycoerythrins, which also carries the PCB on its
-subunit (57).
Other residues that appeared to be important in chromophore interaction
with the polypeptide side chain are present in R. reticulata
R6
PE, for instance Arg-77, Arg-78, Arg-84, Asp-85, and Ala-81 (24,
27, 28, 73, 74). With exception of Arg-78, these residues are
maintained in all
-type sequences. In R. reticulata R6
-PE, there are no tryptophan residues as has been found for all
other
sequences. Asn-72, present in most
-PE and in
-PE R6
also, and in some
-PC, has been shown (75) to be
post-translationally methylated. This modification is functionally
important in the efficiency of energy transfer. A histidine is in this
position in Prochlorococcus
-PE indicating possible
differences concerning PE in this organism.
Without an
-subunit in R. reticulata R6 phycoerythrin,
the question arises whether the
-subunit has a similar
three-dimensional structure to those of
-subunits in
"conventional" phycobiliproteins. That it probably does is
suggested from the high overall homology of its amino acid sequence
with that of
-subunits from the other phycobiliproteins (Fig. 7). By
modeling from published crystallographic data, we deduce the probable
presence of the X, Y, A, B, E, F, G, and H helical segments. Moreover,
residues important in 
heterodimer formation such as Asp-13 and
Arg-91, which contribute to ionic interactions between the
- and
-subunits, and Tyr-92 and Asp-3, also important for
-
interactions, are conserved in R. reticulata R6
-PE. On
the other hand, Asp-3 which has been claimed to play a role in
preventing 
homodimerization (12) is present. However, we cannot
exclude 
interactions, although the models derived from
crystallographic data would argue against this. Alternatively, there
could be specific interactions between the R. reticulata R6
-PE subunits and specific domains within the unusually large linker
polypeptides, PE-LR60 and
PE-LR87. For example, a domain of a large
core-membrane linker polypeptide, the LCM, forms a
component of a trimeric allophycocyanin complex within the core of
cyanobacterial phycobilisomes (3). Further studies, particularly
determination of the amino acid sequences of the
LR60 and LR87 linkers,
are necessary to distinguish between these possibilities.
Linkers and Aggregation States--
We found that the R. reticulata R6 PE is recovered in two different aggregates (184 and
300 kDa) and is associated, respectively, with 60- and 87-kDa colorless
linkers. These molecular weight values are in a good accordance with a
hexameric (
6LR60) and a
dodecameric (
12LR87) assembly,
analogous to trimeric (
)3L and hexameric
(
)6L states described so far for numerous
phycobiliproteins (9, 36, 51, 76-78), excepting the
(
)2 organization of cryptophytan biliproteins (8, 16,
79) that are not associated with linkers. The unusual size of the two
linkers raises questions about the position of these linkers in the
aggregate. In phycocyanin, it is well established that the cavity
within the hexameric structure is large enough to bury the larger part
of the 30-35-kDa apparent molecular mass linkers (78) leaving an
exposed COOH domain in the (
)nL aggregate. In
phycoerythrins, the structure is similar, but, as determined recently
by comparison of crystallographic structure of B- and b-phycoerythrin
from Porphyridium sp., the
-subunit in B-PE is located
inside (
)6 hexamers (29) and probably not protruding
out of the hexamers.
Conclusion--
The main properties of the phycoerythrin from the
unicellular red alga R. reticulata R6 are that it has only
chains encoded by a monocistronic plastid gene and that they are
organized into two aggregation states (hexameric and dodecameric)
stabilized by linker polypeptides significantly larger than linkers
usually described for these complexes. Although 
chain
interactions might occur, the two linker polypeptides alternatively
might act as
chain substitutes. If the linkers contain peptide
domains related to phycobiliprotein sequences, a mosaic origin for
these polypeptides, involving fusion of chloroplast and nuclear
components, can be considered. However, we cannot yet exclude 
chain interactions. The cryptophytan biliproteins, with nuclear-encoded
-subunits of unique structure, are thought to be a primitive system
(16), which might loosely parallel R. reticulata R6
phycoerythrin. Further analyses at the molecular levels of the two
linkers are an essential next step for understanding the structural
features of the novel R. reticulata R6 PE.
 |
ACKNOWLEDGEMENTS |
We thank Anne Mousseau for expert
contribution in biochemical experiments; Annette Joder for cultures of
Rhodella reticulata R6; and our colleagues of the laboratory
headed by Anne-Lise Etienne, particularly Catherine Richaud, for
discussions and comments throughout this work. We are greatly indebted
to François Michel for help with the interpretation of the
non-coding sequences. We also thank Alexander N. Glazer for deep
attention and for fruitful discussions during a meeting in our laboratory.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Ecole Normale
Superieure Laboratoire de Photoregulation 46, Rue d'Ulm 75230 Paris Cedex 05, France. Tel.: 44-32-35-28; Fax: 44-32-35-39;
E-mail: jcthomas{at}biologie.ens.fr.
