|
|
||||||||
J Biol Chem, Vol. 274, Issue 4, 2511-2517, January 22, 1999
From the Bristol-Myers Squibb Pharmaceutical Research Institute,
Princeton, New Jersey 08543 and the § Department of
Dermatology, University of Washington, Seattle, Washington 98105
Isoforms of CD44 are differentially modified by
the glycosaminoglycans (GAGs) chondroitin sulfate (CS), heparan sulfate
(HS), and keratan sulfate. GAG assembly occurs at serines followed by glycines (SG), but not all SG are utilized. Seven SG motifs are distributed in five CD44 exons, and in this paper we identify the HS
and CS assembly sites that are utilized in CD44. Not all the CD44 SG
sites are modified. The SGSG motif in CD44 exon V3 is the only HS
assembly site; this site is also modified with CS. HS and CS attachment
at that site was eliminated by mutation of the serines in the V3 motif
to alanine (AGAG). Exon E5 is the only other CD44 exon that supports
GAG assembly and is modified with CS. Using a number of recombinant
CD44 protein fragments we show herein that the eight amino acids
located downstream of the SGSG site in V3 are responsible for the
specific addition of HS to this site. If the eight amino acids located
downstream from the first SG site in CD44 exon E5 are exchanged with
those located downstream of the SGSG site in exon V3, the SG site in E5
becomes modified with HS and CS. Likewise if the eight amino acids
found downstream from the first SG in E5 are placed downstream from the
SGSG in V3, this site is modified with CS but not HS. We also show that
these sequences cannot direct the modification of CD44 with HS from a
distance. Constructs containing CD44 exon V3 in which the SGSG motif
was mutated to AGAG were not modified with HS even though they
contained other SG motifs. Thus, a number of sequence and structural
requirements that dictate GAG synthesis on CD44 have been identified.
Investigative interest has focused on understanding the
involvement of CD44 in lymphocyte homing, hematopoiesis, leukocyte activation, and tumor metastasis. This apparent diversity of biological function likely results in part from the numerous alternatively spliced
CD44 isoforms, all of which may bestow unique molecular function. For
example, CD44 binding to hyaluronic acid may in part provide the
mechanism of these biological functions (1), but this interaction is
dependent on the alternatively spliced isoform expressed (2).
Additionally, a greater metastatic potential resides in RAT carcinoma
cells that express exon V6 containing CD44 isoforms (3). Also, V3
containing CD44 isoforms are modified with heparan sulfate
(HS)1 and have been shown to
bind growth factors (4, 5).
Additional functional differences of CD44 isoforms may in part be
influenced by the variety of glycosaminoglycans (GAGs) that are
assembled on CD44, which include HS, keratan sulfate, and chondroitin
sulfate (CS) (6). Distinct functions have been attributed to CD44
modified with HS versus CS. Cell surface CS-proteoglycans are required by microvascular endothelial cells for migration on fibrin
gels (7). The cell surface CS-proteoglycan that is predominantly
expressed on microvascular endothelial cells is CD44, and an antibody
to CD44 blocks migration on fibrinogen (8). Alternatively spliced
isoforms that are modified with HS impart a different function. The
isoforms that are modified with HS can bind and present heparin binding
MIP-1 Signals for GAG assembly are encoded for by the proteoglycan backbone.
GAG synthesis occurs at serines that are followed by glycines (SG),
with one or more proximal acidic amino acid. This minimal motif is not
always utilized, suggesting that secondary and/or tertiary structure
rather than the primary sequence is important (10). In addition, some
acceptor sites are modified with only CS, yet others have both CS and
HS. This suggests that CS synthesis occurs by default at any site
capable of GAG attachment, while HS assembly requires additional
signals. Distal signals from the GAG assembly site may exist. It has
been suggested that such signals may target proteins to subcellular
compartments that contain the HS- or CS-synthesizing enzymes (11-13).
Signals additionally found in proteoglycan backbones when HS is
assembled include a proximal hydrophobic residue (14, 15) and
duplication of the SG motif (16). These additional residues are present
in CD44 exon V3.
We have shown previously that CD44 isoforms containing exon V3 are
modified with HS. It was not clear, however, if HS was added to the SG
site in exon V3 or if it was added to other assembly sites. In this
paper we define which of the seven CD44 SG motifs can be modified with
CS and HS. Exon V3 is the only exon that has a HS acceptor site. The
highly specific nature by which HS is added to the SGSG motif in CD44
exon V3 led us to investigate whether we could identify those sequences
in V3 responsible for this event. We also wanted to investigate whether
sequences in CD44 exon V3 could direct the modification of a distal SG
site with HS if the normal acceptor site in exon V3 was not available. In addition, the HS attached to the recombinant proteins was analyzed and shown to have growth factor binding activity.
