JBC Focus on PI3-Kinase with Echelon

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thomas, J.-C.
Right arrow Articles by Passaquet, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thomas, J.-C.
Right arrow Articles by Passaquet, C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 274, Issue 4, 2472-2482, January 22, 1999


Characterization of a Phycoerythrin without alpha -Subunits from a Unicellular Red Alga*

Jean-Claude ThomasDagger and Chantal Passaquet

From the Laboratoire de Photorégulation et Dynamique des Membranes Végétales, CNRS, Unité de Recherche Associée 1810, GDR 1002, Ecole Normale Supérieure, 46 rue d'Ulm, 75 230 Paris Cedex 05, France

    ABSTRACT
Top
Abstract
Introduction
References

We describe here the spectral and biochemical properties of a novel biliprotein belonging to the phycoerythrin family, purified from the phycobilisome of a unicellular red alga, Rhodella reticulata strain R6. This biliprotein is assembled from a unique beta -type subunit, chloroplast-encoded, whose hexameric or dodecameric aggregates are stabilized by unusually large linkers (87 and 60 kDa) encoded by the nuclear genome. Although each beta -type subunit bears two phycoerythrobilins and one phycocyanobilin per chain, the linker polypeptides are non-chromophorylated. The apoprotein of the beta -subunit of the R. reticulata R6 phycoerythrin is specified by a monocistronic rpeB chloroplast gene that is split into three exons. We discuss the relationships between R6 beta -phycoerythrin and the previously published polypeptide sequences, the structural consequences due to the absence of an alpha -subunit, and its evolutionary implications.

    INTRODUCTION
Top
Abstract
Introduction
References

Light is efficiently collected in the prokaryotic cyanobacteria and the eukaryotic Rhodophyta (red algae) by phycobiliproteins (PBP)1 assembled into macromolecular structures, the phycobilisomes (PBS), found on the outer thylakoidal membranes as extrinsic components (1-10). Phycobiliproteins are oligomeric proteins, built up from two chromophore-bearing polypeptides belonging to two families (alpha  and beta ) probably originating from a common ancestor but which apparently diverged early in evolution (11, 12). In PBS, the phycobiliproteins are stabilized by linker polypeptides (L) that are generally colorless. The aggregation states of linker-biliprotein complexes have been typically found as (alpha beta )3L or (alpha beta )6L. In cyanobacteria and Rhodophyta, four main classes of biliproteins exist as follows: allophycocyanin (APC), phycocyanin (PC), phycoerythrin (PE), and phycoerythrocyanin (PEC); this last group was found only in cyanobacteria. In other eukaryotes, the unicellular Cryptophyta (or Cryptomonads), resulting from a secondary endosymbiosis (13, 14) between a red algal cell and a colorless eukaryote (15), only one type of biliprotein is synthesized and localized in the thylakoid lumen (8, 16); the beta -subunit is typical of the rhodophytan beta -PE whereas the alpha -subunit is unlike other PBPs. It is isolated as dimeric (alpha beta )2 aggregates. Recently, PE has been described at the genomic level in another group of prokaryotic organisms, belonging to the cyanobacterial radiation, the prochlorophyte Prochlorococcus marinus (17), but the biochemical characteristics and the intracellular localization of this pigment have not been investigated.

The spectral properties of PBP are due to bilins, linear tetrapyrroles covalently linked to specific cysteinyl residues of the polypeptidic chains by means of one (or less frequently two) thioether bonds. Due to differences in PBP bilin composition, light may be efficiently collected from the blue-green edge to the red part of the visible light spectrum. Moreover, the light absorption properties of the different tetrapyrroles are modulated by molecular interactions with the apoprotein chains in monomers (alpha beta ), in oligomers, and with the specific linker polypeptides.

In prokaryotic organisms (cyanobacteria and Prochlorophyta), the genes for the apoproteins of the two polypeptide chains of a given biliprotein are polycistronic that can be transcribed with genes for specific linker polypeptides as well as for subunits of lyases for chromophore linkage. Cotranscription of the two genes encoding apoproteins is always observed (1, 6, 9, 18). In the eukaryotic Rhodophyta, the PBS apoproteins are encoded by the chloroplast genome, but linkers of the outer PBP (for instance PE linkers, when this pigment present) are nuclear-encoded (19-21). Data from Cryptophyta showed that the beta -subunit of the unique PBP is chloroplast-encoded (22), whereas the alpha -subunit is specified by the nucleus (23) or by the residual nucleus of the first eukaryotic red algal symbiont, the so-called nucleomorph (as proposed in Ref. 9).

During the past 10 years, high resolution crystallographic data have been obtained for representatives of the major groups of phycobiliproteins mentioned above (PC, PEC, PE, and APC). To date, no detailed crystallographic data have been published on cryptophytan biliproteins. For each of the phycobiliproteins, details of the structural interactions between the alpha - and beta -subunits have been delineated (24-31). Such interactions are essential for assembly of alpha beta monomers and of the higher order (alpha beta )3 trimers and (alpha beta )6 hexamers. It has generally been assumed that phycobiliproteins cannot be assembled from only one type (alpha  or beta ) of subunit.

We describe here an unusual biliprotein belonging to the PE family from the unicellular red alga Rhodella reticulata strain R6. This unique PE, in association with C-PC and APC, forms phycobilisomes similar to the hemidiscoidal type found in cyanobacteria and in some unicellular Rhodophyta. This PE can be purified as hexamers and dodecamers containing only beta -type subunits, which are stabilized by unusually large, colorless, linker polypeptides (60 and 87 kDa, respectively) specified by the nuclear genome. Moreover, we show that the beta -subunit is encoded by a monocistronic chloroplast gene, interrupted by two large intronic sequences, one of which is related to a typical group II intron.

    EXPERIMENTAL PROCEDURES

Organisms and Culture Conditions-- R. reticulata strain R6 (Rhodella grisea (Geitler) Fresnel et al. (32)) was collected in 1983 by C. Billard (Caen University France) from seawater samples from Sarasota Bay, FL, and kindly provided by C. Billard. Two other closely related strains were obtained from the UTEX collection: R. reticulata Deason (UTEX LB 2320) and Dixoniella grisea (Geitler) Scott et al. (UTEX LB2615) (as R. reticulata Deason) for comparison. The two last strains were independent isolates from the U. S.

Culture Conditions-- All strains were grown on Erdschreiber liquid medium (33) in Erlenmeyer flasks, bubbled with sterile water-saturated air, and exposed to 50 µmol photons m-2 s-1 of cool fluorescent light under a 16/8 light-dark cycle.