The abbreviations used are:
PBP, phycobiliprotein; PUB, phycourobilin; APC, allophycocyanin; PC, phycocyanin; PCB, phycocyanobilin; PE, phycoerythrin; PEB, phycoerythrobilin; PCB, phycocyanobilin; PBS, phycobilisome; L, linker
polypeptide; C-PC, C-phycocyanin; PEC, phycoerythrocyanin; kb, kilobase
pair; PCR, polymerase chain reaction; nt, nucleotide(s); LiDS-PAGE, lithium dodecylsulphate-polyacrylamide gel electrophoresis; Tricine, N-[2-hydroxy-1,1-bis(hydroxy-
methyl)ethyl]glycine.
2
J. C. Thomas and C. Passaquet, manuscript
in preparation.
 |
REFERENCES |
-
Bryant, D. A.
(1991)
in
Cell Culture and Somatic Cell Genetics of Plants (Bogorad, L., and Vasil, I. K., eds), Vol. 7B, pp. 257-300, Academic Press, New York
-
Gantt, E.
(1986)
in
Photosynthesis III. Encyclopedia of Plant Physiology New Series (Staehelin, L. A., and Arntzen, C., eds), Vol. 19, pp. 260-268, Springer-Verlag, Berlin
-
Glazer, A. N.
(1985)
Annu. Rev. Biophys. Biophys. Chem.
14,
47-77[CrossRef][Medline]
[Order article via Infotrieve]
-
Glazer, A. N.
(1987)
in
The Cyanobacteria (Fay, P., and van Baalen, C., eds), pp. 69-94, Elsevier/North-Holland Biomedical Press, Amsterdam
-
Glazer, A. N.
(1989)
J. Biol. Chem.
264,
1-4[Free Full Text]
-
Grossman, A. R.,
Shaefer, M. R.,
Chiang, G. G.,
and Collier, J. L.
(1993)
Microbiol. Rev.
57,
725-749[Abstract/Free Full Text]
-
Grossman, A. R.,
Bhaya, D.,
Apt, K. E.,
and Kehoe, D. M.
(1995)
Annu. Rev. Genet.
29,
231-288[CrossRef][Medline]
[Order article via Infotrieve]
-
MacColl, R.,
and Guard-Friar, D.
(1987)
Phycobiliproteins, pp. 1-219, CRC Press, Inc., Boca Raton, FL
-
Sidler, W.
(1994)
in
The Molecular Biology of Cyanobacteria. (Bryant, D. A., ed), pp. 139-216, Kluwer Academic Publishers Group, Dordrecht, Netherlands
-
Zuber, H.,
Brunisholz, R.,
and Sidler, W.
(1987)
in
Photosynthesis: New Comprehensive Biochemistry (Amesz, J., ed), Vol. 15, pp. 233-271, Elsevier Science Publishers B.V., Amsterdam
-
Ducret, A.,
Sidler, W.,
Frank, G.,
and Zuber, H.
(1994)
Eur. J. Biochem.
221,
563-580[Medline]
[Order article via Infotrieve]
-
Apt, K. E.,
Collier, J. L.,
and Grossman, A. R.
(1995)
J. Mol. Biol.
248,
79-96[CrossRef][Medline]
[Order article via Infotrieve]
-
Gillot, M. A.,
and Gibbs, S. P.
(1980)
J. Phycol.
16,
558-568[CrossRef]
-
Gibbs, S.
(1981)
Ann. N. Y. Acad. Sci.
361,
193-208[Medline]
[Order article via Infotrieve]
-
Douglas, S. E.,
Murphy, C. A.,
Spenser, D. F.,
and Gray, M. W.
(1991)
Nature
130,
148-151
-
Glazer, A. N.,
and Wedemayer, G. J.
(1995)
Photosynth. Res.
46,
93-105
-
Hess, W. R.,
Partensky, F.,
Van Der Staay, G. W.,
Garcia-Fernandez, M.,
Börner, T.,
and Vaulot, D.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
11126-11130[Abstract/Free Full Text]
-
Tandeau de Marsac, N.,
and Houmard, J.