Cell Culture--
COS cells were purchased from American Type
Culture Collection (Manassas, VA) and maintained in Dulbecco's
modified Eagle's medium with 10% fetal bovine serum, penicillin (100 units/ml), streptomycin (100 µg/ml), and 2 mM
L-glutamine.
Construction of CD44-Ig Expression Vectors--
Constructs
containing various CD44 exon combinations were generated by polymerase
chain reaction (PCR) using the CD44V3-V10-Ig template previously
described (4) and the following oligonucleotide primers: CD44 V3
FP-Spe1, ACTAGTACGTCTTCAAATACCATCTCAG; CD44 V3 RP-BamHI,
GGGATCCAGGGTGCTGGAGATAAAATCTTC; CD44 E5 FP-Spe1,
ACTAGTATTGTTAACCGTGATGGCACC; CD44 E5 RP-BamHI,
GGGATCCGTGGTAGCAGGGATTCTGTC; CD44 V10 FP-Spe1, ACTAGTAGGAATGATGTCACAGGT; CD44 V10 RP-BamHI,
GGGATCCGTGTCTTGGTCTCCTGATAAGGAACGATTGAC; CD44 E15 FP-Spe1,
ACTAGTGACCAAGACACATTCCAC; CD44 E15 RP-BamHI, GGGATCCTCTTGACTCCCATGTGAGTG; CD44 E16 FP-Spe1,
ACTAGTCACTCACATGGGAGTCAA; CD44 E16 RP-BamHI,
GGGATCCGCCAAGGCCAAGAGGGATGC; CD44 V3 mutant (SGSG
PCR reaction conditions were as follows: 94 °C for 5 min with 35 cycles of 94 °C for 30 s, 57 °C for 1 min, and 72 °C for 1 min 45 s. PCR products were purified with Qiaquick spin PCR purification kit (Qiagen Corp., Chatsworth, CA). PCR products were
digested with enzymes SpeI and BamHI (Boehringer
Mannheim), gel-purified, and ligated into
SpeI/BamHI cut vector CDM8 with the CD5 signal
sequence, and human IgG1 immunoglobulin region (Rg) 3' of CD44 insert
as described previously (17). All constructs were checked for the
correct sequence.
To introduce the eight amino acid exchange between exons V3 and E5 a
two-step PCR "sew" reaction was utilized as described (18). Primers
used for the preparation of the primary strands of CD44
V3E5/8aa were CD44 V3-FP-SpeI with CD44 V3a-RP
AGTGCTGCTCCTTTCACTGGAGGAGCCTGATCCAGAAAAGCTTAGGTGTCTGTC and
CD44 V3b-FP
TCCTCCAGTGAAAGGAGCAGCACTTCCAGCACCATTTCAACCACACCACGG with CD44
V4b-RP CGGATTTGAATGGCTTGG. These two primary reactions were then
mixed and amplified by PCR using primers CD44 V3-FP-SpeI and
CD44 V3c-RP-BamHI GGGATCCAGGGTGCTGGAAGTGCTGCTCCT.
Primers used for primary strands of E5V3/8aa were
CD44 E5-FP-Spe1 with CD44 E5a-RP
GATAAAATCTTCATCATCATCGATGCCGCTGCTCACGTCATCATCAGT and CD44 E5b-FP
ATCGATGATGAAGATTTTATCTCAGGAGGTTACATCTTTTACACC with CD44
E5-RP-BamHI. These two primary reactions were then mixed and
amplified by PCR using oligonucleotide primers CD44 E5-FP-Spe1 and CD44
E5-RP-BamHI. The resulting mutant PCR products,
V3E5/8aa (containing SSSERSST in place of IDDDEDFI) and
E5V3/8aa (containing IDDDEDFI in place of SSSERSST), were
digested with SpeI and BamHI (Boehringer
Mannheim) and ligated into CDM7B Metabolic Labeling and Enzymatic Digestion--
COS cell CD44-Rg
fusion protein was produced by using a DEAE-dextran transfection
procedure with approximately 107 cells as described by
Aruffo et al. (1). After Me2SO shock and
overnight recovery in Dulbecco's modified Eagle's medium with 10%
fetal bovine serum, cells were cultured in sulfate free media without
fetal bovine serum and labeled with 500 µCi of
[35S]NaHSO4 (NEN Life Science Products) for
36 h. Cells were also labeled with 150 µCi/ml of
6-[3H]GlcN (NEN Life Science Products) for 24 h in
Dulbecco's modified Eagle's medium. Labeled supernatants were
batch-purified with protein A-Sepharose (Repligen, Cambridge, MA),
washed with PBS containing 0.05% Tween 20, and aliquoted equally. One
aliquot was left untreated, others were digested for 1 h at
37 °C with 50 milliunits of Proteus vulgaris chondroitin
ABC lyase, 1 milliunit of Flavobacterium heparinum