Phycobiliprotein Purification-- Phycobilisomes were isolated by modifications of the procedure of Yamanaka et al. (34). Typically, exponentially growing cells from 1 liter of culture were collected by centrifugation (4,500 × g, 10 min, Kontron A8.24 rotor), rinsed twice with potassium/sodium phosphate buffer 0.75 M, pH 7, 1 mM EDTA, 1 mM benzamidine (buffer I), resuspended in 40 ml of the same buffer, dispersed with a Thoma homogenizer, and submitted to a French press treatment (Aminco Corp.) operating at 12,000 p.s.i. Phenylmethylsulfonyl fluoride in solution in isopropyl alcohol (1 mM final concentration) and Triton X-100 (5% w/v) were added to the broken cells, and incubation with stirring was for 45 min at room temperature. The cell lysate was centrifuged (27,000 × g, 15 min. 15 °C, Kontron A8.24 rotor). The pellet and the upper "cream" were discarded while 3% Triton (w/v) was added to the intermediate blue-violet layer, rapidly mixed, and layered (6 ml) onto a 0.25 to 1 M discontinuous sucrose gradient in buffer I with 6-ml fractions of 0.25, 0.5, 0.625, 0.75- and 1 M sucrose and centrifuged (100,000 × g, 16 h 12 °C, Beckman SW 28 rotor). The intact PBS fraction corresponding to >95% of the total pigments was collected in the 0.625 M sucrose layer and used for subsequent analysis, whereas small aggregates (<5% total pigments) banded in the 0.25 to 0.5 M sucrose layers.

PBS dissociation was achieved as described for Rhodella violacea (35) with modifications. The PBS fraction was diluted 1:3 with buffer I and pelleted by centrifugation (210,000 × g, 6 h, 4 °C, Beckman Ti60 rotor). The pellet was dissolved in 5 mM potassium phosphate buffer, pH 7, containing 10% (v/v) glycerol (buffer II) and dialyzed overnight at 4 °C in the dark. Inhibitors of protease activity (1 mM benzamidine, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride) were added at all experimental steps. The dialysate was layered onto a linear sucrose density gradient (5-20% sucrose, 20 mM phosphate, pH 7, 10% glycerol) and centrifuged (100,000 × g, 15 h, 4 °C, Beckman Ti60 rotor). Pigment aggregates banded in two main fractions and were collected with a syringe; the upper third was blue-colored (fraction A), and the lower two-thirds were pink-violet (fraction B). A small pellet was also collected, but its composition was found similar to fraction B. Fractions A and B were dialyzed separately against potassium phosphate buffer (5 mM, pH 7) containing 10% glycerol (v/v) (buffer III), and each fraction was subjected to chromatography on a column (16 × 250 mm) of DEAE-cellulose (Whatman DE52) prepared according to the manufacturer's instructions and equilibrated with buffer II. The columns were developed with a potassium phosphate linear gradient (5-150 mM, 120 ml each) including 1 mM beta -mercaptoethanol, protease inhibitors at the same concentration as above, and 10% glycerol at 4 °C in the dark (36). The pigment complexes from each major elution peak were pooled and concentrated by centrifugation (160,000 × g, 15 h, Kontron TFT70 rotor) and resuspended in a minimal volume of buffer II. Aliquots (4 ml) were then loaded onto linear sucrose density gradients (5-20% sucrose w/v in buffer III; total volume, 26 ml) and centrifuged (160,000 × g, 16 h 30, 4 °C, Kontron TFT70 rotor). The trimeric aggregates of blue pigments (PC and APC) were collected from the middle third of the gradient, whereas larger aggregates with pink-violet PE were in the lower third.

Pure fractions of PE, as judged by their electrophoretic composition were concentrated by centrifugation after 2-fold dilution with buffer II (160,000 × g, 16 h 30, 4 °C, Kontron TFT70 rotor), and the pellets solubilized in a minimal volume of buffer II were used for characterization of the two forms of PE (see below).

Separation of PE I (PE-LR60) and PE II (PE-LR87) and Calibration-- The pure PE-containing fraction was subjected to centrifugation (260,000 × g, 24 h, 4 °C, Beckman SW41 rotor) on a linear sucrose density gradient (5-20% sucrose w/v in buffer III). Proteins of known molecular mass: catalase (240 kDa), alcohol dehydrogenase (150 kDa), and bovine serum albumin (67 kDa) were used as standards. The gradient was then fractionated using a Isco 185 density gradient fractionator. The absorbance of fractions (180 µl each) was measured at 550 and 280 nm. The apparent molecular weight of pigment aggregates were calculated according to Martin and Ames (37). Two forms of PE, associated, respectively, with two different colorless polypeptides (PE-LR60 and PE-LR87), were thus separated.

Spectroscopic Studies-- Absorption spectra were recorded on a DW2 Aminco spectrophotometer. 77 K fluorescence emission spectra were obtained with a F3010 Hitachi spectrofluorometer equipped with a Dewar device.

Bilin Analyses-- Bilin quantitation was made with samples denatured in 9 M urea at pH 2, using the millimolar extinction coefficients of 53.7 and 0 mM-1 cm-1 for phycoerythrobilin at 550 and 662 nm, respectively, and 6.0 and 35.4 mM-1 cm-1 for phycocyanobilin at the same wavelengths (38).

Chemical Cleavage by Cyanogen Bromide-- Aliquots (100-200 µg) of proteins in buffer II were precipitated with trichloroacetic acid (10% w/v final concentration), and pellets were dissolved in 70 µl of 70% formic acid (v/v) in water and, after complete solubilization, CNBr crystals were added (39). The reaction vessel was flushed with gaseous N2 and sealed. The reaction was carried out overnight at room temperature. The reaction was quenched by addition of 630 µl of H2O, and the samples were lyophilized. Control samples were subjected to the formic acid treatment alone.

Gel Electrophoresis and Peptide Sequencing-- LiDS-PAGE was performed on protein aliquots (20-100 µg) after precipitation with trichloroacetic acid (10% final concentration) on 9-18% acrylamide gradient gels (40). For the resolution of low molecular weight polypeptides after CNBr cleavage, the Tris-Tricine system (41) was used as described previously (40). For the visualization of chromophore-bearing peptides, the gels were soaked in 20 mM zinc acetate for 5 min (42). The fluorescent zinc-bilin complexes were visualized at 312 nm with a transilluminator (Vilbert Lourmat France). After electrophoresis, the peptides were stained in situ by Coomassie Blue G-250 (0.1% in 9% acetic acid, 45% methanol) and destained (7.5% acetic acid, 30% methanol) before blotting onto Immobilon P membrane (Millipore, Bedford, MA) by a liquid transfer system (TE, Hoefer, San Francisco) with Tris (50 mM) borate (50 mM) in 10% methanol as electrophoresis buffer and a constant current of 6 mA for 2 h at room temperature. After transfer, the peptides were stained with Amido Black (0.1% w/v) in methanol/acetic acid (10:2%), and excess stain was removed (45% methanol, 7% acetic acid), then 90:7% for 5 s. Sequence analyses were performed on an Applied Biosystems 473 A sequencer at the Laboratoire de Microséquençage des Proteines, Institut Pasteur, Paris, France.