(1993)
FEMS Microbiol. Rev.
104,
119-189[CrossRef]
-
Egelhoff, T.,
and Grossman, A. R.
(1983)
Proc. Natl. Acad. Sci. U. S. A.
80,
3339-3343[Abstract/Free Full Text]
-
Apt, K. E.,
Hoffman, N.,
and Grossman, A. R.
(1993)
J. Biol. Chem.
268,
16208-16215[Abstract/Free Full Text]
-
Bernard, C.,
Etienne, A. L.,
and Thomas, J. C.
(1996)
J. Phycol.
32,
265-271[CrossRef]
-
Reith, M.,
and Douglas, S.
(1990)
Plant Mol. Biol.
15,
585-592[CrossRef][Medline]
[Order article via Infotrieve]
-
Jenkins, J.,
Hiller, R., G.,
Speirs, J.,
and Godovac-Zimmermann, J.
(1990)
FEBS Lett.
273,
191-194[CrossRef][Medline]
[Order article via Infotrieve]
-
Schirmer, T.,
Bode, W.,
Huber, R.,
Sidler, W.,
and Zuber, H.
(1985)
J. Mol. Biol.
184,
257-277[CrossRef][Medline]
[Order article via Infotrieve]
-
Schirmer, T.,
Huber, R.,
Schneider, M.,
Bode, W.,
Miller, M.,
and Hackert, M. L.
(1986)
J. Mol. Biol.
188,
651-676[CrossRef][Medline]
[Order article via Infotrieve]
-
Schirmer, T.,
Bode, W.,
and Huber, R.
(1987)
J. Mol. Biol.
196,
677-695[CrossRef][Medline]
[Order article via Infotrieve]
-
Duerring, M.,
Huber, R.,
Bode, W.,
Ruembeli, R.,
and Zuber, H.
(1990)
J. Mol. Biol.
211,
633-644[CrossRef][Medline]
[Order article via Infotrieve]
-
Ficner, R.,
Lobeck, K.,
Schmidt, G.,
and Huber, R.
(1992)
J. Mol. Biol.
228,
935-950[CrossRef][Medline]
[Order article via Infotrieve]
-
Ficner, R.,
and Huber, R.
(1993)
Eur. J. Biochem.
218,
103-106[Medline]
[Order article via Infotrieve]
-
Brejc, K.,
Ficner, R.,
Huber, R.,
and Steinbacher, S.
(1995)
J. Mol. Biol.
249,
424-440[CrossRef][Medline]
[Order article via Infotrieve]
-
Chang, W.,
Jiang, T.,
Wan, Z.,
Zhang, J.,
Yang, Z.,
and Liang, D.
(1996)
J. Mol. Biol.
262,
721-731[CrossRef][Medline]
[Order article via Infotrieve]
-
Fresnel, J.,
Billard, C.,
Hindak, F.,
and Pekàrkova, B.
(1989)
Plant Syst. Evol.
164,
253-262[CrossRef]
-
Starr, A. R.
(1978)
J. Phycol.
14 (suppl.),
47-100[CrossRef]
-
Yamanaka, G.,
Glazer, A., N.,
and Williams, R. C.
(1978)
J. Biol. Chem.
253,
8303-8310[Abstract/Free Full Text]
-
Mörschel, E.,
Koller, K. P.,
and Wehrmeyer, W.
(1980)
Arch. Microbiol.
125,
43-51[CrossRef]
-
Yu, M., H.,
Glazer, A., N.,
and Williams, R. C.
(1981)
J. Biol. Chem.
256,
13130-13136[Abstract/Free Full Text]
-
Martin, R. G.,
and Ames, B. N.
(1961)
J. Biol. Chem.
236,
1372-1379[Free Full Text]
-
Glazer, A. N.
(1988)
Methods Enzymol.
167,
291-312[Medline]
[Order article via Infotrieve]
-
Judd, R. C.
(1990)
Methods Enzymol.
182,
613-626[Medline]
[Order article via Infotrieve]
-
Garnier, F.,
Dubacq, J. P.,
and Thomas, J. C.
(1994)
Plant Physiol. (Bethesda)
106,
747-754[Abstract]
-
Schagger, H.,
and von Jagow, G.
(1987)
Anal. Biochem.
166,
368-379[CrossRef][Medline]
[Order article via Infotrieve]