heparitinase (ICN Immunobiologicals, Lisle, IL), or both. Samples were
washed in PBS containing 0.05% Tween 20, heated for 10 min at 95 °C
in an equal volume of 2 × sample buffer with Cleavage with Cyanogen Bromide--
CD44V3-Rg fusion protein was
reconstituted in 100 µl of 70% formic acid, and a solution of
cyanogen bromide (30 mg/100 µl) in 70% formic acid was added to
provide a 1000-fold molar excess over methionine. The reaction
proceeded under a nitrogen cushion for 4 h at 30 °C and for an
additional 18 h at 22 °C in the dark. The digested protein was
vacuum-dried, reconstituted in 100 µl of 0.4 M Tris-HCl,
pH 8.5, containing guanidine HCl (6 M) and Na2EDTA (0.1%), and reduced with dithiothreitol (0.02 M) at 50 °C for 2 h. Samples were subsequently
S-pyridylethylated with 4-vinylpyridine (0.10 M)
for 4 h at 22 °C. The reaction mixture was acidified to pH 2.0 with 20% trifluoroacetic acid, and the cyanogen bromide peptides were
separated by high performance liquid chromatography (HPLC) with a
Bio-Sil TSK-250 (7.5 × 600 mm, Bio-Rad) gel filtration column.
The chromatography was carried out in 0.1% trifluoroacetic acid
containing 40% acetonitrile at a flow rate of 0.25 ml/min.
Cleavage with Asp-N Protease--
Cleavage of the cyanogen
bromide peptides of V3wt-Rg and V3mut-Rg fusion
proteins with Pseudomonas fragi Asp-N protease was done in
40 µl of 0.1 M Tris acetic acid buffer containing 2 M urea, pH 8.0, at 37 °C for 16 h The enzyme to
substrate ratio was 1 to 25. The enzymatic digests were acidified with
10% trifluoroacetic acid to pH 2.0 and separated by reverse-phase HPLC
(19).
Amino Acid Sequence Analysis--
Automated sequence analysis
was performed in a pulsed-liquid protein sequencer (model 476A, Applied
Biosystems), using manufacturer-released cycle programs (19).
Preparation of Small Oligosaccharides from
V3-Rg--
V3wt-Rg was digested with heparitinase I (5 units) for 24 h in PBS at 37 °C. The digested material was
separated by chromatography on a Sephadex G-50 column (1 × 100 cm, Bio-Rad) that was equilibrated with 10 mM phosphate
buffer containing 1.0 M NaCl, pH 7.0. The column was
calibrated with [14C]glucose oligomers. Fractions
corresponding to 6-10 glucose sugar residues were pooled and desalted
with a Bio-Gel P-2 column (1 × 40 cm, Dionex, Sunnyvale, CA).
[3H]GlcN-labeled V3-Rg was used as a tracer for
oligosaccharide purification.
Monosaccharide Analysis--
Strong acid hydrolysis of the
glycopeptides was done in 2 M trifluoroacetic acid at
100 °C for 4 h. Samples were analyzed by high performance
anion-exchange chromatography on a BioLC System (Dionex, Sunnybale, CA)
using a 4 × 250-mm CarboPac PA1 column (Dionex, Sunnybale, CA)
using the conditions described previously (20). A set of seven neutral
saccharides was run as standards. These included fructose, manose
galactose, glucose, xylose, glucosamine, and galactosamine.
Solid Phase Binding Assay of 125I-b-FGF to
V3-Rg--
Human b-FGF was obtained from R & D Systems, Minneapolis,
MN (carrier-free). Iodination of b-FGF was performed by using
IODO-BEADS (Pierce) as described by the manufacturer's procedure.
Iodinated b-FGF was separated from free iodine by using Sephadex G-25
(Amersham Pharmacia Biotech) equilibrated with 1% bovine serum
albumin/PBS. The specificity of iodinated b-FGF was 10 mCi of
125I/mg of b-FGF. Falcon MicroTest III 96-well assay plates
(Becton Dickinson, Lincoln Park, NJ) were coated with CD44 fusion
protein overnight at 4 °C in Tris-buffered saline buffer. Coated
wells were blocked with 1% bovine serum albumin/PBS for 1 h at
room temperature and washed with the same buffer three times.