Genomic Library Construction and Hybridization-- Total DNA from R. reticulata R6 was isolated by procedures described for chromophyte algae (43) except the two CsCl density gradients were adjusted to 1.570 g/cm3 to separate plastid and mitochondrial DNA from nuclear DNA. Plastid DNA libraries were constructed by respectively ligating DNA digests with EcoRI or PstI into EcoRI or PstI cloning sites in pTZ18. Standard methods (44) were used for Southern blotting and in situ colony hybridization using randomly labeled probes.

rpeB Probe Preparation-- Two heterologous probes were prepared from R. violacea DNA by PCR using four synthetic oligonucleotides designed from the R. violacea rpeB gene sequence (45) as follows: oligonucleotide I, 5'ATGCTAGATGCATTTTCAAGA3'; oligonucleotide II, 3'TAATCCGTTTAAACATCTGTCTTC5'; oligonucleotide III, 5'ATGGCTGCTTGCTTACGTGACGGA3'; and oligonucleotide IV, 3'TAAAGCTACAACAGAAGCTTTCAT5'. PCR amplification was done with R. violacea plastid DNA (0.5 mg, one cycle at 94 °C for 5 min, 35 cycles at 94 °C, 55 and 72 °C for 45 s for each step and one final elongation cycle for 5 min) using Tfi polymerase (Promega Corp. Madison, WI). PCR products obtained corresponding to 679 (probe I) or 189 (probe II) base pairs using the I and II coupled oligonucleotides and III and IV, respectively, were used in Southern or library heterologous hybridizations.

DNA Sequencing-- The DNA sequences of both strands were determined by the dideoxyribonucleotide chain termination method using the Sequenase 2.0 system (U. S. Biochemical Corp.) and [alpha -33P]dATP with double-stranded DNA.

RNA Isolation and Northern Hybridization-- Total RNA was isolated as described for cyanobacteria (46). RNA (5 µg) was electrophoresed in 1.2% denaturing agarose gels in HF buffer (0.5 M Hepes, 10 mM EDTA, 16% formaldehyde) and transferred to nylon membranes (Hybond-N, Amersham Pharmacia Biotech). Hybridization was at 42 °C with probes as described under "Results."

cDNA Cloning and Sequencing-- To sequence cDNA in the junction between the exons and introns, we performed coupled reverse transcription and PCR amplification; R. reticulata R6 total RNA (5 mg) was used with 0.02 pmol of strict oligonucleotides (see "Results": rpeB gene cloning and sequencing), 400 units of reverse transcriptase (Life Technologies, Inc.) in the presence of 20 nmol of each dNTP and 20 units of RNasin (Promega). The reaction was allowed to proceed for 30 min at 37 °C and then inhibited for 5 min at 95 °C. Amplification was performed on the retrotranscription product using a second complementary oligonucleotide as forward primer and the first one as reverse primer. The PCR protocol was the same as above.

5' mRNA Determination-- Primer extension was performed for mapping of the 5' terminus of the rpe mRNA using a strictly complementary 24-mer synthetic oligonucleotide (from nt 1468 to 1441): 5'TCCGTCCCTTAAACAGGCGGCCAT3'. 30 µg of total RNA from an R. reticulata R6 exponential culture were used in the primer extension method described by Sambrook et al. (44) modified as in Richaud and Zabulon (47). After ethanol precipitation, the sample was loaded on a sequencing gel together with a sequence standard (pTZ18) in a parallel lane to determine the size of the hybrid.

    RESULTS

Phycobilisome and Biliprotein Characterization-- After release of R. reticulata R6 phycobilisomes by Triton X-100 treatment of cell lysates, they were recovered from the 0.625 M sucrose layer. They exhibited characteristic absorption features of PEB- and PCB- containing biliproteins (Fig. 1) with a single peak at 562 nm originating from the PEB-containing putative phycoerythrin while absorption maxima at 612 and 650 nm (as a shoulder) were attributed to phycocyanin and allophycocyanin, respectively. No shoulder was observed in the 495 nm region, indicating the probable absence of PUB-type chromophores.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 1.   Absorption (293 K) and fluorescence (77 K) emission spectra of R. reticulata R6 intact PBS in 0.75 M potassium/sodium-phosphate buffer, 0.625 M sucrose, pH 7. For fluorescence emission spectrum, PBS at an OD560 nm = 0.1 were absorbed on Millipore glass-fiber prefilters and directly cooled in liquid nitrogen. Absorption spectrum, solid line. Fluorescence emission spectrum, dotted line.

The 77 K fluorescence emission spectrum (Fig. 1) exhibited a main peak at 685 nm from the terminal energy acceptors of the phycobilisome and minor peaks at 629 and 651 nm and a 660 nm shoulder. The 651-nm fluorescence peak and the 660 nm shoulder were attributable to uncoupled phycocyanin and allophycocyanin, respectively, but it was not possible before further subfractionation of the main biliproteins to determine the origin of the 629-nm fluorescence peak.

We determined the R. reticulata R6 PBS polypeptide composition by LiDS-PAGE (Fig. 2, lane 7). The main biliprotein subunits were in the 15-20-kDa range, the LCM was at 95 kDa, and three linkers were 87, 60, and 30 kDa apparent molecular mass, respectively (Fig. 2, lane 7). After zinc acetate treatment, only the biliprotein subunits and the LCM appeared fluorescent (Fig. 2, lane 8) under UV excitation. The three linker polypeptides (87, 60 and 30 kDa) were clearly non-chromophorylated.


View larger version (65K):
[in this window]
[in a new window]
 
Fig. 2.   Polypeptide composition of PBS and PBP fractions determined by LiDS-PAGE. Lanes 1-7, Coomassie Blue staining. Lane 8, bilin fluorescence in presence of zinc acetate. Lanes 1-6, purified PBP. Lanes 7 and 8, PBS. Lane 1, PC + LRC 30. Lane 2, phycoerythrin. Lanes 3 and 4, PE + LR60. Lanes 5 and 6, PE + LR87. Lanes 3-6, fractions 30, 35, 40, 45, respectively, from the sucrose density gradient centrifugation (see Fig. 4, lower panel).

We verified, by labeling experiments of PBS polypeptides in the presence of chloroplastic and cytoplasmic ribosomal translational inhibitors (chloramphenicol and cycloheximide, respectively) as described previously for R. violacea (21), that all the polypeptides of the R. reticulata R6 PBS were chloroplast-encoded. Synthesis of the two PE colorless linkers was blocked by cycloheximide but not by chloramphenicol and therefore are nuclear-encoded (data not shown) as typically is the case for PE linkers in red algae (19-21).

The R. reticulata R6 phycobilisome subcomponents were resolved after gentle dissociation of purified intact particles. Two main fractions were obtained in continuous sucrose gradients. The upper layer (fraction A) contained trimeric aggregates of C-phycocyanin and allophycocyanin and also a minor PE component of low molecular weight (data not shown). The lower part (fraction B) was largely enriched in phycoerythrin but also contained LRC-PC complexes and a LCM-APC complex (see below). Upon DEAE-cellulose chromatography of the fraction B, three main components were eluted (Fig. 3) with increasing phosphate concentration (35, 65, and 110 mM respectively). The two first peaks were identified as the LCM-APC and LRC-PC complexes and the third one as a PE-like pigment.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 3.   DEAE-cellulose chromatography elution profile of the phycobiliproteins of the fraction B (from dissociation of R. reticulata R6 phycobilisomes). The OD of each fraction has been measured at 650 nm (open circle ), 615 nm (- - -), and 550 nm (bullet ). The phycobiliproteins were eluted by linear gradient of potassium phosphate buffer, pH 7 (5-250 mM, 1 mM 2-mercaptoethanol), containing 10% glycerol. Three main fractions corresponding to APC + LCM, PC-LRC complexes, and PE fractions (PE-LR60 + PE-LR87) were eluted, respectively, at 35, 65, and 110 mM phosphate concentration (determined from the conductivity curve (mS).

The different fractions were pelleted separately, and the final step of PC and PE purification was carried out by ultracentrifugation on linear (5-20%) sucrose density gradients (data not shown). Electrophoretic data confirmed the purity of the LRC-PC fraction (Fig. 2, lane 1), and in the PE fraction, two non-chromophoric linkers of 87- and 60-kDa apparent molecular mass (Fig. 2, lanes 2-6) were found in addition to the PE subunits in the 20-kDa range. Surprisingly, as previously mentioned, the two PE linkers were clearly non-chromophorylated (Fig. 2, lane 8).

Two distinct complexes of PE (PE I and PE II) were successfully resolved by sedimentation through a linear sucrose density gradient (Fig. 4, lower panel). Based on a calibration of the sucrose density gradient with proteins of known molecular weight, PE I was determined to be 184 kDa and PE II to be 300 kDa. The 60-kDa linker (LR60) was found in PE I and the 87-kDa linker (LR87) in PE II. Consequently, these complexes have designated PE-LR60 and PE-LR87, respectively.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 4.   Sucrose density gradient purification of PE fractions and their spectral analysis. Upper part, sucrose density gradient centrifugation of PE-LR60 and PE-LR87, compared with standards as follows: bovine serum albumin (Mr 67,000), alcohol dehydrogenase (Mr 150,000), and catalase (Mr 240,000). Lower part, absorbance of PE fractions from sucrose gradient centrifugation at 280 nm. The fractions (180 µl each) were collected and analyzed by LiDS-PAGE (see Fig. 2).

Spectral Properties-- The spectral characteristics of the PC and PE pigments were analyzed. The data clearly showed that PC is a C-phycocyanin type, with alpha - and beta -subunits bearing phycocyanobilin chromophores with an absorption maximum at 622 nm and 77 K fluorescence emission at 651 nm (not shown).

PE I and PE II pigments were indistinguishable with respect to their spectral properties with absorption maxima at 562 and 604 nm, respectively (Fig. 5). When denatured in acidic 9 M urea, the protein absorption maxima were shifted to 550 and 662 nm (data not shown), demonstrating that the 562-nm peak in the native pigment originated from phycoerythrobilin and the 604-nm peak from phycocyanobilin chromophores, with a PEB/PCB molar ratio of 1.9. The 77 K fluorescence emission peak at 630 nm (Fig. 5) clearly arises from the phycocyanobilin chromophore of PE. Thus, we ascribe the 629 nm peak in the 77 K PBS fluorescence emission spectrum in Fig. 1 to uncoupled phycoerythrin.


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 5.   Absorption (293 K) and fluorescence (77 K) emission spectra of R. reticulata R6 PE-LR87 in potassium phosphate buffer, pH 7, 10% glycerol. For fluorescence emission spectrum, PE at an OD560 nm = 0.1 was absorbed on glass fiber Millipore prefilters and directly cooled in liquid nitrogen. Solid line, absorption. Dotted line, fluorescence. The two forms (PE-LR60 and PE-LR87) had identical spectral properties (not illustrated for PE-LR60).

Characterization of PE Subunit Composition-- Because of two types of chromophores linked to the subunits of R. reticulata R6 PE, we examined the chromophore composition of each putative subunit (alpha  and beta ). Pure PE I and PE II fractions were separately denatured by acidic 2 M urea and submitted to weak cation exchange chromatography on Bio-Rex 70. In each case, a single colored fraction was eluted with 9 M urea (data not shown). No pigmented polypeptides were obtained with 8 M urea.

Microsequencing and Chemical Cleavage of PE Subunit-- CNBr chemical cleavage was performed on the 9 M urea Bio-Rex fraction. The electrophoretic pattern of cleavage products is shown in Fig. 6. All peptides were chromophore-linked (Fig. 6), and their amino-terminal sequences were determined. The main fragments (6 and 4 kDa) gave the amino sequences MAACLRD and MKASSVA, respectively. The amino-terminal sequence of the minor components (14 and 5 kDa) were identical to the unique amino-terminal sequence of the native polypeptide, i.e. MLDAFKSSVA. We infer that these two peptides were generated by partial cleavage. The amino-terminal sequence was unequivocally of a beta -PE type (Fig. 7).


View larger version (41K):
[in this window]
[in a new window]
 
Fig. 6.   Cyanogen bromide (CNBr) chemical cleavage of the R. reticulata R6 beta -PE polypeptide. Left, Coomassie Blue G-250 staining. Right, bilin fluorescence in the presence of zinc acetate. Lane 1, native beta -PE. Lane 2, CNBr peptides derived from beta -PE. Molecular mass markers are on the left; the peptides used for microsequencing are indicated on the right and noted by their apparent molecular weight. frag., fragment.


View larger version (87K):
[in this window]
[in a new window]
 
Fig. 7.   Comparison of amino acid sequences of beta -PE apoproteins from different organisms. Sequences were aligned with the Citi 2 program (Pierre et Marie Curie University, Paris) and optimized by introduction of gaps (-). Amino acid positions are indicated by numbers above the sequences. Dashed lines under the R. violacea deduced amino acid sequence indicated peptides used to design synthetic degenerated oligonucleotides, respectively, residues 1-7 (oligonucleotide I), residues 113 to 106 (oligonucleotide II), residues 79-86 (oligonucleotide III), and residues 141 to 134 (oligonucleotide IV). Identical residues are indicated by asterisks. Underlined sequences in R. reticulata R6 were also obtained by protein microsequencing. Arrows with top letters above the deduced amino acid sequence noted the putative helical segments. Red algae: R.r., R. reticulata R6 (this work); R.v., R. violacea (45); P.c., P. cruentum (64); P.b., Polysiphonia boldii (65); A.n., Aglaothamnion neglectum (66). Cyanobacteria: C. 7601, Calothrix PCC 7601 (46); S.6701, Synechocystis PCC 6701 (67); S.WH 8020 II and I, Synechococcus sp. WH 8020 (59, 60, 69); S.WH 7803, Synechococcus 7803 (69); P.m., Prochlorococcus marinus (17). Cryptophyta: C.Phi , Cryptomonas Phi  (22).