[125I]b-FGF was added to each well (0.025 mCi) and
incubated at room temperature for 1 h. Wells were washed three
times and each well counted with a Identification of the CD44 Exons That Are Modified with CS and
HS--
We and others have reported previously that the
post-translational modification of CD44 with HS requires the presence
of the variably spliced CD44 exon V3 (4-6). In addition, the
expression of a fusion protein with only 24 amino acids of exon V3,
which included the SGSG motif, resulted in production of a protein
modified with CS and HS (16). However, it was not clear if HS could be assembled on other sites; also unknown was the location of the CS
assembly sites. The minimal GAG assembly motif is the amino acid
sequence SG. This motif is found in five CD44 exons: E5, E15, E16, V3,
and V10. In this study we analyzed all the possible CD44 GAG assembly
sites to determine whether they are modified with HS and CS.
HS and CS containing CD44 exons were identified by analyzing individual
CD44 exons expressed separately as recombinant immunoglobulin (Rg)
fusion proteins (Fig. 1). The fusion
proteins were analyzed for the disappearance of
[35S]NaHSO4 label after enzymatic digestion
with chondroitin ABC lyase and heparitinase. The retention of some
label is always observed and is in part a results of keratan sulfate
modification (21). Fig. 2 demonstrates
that V3wt-Rg contains both HS and CS, and E5-Rg was
modified with only CS. Unexpectedly, V10-Rg was not modified with
either HS or CS. The potential GAG assembly site in exon V10 is
positioned at the very end of this exon. The first five amino acids of
the following exon, E15, are DQDTF. Since this is a constitutively
expressed exon, these amino acids were included in V10-Rg, thus
creating a motif that is composed of acidic and hydrophobic amino
acids, the hallmark for GAG synthesis. In addition, HS and CS were not
detected on E15-Rg and E16-Rg proteins (data not shown). In summary,
only the CD44 fusion proteins composed of exons E5 or V3 supported GAG
assembly.
HS and CS Are Added to the SGSG Motif in Exon V3--
In order to
establish that the SGSG motif is the site of HS and CS assembly, a
fusion protein, V3mut-Rg, was made where the SGSG was
mutated to AGAG (Fig. 1). This protein was analyzed for HS and CS
assembly by monitoring accumulation of
[35S]NaHSO4 label, followed by digestion with
enzymes specific for HS and CS. These experiments demonstrated that GAG
assembly did not take place on the fusion protein V3mut-Rg
(data not shown). In addition, to further define the usage of the SGSG
site V3mut-Rg and V3wt-Rg were cleaved with
cyanogen bromide, and the resulting peptides were purified by gel
permeation chromatography and identified by amino-terminal sequence
analysis (Fig. 3, A and
B). A comparison of the profiles reveals that
V3wt-Rg contains three peptide pools (pools A,
B, and C) of distinct MW ranges, while digestion
of V3mut-Rg produced only two peptide pools (pools
B and C). Peptide pool B generated from both
fusion proteins contained the Rg domain. Peptide pools A and C
contained peptides that consisted of V3 residues. Pool A, generated
only from V3wt-Rg, was of a higher molecular weight, while
pool C contained V3 peptides of lower molecular weight. Enzymatic
digestion was used to identify which peptide pools contained HS and CS:
V3wt-Rg pool A was the only pool that contained the two
GAGs.
The ratio of HS and CS was determined by analyzing
[3H]GlcN-labeled and unlabeled V3wt-Rg. The
HS and CS were released from pool A peptides by
We also wanted to determine whether both serines of the SGSG motif in
V3wt-Rg were being utilized for GAG modification. To carry
out this analysis, smaller V3 peptide fragments were required. Peptide
pool A was resistant to V8 and Asp-N proteases. Protease-sensitive V3wt-Rg peptide pool C was found to be modified with xylose
and galactose, which are constituents of the GAG precursor linkage oligosaccharide. Therefore, pool C peptides were cleaved with Asp-N
protease, and the resulting peptides were separated by reverse-phase HPLC (Fig. 4). A comparison of the two
chromatographs reveals that the elution profiles of the
V3wt-Rg peptides in peak 3 and 4 are much broader than the
peaks corresponding to V3mut-Rg peptides. This is
indicative of potential glycosylation. Amino acid sequencing and xylose
determination of all 12 peptides confirms that the two
V3wt-Rg peptides, from peaks 3 and 4, contained the
sequence SGSG and were modified with xylose (Table
I). In addition, as determined by
recovery percentages during amino acid sequencing, both serines in the
SGSG motif were occupied on 50% of the peptides. The other 50% of the
serines were not modified. Taken together these results demonstrate
that both HS and CS assembly occurs at the SGSG motif in CD44 exon
V3.