Although the 4-kDa peptide was found to be blue colored, with an absorption maximum at 662 nm originating from PCB chromophores, the other peptides were red colored absorbing at 550 nm and so are linked to PEB chromophores (data not shown).

rpeB Gene Cloning and Sequencing-- The biochemical studies led us to suppose the R. reticulata R6 PE was lacking an alpha -type subunit. Therefore, we undertook the identification and the sequencing of the rpe operon. The close relationship between the red algal beta -PEs known facilitated cloning of the R. reticulata R6 rpe genes by heterologous DNA hybridization experiments using probes from R. violacea plastid DNA corresponding to the first half of the rpeB gene (see "Experimental Procedures"). To confirm the plastidic origin of the rpe operon in R. reticulata R6, a Southern blot of EcoRI fragments from isolated nuclear and plastidic DNA was performed. With probe I (corresponding to the first half of the gene), the only strong signal was with a 2.9-kb plastid DNA fragment (data not shown). This result suggested that a rpeB gene is present as a single copy in the chloroplastic genome of R. reticulata R6.

With probe I, we identified positive clones in the EcoRI R. reticulata R6 plastid DNA library. One was sequenced using forward and reverse universal primers and internal primers designed upon walking through the insert. The nucleotide and deduced amino acid sequences are shown in Fig. 8. The deduced amino acid sequences revealed a beta -type PE amino-terminal sequence and one of the three microsequences obtained from the R6 PE CNBr cleavage products (MAACLRD), but the two coding parts were separated by many stop codons. We concluded that the coding sequences were interrupted by an intron which was confirmed by cDNA sequencing (see below). Furthermore, comparison with other reported beta -PE sequences showed that the 3' region of the rpeB gene was missing in this insert.


View larger version (37K):
[in this window]
[in a new window]
 


View larger version (41K):
[in this window]
[in a new window]
 
Fig. 8.   Nucleotide and deduced amino acid sequences of the rpeB gene encoding beta -PE apoprotein from R. reticulata R6. The amino acids in bold correspond to the PE microsequenced fragments. Nucleotide and amino acid positions are given at right. The transcription start determined by 5' extension from the synthetic oligonucleotide complementary (nt 1468 to 1441) is noted by an asterisk. The proposed -10 and -35 sequences are in bold. ° indicates the stop codon, and solid arrows marked the putative terminator. The two homologous oligonucleotides (I and II) used for reverse transcription-PCR and sequencing of the cDNA are indicated by solid lines. The group II intron domains are noted by dashed arrows (GenBankTM AF114823).

Because of a unique PstI site (positions 1568-1574, Fig. 8) in the insert we prepared a PstI library that was screened with another heterologous probe (probe II) corresponding to the central part of the gene. Recombinant plasmids containing a 4.8-kb fragment in the pTZ8 PstI cloning site were found to contain the 3' end of the second intron and the rpeB 3'-coding sequence. The third microsequence (MKASSVA) obtained from the CNBr cleavage products (see above) is present in the deduced amino acid sequence. Intervening sequences and the splicing sites were identified by synthesizing the cDNA by reverse transcription-PCR with R. reticulata R6 total RNA as template, using an oligonucleotide corresponding to the complementary 2800-2820 nucleotide sequence as the reverse primer and the sequence of the 5' end coding region (nt 490 to 511) as the forward one. The amplification product, 415 nt long, was sequenced (data not shown) and confirmed the junctions between the exon and intron sequences shown in Fig. 8.

A physical map of the two overlapping sequenced clones is shown Fig. 9, and the entire sequence of the rpeB gene is presented in Fig. 8.


View larger version (7K):
[in this window]
[in a new window]
 
Fig. 9.   Physical map of the rpeB gene and flanking regions. Physical map of EcoRI and PstI inserts from PTZ18 plasmids carrying the rpeB gene from R. reticulata R6 plastid DNA. Only the sites used for subcloning are noted. The open reading parts are in boldface.

The first exon is very short and corresponds to the amino-terminal 27 amino acids. The following 0.7-kb intron exhibits the main features of group II introns (48) in which we recognize six putative domains shared by this intron group (Fig. 8). The 5' end sequence GTAAGC, although unusual, is the exact sequence found in the two Rhodella plastid introns known so far, i.e. in the rpeB (45) and pbsA R. violacea genes (47). In addition, the highly conserved nucleotide required for lariat formation, an A located 7 nucleotides upstream from the 3'-splicing site is found (Fig. 8; A+).

Another 1.2-kb intron follows the 180-nt exon 2. It possesses the typical 5' end of group II introns, GTGCG, but of other characteristic domains only a very weak domain V is present between the 2537 and 2560 nucleotides. None of the specific characteristics for the group I introns were observed.

The organization of the rpeB gene in R. reticulata R6 is as follows: 5'rpeb(80 nt)-intron(718 nt)-rpeb(183 nt)-intron(1195 nt)-rpeb(135 nt)3'.

Thus, only 13% of the nucleotide sequence corresponds to the rpeB coding region. We cannot identify other open reading frames in the introns or on the opposite DNA strand. The three exons of rpeB exhibit a strong AT bias with GC being 30 to 34%, whereas the first intron shows a smaller value of 20%. Similar values have been observed in the rpeB gene from R. violacea (45). The second intron in R. reticulata R6, although without apparent open reading frame, has a significantly higher percentage of GC (32%). Downstream from the third exon, we observed an inverted repeat of 34 nucleotides able to form a hairpin (nt 2967 to 3035; Fig. 8) followed by a stretch of Ts that would correspond to a rho-independent transcription terminator.

rpeB Transcription-- The rpeB gene transcript size was determined by Northern blot analysis with total RNA using a PCR product (324 base pairs long) as a homologous probe. The two oligonucleotides used as primers were nt 2800 to 2820 and nt 3123 to 3103, respectively. The PCR product obtained with these two primers avoided amplification of the first part (amino acids 91-135, Fig. 7) of the third exon which is very close to beta PC. The operon transcript size is 0.7 kb as shown in Fig. 10. For comparison, a Northern blot analysis was also performed with a partial sequence of the R. reticulata R6 cpc operon (not shown), 239 nt corresponding to the cpc B 3' end, the intergenic part and the 5' end of cpc A. The transcript size for cpc BA is 1.5 kb, in agreement with the expected size for a transcript covering the entire dicistronic cpcBA. In contrast, the rpe B transcript is significantly shorter.


View larger version (40K):
[in this window]
[in a new window]
 
Fig. 10.   Northern analysis of total RNA from R. reticulata R6 hybridized with rpeB probe (lane A) and cpcBA (lane B). The measured transcript sizes are indicated on the left. kbp, kilobase pair.

The 5' end of the mature RNA, determined by primer extension from a strictly complementary oligonucleotide, is at nucleotide A420 (Fig. 8; A*). The sequences TATTAT (nt 406-411) and TTGCGT (nt 381-387), upstream from the transcription start site, are proposed to be the -10 and -35 promoter elements. The GGAG sequence, 7 nt upstream from the coding ATG, is homologous to the Shine-Dalgarno ribosome-binding site.

    DISCUSSION

We have presented biochemical and molecular evidence of the occurrence of a PE-type pigment assembled from only a beta -subunit in the unicellular red alga R. reticulata R6. Two other rhodophytan strains (mentioned under "Experimental Procedures"), related to R. reticulata R6, isolated independently, have an identical biliprotein composition and synthesize a similar PE pigment.

PBS were purified and electron microscope observations indicate that they belong to the hemidiscoidal type. It has been clearly demonstrated that a 95-kDa LCM permits the assembly of three cylinder cores (49, 50), whereas a 72-kDa LCM is associated with two cylinder cores (49, 50) and a 128-kDa LCM corresponds to the so-called four cylinder core (51). The apparent LCM molecular weight (95 kDa) in R. reticulata R6 PBS suggests that the R6 PBS is assembled with a tricylindrical core as in many cyanobacteria and some Rhodophyta (52, 53). Preliminary ultrastructural observations (not shown) are in agreement with this hypothesis, but the rod organization remains to be established.

Purification of the major biliproteins after PBS dissociation and DEAE-cellulose chromatography allowed us to purify, in addition to allophycocyanin (APC) and C-phycocyanin (C-PC), a phycoerythrin-type pigment. The occurrence of a C-PC has been similarly described in other unicellular or filamentous Rhodophyta as follows: R. violacea (54), Cyanidium caldarium (55), Compsopogon coeruleus (56), and Audouinella species (57). The third pigment, purple-violet in color and responsible for the absorption at 562 nm observed in the phycobilisome fractions from R. reticulata R6, was exhaustively purified. The absorption maxima at 562 and 604 nm originate from PEB and PCB chromophores as shown by the spectral properties obtained after denaturation with acid 9 M urea (absorption maxima at 550 and 662 nm, respectively). No peaks or shoulders were visible in the 495 nm region, indicating that the R. reticulata R6 PE is devoid of PUB. The 77 K fluorescence emission spectrum exhibits a peak at 630 nm that we attribute to the PCB chromophore functioning as a terminal energy acceptor. Surprisingly, zinc-enhanced fluorescence from bilin-linked chromophores was associated only with a 20-kDa subunit. The 60- and 87-kDa linkers were non-fluorescent, thus appearing devoid of chromophore. Two different linkers could correspond to two different PE forms, but we find they account for two different aggregation states.

The spectral properties of the R. reticulata R6 PE are distinct from other previously described PEs from red algae (9). First, the R. reticulata R6 PE subunits are linked to unusually large colorless polypeptides. In all other rhodophytan PEs studied so far, chromophoric linkers (the so-called gamma -type subunits), bearing several PEB and PUB chromophores, were found (58), thus acting as linkers as well as light-harvesting polypeptides (9). In contrast, the PEs found in cyanobacteria are generally stabilized by colorless linker polypeptides, although some exceptions are now known (59, 60). This property shared by the majority of cyanobacterial PE linkers together with the R. reticulata R6 PE linkers may reflect a primitive situation.

Until recently, all PEs were shown to utilize phycoerythrobilins acting as terminal energy acceptors. However, in the primitive red algal Audouinella and Chantransia strains (57), PEs have been described with a 1:3:1 PCB/PEB/PUB chromophore ratio in which the blue chromophore (PCB) acts as the terminal energy acceptor of PE. The spectral properties we observed for PCB in the R. reticulata R6 PE (absorption maximum at 604 nm and fluorescence emission maximum at 630 nm) are very similar to those described for the Audouinella and Chantransia counterparts. Although we did not directly determine the chromophore-binding site, the PCB in the R. reticulata R6 PE is linked to the distal CNBr fragment (from amino acids 135 to 177). Its deduced sequence contains only one C (residue 158) homologous to the beta -155 cysteinyl residue which generally is a chromophore ligator. The spectral properties for R6 PCB (absorption maximum at 604 nm and fluorescence maximum at 629 nm) are similar to those deduced for the beta -155 PCB chromophore, in the C-phycocyanin of the cyanobacterium Synechococcus sp. PCC 7002, as deduced by comparison to the spectral properties of a cpcB/C155S mutant lacking PCB in the beta -155 position (61). To our knowledge, R6 PE is the first reported exception to the rule (62, 63) of the beta -84 chromophores acting as the terminal energy acceptor in PBPs. It is likely that the unique PCB chromophore is located also in the beta -155 position in Audouinella and Chantransia PEs.

That the alpha -subunit could be lacking from the R. reticulata R6 PE was totally unexpected. Until now, no exception has been found to a requirement of alpha - and beta -subunits for phycobiliprotein assembly.

After Edman degradation, only one amino-terminal sequence was identified, MLDAFSKVAVN, which is clearly related to a beta -type amino-terminal sequence (17, 22, 45, 46, 59, 60, 64-69; see Fig. 7 for sequence alignment). The five first amino acids (MLDAF) are shared by almost all rhodophytan beta -PE and beta -PC subunit biliproteins, by beta -PEC found only in cyanobacteria, and by some cyanobacterial beta -PC (12). Serine as the sixth residue is a universal marker for beta -PEs, including the prochlorophytan Prochlorococcus PE (17) and for beta -PEC. However, beta -PEC has a negatively charged amino residue in the tenth position, instead of an aliphatic one in beta -PE.

Of the two internal sequences determined after CNBr cleavage, one (MAACLRDGE) is characteristic of red algal PE (Fig. 7) but also is found in marine cyanobacteria and Prochlorococcus beta -PE (17, 68, 69). The corresponding sequence in cyanobacterial beta -PEC is GAACIRDLG (12). The second microsequence MKASSVAFV is not highly conserved.

Cloning and sequencing the plastid rpe operon from R. reticulata R6 confirms the occurrence of a unique rpeB gene split into three exons. The occurrence of split genes is not general in plastid rhodophytan genes. However, the R. violacea plastid rpeB gene (45) also has one group II intron (340 nt), and a cis-splicing mechanism produces the mature transcript. The same mechanism seems likely for R. reticulata R6 rpeB although no pre-mRNAs were detected. By primer extension, the transcription start of R. reticulata R6 rpeB gene is localized 71 nt upstream from the ATG initiation codon. Northern analyses using a part of the downstream exon as a probe revealed only one 0.7-kb long transcript, the expected size for the mature transcript between the determined transcription start and the proposed terminator. There is no open reading frame related to a rpeA gene following the rpeB sequence. The size of the mature transcript is consistent with a monocistronic rpe operon and the absence of alpha -PE in R. reticulata R6.

Analysis of the R. reticulata R6 beta -PE amino acid sequence shows it is 84-87% homologous to those of the beta -PE subunits of diverse cyanobacteria, red algae, and cryptomonads (Fig. 7; see Refs. 17, 22, 45, 46, 59, 60, and 64-69). Including conservative substitutions of amino acids, the sequence homology with red algal beta -PE subunits ranges from 90 to 95%. The central portions (Fig. 7; residues 71-140) of all beta -PE subunits are particularly conserved, with homology reaching 95% in this region. This central region is also highly conserved in the beta -PC subunits, and there is 84% homology between beta -PE and beta -PC subunits in R. reticulata R6.2

Rhodophytan (58, 71) and cyanobacterial beta -PE (63, 72) subunits carry three bilin chromophores. Two of these are linked through single thioether bonds to Cys-82 and Cys-159, and one bilin is doubly attached at Cys-50 and Cys-61 (58, 63, 71, 72). In cyanobacterial and red algal beta -PE sequences, only PEB has been found at Cys-82. Either PEB or PUB is found at the other two bilin attachment sites (see Ref. 63). The same bilin attachment sites are found in cryptophytan beta -PE, but a greater variety of bilins are found at these sites (16).