Identification of the Sequence Motif Responsible for HS Addition in
CD44 Exon V3--
We next investigated in more detail the sequence
surrounding the SG sites to identify signals for directing HS
versus CS assembly. Negatively charged and hydrophobic
residues located proximal to a SG site have been proposed to play a
role in GAG assembly at SG sites (14-16). In addition, repetitive SG
sites have been shown to enhance HS assembly (16). The first SG motif
in exon E5 has a stretch of acidic amino acids preceding it. In exon V3
there are acidic residues both upstream and downstream of the SGSG
motif. The acidic residues located downstream of the SGSG tetrapeptide are flanked by hydrophobic residues. To determine whether the hydrophobic and acidic residues following the SGSG site in exon V3 are
responsible for HS modification, the eight aa following the SGSG motif
in exon V3 were exchanged with the corresponding amino acids in exon E5
(E5V3/8aa-Rg, Fig. 5). This
exchange effectively switches the addition of HS from exon V3 to exon
E5 (Fig. 6). Thus, replacing SSSERSST
with IDDDEDFI after the first SG motif in E5 results in a protein
product that is modified with HS and CS (Fig. 6). On the other hand,
the V3 SGSG motif followed by the sequence SSSERSST rather than
IDDDEDFI (V3E5/8aa-Rg) is modified with CS but not HS (Fig.
6). These results suggest that the presence of acidic residues
flanked by hydrophobic residues downstream of the SG motif are
necessary for the addition of HS, while duplication of the SG motif is
not required for HS modification.
The Presence of CD44 Exon V3 Does Not Result in the Modification of
Distal SG Sites with HS--
Next we investigated if the regulatory
sequences in exon V3, which directs HS assembly at the SGSG site, could
drive the modification of a distal SG motif when the SGSG motif in V3
was mutated to AGAG. Four constructs were made that contained either
wild type or mutant V3 in combination with other CD44 exons containing
SG sites (Fig. 5). Wild type exon V3 or mutant exon V3 were included in
fusion proteins containing exon E5 (E5V3wt-Rg and
E5V3mut-Rg, respectively) or exons V4-V10
(V3wt-V10-Rg and V3mut-V10-Rg, respectively). These exon combinations were chosen since at least one of the SG sites
in E5 is modified with CS, while the single SG site in V10 is not
utilized. Both fusion proteins that contained wild type exon V3,
E5V3wt-Rg and V3wt-V10-Rg, were found to be
modified with both CS and HS (Fig. 7).
This contrasts with the fusion proteins containing the AGAG mutation in
exon V3, E5V3mut-Rg, which was only modified with CS. In
addition, V3mut-V10-Rg was not modified with GAGs (Fig. 7).
These findings suggest that the sequences in exon V3 which direct GAG
assembly at the proximal SGSG site do not influence GAG assembly at
distal SG sites.
125I-b-FGF Binds V3wt-Rg but Not
V3mut-Rg--
Previously we demonstrated that b-FGF can
bind HS-modified CD44 produced in COS cells (4). Here we show that
125I-b-FGF can bind HS-modified exon V3wt-Rg,
demonstrating that this exon, when independently expressed, is fully
functional. This was demonstrated by 125I-b-FGF to adding
increasing concentrations of immobilized V3wt-Rg and
V3mut-Rg on a microtiter plate (Fig.
8). The interaction was concentration-dependent and saturable.
125I-b-FGF did not bind to V3mut-Rg, confirming
the requirement of HS for the interaction. In addition, the interaction
between 125I-b-FGF and V3wt-Rg was inhibited by
20 µg/ml heparin (porcine intestinal mucosa) and by 20 µg/ml
purified V3wt-Rg-HS oligosaccharides (6-10-mers) generated
by heparitinase I digestion (data not shown).
GAG biosynthesis is known to occur on serines at SG sites, but not
all SG sites found in proteoglycans become modified. Additionally, some
SG sites are modified with CS only, while others are substrates for
both CS and HS synthesis. Previously, we showed that HS was added to
CD44 isoforms that include exon V3, but it was not clear at which
assembly site the synthesis occurred (4). CD44 contains seven SG motifs
encoded in five separate exons. Table II
presents the sequences that surround the SG motifs and summarizes the
results that determined which assembly sites were used. Inspection of the sequences reveals that they all contain acidic and hydrophobic residues, which are hallmarks for GAG acceptor sites (22). However, HS
and/or CS synthesis only occurred on E5-Rg and V3wt-Rg.