The bilins in the R. reticulata R6 beta -PE subunit were localized by sequencing and spectral analysis of four fragments (14, 5, 6, and 4 kDa) obtained by CNBr cleavage. The first two (14 and 5 kDa) shared the same amino-terminal sequence indicating that the 14-kDa polypeptide results from incomplete CNBr cleavage. PEB was associated with 14-, 5-, and 6-kDa CNBr peptides. Its spectral properties show that the 4-kDa fragment represents the COOH terminus of the subunit and that it bears the sole PCB in the R. reticulata R6 beta -PE subunit, presumably at the sole cysteine residue in this region, Cys-158 (Fig. 7). The only other instance of a phycoerythrin carrying a PCB chromophore is that of the Audouinella and Chantransia sp. phycoerythrins, which also carries the PCB on its beta -subunit (57).

Other residues that appeared to be important in chromophore interaction with the polypeptide side chain are present in R. reticulata R6 beta  PE, for instance Arg-77, Arg-78, Arg-84, Asp-85, and Ala-81 (24, 27, 28, 73, 74). With exception of Arg-78, these residues are maintained in all beta -type sequences. In R. reticulata R6 beta -PE, there are no tryptophan residues as has been found for all other beta  sequences. Asn-72, present in most beta -PE and in beta -PE R6 also, and in some beta -PC, has been shown (75) to be post-translationally methylated. This modification is functionally important in the efficiency of energy transfer. A histidine is in this position in Prochlorococcus beta -PE indicating possible differences concerning PE in this organism.

Without an alpha -subunit in R. reticulata R6 phycoerythrin, the question arises whether the beta -subunit has a similar three-dimensional structure to those of beta -subunits in "conventional" phycobiliproteins. That it probably does is suggested from the high overall homology of its amino acid sequence with that of beta -subunits from the other phycobiliproteins (Fig. 7). By modeling from published crystallographic data, we deduce the probable presence of the X, Y, A, B, E, F, G, and H helical segments. Moreover, residues important in alpha beta heterodimer formation such as Asp-13 and Arg-91, which contribute to ionic interactions between the alpha - and beta -subunits, and Tyr-92 and Asp-3, also important for alpha -beta interactions, are conserved in R. reticulata R6 beta -PE. On the other hand, Asp-3 which has been claimed to play a role in preventing beta beta homodimerization (12) is present. However, we cannot exclude beta beta interactions, although the models derived from crystallographic data would argue against this. Alternatively, there could be specific interactions between the R. reticulata R6 beta -PE subunits and specific domains within the unusually large linker polypeptides, PE-LR60 and PE-LR87. For example, a domain of a large core-membrane linker polypeptide, the LCM, forms a component of a trimeric allophycocyanin complex within the core of cyanobacterial phycobilisomes (3). Further studies, particularly determination of the amino acid sequences of the LR60 and LR87 linkers, are necessary to distinguish between these possibilities.

Linkers and Aggregation States-- We found that the R. reticulata R6 PE is recovered in two different aggregates (184 and 300 kDa) and is associated, respectively, with 60- and 87-kDa colorless linkers. These molecular weight values are in a good accordance with a hexameric (beta 6LR60) and a dodecameric (beta 12LR87) assembly, analogous to trimeric (alpha beta )3L and hexameric (alpha beta )6L states described so far for numerous phycobiliproteins (9, 36, 51, 76-78), excepting the (alpha beta )2 organization of cryptophytan biliproteins (8, 16, 79) that are not associated with linkers. The unusual size of the two linkers raises questions about the position of these linkers in the aggregate. In phycocyanin, it is well established that the cavity within the hexameric structure is large enough to bury the larger part of the 30-35-kDa apparent molecular mass linkers (78) leaving an exposed COOH domain in the (alpha beta )nL aggregate. In phycoerythrins, the structure is similar, but, as determined recently by comparison of crystallographic structure of B- and b-phycoerythrin from Porphyridium sp., the gamma -subunit in B-PE is located inside (alpha beta )6 hexamers (29) and probably not protruding out of the hexamers.

Conclusion-- The main properties of the phycoerythrin from the unicellular red alga R. reticulata R6 are that it has only beta  chains encoded by a monocistronic plastid gene and that they are organized into two aggregation states (hexameric and dodecameric) stabilized by linker polypeptides significantly larger than linkers usually described for these complexes. Although beta beta chain interactions might occur, the two linker polypeptides alternatively might act as alpha  chain substitutes. If the linkers contain peptide domains related to phycobiliprotein sequences, a mosaic origin for these polypeptides, involving fusion of chloroplast and nuclear components, can be considered. However, we cannot yet exclude beta beta chain interactions. The cryptophytan biliproteins, with nuclear-encoded alpha -subunits of unique structure, are thought to be a primitive system (16), which might loosely parallel R. reticulata R6 phycoerythrin. Further analyses at the molecular levels of the two linkers are an essential next step for understanding the structural features of the novel R. reticulata R6 PE.

    ACKNOWLEDGEMENTS

We thank Anne Mousseau for expert contribution in biochemical experiments; Annette Joder for cultures of Rhodella reticulata R6; and our colleagues of the laboratory headed by Anne-Lise Etienne, particularly Catherine Richaud, for discussions and comments throughout this work. We are greatly indebted to François Michel for help with the interpretation of the non-coding sequences. We also thank Alexander N. Glazer for deep attention and for fruitful discussions during a meeting in our laboratory.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed: Ecole Normale Superieure Laboratoire de Photoregulation 46, Rue d'Ulm 75230 Paris Cedex 05, France. Tel.: 44-32-35-28; Fax: 44-32-35-39; E-mail: jcthomas{at}biologie.ens.fr.

The abbreviations used are: PBP, phycobiliprotein; PUB, phycourobilin; APC, allophycocyanin; PC, phycocyanin; PCB, phycocyanobilin; PE, phycoerythrin; PEB, phycoerythrobilin; PCB, phycocyanobilin; PBS, phycobilisome; L, linker polypeptide; C-PC, C-phycocyanin; PEC, phycoerythrocyanin; kb, kilobase pair; PCR, polymerase chain reaction; nt, nucleotide(s); LiDS-PAGE, lithium dodecylsulphate-polyacrylamide gel electrophoresis; Tricine, N-[2-hydroxy-1,1-bis(hydroxy- methyl)ethyl]glycine.

2 J. C. Thomas and C. Passaquet, manuscript in preparation.

    REFERENCES
Top
Abstract
Introduction
References

  1. Bryant, D. A. (1991) in Cell Culture and Somatic Cell Genetics of Plants (Bogorad, L., and Vasil, I. K., eds), Vol. 7B, pp. 257-300, Academic Press, New York
  2. Gantt, E. (1986) in Photosynthesis III. Encyclopedia of Plant Physiology New Series (Staehelin, L. A., and Arntzen, C., eds), Vol. 19, pp. 260-268, Springer-Verlag, Berlin
  3. Glazer, A. N. (1985) Annu. Rev. Biophys. Biophys. Chem. 14, 47-77[CrossRef][Medline] [Order article via Infotrieve]
  4. Glazer, A. N. (1987) in The Cyanobacteria (Fay, P., and van Baalen, C., eds), pp. 69-94, Elsevier/North-Holland Biomedical Press, Amsterdam
  5. Glazer, A. N. (1989) J. Biol. Chem. 264, 1-4[Free Full Text]
  6. Grossman, A. R., Shaefer, M. R., Chiang, G. G., and Collier, J. L. (1993) Microbiol. Rev. 57, 725-749[Abstract/Free Full Text]
  7. Grossman, A. R., Bhaya, D., Apt, K. E., and Kehoe, D. M. (1995) Annu. Rev. Genet. 29, 231-288[CrossRef][Medline] [Order article via Infotrieve]
  8. MacColl, R., and Guard-Friar, D. (1987) Phycobiliproteins, pp. 1-219, CRC Press, Inc., Boca Raton, FL
  9. Sidler, W. (1994) in The Molecular Biology of Cyanobacteria. (Bryant, D. A., ed), pp. 139-216, Kluwer Academic Publishers Group, Dordrecht, Netherlands
  10. Zuber, H., Brunisholz, R., and Sidler, W. (1987) in Photosynthesis: New Comprehensive Biochemistry (Amesz, J., ed), Vol. 15, pp. 233-271, Elsevier Science Publishers B.V., Amsterdam
  11. Ducret, A., Sidler, W., Frank, G., and Zuber, H. (1994) Eur. J. Biochem. 221, 563-580[Medline] [Order article via Infotrieve]
  12. Apt, K. E., Collier, J. L., and Grossman, A. R. (1995) J. Mol. Biol. 248, 79-96[CrossRef][Medline] [Order article via Infotrieve]
  13. Gillot, M. A., and Gibbs, S. P. (1980) J. Phycol. 16, 558-568[CrossRef]
  14. Gibbs, S. (1981) Ann. N. Y. Acad. Sci. 361, 193-208[Medline] [Order article via Infotrieve]
  15. Douglas, S. E., Murphy, C. A., Spenser, D. F., and Gray, M. W. (1991) Nature 130, 148-151
  16. Glazer, A. N., and Wedemayer, G. J. (1995) Photosynth. Res. 46, 93-105
  17. Hess, W. R., Partensky, F., Van Der Staay, G. W., Garcia-Fernandez, M., Börner, T., and Vaulot, D. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 11126-11130[Abstract/Free Full Text]
  18. Tandeau de Marsac, N., and Houmard, J. (1993) FEMS Microbiol. Rev. 104, 119-189[CrossRef]
  19. Egelhoff, T., and Grossman, A. R. (1983) Proc. Natl. Acad. Sci. U. S. A. 80, 3339-3343[Abstract/Free Full Text]
  20. Apt, K. E., Hoffman, N., and Grossman, A. R. (1993) J. Biol. Chem. 268, 16208-16215[Abstract/Free Full Text]
  21. Bernard, C., Etienne, A. L., and Thomas, J. C. (1996) J. Phycol. 32, 265-271[CrossRef]
  22. Reith, M., and Douglas, S. (1990) Plant Mol. Biol. 15, 585-592[CrossRef][Medline] [Order article via Infotrieve]
  23. Jenkins, J., Hiller, R., G., Speirs, J., and Godovac-Zimmermann, J. (1990) FEBS Lett. 273, 191-194[CrossRef][Medline] [Order article via Infotrieve]
  24. Schirmer, T., Bode, W., Huber, R., Sidler, W., and Zuber, H. (1985) J. Mol. Biol. 184, 257-277[CrossRef][Medline] [Order article via Infotrieve]
  25. Schirmer, T., Huber, R., Schneider, M., Bode, W., Miller, M., and Hackert, M. L. (1986) J. Mol. Biol. 188, 651-676[CrossRef][Medline] [Order article via Infotrieve]
  26. Schirmer, T., Bode, W., and Huber, R. (1987) J. Mol. Biol. 196, 677-695[CrossRef][Medline] [Order article via Infotrieve]
  27. Duerring, M., Huber, R., Bode, W., Ruembeli, R., and Zuber, H. (1990) J. Mol. Biol. 211, 633-644[CrossRef][Medline] [Order article via Infotrieve]
  28. Ficner, R., Lobeck, K., Schmidt, G., and Huber, R. (1992) J. Mol. Biol. 228, 935-950[CrossRef][Medline] [Order article via Infotrieve]
  29. Ficner, R., and Huber, R. (1993) Eur. J. Biochem. 218, 103-106[Medline] [Order article via Infotrieve]
  30. Brejc, K., Ficner, R., Huber, R., and Steinbacher, S. (1995) J. Mol. Biol. 249, 424-440[CrossRef][Medline] [Order article via Infotrieve]
  31. Chang, W., Jiang, T., Wan, Z., Zhang, J., Yang, Z., and Liang, D. (1996) J. Mol. Biol. 262, 721-731[CrossRef][Medline] [Order article via Infotrieve]
  32. Fresnel, J., Billard, C., Hindak, F., and Pekàrkova, B. (1989) Plant Syst. Evol. 164, 253-262[CrossRef]
  33. Starr, A. R. (1978) J. Phycol. 14 (suppl.), 47-100[CrossRef]
  34. Yamanaka, G., Glazer, A., N., and Williams, R. C. (1978) J. Biol. Chem. 253, 8303-8310[Abstract/Free Full Text]
  35. Mörschel, E., Koller, K. P., and Wehrmeyer, W. (1980) Arch. Microbiol. 125, 43-51[CrossRef]
  36. Yu, M., H., Glazer, A., N., and Williams, R. C. (1981) J. Biol. Chem. 256, 13130-13136[Abstract/Free Full Text]
  37. Martin, R. G., and Ames, B. N. (1961) J. Biol. Chem. 236, 1372-1379[Free Full Text]
  38. Glazer, A. N. (1988) Methods Enzymol. 167, 291-312[Medline] [Order article via Infotrieve]
  39. Judd, R. C. (1990) Methods Enzymol. 182, 613-626[Medline] [Order article via Infotrieve]
  40. Garnier, F., Dubacq, J. P., and Thomas, J. C. (1994) Plant Physiol. (Bethesda) 106, 747-754[Abstract]
  41. Schagger, H., and von Jagow, G. (1987) Anal. Biochem. 166, 368-379[CrossRef][Medline] [Order article via Infotrieve]