E5-Rg was modified with only CS, and V3wt-Rg was modified
with both CS and HS. Both V3wt-Rg and E5-Rg have a cluster
of at least three acidic residues, V10-Rg and E15-Rg contain a DQD
motif proximal to the SG, and E16-Rg only has a couple of acidic
residues at a distance. Inspection of other proteins that are modified
with GAGs reveals that some proteoglycans contain unclustered acidic residues not unlike V10-Rg and E15-Rg (16). Taken together, these data
strongly support the notion that a simple linear sequence is not
sufficient to initiate GAG synthesis but that the secondary and/or
tertiary structure around the SG motif is critical. Mann et
al. (10) used energy minimization calculation to predict the
structure of the seven amino acids at the GAG attachment site in
decorin and found that the SG was embedded in a The finding that only CD44 exon V3 supports HS assembly and that HS is
added to the SGSG site located in this exon led us to investigate
whether we could identify CD44 sequences which direct the modification
of a given SG site with a specific GAG. The results of experiments
described herein show that the eight amino acids located downstream of
the SG site are involved in directing the modification of the SGSG in
V3 with HS. Replacing these eight aa with the corresponding aa located
downstream from the first SG in CD44 exon E5, which is only modified
with CS, allows the SGSG site in V3 to be modified with CS only.
Conversely, we were able to show that if the eight aa located
downstream of the SGSG site in CD44 exon V3 are placed downstream of
the first SG site in E5, then E5 is modified with both HS and CS.
We also explored the possibility that sequences in CD44 exon V3 are
capable of driving the addition of GAGs to distal SG sites when the
normal site of GAG modification is not available. This was done by
analyzing the GAG content of two polypeptides that contained a mutant
V3 exon, in which the SGSG site was changed to AGAG, as well as
additional SG sites. The mutant V3 exon was included in polypeptides
containing SG sites, which were either not modified with GAGs or
modified with CS. In both cases we found that inclusion of the mutant
V3 exon does not alter the GAG modification of distal SG sites. This
suggest that the enzyme(s) involved in adding the xylose moiety to the
SG residue, the initial step in GAG modification, binds to sequences
proximal to the SG site that will be modified with GAGs.
HS-modified isoforms of CD44 are expressed by splicing of alternative
exon V3, thereby imparting the ability to interact with HS-binding
proteins. Previously we had shown that HS-modified CD44 can bind b-FGF
(4). In this paper we show that b-FGF binds CD44 HS-modified exon V3 in
a dose-dependent manner. This demonstrates that exon V3 is
functional when expressed independently, allowing for it to be used to
generate artificial proteoglycans (see accompanying paper (23)).
Different GAGs impart unique functions to glycoproteins, and it is of
interest to determine the different functions of CD44 isoforms. Exon E5
is expressed in all isoforms of CD44, and here we have shown that this
exon and alternatively spliced exon V3 are modified with CS.
CS-modified CD44 has been shown recently to be involved in
microvascular endothelial migration on fibrinogen (7). Previously it
had been demonstrated that wounded migrating aortic endothelial cells
convert from expressing predominately HS to CS-A and -B (8). In
contrast, when CD44 exon V3 is expressed, CD44 is able to concentrate
and present HS-binding growth factors and chemokines. In this way, CD44
may provide a critical step in a large range of biological functions.
Gaining an understanding of the sequence requirements for GAG assembly
led to the idea that GAG assembly sites may be introduced into other
proteins. These proteins would then acquire an additional function and could be used to deliver HS-binding proteins to locations of interest. The accompanying paper (23) addresses this concept of
creating artificial proteoglycans.
We thank Bill Bear for oligonucleotide
preparation, Joe Cook and Trent Youngman for DNA sequencing and Debby
Baxter and Robin Michaels for help in the preparation of this manuscript.
*
This work was supported in part by Public Health Service
Grant AR 21557 from the National Institutes of Health, Department of
Health and Human Services.The costs of publication of this article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed: BMS-PRI, P. O.
Box 4000, Princeton, NJ 08543. Tel.: 609-252-6719; Fax: 609-252-6058; E-mail: bennettk{at}bms.com.
The abbreviations used are:
HS, heparan sulfate; GAG(s), glycosaminoglycan(s); CS, chondroitin sulfate; PCR, polymerase chain reaction; PBS, phosphate-buffered saline; PAGE, polyacrylamide gel electrophoresis; HPLC, high performance liquid
chromatography; b-FGF, basic fibroblast growth factor; Rg, human IgG1
immunoglobulin region; aa, amino acid(s); wt, wild type; SG, serine/glycine.
Characterization of the Heparan Sulfate and Chondroitin Sulfate
Assembly Sites in CD44*
,
,
![]()
ABSTRACT
Top
Abstract
Introduction
References
![]()
INTRODUCTION
Top
Abstract
Introduction
References
to lymphocytes in vitro and induce VLA-/VCAM-1
interactions, a required step during lymphocyte homing (9). While the
demonstration that CD44 is the proteoglycan that provides this function
in vivo has been lacking, a recent report showed that wound
microvascular endothelial cells contain mRNA that encodes for
isoforms, which include exon V3 (7). To help clarify the functions that
are attributed to alternatively spliced CD44 isoforms, we have
identified which CD44 exons have functional GAG assembly sites.
![]()
MATERIALS AND METHODS
AGAG) was
made by changing serine 293 and serine 295 to alanines using CD44 V3
mut RP-BamHI oligonucleotide primer
GGGATCCAGGGTGCTGGAGATAAAATCTTCATCATCATCAATGCCTGCTCCAGCAAAACTGAGGTG and the CD44 V3-FP-Spe1 primer described above.
vector with CD5 signal
sequence and human Ig constant domains as described above. Introduction
of the mutations was confirmed by DNA sequencing.
-mercaptoethanol,
and analyzed on 8-16% Tris/glycine SDS-PAGE gradient gels (Novex, San
Diego, CA). Gels were fixed and soaked in Amplify solution (Amersham
Pharmacia Biotech). Dried gels were then analyzed by PhosphorImager
(Molecular Dynamics, Sunnyvale, CA) for the presence or absence of
modifying sulfate label on fusion proteins.
-counter.
![]()
RESULTS

View larger version (15K):
[in a new window]
Fig. 1.
CD44 and CD44 immunoglobulin fusion
proteins. Line drawings representing all the CD44 extracellular
domain exons and CD44-Rg constructs used in these studies. Boxes
representing the variably spliced exons and standard exons are labeled
V or E, respectively. The potential GAG acceptor
sites are marked with double vertical lines with an oval on
top. The boxes representing the immunoglobulin constant
region domains in the fusion proteins are labeled Rg.

View larger version (38K):
[in a new window]
Fig. 2.
GAG modification of CD44 exons expressed as
independent Rg fusion proteins.
[35S]NaHSO4-labeled V3-Rg (A),
E5-Rg (B), and V10-Rg (C) were recovered from the
supernatant of COS cell transfectants, purified, and divided equally
into four aliquots. One aliquot was left untreated, and the others were
digested for 1 h with heparitinase, chondroitin ABC lyase, or both
enzymes. The proteins were then resolved by SDS-PAGE and analyzed by
radiography.

View larger version (17K):
[in a new window]
Fig. 3.
Gel permeation chromatography of
V3wt-Rg and V3mut-Rg cyanogen bromide
peptides. CNBr peptides of V3wt-Rg and
V3mut-Rg were purified by gel permeation chromatography on
a Bio-Sil TSK-250 column. Shown are the elution patterns of 1.5 nmol of
S-pyridylethylated peptide from V3mut-Rg
(A) and V3wt-Rg (B). The elution
volumes of ovalbumin (Mr = 43,000), carbonic
anhydrase (Mr = 32,000), lactoalbumin
(Mr = 14,800), cytochrome c
(Mr = 12,300), and insulin
(Mr = 6000) are indicated.
elimination.
Samples of released HS and CS were run over a Sephadex G-50 column
before and after digestion with either heparitinase I and heparinase or
with chondroitin ABC lyase. The percent decrease in peak area was
calculated for the unlabeled material, and the counts/min for each
fraction was determined for the radiolabeled carbohydrates. The molar
ratio of HS to CS was determined by both methods to be 3 to 2.

View larger version (17K):
[in a new window]
Fig. 4.
Reverse-phase high performance liquid
chromatography of V3wt-Rg and V3mut-Rg peak C
CNBr peptide after further digestion with Asp-N protease. The
peptides were separated on a 2.1 × 100-mm RP-300 column. The
elution pattern is shown for 150 pmol of the peptides from
V3mut-Rg (A) and 150 pmol of the peptides from
V3wt-Rg (B). Elution of the peptides was
achieved with a 60-min gradient of 0.1% trifluoroacetic acid in water
to 45% acetonitrile containing 0.1% trifluoroacetic acid at a flow
rate of 100 µl/min at 40 °C.
Amino acid sequence of pool C peptides and xylose detection

View larger version (34K):
[in a new window]
Fig. 5.
CD44 immunoglobulin fusion proteins.
Line drawings of the extracellular region of CD44. Boxes
representing the variably spliced exons and standard exons are labeled
V or E, respectively. The boxes
representing the immunoglobulin constant region domains in the fusion
proteins are labeled Rg. Amino acid sequences, which were
changed in the mutant proteins, are shown underneath each construct in
boldface.

View larger version (25K):
[in a new window]
Fig. 6.
The eight amino acids downstream of the SG
site in CD44 exon V3 and E5 dictate the specificity of GAG
modification. [35S]NaHSO4-labeled
V3E5/8aa-Rg and E5V3/8aa-Rg proteins were
recovered from the supernatant of COS cell transfectants, purified, and
divided equally into four aliquots. One aliquot was left untreated, and
the others were digested for 1 h with either heparitinase,
chondroitin ABC lyase, or with both enzymes. The proteins were then
resolved by SDS-PAGE and analyzed by radiography.

View larger version (50K):
[in a new window]
Fig. 7.
Residues in CD44 exon V3 do not direct the
modification of distal sites with HS.
[35S]NaHSO4-labeled E5V3wt-Rg,
E5V3mut-Rg, V3wt-V10-Rg, and
V3mut-V10-Rg proteins were recovered from the supernatant
of COS cell transfectants, purified, and divided equally into four
aliquots. One aliquot was left untreated, and the others were digested
for 1 h with heparitinase, chondroitin ABC lyase, or with both
enzymes. The proteins were then resolved by SDS-PAGE and analyzed by
radiography.

View larger version (12K):
[in a new window]
Fig. 8.
Binding of 125I-b-FGF to
V3wt-Rg and V3mut-Rg.
125I-b-FGF bound to increasing concentrations of
V3wt-Rg (open circles) but not to
V3mut-Rg (closed circles).
![]()
DISCUSSION
-turn. Currently, the protein structure of the GAG assembly sites in CD44 is not known.
The surrounding sequence of the potential assembly site in the CD44
exons
![]()
ACKNOWLEDGEMENTS
![]()
FOOTNOTES
These authors contributed equally to this work.
![]()
REFERENCES
Top
Abstract
Introduction
References
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
D. Kothapalli, L. Zhao, E. A. Hawthorne, Y. Cheng, E. Lee, E. Pure, and R. K. Assoian Hyaluronan and CD44 antagonize mitogen-dependent cyclin D1 expression in mesenchymal cells J. Cell Biol., February 12, 2007; 176(4): 535 - 544. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gotte and G. W. Yip Heparanase, Hyaluronan, and CD44 in Cancers: A Breast Carcinoma Perspective Cancer Res., November 1, 2006; 66(21): 10233 - 10237. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Pratt, C. D. Conway, N. M. M.-L. Tian, D. J. Price, and J. O. Mason Heparan sulphation patterns generated by specific heparan sulfotransferase enzymes direct distinct aspects of retinal axon guidance at the optic chiasm. J. Neurosci., June 28, 2006; 26(26): 6911 - 6923. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. D. Bassett, R. Swinhoe, O. Chassande, J. Samarut, and G. R. Williams Thyroid Hormone Regulates Heparan Sulfate Proteoglycan Expression in the Growth Plate Endocrinology, January 1, 2006; 147(1): 295 - 305. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Barbour, J. A. Reeder, M. D. Walsh, J. Fawcett, T. M. Antalis, and D. C. Gotley Expression of the CD44v2-10 Isoform Confers a Metastatic Phenotype: Importance of the Heparan Sulfate Attachment Site CD44v3 Cancer Res., February 15, 2003; 63(4): 887 - 892. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Cichy, R. Bals, J. Potempa, A. Mani, and E. Pure Proteinase-mediated Release of Epithelial Cell-associated CD44. EXTRACELLULAR CD44 COMPLEXES WITH COMPONENTS OF CELLULAR MATRICES J. Biol. Chem., November 8, 2002; 277(46): 44440 - 44447. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Delcommenne, R. Kannagi, and P. Johnson TNF-{alpha} increases the carbohydrate sulfation of CD44: induction of 6-sulfo N-acetyl lactosamine on N- and O-linked glycans Glycobiology, October 1, 2002; 12(10): 613 - 622. [Abstract] [Full Text] [PDF] |
||||
![]() |
K Prydz and K. Dalen Synthesis and sorting of proteoglycans J. Cell Sci., January 1, 2000; 113(2): 193 - 205. [Abstract] [PDF] |
||||
![]() |
E. A. Wolff, B. Greenfield, D. D. Taub, W. J. Murphy, K. L. Bennett, and A. Aruffo Generation of Artificial Proteoglycans Containing Glycosaminoglycan-modified CD44. DEMONSTRATION OF THE INTERACTION BETWEEN RANTES AND CHONDROITIN SULFATE J. Biol. Chem., January 22, 1999; 274(4): 2518 - 2524. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |